
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00773-9
10.1016/j.psj.2024.104194
104194
PHYSIOLOGY AND REPRODUCTION
Vitamin E alleviates glyphosate-based herbicide-induced progesterone secretion inhibition and oxidative stress increase in chicken primary granulosa cells
Mathias Fréville
Ophélie Bernardi
Christelle Ramé
Pascal Froment
Joëlle Dupont joelle.dupont@inrae.fr
1
CNRS, IFCE, INRAE Animal Physiology Department, Université de Tours, PRC, F-37380, Nouzilly, France
1 Corresponding author: joelle.dupont@inrae.fr
14 8 2024
11 2024
14 8 2024
103 11 1041944 5 2024
5 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Glyphosate-based herbicides (GBH) are the most extensively used herbicides worldwide. Despite a presumed nondangerousness for animals, several studies reported negative effects after a GBH exposure in several animal models including birds, notably on reproductive functions. Several studies concerning the advantages of Vitamin E (VE) for antioxidant activity but also growth and reproduction have been reported in birds. However, it remains unclear whether VE could alleviate the negative effect of GBHs on chicken ovarian cells. Here we exposed chicken primary granulosa cells (GCs) from F1 and F3/4 follicles to growing doses of GBH (0.036, 0.36, 3.6, and 36 gly eq/L), with or without VE supplementation (1 mg/L) and investigated cell viability, proliferation, oxidative stress and steroidogenesis. GBH exposure did not affect F1 and F3 GCs viability but it increased cell proliferation only in F1 GCs and this effect was not altered by VE. In both F1 and F3/4 GCs, GBH exposure increased total oxidant status (TOS), reduced total antioxidant status (TAS) and consequently increased index of oxidative stress (OSI) in dose dependent manner. This latter effect for GBH 36 mg eq gly/L was totally abolished in response to VE. In both F1 and F3/4 GCs, GBH exposure reduced progesterone secretion in a dose dependent manner and this effect with GBH 0.36 and 1.8 mg eq glyphosate/L was alleviated by VE. However, we did not observe any effect of GBH and VE on the gene expression of several components of the steroidogenesis process. Taken together, these results show that GBH may have endocrine disruptor effects, and that these effects might be alleviated by antioxidant VE supplementation.

Key words

glyphosate-based Herbicide
endocrine disruptor
poultry
steroidogenesis
progesterone
Abbreviations

ABTS 2,2′-Azino-di-[3-ethylbenzthiazoline sulphonate]

ACTB Actin B

AMPA Aminomethyl phosphonic acid

ANOVA ANalyse Of VAriance

BRDU Bromodesoxyuridin

bw body weight

CAT Catalase

CCK8 Cell Counting Kit-8

cDNA Complementary DNA

Cq Quantification cycle

CT Control

CV Coefficient of variation

CYP11A1 Cytochrome P450 family 11 subfamily A member 1

CYP19A1 Cytochrome P450 family 19 subfamily A member 1

DMEM Dulbecco's Modified Eagle Medium

DNA Desoxyribonucleic acid

dNTP deoxyribonucleotide triphosphate

E Efficiency

E2 Estradiol

ED Endocrine disruptors

EEF1α Eukaryotic elongation factor 1 alpha

EFSA European Food Safety Authority

ELISA Enzyme-linked immunosorbent assay

ER Estrogen receptor

ERK Extracellular signal-regulated kinases

F1 F1 follicles

F3/4 F3 and F4 follicles

FBS Fetal bovine serum

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

GBH Glyphosate-based herbicides

GC Granulosa cells

Gly Glyphosate

gly eq Glyphosate equivalent

GST Glutathione S-transferase

HSD3beta 3β-Hydroxysteroid dehydrogenase

IARC International Agency for Research on Cancer

IGF-1 Insulin-like Growth Factor-1

INRAE Institut national de recherche pour l'agriculture, l'alimentation et l'environnement

LH Luteinizing hormone

MMLV Moloney murine leukemia virus reverse transcriptase

NOAEL No Observed Adverse Effect Level

OSI Oxidative Stress Index

P450scc Cytochrome P450 side-chain cleavage

PI3K Phosphoinositide 3-kinase

qPCR Quantitative Polymerisation Chain Reaction

RNA Ribonucleic acid

ROS Reactive Oxygen Species

RT Retrotranscriptase

SEM Standard error of the mean

SOD Superoxyde dismutase

StAR Steroidogenic Acute Regulatory

t.test Student's t-test

TAS Total Antioxidant Status

TOS Total Oxidant Status

VE Vitamin E

VEGFR2 Vascular endothelial growth factor receptor 2
==== Body
pmcINTRODUCTION

Glyphosate-based herbicides (GBH) are powerful herbicides extensively used in agriculture. Their great effectiveness and their supposed innocuity lead them to be the most spread herbicides in the world (Gill et al., 2018). Their active molecule is called glyphosate (Gly) or N-(phosphonomethyl) glycine. It acts by inhibiting EPSPS (5-enolpyruvylshikimate-3-phosphate synthase), a key enzyme of the shikimate pathway of the biosynthesis of aromatic amino acids (Schönbrunn et al., 2001), which eventually results in a default in amino acids supply and other dysregulations in the plant, leading it to die (Bradberry et al., 2004). Its main metabolite, called aminomethyl phosphonic acid (AMPA) is obtained in soils after a bacterial biodegradation of Gly (Bai and Ogbourne, 2016). GBHs use in Europe is controversial. Indeed, despite the existence of numerous studies detecting adverse effects on human and animals’ health, GBHs are still authorized for agriculture use and they will be until 2033. For instance, the International Agency for Research on Cancer (IARC) classified Gly as “potentially carcinogenic in human” in its 2015 monography (Guyton et al., 2015). In contrast, the European Food Safety Authority (EFSA) does not classify Gly as a carcinogenic agent. The European authority also highlights differences in the selection of studies and the interpretation of statistical analyses (European Food Safety Authority [EFSA], 2015). However, Gly alone is not able to exert its full herbicide power, and needs other co-formulants (called surfactants) which act as wetting agents and allow Gly to better penetrate plant systems (Bradberry et al., 2004). The combination of Gly and of these co-formulants is called a GBH, and GBHs are the products which are actually spread on crops. It therefore seems more relevant to consider whole GBH formulations when assessing Gly's toxicity on animals, as Gly alone is less likely to reach them than GBH formation.

Glyphosate, and by extension GBHs are also very suspected to act as endocrine disruptors (ED) in several models, which also fuels the controversy surrounding their use. According to the World Health Organization, “an endocrine disruptor” is an exogenous substance or mixture that alters function(s) of the endocrine system and consequently causes adverse health effects in an intact organism, or its progeny, or (sub)populations”. Exposure to ED occurs via ingestion, inhalation and dermal absorption (Ingaramo et al., 2020). In a review published in 2021, Muñoz et al., 2021 draw up a state of the art of the studies investigating the possible ED nature of Gly. A previous study shows that a GBH administration can disturb steroidogenesis step limiting StAR protein in MA-10 cells (Walsh et al., 2000). Furthermore, it can be associated to an increase in the oxidative stress in vitro in different cell types including bovine embryo (Dovolou et al., 2024) and in vivo in various tissues and species such as chicken testis (Ren et al., 2018) and mice liver mice (Qi et al., 2023). Glyphosate has been reported to cause mitochondrial dysfunctions in different models such as C. Elegans (Bailey et al., 2018), pig oocyte (Xing et al., 2022), and danio brain (Pereira et al., 2018). Studies have already investigated the impact of GBHs or Gly on mammalian granulosa cells (GC) (Perego et al., 2017; Gigante et al., 2018; Bhardwaj et al., 2019) but no data are yet available in avian species. In caprine GCs, Vitamin E (VE) is able to alleviate the negative effects of GBHs (Bhardwaj et al., 2019, 2022). Vitamin E is a lipid-soluble vitamin that acts as a natural antioxidant (Gibaldi, 1996). It has several critical functions in animals, including protecting cells alongside the harmful properties of irritable oxygen species and promoting humoral and cellular immune responses. In chicken, VE supplementation in broiler diets improves production parameters (body weight and feed efficiency) without negatively affecting the health.

In a previous study, we chronically dietary exposed 32 wk-old hens to a dose of GBH of 47 mg/kg bw/d, which is close to half the No Observed Adverse Level (NOAEL) determined by EFSA in birds. The maximal blood plasma Gly concentration monitored was 1.5 mg/L (Fréville et al., 2022). Here, we assessed the impact of the GBHs from 0.036 to 36 mg of Gly equivalent/L on GCs viability, proliferation, oxidative stress and steroidogenesis after 24 h of exposure. Considering that the induction of an oxidative stress is probably the most described effect of GBH (Wang et al., 2022), we added 1 mg/L of VE in the culture medium to determine a possible alleviation of the GBH impacts in chicken GC. Thus, the aim of the present study was to assess the impact of growing doses of a GBH on chicken primary GCs functions and the potential effect of VE (1 mg/L) on the GBHs effects.

MATERIAL AND METHODS

Animals and Ethical Issues

Fifty female broilers 26 wk-old of the commercial ROSS 308 breed (Hendrix Genetics, Saint Laurent de la Plaine, France) were reared at “Pôle Expérimental Avicole de Tours” (INRAE, Nouzilly, France) according to the standard breeding conditions. Animals were divided in groups of 5 in 10 pens, each pen with an area of 3 m2 and with thermostatically controlled air inlets and a dynamic cross-ventilation system. The animals were exposed to 15 h of light per day at 23 wk to induce the laying and they were maintained under this light regime until the end of the experiment. All animals received a restricted diet according to Hendrix Genetics recommendation. The composition of the diet (%) was (corn: 54.19; wheat: 8; Soybean meal: 13.95; Soy oil: 2; Sunflower oil: 5.8; Sodium Bicarbonate: 0.1; Calcium carbonate: 6.6; Phosphate: 2.2; Salt: 0.28; Methionine DL: 0.05; Mineral premix: 0.5; and Soybean: 6.33). Ovarian follicles have been collected during meat processing as local abattoir by-products by highly qualified and experienced laboratory staff. Thus, according to the ethical issues for the protection of animals, this project does not require the consent of the competent ethics committee for animal experiments.

Isolation of Chicken GC

After electronarcosis, the ovaries were immediately removed and placed in ice-cold sterile 1% NaCl saline solution for immediate use. GCs from the first (F1 = the largest follicle size), third and fourth (F3 and F4) largest hierarchical follicles were dissected as previously described (Tosca et al., 2006; Chabrolle et al., 2007). GCs from F3 and F4 follicle were pooled into 1 single group, hereinafter called F3/4 group. They were prepared for culture by being dispersed in 0.3% collagenase type A (Roche Diagnostic, Meylan, France) in F12 medium containing 5% fetal bovine serum (FBS). Cells were recovered by centrifugation (10 min, 800 g at room temperature) washed with fresh medium, and counted in a haemocytometer. The viability of F1–F3/4 GCs was estimated by trypan blue exclusion at about 95%. The culture medium was DMEM supplemented with 100 U/ml penicillin, 100 mg/l streptomycin, 3 mmol/l l-glutamine and 5% FBS. Cells were initially cultured for 24 h with no treatment, then incubated in fresh culture medium with or without test reagents for the appropriate time. All of the cultures were maintained in a water-saturated atmosphere of 95% air:5% CO2 at 37 °C.

Chemicals

Gallup Super 360, hereinafter called GBH was obtained from Axereal (Monnaie, France). It contains 360 g/L of glyphosate (485.8 g/L of isopropylamine salt). Human recombinant IGF-1 was obtained from Sigma Aldrich (Saint Quentin Fallavier, France). Purified ovine luteinizing hormone (LH) (lot 26) was obtained from Dr AF Parlow and the National Hormone and Pituitary Programme (Bethesda, MD). Vitamin E (VE, α-tocopherol acetate) was provided by Sigma-Aldrich (Saint Quentin-Fallavier, France).

Cell Viability

GCs were treated in 96 wells plates with several dilutions of GBH; 0.036, 0.36, 3.6, and 36 mg gly eq/L and CT (0 mg gly eq/L) for 24 h, with or without addition of VE (1 mg/L). Cell viability was determined using a Cell Counting Kit-8 (CCK8) assay commercial kit (Sigma–Aldrich, Saint Quentin Fallavier, France). The assay was performed according to the manufacturer recommendations. Absorbances were measured at a 450 nm wavelength using a spectrophotometer. Four biological replicates were created for each concentration (n = 4) and the assay was performed 4 times to obtain 4 statistical replicates (N = 4).

Cell Proliferation

GCs were treated in 96 wells plates with several dilutions of GBH; 0.036, 0.36, 3.6 and 36 mg gly eq/L and CT (0 mg gly eq/L) for 24 h, with or without addition of VE (1 mg/L). Cell proliferation was determined using a BRDU ELISA assay (Sigma-Aldrich, Saint Quentin Fallavier). Absorbances were measured at a 405 and 492 nm wavelength using a spectrophotometer. The assay was performed according to the manufacturer recommendations. Four biological replicates were created for each concentration (n = 4) and the assay was performed 4 times to obtain 4 statistical replicates (N = 4).

TAS, TOS and OSI Determination

TAS (total antioxidant status) was determined using a commercial kit supplied by Randox (Crumlin, UK) according to the manufacturer's instructions. In this method, metmyoglobin is converted into ferrylmyoglobin in the presence of iron ions. The result of the reaction between ferrylmyoglobin with the Randox ABTS reagent was a green product, the absorbance of which was measured at 600 nm. The TOS (total oxidant status) was determined using the commercial kit Per-OX TOS/TOC (Immune Diagnostics, Bensheim, Germany). The reaction of peroxidase with lipid hydroperoxides led to the production of reduced phospholipid products of green color, which changes to yellow upon addition of the stop reagent. Absorbance was measured at 450 nm. The index of oxidative stress (OSI) was calculated based on the formula = TOS/TAS × 100.

Progesterone Assay

Progesterone concentration in hen GCs was determined in serum-free media after culturing for 24 h in the presence or absence of different doses of GBH; CT (0 mg gly eq/L), 0.036, 0.36, 3.6 and 36 mg gly eq/L with or without vitamin E (1 mg/L), and/or LH (10−8M), and/or IGF (10−8M) for 24 h. Initially, granulosa were grown in 48-well dishes (1.25 × 105 viable cells/250 μl medium per well) in DMEM and 5% FBS for 24 h. After overnight serum starvation, GCs were incubated with the appropriate treatment for 24 h. The concentration of progesterone derived from hen GCs, in the culture media was measured using an ELISA protocol as previously described (Canépa et al., 2008). The intra-assay coefficient of variation (CV) averaged <10%. The results are expressed as the amount (mean ± s.e.m.) of steroid (ng/ml)/ 100μg of total protein secreted per 24h. There were 4 replicates for each treatment within each culture, and we performed 4 cultures. In each culture, we used 4 hens, and consequently we used a pool of GCs from 4 follicles of the same category (GC from 1 follicle per hen).

Measurement of Steroidogenesis Transcripts Expressions in GC

GC were treated in 6 wells plates with several dilutions of GBH; 0.036, and 36 mg gly eq/L and CT (0 mg gly eq/L) (n = 6) for 24 h, with and without vitamin E supplementation (1mg/L). Total RNA was extracted from each well using TRIzol RNA Isolation Reagents and an Ultra-Turrax instrument for grinding, according to the manufacturer's recommendations (Invitrogen by Life Technologies, Villebon-sur-Yvette, France). The purity and concentrations of the obtained RNA were checked via their A260/A280 ratios using a Nanodrop machine. cDNA was obtained by reverse transcription of 2 µg of the total RNA in 20 µL of a mix containing each deoxyribonucleotide triphosphate (dATP, dTTP, dGTP, dCTP; 0.5 mM), 2 M RT Buffer, 15 μg/μL oligodT, 0.125 U of ribonuclease inhibitor and 0.05 U of Moloney murine leukemia virus reverse transcriptase (MMLV); the mixture was kept for 1 h at 37°C. Quantitative PCR was performed using a mix of 3 µL of cDNA and 8 µL of SYBR Green Supermix 1X Reagent (Bio-Rad, Marnes-la-Coquette, France) with 250 nM of specific primers (Invitrogen by Life Technologies, Villebon-sur-Yvette, France) given in Table 1. Samples were set up in duplicate in a 384-well plate and a MyiQ Cycle Device (Bio-Rad, Marnes-la-Coquette, France) was used to apply the following procedure: incubation (2 min at 50°C), denaturation (10 min at 95°C) and 40 PCR cycles (30 s at 95°C, 30 s at 60°C, 30 s at 72°C). Relative expression of genes was related to the geometric mean of the expression of 3 reference genes (GAPDH [glyceraldehyde-3-phosphate dehydrogenase], actin B [ACTB] and EEF1α [eukaryotic elongation factor 1 alpha]). Primer efficiency was calculated using a 5 points serial dilution for each gene, applying the formula E = 10−1/slope value. Primer efficiencies were ranged between 1.85 and 2.00. For each target gene, expression was calculated according to primer efficiency (E) and quantification cycle (Cq), where expression = E−Cq. Then, relative expression of the target gene to the 3 reference genes was analyzed according to the △Cq method.Table 1 Primer sequences used for qPCR analysis.

Table 1Gene	Primer F	Primer R	Reference	
GAPDH	ACGGATTTGGTCGTATTGGG	TGATTTTGGAGGATCTCGC	Grandhaye et al. (2020)	
EEF1α	AGCAGACTTTGTGACCTTGCC	TCACATGAGACAGACGGTTGC	
β-actin	ACGGAACCACAGTTTATCATC	GTCCCAGTCTTCAACTATACC	
StAR	TGCCATCTCCTACCAACA	CATCTCCATCTCGCTGAAG	Estienne et al. (2020)	
HSD3β	TACTGCTGGAAGAAGATGAG	CAAGGTGTCAATGATGGAAG	
cyp11a1	TGAATATCATCAGCCCCCGC	GTAGGGCTTGTTGCGGTAGT	

Statistical Analysis

GraphPad Prism (version 10) was used for each statistical test and graph generation. Data are presented as mean ± SEM. One-way ANOVA followed by Dunn pair-wise comparison tests was performed to detect statistical differences between control and different concentrations of GBH in the absence or in the presence of LH and/or IGF-1 and without addition of VE. In the presence of VE, a student t test was used for the control and different concentrations of GBH except for Figure 6 where a 1-way ANOVA followed by Dunn pair-wise comparison tests was used to detect if the LH and/or IGF-1 effect on progesterone secretion was altered. Significant differences compared to control condition identified by 1-way ANOVA (Figure 6) are indicated by lowercase letters, and significant differences identified by student T test are indicated by stars. *P < 0.05, **P < 0.01, ***, P < 0.001, ****P < 0.0001.

RESULTS

Effect of GBH Exposure With or Without VE Supplementation in Chicken F1 and F3/4 GC Viability

As shown in Figure 1, GBH exposure for 24 h did not affect cell viability whatever the concentration used (0.036 to 36 mg Gly eq/L) in both F1 (A) and F3/4 (B) GC. Similar data were obtained after the addition of VE (1 mg/L) whatever the GBH concentration (0.36 and 1.8 mg eq/L) exposure for 24 h in both F1 (C) and F3/4 (D) GCs. (Figures 1C and 1D).Figure 1 Viability of primary granulosa cells (GCs) from F1 (A) and F3/4 (B) follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N (number of experiment) = 4, n (number of replicates per experiment) = 4). Viability of primary GCs from F1 (C) and F3/4 (D) follicles, after a 24-h exposure to GBH 0 (control, CT), 0.36 and 1.8 mg of gly eq/L with or without addition of vitamin E (VE, 1 mg/L) (N = 4, n = 4). Significant differences as compared to the control (CT, A and B) identified by 1-way ANOVA or to without VE condition for each GBH concentration identified by student T test (C and D) are indicated by stars. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Figure 1

Effect of GBH Exposure With or Without VE Supplementation in Chicken F1 and F3/4 GC Proliferation

As shown in Figure 2A, GBH exposure (24 h) increased cell proliferation from concentration of 0.036 until 36 mg of Gly eq /L in F1 GCs whereas it did not affect F3/4 granulosa cell proliferation as compared to the control (Figure 2B). The addition of VE increased F1 granulosa cell proliferation in control condition whereas it did significantly modify the effect of GBH at 0.36 or 1.8 mg Gly eq/L (Figure 2C). In F3/4 GC, VE supplementation did not alter cell proliferation in control condition and after 1.8 mg Gly eq/L of GBH exposure whereas it decreased number of proliferative cells in response to 0.36 mg Gly eq/L of GBH (Figure 2D).Figure 2 Proliferation of primary granulosa cells (GCs) from F1 (A) and F3/4 (B) follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N (number of experiment) = 4, n (number of replicates per experiment) = 4). Proliferation of primary GCs from F1 (C) and F3/4 (D) follicles, after a 24-h exposure to GBH 0 (control, CT), 0.36 and 1.8 mg of gly eq/L with or without addition of vitamin E (VE, 1 mg/L) (N = 4, n = 4). Significant differences as compared to the control (CT, A and B) identified by 1-way ANOVA or to without VE condition for each GBH concentration identified by student T test (C and D) are indicated by stars. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Figure 2

Effect of GBH Exposure With or Without VE Supplementation in Chicken F1 and F3/4 on TOS, TAS and OSI

In both F1 (Figures 3A–C) and F3/4 (Figures 4A–C) GCs, GBH exposure increased the TOS, decreased the TAS and increased the OSI from 3.6 mg of Gly eq/mL in a dose dependent manner. Furthermore, the addition of vitamin E decreased TOS, increased TAS and decreased OSI in absence and in response to exposure to GBH at concentrations of 1.8 and 36 mg Gly eq/L in both F1 (Figures 3D–F) and F3/4 GCs (Figures 4D–F). Interestingly, VE reduced by 4 -fold OSI in response to GBH at 36 mg Gly eq/L whereas it decreased it by only by twice in the absence or in the presence of GBH 1.8 mg Gly eq/L in both F1 and F3/4 GCs.Figure 3 (A) Total oxidant status (TOS) in primary granulosa cells (GCs) from F1 follicles after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L(N (number of experiment) = 4, n (number of replicates per experiment) = 4). (B) Total antioxidant (TAS) status in primary GCs from F1 follicles after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N = 4, n = 4). (C) Oxidative stress index (TOS/TAS) in primary GCs from F1 follicles after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N = 4, n = 4). (D) TOS, (E) TAS and Oxidative stress index (TOS/TAS) in primary GCs from F1 follicles after a 24-h exposure to doses of GBH of 0 mg of gly eq/L (control, CT), 0.36 and 1.8 mg of gly eq/L with or without addition of vitamin E (VE, 1 mg/L) (N = 4, n = 4). Significant differences as compared to the control (CT, A, B and C) identified by 1-way ANOVA or to without VE condition for each GBH concentration identified by student T test (D, E and F) are indicated by stars. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Figure 3

Figure 4 (A) Total oxidant status (TOS) in primary granulosa cells (GCs) from F3/4 follicles after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L(N (number of experiment) = 4, n (number of replicat per experiment) = 4). (B) Total antioxidant (TAS) status in primary GCs from F3/4 follicles after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N = 4, n = 4). (C) Oxidative stress index (TOS/TAS) in primary GCs from F3/4 follicles after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N = 4, n = 4). (D) TOS, (E) TAS and Oxidative stress index (TOS/TAS) in primary GCs from F3/4 follicles after a 24-h exposure to doses of GBH of 0 mg of gly eq/L (control, CT), 0.36 and 1.8 mg of gly eq/L with or without addition of vitamin E (VE, 1 mg/L) (N = 4, n = 4). Significant differences as compared to the control (CT, A, B and C) identified by 1-way ANOVA or to without VE condition for each GBH concentration identified by student T test (D–F) are indicated by stars. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Figure 4

Effect of GBH Exposure With or Without VE Supplementation in Chicken F1 and F3/4 on Progesterone Secretion and Expression of StAR, HSD3beta and CYP11A1

In both F1 (Figure 5A) and F3/4 (Figure 6A) GCs, GBH exposure reduced in a dose dependent manner progesterone (Pg) secretion from 0.36 until 36 mg Gly eq/L of GBH. The VE supplementation increased progesterone secretion in the same way in the absence or the presence of GBH (0.36 and 1.8 mg Gly eq/L) in both F1 (Figure 5B) and F3/4 (Figure 6B) GCs. As shown in Figures 5C and 6C, GBH exposure (0.36 and 1.8 mg Gly eq/L) decreased not only in basal condition but also in response to LH or/and IGF-1 and this inhibitory effect was totally or strongly reduced after the addition of VE (Figures 5D and 6D) in both F1 and F3/4 GCs.Figure 5 (A) Progesterone (Pg) secretion in culture medium by primary granulosa cells (GC) from F1 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N (number of experiment) = 4, n (number of replicates per experiment)). (B) Pg secretion in culture medium by primary GCs from F1 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT),), 0.36 and 1.8 mg of gly eq/L with or without addition of vitamin E (VE, 1 mg/L) (N = 4, n = 4). (C) Pg secretion by primary GCs from F1 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT), 0.36 and 1.8 mg of gly eq/L in response to IGF-1 (10−8M) and LH (10−8M), (N = 4, n = 4). (D) Pg secretion by primary GCs from F1 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT),), 0.36 and 1.8 mg of gly eq/L in response to IGF-1 (10−8M) and LH (10−8M) with or without addition of vitamin E (VE, 1 mg/L), (N = 4, n = 4). Significant differences as compared to the control (CT, A) identified by 1-way ANOVA or to without VE condition for each GBH concentration identified by student T test (B) are indicated by stars. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Significant differences as compared to without GBH, LH or/and IGF-1 and VE condition (B, C and D) identified by 1-way ANOVA are indicated by different lowercase letter at P < 0.05.

Figure 5

Figure 6 (A) Progesterone (Pg) secretion in culture medium by primary granulosa cells (GCs) from F3/4 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT) to 36 mg of gly eq/L (N (number of experiment) = 4, n (number of replicates per experiment)). (B) Pg secretion in culture medium by primary GCs from F3/4 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT), 0.36 and 1.8 mg of gly eq/L with or without addition of vitamin E (VE, 1 mg/L) (N = 4, n = 4). (C) Pg secretion by primary GCs from F3/4 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT), 0.36 and 1.8 mg of gly eq/L in response to IGF-1 (10−8M) and LH (10−8M), (N = 4, n = 4). (D) Pg secretion by primary GCs from F3/4 follicles, after a 24-h exposure to growing doses of GBH ranging from 0 mg of gly eq/L (control, CT), 0.36 and 1.8 mg of gly eq/L in response to IGF-1 (10−8M) and LH (10−8M) with or without addition of vitamin E (VE, 1 mg/L), (N = 4, n = 4). Significant differences as compared to the control (CT, A) identified by 1-way ANOVA or to without VE condition for each GBH concentration identified by student T test (B) are indicated by stars. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Significant differences as compared to without GBH, LH or/and IGF-1 and VE condition (B–D) identified by 1-way ANOVA are indicated by different lowercase letter at P < 0.05.

Figure 6

We next determined whether the effects of GBH and VE on progesterone secretion by F1 and F3/4 granulosa could be due to variations in mRNA expression of steroidogenesis factor (StAR, the cholesterol carrier) or enzymes (HSD3β and CYP11A1). However, as shown in Figure 7, neither GBH nor VE did significantly affect the expression of the steroidogenesis components in F1 (Figure 7A) and F3/4 (Figure 7B) GC.Figure 7 StAR, HSD3β and cyp11a1 mRNA expression in primary granulosa cells from F1 (A) and F3/4 (B) follicles, after a 24-h exposure to GBH (36 mg gly eq/L) or not (Control, CT) with or without addition of vitamin E (1 mg/L); (N (number of experiment) = 4, n (number of replicates per experiment).

Figure 7

DISCUSSION

Chicken is easily exposed to GBH through their diet and we previously observed that Gly accumulates in yolk (Estienne et al., 2022). GCs are a main component of the chicken follicle that are close to the yolk-filled oocyte suggesting that Gly exposure in yolk could affect the follicular development. GBH can induce the production of ROS and decrease SOD, CAT, and GST activities, as demonstrated on caprine GC in a previous study (Bhardwaj et al., 2022; Wang et al., 2022). On the other hand, VE's ability to scavenge peroxyl radical, most likely by the donation an hydrogen atom, has been described in previous studies (Traber and Atkinson, 2007). Therefore, VE could reduce TOS and increase TAS by neutralizing oxidant molecules. Thus, GBH could modulate the expression of several hormones, including progesterone according to the animal model, the age, the sex and the physiological status (Serra et al., 2021b). However, few works exploring the ability of GBHs to disturb reproductive functions have been performed in avian species. Serra et al. (2021a) showed that a GBH enriched diet (46.8 mg gly eq/kg bw/d) increases plasma testosterone and estradiol levels in roosters, while an exposure to 160 mg gly eq /kg bw/d of GBH decreased plasma testosterone levels in Japanese quail (Ruuskanen et al., 2020). The mechanisms and signaling pathways underlying these effects remain unclear, but alterations in signaling pathways such as ERα, VEGFR2, pERK and PI3K (p85) have been reported in hormone responsive cells (Muñoz et al., 2021). In the present study, we showed for the first time that 1 GBH increased oxidative stress and decreased progesterone secretion in chicken preovulatory F1 and F3/4 GCs without any cytotoxic effect. Furthermore, we demonstrated that VE was able to alleviate some of these negative effects.

We showed that a GBH exposure did not affect the cell viability in F1 and F3/4 GC whereas it increased and did not alter F1 and F3/4 GCs cell proliferation, respectively. Thus, we can conclude that a GBH exposure until 36 mg Gly Eq/L was not cytotoxic for chicken GC. These data are important because GC play a decisive role in follicular development and a GBH exposure could inhibit this process. Furthermore, GC differentiation regulates the initiation of primordial follicles. Our result is different from those obtained in bovine GC since Perego et al., 2017 showed that Round up exposure at 10 and 300 mg/L strongly decreased cell numbers. However, other studies showed that Gly induced cell proliferation in glioblastoma cells (Bianco et al., 2023) and GBH increased the growth of rat uterine subepithelial stroma cells (Zanardi et al., 2024). In our study, we showed that the GBH increased cell proliferation in F1 and not F3/4 GC suggesting that the effect of GBH on the preovulatory granulosa cell toxicity could be dependent not only the species but also on the differentiation follicle status. Indeed, in mature hen, the preovulatory follicles show a hierarchy according to their size (F5/6 to F1) (Etches and Petitte, 1990). The largest follicle (F1), filled of yolk is first to ovulate, followed by the second largest follicle (F2) approximately 24 to 26 h later and this continues down the hierarchy.

In the present study, we showed that the GBH exposure reduced progesterone secretion in basal state from 0.36 mg of Gly eq/L but also in response to LH and/or IGF-1 in both F1 and F3/4 GCs. These data are in good agreement with other studies including bovine GC (Perego et al., 2024; for review Kaboli Kafshgiri et al., 2022; Serra et al., 2021b) showing that Gly alone or GBH inhibited steroidogenesis. However, Gigante et al., observed that Gly increased progesterone secretion by porcine GCs whereas Ganesan et al. (2020) indicated no in vivo effect on ovarian folliculogenesis and steroidogenesis. Thus, the effect of Gly and GBHs are very controversial in mammals. This difference may be due to the different effect of glyphosate on granulosa cells and steroidogenesis in in vivo studies compared to in vitro studies. The use of an in vitro model allowed to better target the desired cells, to control the experimental parameters and to minimize biological variations. Still, the obtained results should be confirmed in vivo experiments in the future.

According to Muñoz et al., 2021, there are 10 key characteristics on which we should refer to state on the ED nature of a molecule (Muñoz et al., 2021). Among them, the alteration of hormone synthesis can be an easy parameter to assess with in vitro models. It has been shown that growing doses of a GBH applied on mouse MA-10 Leydig tumor cells for 2 h can reduce their production of progesterone in a dose dependent manner (Walsh et al., 2000). This could be due to a disruption of StAR protein expression, which mediates the rate-limiting step in steroidogenesis. StAR is a mitochondrial protein that is rapidly synthesized in response to stimulation of the cell to produce steroid. In our study, we observed that the GBH did not affect the mRNA expression of StAR and 2 enzymes named cytochrome P450 side-chain cleavage (P450scc or CYP11A1), and 3-hydroxysteroid dehydrogenase (3β-HSD or HSD3B) that are very well known regulated the progesterone production (Yamazaki et al., 2005). One hypothesis is that the reduction in progesterone production in response to the GBH exposure is due to an inhibition of the activity of CYP11A1 and/or HSD3B. A study performed on bovine GCs showed that growing doses of GBH (10 and 300 µg/mL) drastically reduced progesterone and E2 production, while Gly alone had no significant effect (Perego et al., 2017). Here in chicken GCs, we used a GBH and not Gly, 1 hypothesis is that the inhibition in progesterone secretion observed be due to the co-formulants and not Gly. Several reports showed that co-formulants could be more toxics than Gly (Mesnage et al., 2022; Makame et al., 2023; Defarge et al., 2016). We analyzed only progesterone secretion and not oestradiol. Indeed, in chicken, GCs are the source of progesterone, and estrogens are derived from theca cells by aromatase (Huang et al., 1979, Marrone and Hertelendy, 1983). Whereas, in the mammalian ovary, estrogens are produced in GCs, and there was no or less expression of CYP19A1 in theca cells (Magoffin, 2005).

We showed that the GBH exposure induced an increase in TOS, decrease in TAS and consequently an increase in OSI from 3.6 mg of Gly eq/L in both F1 and F3/4 GC. Since the effects of GBH on steroid production are observed with a lower concentration (0.36 mg of Gly eq/L), increased TOS, decreased TAS and thus increased OSI due to exposure of granulosa cells to GBH are certainly not responsible for this inhibition of steroidogenesis. Many studies reported that Gly or/and GBHs are able to increase oxidative stress (Wang et al., 2022; Cattani et al., 2023; Qi et al., 2023). Thus, we investigated if the antioxidant VE was able to alleviate the negative effects on the steroid production.

In mammals, some reports demonstrated a beneficial effect of VE after Gly or GBH exposure both in vivo (Chandran et al., 2023; Bhardwa et al., 2022; and in vitro (Ünlü Endirlik et al., 2022). In the present study we demonstrated that VE is able to alleviate the negative effects of GBH on the progesterone production and oxidative stress in chicken F1 and F3/4 GCs. However, it remains to determine what are the molecular mechanisms involved. Other components such melatonin has been recently shown to alleviate negative effects of Gly or GBH. For example, melatonin alleviated Gly-induced testosterone synthesis inhibition via targeting mitochondrial function in roosters (Ren, 2024). It also alleviated the deterioration of oocytes and hormonal disorders from mice subjected to Gly (Zhang, 2021).

CONCLUSION

In this study, we demonstrated that a GBH can alter the physiological functions of chicken GCs. Progesterone production and oxidative stress were strongly affected by the GBH exposure. All these effects were at least partially reversed by the addition of VE in the culture medium. It remains to determine the molecular mechanisms and signaling pathways involved in the GBHs and VE effects.

DISCLOSURES

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ACKNOWLEDGMENTS

The authors thank all the technicians from “Pôle Expérimental Avicole de Tours” unit (INRAE, Nouzilly, France) for the care of animals. The authors thank to Région Centre Val de Loire for its support (Grant number 32000868 ).
==== Refs
REFERENCES

Bai S.H. Ogbourne S.M. Glyphosate: Environmental contamination, toxicity and potential risks to human health via food contamination Environ. Sci. Pollut. Res. 23 2016 18988 19001
Bailey D.C. Todt C.E. Burchfield S.L. Pressley A.S. Denney R.D. Snapp I.B. Negga R. Traynor W.L. Fitsanakis V.A. Chronic exposure to a glyphosate-containing pesticide leads to mitochondrial dysfunction and increased reactive oxygen species production in Caenorhabditis elegans Environ. Toxicol. Pharmacol. 57 2018 46 52 29190595
Bhardwaj J.K. Mittal M. Saraf P. Effective attenuation of glyphosate-induced oxidative stress and granulosa cell apoptosis by vitamins C and E in caprines Mol. Reprod. Dev. 86 2019 42 52 30411421
Bhardwaj J.K. Mittal M. Saraf P. Sharma S. Ameliorative potential of vitamin C and E against roundup-glyphosate induced genotoxicity triggering apoptosis in caprine granulosa cells Environ. Mol. Mutagen. 63 2022 246 254 35770910
Bianco C.D. Ourique F. Dos Santos D.C. Pedrosa R.C. Kviecisnki M.R. Zamoner A. Glyphosate-induced glioblastoma cell proliferation: Unraveling the interplay of oxidative, inflammatory, proliferative, and survival signaling pathways Environ. Pollut. 338 2023 122695
Bradberry S.M. Proudfoot A.T. Vale J.A. Glyphosate poisoning Toxicol. Rev. 23 2004 159 167 15862083
Canépa S. Lainé A.L. Bluteau A. Fagu C. Flon C. Monniaux D. Validation d’une méthode immunoenzymatique pour le dosage de la progestérone dans le plasma des ovins et des bovins Cahier des Techniques de l’INRA 64 2008 19 30
Cattani D. Pierozan P. Zamoner A. Brittebo E. Karlsson O. Long-Term Effects of Perinatal Exposure to a Glyphosate-Based Herbicide on Melatonin Levels and Oxidative Brain Damage in Adult Male Rats Antioxidants 12 2023 1825 37891904
Chabrolle C. Tosca L. Crochet S. Tesseraud S. Dupont J. Expression of adiponectin and its receptors (AdipoR1 and AdipoR2) in chicken ovary: Potential role in ovarian steroidogenesis Domest. Anim. Endocrinol. 33 2007 480 487 17010558
Chandran D. Jayaraman S. Sankaran K. Veeraraghavan V.P. Antioxidant vitamins attenuate glyphosate- induced development of type-2 diabetes through the activation of glycogen synthase kinase-3 β and forkhead box protein O-1 in the liver of adult male rats Cureus 15 2023 e51088
Defarge N. Takács E. Lozano V.L. Co-formulants in glyphosate-based herbicides disrupt aromatase activity in human cells below toxic levels Int. J. Env. Res. Public Health 13 3 2016 264 26927151
Dovolou E. Nanas I. Giannoulis T. Fytsilli A. Ntemka A. Anifandis G. Tsakmakidis I. Amiridis G.S. The effects of a glyphosate-based herbicide on the bovine gametes during an in vitro embryo production model Environ. Pollut. 350 2024 123967
Estienne A. Fréville M. Bourdon G. Ramé C. Delaveau J. Rat C. Chahnamian M. Brionne A. Chartrin P. Adriensen H. Lecompte F. Froment P. Dupont J. Chronic dietary exposure to a glyphosate-based herbicide results in reversible increase early embryo mortality in chicken Ecotoxicol. Environ. Saf. 241 2022 113741
Estienne A. Reverchon M. Partyka A. Bourdon G. Grandhaye J. Barbe A. Barbe A. Caldas-Silveira E. Rame C. Niżański W. Froment P. Dupont J. Chemerin impairs in vitro testosterone production, sperm motility, and fertility in chicken: possible involvement of its receptor CMKLR1 Cells 9 2020 1599 32630345
Etches R.J. Petitte J.N. Reptilian and avian follicular hierarchies: Models for the study of ovarian development J. Exp. Zool. 256 1990 112 122
European Food Safety Authority (EFSA) Conclusion on the peer review of the pesticide risk assessment of the active substance glyphosate EFSA J. 13 2015 1 107
Fréville M. Estienne A. Ramé C. Lefort G. Chahnamian M. Staub C. Venturi E. Lemarchand J. Maximin E. Hondelatte A. Zemb O. Canlet C. Guabiraba R. Froment P. Dupont J. Chronic dietary exposure to a glyphosate-based herbicide results in total or partial reversibility of plasma oxidative stress, cecal microbiota abundance and short-chain fatty acid composition in broiler hens Front. Physiol. 13 2022 974688
Ganesan S. McGuire B.C. Keating A.F. Absence of glyphosate-induced effects on ovarian folliculogenesis and steroidogenesis Reprod. Toxicol. 96 2020 156 164 32592754
Gibaldi M. Antioxidant vitamins and health J. Clin. Pharmacol. 36 1996 1093 1099 9013364
Gigante P. Berni M. Bussolati S. Grasselli F. Grolli S. Ramoni R. Basini G. Glyphosate affects swine ovarian and adipose stromal cell functions Anim. Reprod. Sci. 195 2018 185 196 29843941
Gill J.P.K. Sethi N. Mohan A. Datta S. Girdhar M. Glyphosate toxicity for animals Environ. Chem. Lett. 16 2018 401 426
Grandhaye J. Douard V. Rodriguez-Mateos A. Xu Y. Cheok A. Riva A. Guabiraba R. Zemb O. Philippe C. Monnoye M. Staub C. Venturi E. Barbe A. Ramé C. Dupont J. Froment P. Microbiota changes due to grape seed extract diet improved intestinal homeostasis and decreased fatness in parental broiler hens Microorganisms 8 2020 1141 32731511
Guyton K.Z. Loomis D. Grosse Y. El Ghissassi F. Benbrahim-Tallaa L. Guha N. Scoccianti C. Mattock H. Straif K. Carcinogenicity of tetrachlorvinphos, parathion, malathion, diazinon, and glyphosate Lancet Oncol 16 2015 490 491 25801782
Huang E.S. Kao K.J. Nalbandov A.V. Synthesis of sex steroids by cellular components of chicken follicles Biol. Reprod. 20 1979 454 461 454748
Ingaramo P. Alarcón R. Muñoz-de-Toro M. Luque E.H. Are glyphosate and glyphosate-based herbicides endocrine disruptors that alter female fertility? Mol. Cell. Endocrinol. 518 2020 110934
Kaboli Kafshgiri S. Farkhondeh T. Miri-Moghaddam E. Glyphosate effects on the female reproductive systems: a systematic review Rev. Environ. Health 37 2022 487 500 34265884
Magoffin D.A. Ovarian theca cell Int. J. Biochem. Cell Biol. 37 2005 1344 1349 15833266
Makame K.R. Masese S.N. Ádám B. Nagy K. Oxidative stress and cytotoxicity induced by co-formulants of glyphosate-based herbicides in human mononuclear white blood cells Toxics 11 2023 976 38133378
Marrone B.L. Hertelendy F. Steroid metabolism by avian ovarian cells during follicular maturation Biol. Reprod. 29 1983 953 962 6640044
Mesnage R. The surfactant co-formulant POEA in the glyphosate-based herbicide RangerPro but not glyphosate alone causes necrosis in Caco-2 and HepG2 human cell lines and ER stress in the ToxTracker assay Food Chem. Toxicol. 168 2022 113380 36028061
Muñoz J.P. Bleak T.C. Calaf G.M. Glyphosate and the key characteristics of an endocrine disruptor: A review Chemosphere 270 2021 128619
Perego M.C. Caloni F. Cortinovis C. Schutz L.F. Albonico M. Tsuzukibashi D. Spicer L.J. Influence of a Roundup formulation on glyphosate effects on steroidogenesis and proliferation of bovine granulosa cells in vitro Chemosphere 188 2017 274 279 28888115
Perego M.C. Spicer L.J. Cortinovis C. Bertero A. In vitro effects of two environmental toxicants, beauvericin and glyphosate in Roundup, on cell numbers and steroidogenesis of bovine ovarian cells Vet. Res. Commun. 48 2024 1769 1778 38558370
Pereira A.G. Jaramillo M.L. Remor A.P. Latini A. Davico C.E. Da Silva M.L. Müller Y.M.R. Ammar D. Nazari E.M. Low-concentration exposure to glyphosate-based herbicide modulates the complexes of the mitochondrial respiratory chain and induces mitochondrial hyperpolarization in the Danio rerio brain Chemosphere 209 2018 353 362 29935464
Qi L. Dong Y.-M. Chao H. Zhao P. Ma S.-L. Li G. Glyphosate based-herbicide disrupts energy metabolism and activates inflammatory response through oxidative stress in mice liver Chemosphere 315 2023 137751
Ren Y.L. Melatonin alleviates glyphosate-induced testosterone synthesis inhibition via targeting mitochondrial function in roosters Environ. Pollut. 348 2024 123828 38522604
Ren X. Li R. Liu J. Huang K. Wu S. Li Y. Li C. Effects of glyphosate on the ovarian function of pregnant mice, the secretion of hormones and the sex ratio of their fetuses Environ. Pollut. 243 2018 833 841 30245445
Ruuskanen S. Rainio M.J. Gómez-Gallego C. Selenius O. Salminen S. Collado M.C. Saikkonen K. Saloniemi I. Helander M. Glyphosate-based herbicides influence antioxidants, reproductive hormones and gut microbiome but not reproduction: A long-term experiment in an avian model Environ. Pollut. 266 2020 115108
Schönbrunn E. Eschenburg S. Shuttleworth W.A. Schloss J.V. Amrhein N. Evans J.N.S. Kabsch W. Interaction of the herbicide glyphosate with its target enzyme 5-enolpyruvylshikimate 3-phosphate synthase in atomic detail Proc. Natl. Acad. Sci 98 2001 1376 1380 11171958
Serra L. Estienne A. Bourdon G. Ramé C. Chevaleyre C. Didier P. Chahnamian M. El Balkhi S. Froment P. Dupont J. Chronic dietary exposure of roosters to a glyphosate-based herbicide increases seminal plasma glyphosate and AMPA concentrations, alters sperm parameters, and induces metabolic disorders in the progeny Toxics 9 2021 318 34941753
Serra L. Estienne A. Vasseur C. Froment P. Dupont J. Review: Mechanisms of glyphosate and glyphosate-based herbicides action in female and male fertility in humans and animal models Cells 10 2021 3079 34831302
Tosca L. Crochet S. Ferré P. Foufelle F. Tesseraud S. Dupont J. AMP-activated protein kinase activation modulates progesterone secretion in granulosa cells from hen preovulatory follicles J. Endocrinol. 190 2006 85 97 16837613
Traber M.G. Atkinson J. Vitamin E, antioxidant and nothing more Free Radic. Biol. Med. 43 2007 4 15 17561088
Ünlü Endirlik B. Bakır E. Ökçesiz A. Güler A. Hamurcu Z. Eken A. Dreij K. Investigation of the toxicity of a glyphosate-based herbicide in a human liver cell line: Assessing the involvement of Nrf2 pathway and protective effects of vitamin E and α-lipoic acid Environ. Toxicol. Pharmacol. 96 2022 103999 36252731
Walsh L.P. McCormick C. Martin C. Stocco D.M. Roundup inhibits steroidogenesis by disrupting steroidogenic acute regulatory (StAR) protein expression Environ. Health Perspect. 108 2000 8
Wang X. Lu Q. Guo J. Ares I. Martínez M. Martínez-Larrañaga M.-R. Wang X. Anadón A. Martínez M.-A. Oxidative stress and metabolism: A mechanistic insight for glyphosate toxicology Annu. Rev. Pharmacol. Toxicol. 62 2022 617 639 34990202
Xing C. Chen S. Wang Y. Pan Z. Zou Y. Sun S. Ren Z. Zhang Y. Glyphosate exposure deteriorates oocyte meiotic maturation via induction of organelle dysfunctions in pigs J. Anim. Sci. Biotechnol. 13 2022 80 35799248
Yamazaki T. Shimodaira M. Kuwahara H. Wakatsuki H. Horiuchi H. Matsuda H. Kominami S. Tributyltin disturbs bovine adrenal steroidogenesis by two modes of action Steroids 70 2005 913 921 16038956
Zanardi M.V. Gastiazoro M.P. Rossetti M.F. Doná F. Lazzarino G.P. Zierau O. Varayoud J. Durando M. Glyphosate-based herbicide worsens alterations induced by cafeteria diet on rat uterus J. Endocrinol. 261 2024 e240071
Zhang J. Melatonin alleviates the deterioration of oocytes and hormonal disorders from mice subjected to glyphosate Mol. Cell. Endocrinol. 520 2021 111073 33159990
