
==== Front
Mol Biol Cell
Mol Biol Cell
molbiolcell
mboc
Molecular Biology of the Cell
1059-1524
1939-4586
The American Society for Cell Biology

38809582
E23-12-0488
10.1091/mbc.E23-12-0488
Articles
Cross-Species
new_hypothesis
The myosin chaperone UNC-45 has an important role in maintaining the structure and function of muscle sarcomeres during adult aging
Matheny Courtney J. a
Qadota Hiroshi a
Bailey Aaron O. b
Valdebenito-Silva Silvana c
Oberhauser Andres F. c
Benian Guy M. a *
a Department of Pathology, Emory University, Atlanta, GA 30322
b Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX 77550
c Department of Neurobiology, University of Texas Medical Branch, Galveston, TX 77550
Murphy Coleen Monitoring Editor
Princeton University
Author contributions: C.J.M., H.Q., and G.M.B. conceived the study. C.J.M. performed most of the experiments, their analysis and interpretation, with help from H.Q. and G.M.B.. A.O.B. performed and interpreted the mass spec analysis. A.F.M. analyzed the phosphorylation data placing the phosphosites on the UNC-45 crystal structures, and predicted their functional consequences and possible protein kinases. S.V.S performed the molecular dynamics simulations, with input from A.F.O. C.J.M., A.F.M., and G.M.B. primarily wrote the manuscript with input from H.Q., A.O.B., and S.V.S.

Conflict of interest statement: The authors declare no conflicts of interest.

National Institutes of Health grant R01GM118534

National Institutes of Health Office of Research Infrastructure Programs (P40 OD010440)

Cancer Prevention Research Institute of Texas (CPRIT) grant number RP190682

ORCID ID: Guy M. Benian, 0000-0002-8236-3176

*Address correspondence to: Guy M. Benian, (pathgb@emory.edu).
01 7 2024
01 7 2024
35 7 ar9818 12 2023
26 4 2024
21 5 2024
© 2024 Matheny et al. “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology.
2024
https://creativecommons.org/licenses/by-nc-sa/4.0/ This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 4.0 Unported Creative Commons License.

C. elegans undergo age-dependent declines in muscle organization and function, similar to human sarcopenia. The chaperone UNC-45 is required to fold myosin heads after translation and is likely used for refolding after thermally- or chemically-induced unfolding. UNC-45′s TPR region binds HSP-90 and its UCS domain binds myosin heads. We observe early onset sarcopenia when UNC-45 is reduced at the beginning of adulthood. There is sequential decline of HSP-90, UNC-45, and MHC B myosin. A mutation in age-1 delays sarcopenia and loss of HSP-90, UNC-45, and myosin. UNC-45 undergoes age-dependent phosphorylation, and mass spectrometry reveals phosphorylation of six serines and two threonines, seven of which occur in the UCS domain. Additional expression of UNC-45 results in maintenance of MHC B myosin and suppression of A-band disorganization in old animals. Our results suggest that increased expression or activity of UNC-45 might be a strategy for prevention or treatment of sarcopenia.

Sarcopenia is the decline in skeletal muscle mass and function without underlying disease. The mechanisms of sarcopenia remain unclear.

Taking advantage of the conservation of muscle structure and function, the authors used C. elegans to learn that the chaperone UNC-45, first identified as required for the initial folding of the myosin head, also has an important role in preserving myosin as well as muscle structure and function during adult aging.

The results suggest that increasing the expression or activity of UNC-45 might be a way to delay or reduce sarcopenia.
==== Body
pmcINTRODUCTION

Sarcopenia, the decline in skeletal muscle mass and function without any underlying disease, is a major contributor to physical disability, poor quality of life, and death among the elderly (Cruz-Jentoft et al., 2014). Forty to fifty percent of individuals over 80 y of age suffer from this loss of muscle mass and function (Iannuzzi-Sucich et al., 2002; Barbosa-Silva et al., 2016). The molecular mechanisms responsible for this age-related condition remain uncertain (Zembron-Lacny et al., 2014). Resistance training and dietary changes are recognized as the gold standard therapy but have only a modest effect (Candow, 2011). There is a direct association between poor hand grip strength, reduced physical function and a higher risk of falling (Szulc et al., 2016). Intriguingly, even in middle age (40–69), there is a correlation between reduced grip strength and all-cause mortality and incidence of mortality from cardiovascular disease, respiratory disease, and cancer (Celis-Morales et al., 2018). One hypothesis is that sarcopenia is initiated by loss of motor neurons with age (Kwan, 2013), and this has been supported by a recent study of >40,000 patients showing that hand grip strength is positively correlated with cognitive performance, mental health and increased grey matter volume (Jiang et al., 2022). Elderly individuals at a higher risk of falling are at a higher risk of vertebral and non-vertebral fractures (Szulc et al., 2016) – leading to surgeries, hospitalization, and increased medical complications and risks. Additionally, the increased risk of respiratory illness in individuals over 65 y of age may be partially explained by the ageing-related weakening of the diaphragm muscle resulting in nonproductive coughs and more severe respiratory illnesses (Gosselin et al., 1994). With the ever-increasing population of elderly and the predicted strain on the healthcare system (Federal Interagency Forum on Aging-Related Statistics, 2012), it is crucial we understand the molecular mechanisms responsible for age-related diseases like sarcopenia so that we can develop more effective therapies and prevention methods.

Sarcopenic patients exhibit a loss of myofibrils, which are comprised of thin and thick filaments. The thin filaments are predominantly composed of filamentous actin while thick filaments are predominantly composed of myosin (Henderson et al., 2017). There is a superfamily of myosins composed of at least 30 classes of myosins, but all myosins consist of three regions: a “head”, a “neck”, and a “tail” (Squire et al., 2017). The head is a complex structure that converts the energy of ATP hydrolysis to the mechanical work of binding and moving along F-actin tracks (Squire et al., 2017). The chaperone UNC-45 is required to fold the myosin head initially after translation and, likely, to refold the myosin head after stress results in unfolding (Barral et al., 1998, 2002; Etard et al., 2008; Kachur and Pilgrim, 2008). UNC-45 may also be crucial in mature muscle because of the physical stress muscle cells undergo throughout life and the relatively slow turnover rate of myosin in established thick filaments (Solomon and Goldberg, 1996). UNC-45, which is conserved across all eukaryotes, was first identified in Caenorhabditis elegans (Barral et al., 1998; Venolia et al., 1999) and named for the uncoordinated (impaired movement) phenotype observed in mutant animals (Epstein and Thomson, 1974). Misregulation of UNC-45 is associated with several diseases including myopathies, cardiomyopathies, cataracts, and cancer metastasis (Bazzaro et al., 2007; Janiesch et al., 2007; Wohlgemuth et al., 2007; Bernick et al., 2010; Melkani et al., 2011; Hansen et al., 2014; Esteve et al., 2018). UNC-45 is comprised of a C-terminal UCS domain responsible for binding myosin, an N-terminal tetratricopeptide repeat (TPR) domain that interacts with the heat shock cochaperone protein HSP-90 (Barral et al., 2002), and a central domain that acts as an inhibitor of the myosin power stroke (Bujalowski et al., 2018). These authors put forth the following model: Under normal conditions, the UCS domain of UNC-45 is bound to the myosin head and the TPR domain is bound to HSP-90. Under stress conditions, HSP-90 detaches from the TPR domain, causing a conformational change in UNC-45 that allows the Central domain to bind to the myosin neck resulting in inhibition of the myosin power stroke while the UCS domain refolds the myosin head. After refolding of the myosin head, HSP-90 then rebinds the TPR domain, causing the Central domain to release the myosin neck, allowing movement of the myosin motor (Bujalowski et al., 2018).

C. elegans is an excellent genetic model organism to study sarcomere assembly, maintenance and regulation (Gieseler et al., 2017), and conserved mechanisms of aging (Kenyon, 2010). The C. elegans model provides the shortest lifespan and largest possible sample size among the models used to study sarcopenia. Their short lifespan (average 18–21 d) makes them particularly convenient for aging studies. Muscle function is easy to monitor in worms because they require functioning body wall muscles for locomotion. Additionally, nematode muscle does not contain stem cells and thus provides an opportunity to investigate how the assembled muscle contractile apparatus is maintained and functions during aging in the absence of regeneration. Monica Driscoll’s lab was the first to report that C. elegans undergo an age-dependent decline in whole animal locomotion and deterioration of the muscle myofilament lattice and thus C. elegans is a good model for sarcopenia (Herndon et al., 2002). Since that seminal report, C. elegans has continued to provide insight into early events and mechanisms associated with the decline of muscle function with age. For example, like in people, C. elegans undergoes a decline in maximal muscle contraction starting in early to mid-life, as early as d 2 of adulthood (Gaffney et al., 2018). In addition, these authors showed that the decline in mobility is more strongly associated with mitochondrial fragmentation than with a decline in sarcomere structure; mitochondria begin to fragment at d 4, whereas A-bands become disorganized at d 6. Similarly, as in rodents and humans (Borsch et al., 2021), changes in mitochondrial gene expression and metabolism are an early event in C. elegans muscle aging (Vintila et al., 2023). Importantly, in C. elegans, delaying these mitochondrial changes delays muscle decline with age (Vintila et al., 2023). This decline in mitochondrial function appears to be caused by increased calcium accumulation in mitochondria via the mitochondrial calcium uniporter (Higashitani et al., 2023). Despite this recent insight into the early stages of sarcopenia, we have little understanding about the later stages, and more specifically the mechanisms responsible for the decrease in the numbers and organization of sarcomeres.

Here we have verified and expanded upon evidence that C. elegans develop sarcopenia as they age. We observe early onset of sarcopenia when UNC-45 is perturbed at the beginning of adulthood in a temperature sensitive mutant, providing evidence that UNC-45 is important during adulthood and that UNC-45 may play a role in sarcopenia pathology. There is sequential decline of HSP-90 (d 3 of adulthood), UNC-45 (d 4), and MHC B myosin (d 8). Loss of function of AGE-1 (PI3 kinase), one component of insulin-like signaling, delays sarcopenia, including maintenance of A-band numbers, and levels of HSP-90, UNC-45 and myosin. UNC-45 is phosphorylated, beginning at d 3. At d 4, mass spectrometry reveals phosphorylation of six serines and two threonines, seven of which occur in the UCS domain, and one of which is at a residue conserved between nematode and human UNC-45. Additional expression of UNC-45 in old animals results in increased MHC B myosin, and a reduction in age-dependent sarcomere disorganization. Increased expression or activity of UNC-45 might be a potential strategy to prevent or treat human sarcopenia.

Results

C. elegans develop sarcopenia including decreased numbers and disorganization of A-bands, and decreased locomotion during aging

In the studies reported in Herndon et al. (2002), a transgenic line overexpressing GFP-MHC A was used to show that old adults (d 18) had disorganization of thick filaments, as compared with d 4 adults. In retrospect, this result could be questioned because in this strain, even young adults show some disorganization of thick filaments (unpublished data). Therefore, we have verified and extended the results reported in Herndon et al. (2002) by performing immunostaining on wild type worms using an antibody to MHC A (one of the myosin heavy chain isoforms in body wall muscle), and also examined earlier and additional time points. We observe that the number of A-bands, which are the parallel arrays of thick filaments cross linked by M-lines, declines with age (Figure 1, A–F). We began counting A-bands at d 1 of adulthood and continued until d 16, when most animals had stopped spontaneous movement (Figure 1H). A significant loss of A-band number can be seen by d 12 of adulthood. A similar result was obtained when antibodies to MHC B, the major myosin heavy chain in body wall muscle, were used for immunostaining (Supplemental Figure S1). When we measured the fraction of body wall muscle cells having obvious disorganization of A-bands (e.g. Figure 1E), we observed a significant increase in the fraction of cells disorganized at d 8, as compared with d 1 (Figure 1G). This disorganization is similar to that observed in unc-45 missense mutants (Gazda et al., 2013; Moncrief et al., 2021). Because older animals may be more fragile, their sarcomeres may be more prone to disorganization from the fixation required for immunostaining. Therefore, we examined sarcomere organization in live animals using the CRISPR strain KAG420 which expresses GFP-MYO-3 (MHC A). As shown in Supplemental Figure S2, a significant decrease in A-band number is first found at d 8, and a significant increase in the fraction of muscle cells with disorganized A-bands is found at d 12. Thus, the progressive disorganization of A-bands with aging is observed by both immunostaining and live imaging. These results support the notion that C. elegans experience a loss of sarcomere organization and mass with age, beginning at the midpoint of life and continuing until death, analagous to humans. We also measured whole animal locomotion using a crawling assay and found that motility declines by d 8 of adulthood and continues to decline until there is almost no significant mobility by d 16 (Figure 1H). Interestingly, muscle function declines at d 8, the same day that there is a significant decline in sarcomere organization, and before there is a loss of muscle mass (d 12), at least by immunostaining (Figure 1). This may suggest that some myosin molecules or thick filaments are less functional before they are lost. A caveat is that reduced mobility with age might also involve a decline of the nervous system and/or metabolism, or simply behavioral because the animals have passed the end of their peak reproductive period, and searching for food is less required.

FIGURE 1: The number of A-bands and nematode locomotion decline, and A-band disorganization increases, with age. (A–E) are representative images of body wall muscle near the vulva immunostained with anti-MHC A at different ages of adulthood (d 1, 4, 8, 12, and 16) of wild type nematodes grown at 20° with an A-band count depicted as white numbers along the A-bands. (F) is the quantification of A-band number at different ages of adulthood. (G) shows the fraction of body wall muscle cells having disorganized A-bands. (H) is the quantification of agar crawling motility assays at different ages of adulthood measured in body bends per second. Statistics depicted compare d 1 of adulthood to either d 4, 8, 12, or 16 of adulthood. For F and H, means and standard deviations are shown; for G, medians and 95% confidence intervals are shown. Note that A-band number declines at d 12, that the number of cells having disorganized A-bands increases at d 8, and that locomotion declines at d 8 (circled in red). ns: no significant difference; *: p value < 0.05; **: p value < 0.005; ***: p value < 0.0005; ****: p value < 0.0001.

UNC-45 has a role in maintaining the number and organization of A-bands and nematode locomotion during adulthood

To assess the possible role of UNC-45 in adult aging, we utilized the canonical unc-45(e286) temperature sensitive mutant. unc-45(e286) has a L822F mutation in the UCS domain of UNC-45 (Barral et al., 1998). e286 has a much more severe phenotype at 25°C: at 15°C, in 25% of the animals the A-band organization is normal and in 75% of the animals, A-bands are moderately disorganized, whereas at 25°C, 100% of the animals show severe disorganization of A-bands (Supplemental Figure S3). In shifting from 15°C to 25°C, there is a 60% reduction in the level of UNC-45, and the comparable mutation (L808F) in human UNC-45B results in a 25% reduction in chaperone activity in vitro (Moncrief et al. 2021). When allowed to develop at 25°C, this strain has reduced levels of both thick filament isoforms of myosin heavy chain, MHC A and MHC B (Barral et al., 1998; Landsverk et al., 2007), reduced numbers of thick filaments (Barral et al., 1998), and disorganized A-bands (Moncrief et al., 2021). For our purposes, we allowed the animals to develop at 15°C and transferred them to the restrictive temperature of 25°C only after muscle maturity had been reached (referred to as d 0 of adulthood). We observed a decline in the number of A-bands beginning at d 8 of adulthood assessed by anti-MHC A staining (Figure 2A), as opposed to d 12 in the wildtype strain (Figure 1F). Although only 75% of e286 animals show moderate A-band disorganization at 15°C (Supplemental Figure S3), we could still record a decline in A-band numbers at d 8 (Supplemental Figure S4). unc-45(e286) animals grown at the restrictive temperature (25°C) show an increase in the fraction of body wall muscle cells having A-band disorganization by d 2 of adulthood (Figure 2B), which is earlier than that observed in wild type (d 8, Figure 1G). In fact, within 24 h of being transitioned to the restrictive temperature (d 1) we observe disorganization of A-bands of unc-45(e286; Figure 2E). At d 1, the fraction of cells showing A-band disorganization is ∼0.1 in wild type (Figure 1 G) vs. 0.4 in e286 (Figure 2B). unc-45(e286) animals grown at the restrictive temperature also display a decline in motility at d 1 of adulthood (Figure 2C), as opposed to d 8 in wildtype (Figure 1H). As shown in Supplemental Figure S5, the growth of wild type animals at 25°C does not significantly affect worm locomotion compared with worm growth at 15°C when sampled at numerous time points from d 1 to d 16 of adulthood, except for d 3. Overall, we would describe the phenotype of unc-45(e286) as early onset of sarcopenia. This provides evidence that UNC-45 is essential to striated muscle during adulthood.

FIGURE 2: UNC-45 has a role in maintaining the number and organization of A-bands and nematode motility during adulthood. The canonical unc-45 temperature sensitive mutant, e286, was allowed to develop normally at the permissive temperature of 15°C and shifted to the restrictive temperature of 25°C on d 0 of adulthood. (A) is the quantification of A-band number at different adult ages. (B) shows the fraction of body wall muscle cells having disorganization of A-bands; d 1 is compared with d 2, 3, and 4. (C) is the quantification of crawling motility assays at different adult ages at the permissive (15°C) and restrictive (25°C) temperatures. (D) is a representative image of body wall muscle immunostained with anti-MHC A at d 0 of adulthood after the animal was allowed to develop at 15°C. This normal A-band organization is found in 25% of animals grown at 15°C, whereas 75% of the animals show moderate disorganization (Supplemental Figure S3). (E–K) are representative images of body wall muscle from animals grown at 25°C immunostained with anti-MHC A at different adult ages (d 1, 2, 3, 4, 8, 12, and 16). One-hundred percent of the animals show this moderate disorganization of A-bands. Note that there is a decline in A-band number at d 8 (circled in red), which is 4 d earlier than the drop in A-band number for wild type (Figure 1). Also note that the fraction of cells having disorganized sarcomeres in unc-45(e286) is higher than wild type at d 1 (compare to Figure 1G) and continues to rise through d 2–4. Means and SEMs are represented. ns: no significant difference; *: p value < 0.05; **: p value < 0.005; ***: p value < 0.0005; ****: p value < 0.0001.

As adults age, there is a sequential decline of HSP-90, UNC-45 and myosin

Using quantitative western blotting we have found that at d 3 of adulthood, there is a drop in the level of HSP-90 protein (Figure 3A). At d 4 of adulthood there is a drop in the level of UNC-45 protein (Figure 3B). By d 8 of adulthood, there is a drop in the level of MHC B protein, the major client of UNC-45 (Figure 3C). The level of MHC A protein shows a more gradual decline beginning at d 1 (Figure 3D). Although the decline in the level of HSP-90 protein at d 3, may be causally related to the decline in hsp-90 mRNA at d 2 (Figure 3E), the declines in UNC-45 and MHC-B proteins may be more related to the degradation of UNC-45 and MHC B proteins, rather than the declines in their mRNAs: There is a significant decline in unc-45 mRNA by d 2 (Figure 3F), and a significant decline in unc-54 (encodes MHC B) mRNA by d 1 (Figure 3G), and the levels of these mRNAs remain low throughout the remainder of adulthood.

FIGURE 3: The Sequential Decline of HSP-90, UNC-45, and Myosin with Age. (A–D) Graphical quantification of steady state protein levels of HSP-90, UNC-45, MHC B, and MHC A (myosin isoforms). Data are shown as a percentage of protein relative to protein measured at d 0 of adulthood. In each lane of the blot, the proteins were normalized to the level of histone H3. (E–H) Steady state mRNA fold expression of unc-45, hsp-90, unc-54 (MHC B), and myo-3 (MHC A) during aging relative to the level of each mRNA at d 0 of adulthood. Normalization was performed using the level of gpd-2 mRNA. Days of significant protein or mRNA decline are circled with red circles. Means and SEMs are represented. ns: no significant difference; *: p value < 0.05; **:p value < 0.005; ***: p value < 0.0005; ****: p value < 0.0001.

A delayed onset of sarcopenia is associated with increased UNC-45 and HSP-90

It is well-established that genetic disruption of the insulin-like signaling pathway results in increased longevity of C. elegans (Klass, 1983; Kenyon et al., 1993). The age-1(hx546) strain has a mutation in the phosphatidylinositol 3-kinase (AGE-1) of the insulin like signaling pathway that results in animals living ∼7–9 fold longer (Ayyadevara et al., 2008). We have found that these mutant animals have increased A-band numbers compared with wild type, beginning at d 8, and continuing through d 16 (Figure 4F). In fact, there is no significant difference in the number of A-bands between d 1 wild type animals and d 16 age-1 animals (Figure 4F). Intriguingly, although it has been reported that these animals move more in liquid media early in life (Duhon and Johnson, 1995), we found a slight decline in spontaneous movement on agar plates at d 1 and 4 (Figure 4G). This does not necessarily correlate to muscle health as it could be due to uncharacterized neuronal or metabolic changes caused by this mutation. When stimulated by poking with a toothpick, the animals display normal, healthy sinusoidal movement on the agar surface until at least d 8 of adulthood. These mutant animals not only retain their HSP-90, UNC-45, and MHC B protein levels longer than wildtype, but the steady state levels of these proteins continue to increase past d 0 of adulthood (Figure 5, A–C). This is not surprising because we observe that the steady state transcripts of hsp-90 and unc-54 continue to increase past d 0 of adulthood, spiking around d 2 and 3, as if the animals are still developing. In contrast, we don’t see much change in unc-45 transcript levels between wildtype and the long-lived animals. We once again found that the decline in UNC-45 protein occurs independently of its transcript and after the decline in HSP-90 protein.

FIGURE 4: The age-1(hx546) longevity mutant has a delayed loss of A-band number. (A–E) are representative images from age-1(hx546) grown at 20° of body wall muscle near the vulva immunostained with anti-MHC A at different ages of adulthood (d 1, 4, 8, 12, and 16) with an A-band count depicted as white numbers along the A-bands. (F) is the quantification of A-band number at different ages of adulthood compared with N2 wildtype. Note that beginning at d 8 (circled in red) and continuing at d 12 and 16, age-1(hx546) shows a higher A-band number than wild type. The bracket compares the A-band numbers in d 1 wildtype to d 16 age-1(hx546) animals. (G) is the quantification of agar crawling motility assays at different ages of adulthood measured in body bends per second compared with N2 wildtype. Means and SEMs are shown. ns: no significant difference; *: p value < 0.05; **: p value < 0.005; ***: p value < 0.0005; ****: p value < 0.0001.

FIGURE 5: The age-1(hx546) longevity mutant has increased levels of UNC-45, HSP-90, and myosin MHC-B. (A–C) Graphical quantification of steady state protein levels of HSP-90, UNC-45, and MHC B (major body wall myosin isoform). Data are shown as percentage of protein relative to protein measured at d 0 of adulthood. In each lane of the blot, the proteins were normalized to the level of histone H3. (D–F) Steady state mRNA expression of unc-45, hsp-90 and unc-54 (MHC B) during aging relative the levels at d 0 of adulthood. Normalization was performed using the level of gpd-2 mRNA. Means and SEMs are shown. ns: no significant difference; **: p value < 0.005; ***: p value < 0.0005; ****: p value < 0.0001.

Hsp90 and UNC-45B also decline with age in mouse skeletal muscle

Altun et al. (2010) reported that there is an age-dependent decline in UNC-45B levels (but not mRNA levels) in rats. We wished to determine whether a similar phenomenon occurs in the mouse, and in addition whether there is also a decline in Hsp90. To examine this question we prepared protein extracts from the quadriceps muscles of three different mice from 3 and 24 mo of age, and subjected them to Western blot analysis. As indicated in Figure 6, there is an age-dependent decline in both Hsp90 and UNC-45B. This further supports the idea that the findings that we report here on C. elegans muscle are relevant to mammalian muscle.

FIGURE 6: UNC-45B and Hsp90 chaperone levels decline with age in mouse skeletal muscle. (A) is a Western blot for UNC-45B, and (B) is a western blot for Hsp90, from extracts of quadriceps muscles from three different mice, aged 3 and 24 mo old. (C) is the corresponding blot stained with Ponceau S. (D) Quantification of UNC-45B and Hsp90 protein levels at the two ages. The intensity of each protein band was normalized to total protein in the lane assessed by Ponceau S staining. Means and standard deviations are indicated. *: p value < 0.05; **: p value < 0.01

UNC-45 phosphorylation increases with aging

Using gradient SDS–PAGE gels, we noticed that during adult aging in C. elegans, as the protein band corresponding to UNC-45 (107 kDa) declines, a higher molecular weight band appears and increases (Figure 7). We suspected that this higher molecular weight UNC-45 protein band was the result of posttranslational modification. In an attempt to identify this post translational modification, we ran protein lysates from different aged wildtype worms on a SuperSep Phos-tag electrophoresis gel, which separates proteins based on both molecular weight and phosphorylation status (more phosphate groups cause the protein to run slower through a gel containing the Phos-tag organic molecule which binds to phosphates, including phosphorylated proteins). Electrophoresis through this gel followed by western blotting and reaction with anti-UNC-45 antibodies shows that with age there is an increase in UNC-45 protein bands that run more slowly in the gel beginning at d 3 of adulthood, consistent with an increase in the phosphorylation of UNC-45 with aging (Figure 8A). Further evidence that these slower running UNC-45 bands are phosphorylated was provided by showing that they are eliminated upon treatment of the protein lysates with lambda phosphatase (Figure 8B).

FIGURE 7: A higher molecular weight UNC-45 band accumulates as the expected sized UNC-45 band declines with aging. Protein lysate from d 0, 1, 2, 3, 4, 8, 12, and 16 old worms were run on a 4–15% gradient gel, transferred to a nitrocellulose blot, and reacted with the UNC-45 antibody to reveal a higher molecular weight UNC-45 band.

FIGURE 8: The phosphorylation of UNC-45 increases with age. (A) UNC-45-mNeonGreen was immunoprecipitated from worms of the indicated ages using anti-mNeonGreen nanobodies, and this material was run on SuperSep Phos-tag gel, blotted and reacted with anti-UNC-45. Notice that a small amount of UNC-45 that has reduced mobility appears at d 3, and becomes more prominent at d 4 and continues through d 16. (B) A similar gel and blot as in (A) with protein extracts from worms with the indicated ages shows that λ phosphatase treatment reduces or eliminates the bands of reduced mobility, a further indication that the bands of reduced mobility result from phosphorylation.

Identification of novel age-dependent phosphorylation sites in UNC-45 by mass spectrometry

We have reported (Moncrief et al., 2021) creation of a CRISPR strain that expresses UNC-45-mNeonGreen. As shown in Supplemental Figure S6, UNC-45-mNeonGreen is predominantly expressed in body wall, pharyngeal and vulval muscles, the known expression pattern for endogenous UNC-45 (Ao and Pilgrim, 2000). In addition, using anti-UNC-45, UNC-45-mNeonGreen is properly localized to the outer portions of the A-bands (Supplemental Figure S6). Using nanobodies to mNeonGreen coupled to magnetic beads we immunoprecipitated UNC-45-mNeonGreen from d 0 and d 4 synchronized populations of UNC-45-mNeonGreen worms and subjected the proteins to mass spectrometry analysis (see Materials and Methods) to identify possible PTMs on the UNC-45 sequence, possibly including acetylation and phosphorylation. For d 0 young adults, this analysis did not reveal any PTMs. For d 4 old adults eight high-confidence phospho-sites were revealed (Table 1, and Figure 9). Of the eight total phosphorylated serines and threonines, all but one of these sites resides in the myosin head-binding UCS region (Figure 9). One of these sites in the UCS domain is conserved in human UNC-45b (S659 in the worm sequence, corresponding to S642 in the human sequence). An additional phosphosite in the worm UNC-45 UCS, S723, is conserved in the Drosophila UNC-45 sequence (S709).

TABLE 1: List of phosphorylated residues in UNC-45 identified by mass spectrometry from d 4 adults. Columns from left to right: 1st column: list of phosphorylated residues, with * indicating conservation in human Unc-45B. 2nd column: sequence alignment between worm (top) and human (below); residues in red font are conserved between worm, Drosophila, mouse and human. 3rd column: location of phosphorylated residues on the secondary structure. 4th column: predicted effects of phosphorylation on structure or function using in silico approaches. 5th column: predicted protein kinase using in silico prediction tools (NetPhos, GPS).

	

FIGURE 9: Location of phosphorylated residues in UNC-45 identified by mass spectrometry from d 4 adults. (A) On top is a sequence alignment of C. elegans, Drosophila, zebrafish, and human UNC-45/Unc-45b at the end of the TPR domain. The location of the phosphorylation site, S111, in C. elegans UNC-45 and its orthologs is indicated by the red box. Below is the crystal structure (4i2z.pdb) of the UNC-45–-HSP-90 interaction site in C. elegans, with the UNC-45 TPR in yellow, and the HSP-90 C-terminus in purple. (B) Molecular surface of the UCS domain (4i2z.pdb) with mapped myosin binding regions colored in red. Phosphorylated residues are shown in black.

In silico approaches predict effects of phosphorylation on UNC-45 protein structure and function

Several machine learning methods have been used to generate prediction tools for phosphorylation sites (Perez-Mejias et al., 2020). We used two in silico prediction tools, NetPhos 3.1 (Blom et al., 1999) and GPS 6.0 (Chen et al., 2023), to predict phosphorylation sites and associated kinases; these are listed in column five of Table 1. For example, the residues S659 and S723 are putative targets of Ca2+/calmodulin (CaM)-dependent protein kinase II (CaMKII). To predict the impact of phosphorylation on local and global chaperone structure we in silico mutated the corresponding residues to Glutamates because this substitution provides the negative charge of a phosphoresidue and is of a similar volume, and is the simplest method to introduce canonical amino acids (Thorsness and Koshland, 1987; Pearlman et al., 2011). Glu is a suitable phosphomimetic replacement as it matches the phosphate oxygens of pSer and pThr. After introducing this phosphomimic, the structure was energy minimized in order to account for steric clashes after adding the new side chain. We found that phosphorylation of Ser 111 leads to a significant change in the local structure of the HSP-90 binding region (TPR repeats three and four): in Figure 9A, the UNC-45 TPR is shown in yellow and Hsp90 C-terminus is shown in purple (showing several potential salt-bridges, e.g. K82TPR-E407Hsp90., D114TPR-R404Hsp90). We predict that the addition of a bulky negative charge by phosphorylation should change the local TPR structure and hence weaken the binding. Figure 9B shows a molecular surface of the UCS domain with mapped myosin binding regions (in red) with key myosin binding residues (in magenta). The Ser and Thr were mutated to Glu and energy minimized. Phosphorylated residues are shown in black. Our data show that the age-specific phosphosites in UNC-45 are predicted to be solvent exposed (Ser111, S571, S659, S862) or buried (S655, S723, T812, T926). One caveat is that these predictions are based on the UNC-45 crystal structure (5MZU.pdb) and yet proteins, and in particular chaperones, are not rigid structures: they undergo large-scale movements of secondary structures, subunits or domains, referred to as protein “breathing”, that define a native-state ensemble of structures (Marino Perez et al., 2022). To predict the conformational changes on UNC-45 caused by the perturbations introduced by phosphorylation, we used dynamics simulations (e.g., [Marino Perez et al., 2022]; Figure 10). This simulation shows that indeed the secondary structure undergoes large-scale movements (e.g., in the myosin-binding loop). Based on these simulations, we predict that the surface residues are likely phosphorylated first, and that buried phosphosites are exposed by structural changes that are induced by the phosphorylation of the surface residues.

FIGURE 10: Molecular dynamics simulations of the UCS chaperonin domain of C. elegans UNC-45. Four snapshots are shown (10, 25, 125, and 200 ns) that illustrate the secondary structure elements that undergo large-scale movements (e.g., the myosin-binding loop in blue). Based on these simulations we predict that the surface residues are likely phosphorylated first, and that some buried phosphosites are exposed by structural changes that are induced by the phosphorylation of the surface residues and the spontaneous large-scale movements (“protein breathing”) of the chaperone structure.

Additional UNC-45 expression delays the age-associated decline in myosin levels, A-band numbers and A-band organization

We wished to determine whether increased expression of UNC-45 in older adults might ameliorate sarcopenia. To address this question, we created an integrated transgenic array designed to express via a heat shock promoter, UNC-45 with a C-terminal HA tag. As shown in Supplemental Figure S7A, heat shock at 30°C for 2 h induces expression of UNC-45-HA. We found that this heat shock method can induce expression of UNC-45-HA each day of adulthood through d 12, although maximum expression was observed at adult d 0 (Supplemental Figure S7B). Moreover, we found that the induced UNC-45-HA persisted to a variable extent 2 d after the heat shock, including 2 d after heat shock at d 10 (Supplemental Figure S7C). Based on these results, we then designed a “treatment plan” in which worms carrying the hsp-UNC-45-HA array were heat shocked (30°C for 2 h) to induce expression each day starting at d 2 and continuing through d 12 of adulthood, and samples for protein extracts and immunostaining were collected on d 0, 4, 8, and 12 (Figure 11A). As a negative control, we used the same heat shock protocol on wild type worms (Supplemental Figure S8). In wild type worms, heat shock increases UNC-45, but rather minimally: as compared with the level of UNC-45 at d 0, at d 4, there is a 1.4-fold increase; at d 8, there is a 1.6-fold increase, and at d 12 there is a 1.1 fold increase (Supplemental Figure S8B). However, this is in contrast to the heat shock promoter induced increase in UNC-45-HA: 1.76-fold increase at d 4, a 4.53-fold increase at d 8, and a 2.93-fold increase at d 12 (Figure 11B). Importantly, the heat shock promoter based overexpression of UNC-45 leads to maintenance of the level of MHC B through d 12 (Figure 11C) in contrast to simple heat shock on wild type which shows a decrease in MHC B at d 8 (Supplemental Figure S8C). Thus, heat shock on wild type, despite causing a small increase in UNC-45, does not lead to maintenance of MHC B because without heat shock wild type animals also show a decline in MHC B at d 8 (Figure 3C). Heat shock promoter-based overexpression of UNC-45 also leads to maintenance of A-band numbers through d 8 (Figure 11D), as compared with simple heat shock on wild type which shows a decrease in A-band number at d 8 (Supplemental Figure S8D). Overexpression of UNC-45-HA also leads to suppression of disorganization of A-bands (Figure 11E) which does not occur in wild type after our heat shock protocol (Supplemental Figure S8E).Therefore, substantial overexpression of UNC-45 leads to maintenance of myosin, A-band numbers and sarcomere organization in older adults.

FIGURE 11: Additional expression of UNC-45 maintains the level of myosin and reduces the disorganization of A-bands in old animals. (A) An integrated transgenic line that expresses UNC-45-HA from a heat shock promoter, was heat shocked (30° for 2 h) every day beginning at d 2 and continuing until d 12 of adulthood, and samples were collected for protein extracts and immunostaining at d 0, 4, 8, and 12. Results of quantitative western blots for total UNC-45 (endogenous UNC-45 plus UNC-45-HA) and MHC B are shown in B and C. (B) The treatment protocol raised the level of total UNC-45 on d 8 (circled in red) and 12 by ∼ fivefold as compared with the endogenous level of UNC-45 at d 0. There was also an increase of UNC-45 at d 4 but it did not reach statistical significance. (C) The treatment maintained the level of MHC B myosin at d 4 and 8 compared with d 0. This is in contrast to what normally happens during adult aging, a 50–60% decrease in MHC B levels at d 8 (Figure 3C). (D) Treatment failed to prevent the normal decline in A-band number (Figure 1F) that occurs at d 12 (circled in red). (E) Additional expression of UNC-45 prevents the age-dependent increase in A-band disorganization. Note that at d 8 (circled) there is a statistically significant difference in disorganization comparing wild type with additional UNC-45 expression. The wild type values were taken from Figure 1G. In B and C means and standard deviations are shown; in D means and SEMs are shown; and in E medians and 95% confidence intervals are shown. ns: no significant difference; *: p value < 0.05; **: p value < 0.005; ****: p value < 0.0001.

Discussion

Previously, UNC-45 had been shown to be crucial during muscle development (Epstein and Thomson, 1974; Venolia and Waterston, 1990), but its role in adulthood had not been explored. However, since then more evidence has emerged that suggests that myosin may require its chaperone UNC-45 to maintain its integrity in the face of damage that accumulates with age. We now know that sarcomere proteins assembled into the thick filament have a low protein turnover rate (Solomon and Goldberg, 1996) and it has been shown that the reduction in myofibrillar synthesis rate in old (61–74 y) vs. young (22–31 y) human muscle is not caused by reduced myosin mRNA (Welle et al., 1996). This suggests that the myosin assembled into thick filaments requires a mechanism to retain its structure after denaturing events (chemical, thermal, and physical stress) that occur within the muscle and accumulate with age. Barral et al. (2002) have shown that UNC-45 prevents thermal aggregation of myosin heads in vitro. Etard et al. (2008) have shown that Unc-45b, the skeletal muscle specific isoform, localizes to the Z-discs normally and moves to thick filaments during stress (cold and heat shock, chemical, and physical) in zebrafish skeletal muscle. We find that using the ts mutant unc-45(e286) and shifting it from the permissive to the restrictive temperature at d 1 of adulthood is enough to cause an early onset of sarcopenia-like state. In wildtype worms, we observe a decline in A-band numbers at d 12 of adulthood, but when the ts mutant unc-45(e286) is grown at the restrictive temperature from the beginning of adulthood, the A-band decline occurs at d 8 (compare Figure 1F and Figure 2A). Moreover, disorganization of A-bands occurs as early as d 1 of adulthood in unc-45(e286; Figure 2B) whereas a similar level of disorganization is not found until d 8 of adulthood in wildtype (Figure 1G). Whole worm locomotion is also reduced in d 1 unc-45(e286) animals, whereas decreased locomotion occurs at d 8 in wildtype (compare Figure 2C and Figure 1H). Thus, our results strongly suggest that UNC-45 is crucial to maintaining muscle health during adulthood.

We then sought to characterize the changes in total steady state protein and transcript levels of UNC-45, its cochaperone HSP-90, and its clients within body wall muscle, MHC A and MHC B (Figure 3). We found that hsp-90 transcript declines at d 2 of adulthood, directly before the decline in HSP-90 protein (d 3). The loss of HSP-90 at d 3 directly precedes a loss of UNC-45 protein at d 4 of adulthood. Then, there is a major decline in MHC B, the main client of UNC-45 and most abundant body wall muscle myosin isoform, at d 8 of adulthood. A similar decrease in Unc-45b and Hsp90 in skeletal muscle was observed in young versus old mice, demonstrating the evolutionary conservation of this process and its relevance to human sarcopenia (Figure 6). The sequential decline of nematode HSP-90, UNC-45 and myosin, may be cause and effect. It is reasonable to expect that loss of UNC-45 would result in a reduced level of myosin because myosin in muscle thick filaments turns over slowly (1–2% per day in humans [Rennie et al., 1994]), and it is possible that UNC-45 refolds existing myosin heads that are damaged by thermal denaturation, and by oxidative stress-induced PTMs like oxidation or carbonylation which can also accumulate over time. These modifications may affect myosin function through alteration of its conformation and interactions with actin and other proteins. The oxidative damage may be a result of one of the earliest identified changes in older muscle: an increase in mitochondrial fragmentation and reduced mitochondrial function (maximal mitochondrial ATP production; Gaffney et al., 2018). These less functional mitochondria may have less efficient electron transport and thus produce more ROS, resulting in damage to both UNC-45 and myosin. It has been shown that PTMs affect the enzymatic activity and stability of myosin during aging (e.g., Prochniewicz et al., 2007). Structural studies on skeletal muscle cells has revealed that the fraction of active myosin heads is decreased by ∼30% in aged versus young rats (Lowe et al., 2001). Comparison of human skeletal muscle from young versus old individuals has revealed that by mass spec, two PTMs occur in the motor domain in the old (carbonylation of - Pro79 and Asn81; Li et al., 2015). At least for C. elegans, the crystal structure of UNC-45 (Gazda et al., 2013) shows that it forms linear multimers in which the length of the repeating unit is similar to the repeating unit in the staggered display of pairs of myosin heads on the surface of thick filaments. In addition, antibodies to UNC-45 colocalize with MHC B myosin on the major portions of the thick filament in already assembled sarcomeres of adult muscle (Ao and Pilgrim, 2000; Gazda et al., 2013). Thus, in adult muscle, UNC-45 is positioned on the thick filament to refold any myosin heads that are damaged by thermal or chemical stress. The role of HSP-90 in these age associated changes is uncertain, but because HSP-90 binds to the TPR region of UNC-45 (Barral et al., 2002), it is possible that this binding stabilizes UNC-45 or protects it from ubiquitylation, and if HSP-90 is reduced, the degradation of UNC-45 might increase.

Nevertheless, our interpretation of the sequential decline of HSP-90, UNC-45 and muscle myosins as being cause and effect in muscle, has some limitations. This is because HSP-90 and UNC-45 expression is not restricted to body wall muscle cells and whole-body variations that we have observed by RTqPCR and western blot may not reflect muscle-specific changes. Furthermore, HSP-90 interacts with many different proteins, not just UNC-45.

We theorize that the decline in UNC-45 protein is due primarily to protein degradation. The decline in UNC-45 that we observe during adulthood may be due to increased ubiquitination followed by proteasomal degradation. It has been reported that C. elegans UNC-45 is polyubiquitinated by CHN-1 and CDC-48 resulting in degradation by the 26S proteasome (Hoppe et al., 2004). One study found that aged sarcopenic rat skeletal muscle contains higher levels of CHIP and p97, which are the mammalian homologues of CHN-1 and CDC-48 (Altun et al., 2010). The authors found no significant change in unc-45b mRNA between young adult and aged muscle samples but found that Unc-45B protein was decreased in the aged muscle compared with young adult muscle (Altun et al., 2010). We observe what appears to be an increase in posttranslational modification of UNC-45 with age (Figure 7), and have identified that one of these modifications is phosphorylation of serines and threonines (Figure 8; Table 1; Figure 9). Phosphorylation may be related to the already known ubiquitylation of UNC-45 and its degradation by the proteasome (Janiesch et al., 2007). Future experiments will test the ideas that phosphorylation increases the rate of UNC-45 degradation, and/or interferes with UNC-45 function.

Consistent with our phos-tag gel results (Figure 8A), we detected no phosphorylation of UNC-45 from d 0 animals, but significant phosphorylation from d 4 animals (Table 1). It is also significant that seven of the eight phosphosites reside in the myosin binding UCS domain (Figure 9B), which suggests that that one or more of these modifications could reduce the chaperone function of UNC-45 even before they may promote degradation. We have found the age-specific phosphosites in UNC-45 are predicted to be solvent exposed (S111, S571, S659, S862), or buried (S655, S723, T812, T926; Table 1; Figure 9B). Based on our molecular dynamics simulations (Figure 10), we predict that the buried residues become solvent exposed during large-scale movements of its secondary structures. Thus, we also predict that the surface residues are phosphorylated first and that buried phosophsites are exposed by structural changes that are induced by the phosphorylation of the surface residues. To test this idea, future experiments will include mass spec analysis of UNC-45 from earlier aged adults (d 1, 2, and 3). S111 resides in the TPR repeat region of UNC-45 and we predict that phosphorylation will reduce interaction with HSP-90. Future experiments will include in vitro binding assays with recombinant proteins comparing wild type UNC-45 to the phosphomimetic S111E. Although in a conserved region, serine 111 is not a conserved residue (Figure 9A). In Drosophila, zebrafish and humans this residue is aspartic acid or glutamic acid, which would act like a phosphomimetic. This raises the question of why this residue evolved from being phosphorylated to being constitutively negatively charged. Perhaps this site is crucial to the regulation of UNC-45 protein levels within muscle cells.

During aging, the age-1(hx546) longevity mutant showed no decline in A-band numbers even at d 16 of adulthood (Figure 4F) despite showing decreased locomotion (Figure 4G). Moreover, as compared with wild type, the age-1(hx546) animals show higher levels of HSP-90 at d 4, higher levels of UNC-45 at d 4 and 8, and higher levels of MHC B even out to d 16 (Figure 5, A–C). hsp-90 and unc-54 transcripts remain above wildtype levels while unc-45 transcript has the same trend as in the wildtype animals (Figure 5, D–F). Because one theory behind the improved stress resistance of age-1(hx546) is an increase in heat shock proteins and chaperones (Walker et al., 2001; Shmookler Reis et al., 2012), it is not surprising that the hsp-90 mRNA is upregulated. However, we still observe a decline in HSP-90 protein back to wildtype levels by d 8 of adulthood, which precedes a decline in UNC-45 protein back to wildtype levels by d 12 of adulthood. This 4-d delay in the loss of UNC-45 protein is likely to be the key factor in maintaining A-band numbers even in old (d 16) adults.

To determine whether providing extra UNC-45 in old animals could reduce sarcopenia, we developed a system in which we could express UNC-45 with an HA via a heat shock promoter. As shown in Supplemental Figure S7, we were able to induce expression through much of adulthood even at d 12, and we found that much of the UNC-45-HA persisted 2 d after the 2 h of heat shock. Using a paradigm in which we heat shocked for 2 h every day beginning with d 2, we were able to increase the level of total UNC-45 by 1.8-fold at d 4, by 4.5-fold at d 8, and by 2.9-fold by d 12, as compared with the level of UNC-45 at d 0 (Figure 11B). This resulted in maintaining MHC B myosin at d 8 and even marginally at d 12 (Figure 11C). This is in contrast to using the same heat shock protocol on wild type animals, which despite causing a small increase in UNC-45, did not lead to maintenance of MHC B (it declines at d 8 like it does without heat shock; Supplemental Figure S8C). Although forced overexpression did not delay the decline in A-band numbers, which normally occurs at d 12 (Figures 1F and 11D), it greatly blunted the onset of A-band disorganization (Figure 11E): With normal UNC-45 expression, the fraction of cells showing disorganization jumps from less than 10% at d 1 to 30% at d 8 (Figure 1G). In contrast, additional UNC-45 expression is able to dampen the percent of cells with disorganization to less than 10% even at d 12 (Figure 11E). Thus, although the number of A-bands was not improved, the organization of these A-bands was improved, suggesting not only an increase in myosin levels but an improvement in the quality of this myosin (e.g., better able to assemble into thick filaments). The relevance of our findings in C. elegans to human muscle is highlighted by our finding that in mouse skeletal muscle there is a similar age-related decline in Hsp90 and Unc-45b levels (Figure 6). Overall, our results suggest the possibility that increased expression or increased activity of UNC-45 might be a strategy for preventing or treating human sarcopenia.

MATERIALS AND METHODS

C. elegans strains and growth conditions

Standard growth conditions for C. elegans were used (Brenner, 1974). Wildtype Bristol N2, KAG420, age-1(hx546), GB319, GB350, and GB371 were grown at 20°C. As described in the above results, temperature sensitive mutants unc-45(e286) and hsp-90(p673) were grown at 15 or 25°C. To obtain a synchronized culture of adults, embryos were prepared by the alkaline bleach method, embryos were placed on unseeded NGM plates, allowing growth until the L1 stage, then the L1s were placed on OP50 seeded NGM plates at 20°. Forty-eight hours later, the worms were young adults, designated as d 0 adults, and after an additional 24 h, were designated as d 1 adults. Adult worms were separated from their progeny daily by allowing the adults to sink in M9 buffer in glass tubes, removing the supernatant containing the L1s, and washing several times before returning to NGM plates. KAG420 (a kind gift from Kathrin Gieseler, Universite Claude Bernard Lyon, France) is a CRISPR-generated strain which expresses GFP-MYO-3 (MHC A). GB319 is the 2X outcrossed derivative of PHX789 (unc-45(syb789)) which is a CRISPR-generated strain that expresses UNC-45-mNeonGreen and was described previously (Moncrief et al., 2021). The strain, PHX501 (hsp-90(syb501)), is a CRISPR-generated strain which expresses HSP-90 with a C-terminal mKate2 tag. PHX501 was created by SunyBiotech (www.sunybiotech.com). PHX501 was outcrossed 2X to wild type to generate strain GB350. GB371 (sfIs27 [hsp::UNC-45::HA; sur-5::GFP]) is a strain that contains an integrated transgenic array that expresses UNC-45-HA from a heat shock promoter (described below).

Immunostaining of adult body-wall muscle

Adult nematodes were fixed and immunostained according to the method described by Nonet et al. (1993) and described in further detail by Wilson et al. (2012). The following primary antibodies were used: anti–MHC A at 1:200 (mouse monoclonal 5–6 [Miller et al., 1983]), anti-MHC B at 1:200 (mouse monoclonal 5–8 [Miller et al., 1983]), anti–UNC-95 at 1:100 (rabbit polyclonal Benian-13 [Qadota et al., 2007]), and anti-UNC-45 at 1:100 (rabbit polyclonal [Moncrief et al., 2021]). Secondary antibodies, used at 1:200 dilution, included anti-rabbit Alexa 488 (Invitrogen, Thermo Fisher Scientific) and antimouse Alexa 594 (Invitrogen). Images were captured at room temperature with a Zeiss confocal system (LSM510) equipped with an Axiovert 100M microscope and an Apochromat × 63/1.4 numerical aperture oil immersion objective. The color balances of the images were adjusted by using Photoshop (Adobe, San Jose, CA).

Live imaging of GFP-MYO-3 (MHC A) nematodes

KAG420 strain synchronized adults were prepared as described above, and immobilized using Pluronic F127 without levamisole as described in Moody et al. (2020). Images of d 1, 4, 8, 12, and 16 were taken using the confocal microscope system described above.

Counting the fraction of cells showing disorganization of A-bands

For each adult stage (d 1, d 4, d 8, etc.), confocal images of MHC A and MHC B staining, and live images of GFP-MYO-3 (MHC A) worms, from six to 12 animals, each containing one to seven (mean = 4) body wall muscle cells near the vulva, were scored for obvious disorganization of A-bands. If any cells had broken, fuzzy, or fat A-bands, that cell was counted as having A-band disorganization. The fraction of cells from each image having A-band disorganization was plotted vs. age with means and standard error of the means (SEM) represented.

Motility crawling assays

Adult worms were collected at different ages using M9 buffer containing 0.2 g/L gelatin. They were transferred to a 1.5 ml microcentrifuge tube, allowed to settle to the bottom, and washed 3X with M9 buffer containing 0.2 g/L gelatin. Five microliters of worm suspension was added to the center of a 6-cm unseeded NGM plate. Worms were allowed to adapt for 5 min before a video recording of their crawling was made using a dissecting stereoscopic microscope fitted with a CMOS camera (Thorlabs). Several 10-s videos were recorded for each sample and analyzed by Image J FIJI WrmTracker software to obtain body bends per second (BBPS).

Quantitative real-time PCR

Worms from two 10-cm NGM plates were collected using M9 buffer and frozen as a dry packed worm pellet. Lysis buffer from the Qiagen RNeasy Plus Mini Kit (catalogue 74134) was added, the sample was freeze-thawed in liquid nitrogen five times to crack the worm cuticle, and then vortexed with MagnaLyser beads (Roche) for 1 min. The samples were centrifuged, and the supernatant was used to extract RNA with the Qiagen RNeasy Plus Mini Kit. The NCBI primer designing tool (www.ncbi.nlm.nih.gov/tools/primer-blast/) was used to create primer pairs specific for each gene of interest that also had at least one intron separating the primer pair (see Supplemental Table S1). One microgram of cDNA was synthesized from the RNA using BioRad iScript Reverse Transcription Supermix (catalogue 1708840). The cDNA was then diluted 1/10 in nuclease free water and 2.5 µL was used per reaction with 10µL of qRT-PCR master mix (1.25 µL of each primer, 1.25 µL of nuclease free water, and 6.25 µl of SybrGreen supermix [Biorad catalogue 1708880]). A BioRad CFX Real-Time PCR thermal cycler was used. Fold change was determined using the 2^ddCt method (Schmittgen and Livak, 2008). gpd-2 mRNA was used for normalization. Supplemental Figure S9 shows that gpd-2 mRNA does not change appreciably from adult d 0 through adult d 16, at least no more than 1.15-fold.

Production and purification of antibodies

The generation of rabbit polyclonal antibodies to the C-terminal 120 residues of UNC-45 was described previously (Moncrief et al., 2021). A 149 residue region (aa 553-702) at the C-terminus of HSP-90 (“HSP-90 antigen”; Figure S10A) was expressed in E. coli as a GST fusion protein and sent to Noble Life Sciences for antibody production in rats. After ∼3 mo, we received the antisera, and affinity purified anti-HSP-90 antibodies by use of an MBP-HSP-90 antigen coupled to Affigel matrix (BioRad), using a procedure previously published (Benian et al., 1993). Both antibodies work well in western blots, detecting a polypeptide of expected size for UNC-45 (107 kDa) and HSP-90 (80 kDa), and no detectable extraneous bands at a 1:5000 or 1:2500 dilution, respectively. In addition, we demonstrated that anti-HSP-90 antibodies detect a protein of expected size of ∼100 kDa from a lysate prepared from animals that express HSP-90-mKate2 (Supplemental Figure S10B).

Western blots and quantitation of protein levels

We used the procedure of Hannak et al. (2002) to prepare total protein lysates from wild-type, age-1(hx546) and GB371 strains. When comparing wild-type and mutant strains, we loaded approximately equal amounts of protein extract estimated by finding volumes of extracts that would give equal intensity of banding after Coomassie staining. We used quantities of extracts and dilutions of antibodies that would place us into the linear range of detection by ECL and exposure to film. The following antibodies and dilutions were used: rabbit anti–UNC-45(Moncrief et al., 2021) at 1:5000; rat anti–HSP-90 at 1:2500; mouse monoclonal 5–8 (Miller et al., 1983) for MHC B at 1:40,000; mouse monoclonal 5–6 ascites (Miller et al., 1983) for MHC A at 1:5000; and rabbit monoclonal anti-HA (Cell Signaling Technology, catalogue no. 3724) at 1:1000. Representative western blot results for each protein/antibody pair used and at each day of adulthood examined, are shown in Supplemental Figure S11 The quantitation of steady-state levels of protein was performed as described in Miller et al. (2009). The relative amount of each of these muscle proteins in each lane was normalized to the amount of Histone H3 detected using anti-Histone H3 (abcam, catalogue. ab1791) at 1:40,000 dilution, or in some cases, simply comparing total protein stained by Ponceau S. The amount of Histone H3 at different ages was compared with Ponceau S staining to ensure no significant changes throughout aging (Supplemental Figure S12). BioRad precast Mini-PROTEAN TGX Stain-Free Gels were used.

Hsp90 and UNC-45B levels in mouse skeletal muscle

Quadriceps muscle samples that had been stored at –80° from 3 and 24 mo old C57BL6 mice, from three separate mice each, of approximate size 1 × 1 × 0.5 cm were cut up into small pieces with a razor blade and added to 400 μl of RIPA Buffer in a 1.5 ml Eppendorf tube, and homogenized using a Pellet Pestle Motor (DWK Life Sciences, Kimble Kontes),vortexed for 30 s and centrifuged at top speed in a microfuge at 4° for 5 min. The supernatant was saved and its protein concentration was determined by a BCA protein assay kit (Pierce, catalogue no. 23225). Twenty-five micrograms of total protein from each sample was mixed with 2X Laemmli sample buffer and separated on two 10% SDS–PAGE gels, transferred to nitrocellulose membranes, and one membrane reacted with a rabbit polyclonal antibody to mouse UNC-45B (Proteintech, catalogue no. 21640-1-AP) at 1:3,000 dilution, and one membrane reacted with a mouse monoclonal antibody to human Hsp90 (Abcam, catalogue no. ab58950) at 1:500 dilution and the bands visualized by ECL. Normalization used total protein in the blot lanes detected by Ponceau S staining.

Phosphorylation detection using Phos-tag gels

GB319 worms, which express UNC-45-mNeonGreen,were collected from two to four 10-cm NGM plates with M9 and frozen at –80°. Five-hundred microliters to one milliliter of IP Buffer (25 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% NP40, 5% glycerol, 1X Halt protease & phosphatase inhibitor cocktail (Thermo Scientific, catalogue no. 78441) was added to each sample. They were then freeze-thawed in liquid nitrogen 3–5X to crack the cuticle, added to MagNA Lyser Green Beads (Roche Diagnostics, catalogue. no. 03358941001), and vortexed for 1 min. The samples were centrifuged, and the lysate supernatant was added to 25 µl of 1:1 mixture magnetic beads coupled to anti-mNeonGreen nanobodies (mNeonGreen-Trap Magnetic Agarose, ChromoTek, catalogue no. ntma-20). They were then incubated with gentle mixing at 4°C for 1 h, washed 3X with IP Buffer, and eluted with 2X Laemmli buffer. The resulting samples were separated on SuperSep phos-tag SDS gels (Fuji Film catalogue nos.198-17981 and 195-17991), and transferred to nitrocellulose membranes per the manufacturer’s instructions. The WIDE-VIEWPrestained Protein Size Marker III (Fuji Film, 230-02461) was used with all SuperSep phos-tag SDS gels. Lambda protein phosphatase (New England BioLabs, P0753S) was used per product instructions. The resulting membranes were incubated with anti-UNC-45, as described above.

Immunoprecipitation of UNC-45-mNeonGreen from d 0 and d 4 adults

To prepare the adult d 0 sample, strain GB319 worms were grown as follows: An “egg prep” (by sodium hypochlorite treatment) was performed on worms grown on 40 10-cm NGM plates seeded with E. coli OP50, and allowed to hatch into L1 larvae on 8 10-cm unseeded NGM plates. The next day, the L1s were transferred to 38 15-cm high-peptone NGM plates seeded with E. coli NA22 (for high density growth), and after ∼2 d were harvested as d 0 adults, yielding ∼4 g of packed worms. These worms were ground into a fine powder in liquid nitrogen using a mortar and pestle on a bed of dry ice, and the powder was stored at –80°.

To prepare the adult d 4 sample, strain GB319 was grown as follows: An “egg prep” was performed on worms grown on 40 10-cm NGM plates seeded with E. coli OP50, and allowed to hatch into L1 larvae on 8 10-cm unseeded NGM plates. The next evening, the L1s were transferred to 40 10-cm NGM plates seeded with OP50, and 39 h later, the resulting L4 larvae, were transferred to 30 15-cm high-peptone NGM plates containing 50 μM FUDR seeded with NA22. Five days later a nearly pure population of d 4 adults were harvested, yielding ∼2 g of packed worms. A worm powder was prepared as described above.

The following method was used to IP UNC-45-mNeonGreen from either d 0 or d 4 adults. The IP Buffer consisted of 50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% NP40, 5% glycerol, 1X Halt protease and phosphatase inhibitor cocktail (Thermo Scientific, catalogue no. 78441), and 1 mM phenylmethylsulfonyl fluoride. Worm powder was added to 1 ml of IP Buffer at a ratio of ∼ 1:10, and then the mixture was vortexed for 1 min, incubated on ice for 2 min, and vortexed again for 1 min. The mixture was centrifuged at top speed in a microfuge at 4° for 10 min, and the supernatant was saved. To the supernatant was added 40 μl of a 1:1 mixture of magnetic beads coupled to anti-mNeonGreen nanobodies (mNeonGreen-Trap Magnetic Agarose, ChromoTek, catalogue no. ntma-20), and gently mixed at 4° for 1 h, 30 min. The beads were then separated out using a magnetic stand, and the beads were washed three times with IP Buffer, and washed 2X with sterile-filtered phosphate-buffered saline (PBS), and finally stored in ∼100 μl of PBS at 4°. To verify IP of UNC-45-mNeonGreen, ∼10% of the beads were eluted with Laemmli sample buffer and run on a SDS–PAGE and stained with Coomassie.

Peptide mapping mass spectrometry

IPd UNC-45-mNeonGreen was run on a 4–20% SDS–PAGE, and the resulting bands were excised and prepared for LC–MS/MS analysis as previously described (Su et al., 2020). Samples were analyzed by nanoLC-MS/MS (nanoRSLC, Thermo Fisher) using an Aurora series (Ion Opticks) reversed phase HPLC column (25 cm length x 75 µm inner diameter) directly injected to an Orbitrap Eclipse using a 120 min gradient (mobile phase A = 0.1% formic acid (Thermo Fisher), mobile phase B = 99.9% acetonitrile with 0.1% formic acid (Thermo Fisher); hold 12% B for 5 min, 2–6% B in 0.1 min, 6–25% in 100 min, 25–50% in 15 min) at a flow rate of 350 nL/min. Eluted peptide ions were analyzed using a data-dependent acquisition (DDA) method with resolution settings of 120,000 and 15,000 (at m/z 200) for MS1 and MS2 scans, respectively. DDA-selected peptides were fragmented using stepped high energy collisional dissociation (20, 30, and 40%). Tandem mass spectra were analyzed according to a label-free proteomic strategy using Proteome Discoverer (version 2.5.0.400, Thermo Fisher) with the Byonic (version 4.1.10, Protein Metrics) and Minora nodes using the unreviewed C. elegans proteome (Uniprot, downloaded 6 May 2021) and the UNC-45-mNeonGreen sequence as a reference FASTA database (Bern et al., 2012; Lin et al., 2018). Mass tolerances of 10 and 20 ppm were used for matching parent and fragment masses, respectively. Mass spectra were searched with a fixed modification of carbamidomethyl (C), and up to two common variable modifications of deamidation (N, Q), oxidation (M), phosphorylation (S, T, and Y), with Wildcard Search enabled, allowing for a mass tolerance of –40 Da to +400 Da. Peptide spectral matches were filtered for quality: PEP2D < 0.01, Byonic score > 100 (Tian et al., 2021).

Transgenic heat shock-induced expression of UNC-45-HA

To create a plasmid for transgenic expression of UNC-45 with HA tag at its C-terminus under the control of a heat shock promoter, three separate cDNA fragments (fragment 1, fragment 2, and fragment 3) of a full length unc-45 cDNA were amplified by using PCR with the following primers and the RB2 cDNA library (a gift from Robert Barstead, Oklahoma Medical Research Foundation):

u45-1: for fragment 1:

GCGCCCGGGATGGTTGCTCGAGTACAGACTG

u45-2: for fragment 1:

CGCGGTACCTTCAGGAATAAATCGATGCAC

u45-3: for fragment 2:

GCGCCCGGGGAGACGTGCATCGATTTATTC

u45-4: for fragment 2:

CGCGGTACCGTTTTACCATTTCCTCGTCGAC

u45-5: for fragment 3:

GCGCCCGGGCATTTGAAAAGCCAAAAGTCGAC

u45-HA-6: for fragment 3:

CGCGGTACCGTTAACTTAAGCGTAATCTGGAACATCGTATGGGTAAGATCCACCAGCGTAATCTGGAACATCGTATGGGTAAGATCCACCAGCGTAATCTGGAACATCGTATGGGTATTCCTGAATGGTGCTCATTTG.

All fragments were cloned into the SmaI and KpnI sites of pBluescript KS+ (pBS-u45 fragment 1, pBS-u45 fragment 2, and pBS-u45 fragment 3) and their sequences were determined to be error-free by Sanger sequencing. To create fragment 1+2, a ClaI / KpnI fragment of pBS-u45 fragment 2 was cloned into the ClaI and KpnI sites of pBS-u45 fragment 1, resulting in pBS-u45 fragment 1+2. To create fragment 1+2+3, a SalI/KpnI fragment of pBS-u45 fragment 3 was cloned into the SalI and KpnI sites of pBS-u45 fragment 1+2, resulting in pBS-u45 fragment 1+2+3. A SmaI/HpaI fragment of pBS-u45 fragment 1+2+3 was cloned into the EcoRV site of pPD49.78 and pPD49.83 (both heat shock promoter plasmids; gifts of Andrew Fire, Stanford University), resulting in plasmids pPD49.78-UNC-45::HA and pPD49.83-UNC-45::HA.

A mixture of pPD49.78-UNC-45::HA, pPD49.83-UNC-45::HA, and pTG96 (sur-5::gfp transformation marker) at ratio of 1: 1: 20 was injected into N2 wild type worms, and screened for GFP+ worms, resulting in GB370 sfEx75 [hsp::UNC-45::HA; sur-5::GFP]. After confirmation of heat shock induced expression by Western blot, sfEx75 was integrated into the genome by ultraviolet irradiation (Mitani, 1995) with some modifications (P. Barrett, personal communication), resulting in strain GB371 (sfIs27 [hsp::UNC-45::HA; sur-5::GFP]).

To perform the heat shock induced overexpression experiment shown in Figure 11, the following method was used: the strain GB371(sfIs27) was chunked onto 16 10-cm NGM plates seeded with OP50, and an egg prep was conducted 3 d later, and the embryos placed onto the four unseeded 10-cm NGM plates and allowed to hatch into L1 overnight. The next evening, these L1s were placed onto 16 10-cm NGM plates seeded with OP50, and ∼39 h later, the L4 and young adults were placed onto 20 10-cm NGM plates containing 50 μM FUDR seeded with OP50. The next morning, the d 0 adults from two plates were collected for immunostaining, and from two plates collected for western blot extracts. When d 2 of adulthood was reached, and for each day afterwards through d 12, the worm plates were heat shocked for 2 h at 30°. Then, on d 4, 8, and 12, the worms from two plates each were collected for immunostaining and for western blot extracts. Western blot quantitation for total UNC-45, using our anti-UNC-45 antibody and MHC B, and immunostaining with anti-MHC A and analysis of A-band number and A-band organization was performed as described above. A similar procedure was used to grow and heat shock wild type animals, and analyze UNC-45 and MHC B levels and A-band numbers and organization, and results are shown in Supplemental Figure S8.

Molecular dynamics simulations

Molecular dynamics simulation was implemented in AMBER20 (Case et al., 2005; 2023). Coulombic forces were restricted using the switching function from 10 Å to a cutoff at 12 Å. The FF99SB force field was used throughout the simulations. The C. elegans UCS domain (4I2Z.pdb) was solvated in a water sphere with a boundary of 15 Å. The system was charge neutralized by adding Na+ and Cl− ions. The total ionic strength of the system corresponded to a final concentration of 0.1 M. The simulations contained a total of 13762 atoms. The system was then minimized with 1000 steps of conjugate gradient minimization from an initial temperature of 310 K. This step was followed by a 400 ps MD simulation to equilibrate the entire system (protein, water, and ions).

Statistics

GraphPad Prism9 was used to plot and analyze data. For most cases, data are plotted with means ± SEM, or in a few cases, standard deviations. An unpaired student’s t test with Welch’s correction was applied to determine statistical significance. For data with more extreme variance (Figures 1G, 11E; Supplemental Figures S2G and S8E), data are plotted with medians and 95% confidence intervals, and statistical significance was tested using the nonparametric Mann-Whitney test.

Data Availability Statement

All data generated during this study are included in the figures and supplemental figures. Any materials, such as antibodies or nematode strains generated during this study, are available from the corresponding author upon request.

Supplementary Material

This work was supported in-part by National Institutes of Health grant R01GM118534 to G.M.B. and A.F.O., and also supported in-part by the Emory Initiative Biological Discovery Through Chemical Innovation (BDCI) to G.M.B. Many of the nematode strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health Office of Research Infrastructure Programs (P40 OD010440). The Mass Spectrometry Facility at UTMB is supported in part by Cancer Prevention Research Institute of Texas (CPRIT) grant number RP190682. Monoclonal culture supernatants for five to six and five to eight antibodies were obtained from the University of Iowa Hybridoma Bank, and the five to six ascites fluids were kindly provided by Henry F. Epstein (deceased). We also thank Robert Barstead (Oklahoma Medical Research Foundation) for the cDNA library RB2; Andrew Fire (Stanford University) for the heat shock promoter vectors pPD49.78 and pPD49.83; and Kathrin Gieseler (Universite Claude Bernard Lyon, France) for worm strain KAG420.

Abbreviations used:

d day

GFP green fluorescent protein

h hour

HA hemagglutinin epitope tag

IP immunoprecipitation or immunoprecipitate

Reviewer Report

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E23-12-0488) on May 29, 2024.
==== Refs
REFERENCES

Altun MBesche HCOverkleeft HSPiccirillo REdelmann MJKessler BMGoldberg ALUlfhake B (2010). Muscle wasting in aged, sarcopenic rats is associated with enhanced activity of the ubiquitin proteasome pathway. J Biol Chem 285 , 39597–39608.20940294
Ao WPilgrim D (2000). Caenorhabditis elegans UNC-45 is a component of muscle thick filaments and colocalizes with myosin heavy chain B, but not myosin heavy chain A. J Cell Biol 148 , 375–384.10648570
Ayyadevara SAlla RThaden JJShmookler Reis RJ (2008). Remarkable longevity and stress resistance of nematode PI3K-null mutants. Aging Cell 7 , 13–22.17996009
Barbosa-Silva TGBielemann RMGonzalez MCMenezes AM (2016). Prevalence of sarcopenia among community-dwelling elderly of a medium-sized South American city: results of the COMO VAI? study J Cach, Sarcopenia & Muscle 7 , 136–143.
Barral JMBauer CCOrtiz IEpstein HF (1998). Unc-45 mutations in Caenorhabditis elegans implicate a CRO1/She4p-like domain in myosin assembly. J Cell Biol 143 , 1215–1225.9832550
Barral JMHutagalung AHBrinker AHartl FUEpstein HF (2002). Role of the myosin assembly protein UNC-45 as a molecular chaperone for myosin. Science 295 , 669–671.11809970
Bazzaro MSantillan ALin ZTang TLee MKBristow REShih Ie MRoden RB (2007). Myosin II co-chaperone general cell UNC-45 overexpression is associated with ovarian cancer, rapid proliferation, and motility. Am J Path 171 , 1640–1649.17872978
Benian GML’Hernault SWMorris ME (1993). Additional sequence complexity in the muscle gene, unc-22, and its encoded protein, twitchin, of Caenorhabditis elegans. Genetics 134 , 1097–1104.8397135
Bern MKil YJBecker C (2012). Byonic: advanced peptide and protein identification software. Curr Protoc Bioinform Chapter 13 , Unit13.20, 10.1002/0471250953.bi1320s40.
Bernick EPZhang PJDu S (2010). Knockdown and overexpression of Unc-45b result in defective myofibril organization in skeletal muscles of zebrafish embryos. BMC Cell Biol 11 , 70. 10.1186/1471-2121-11-70.20849610
Blom NGammeltoft SBrunak S (1999). Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294 , 1351–1362.10600390
Borsch AHam DJMittal NTintignac LAMigliavacca EFeige JNRuegg MAZavolan M (2021). Molecular and phenotypic analysis of rodent models reveals conserved and species-specific modulators of human sarcopenia. Comm Biol 4 , 194.
Brenner S (1974). The genetics of Caenorhabditis elegans. Genetics 77 , 71–94.4366476
Bujalowski PJNicholls PGarza EOberhauser AF (2018). The central domain of UNC-45 chaperone inhibits the myosin power stroke. FEBS Open Bio 8 , 41–48.
Candow DG (2011). Sarcopenia: current theories and the potential beneficial effect of creatine application strategies. Biogeron 12 , 273–281.
Case DAAktulga HMBelfon KCerutti DSCisneros GACruzeiro VWDForouzesh NGiese TJGotz AWGohlke H, et al. (2023). AmberTools J Chem Inf Model 63 , 6183–6191.37805934
Case DACheatham TE, 3rdDarden TGohlke HLuo RMerz KM, Jr.Onufriev ASimmerling CWang BWoods RJ (2005). The Amber biomolecular simulation programs. J Comput Chem 26 , 1668–1688.16200636
Celis-Morales CAWelsh PLyall DMSteell LPetermann FAnderson JIliodromiti SSillars AGraham NMackay DF, et al. (2018). Associations of grip strength with cardiovascular, respiratory, and cancer outcomes and all-cause mortality: prospective cohort study of half a million UK Biobank participants. BMJ (Clinical research ed.) 361 , k1651, https://doi.org/ 10.1136/bmj.k1651.29739772
Chen MZhang WGou YXu DWei YLiu DHan CHuang XLi CNing W, et al. (2023). GPS 6.0: an updated server for prediction of kinase-specific phosphorylation sites in proteins. Nuc Acids Res 51 , W243–W250.
Cruz-Jentoft AJLandi FSchneider SMZuniga CArai HBoirie YChen LKFielding RAMartin FCMichel JP, et al. (2014). Prevalence of and interventions for sarcopenia in ageing adults: a systematic review. Report of the International Sarcopenia Initiative (EWGSOP and IWGS). Age & Aging 43 , 748–759.
Duhon SAJohnson TE (1995). Movement as an index of vitality: comparing wild type and the age-1 mutant of Caenorhabditis elegans. J Geron Series A 50 , B254–B261.
Epstein HFThomson JN (1974). Temperature-sensitive mutation affecting myofilament assembly in Caenorhabditis elegans. Nature 250 , 579–580.4845659
Esteve CFrancescatto LTan PLBourchany ADe Leusse CMarinier EBlanchard ABourgeois PBrochier-Armanet CBruel AL, et al. (2018). Loss-of-Function Mutations in UNC45A Cause a Syndrome Associating Cholestasis, Diarrhea, Impaired Hearing, and Bone Fragility. Amer J Hum Gen 102 , 364–374.
Etard CRoostalu UStrahle U (2008). Shuttling of the chaperones Unc45b and Hsp90a between the A band and the Z line of the myofibril. J Cell Biol 180 , 1163–1175.18347070
Gaffney CJPollard ABarratt TFConstantin-Teodosiu DGreenhaff PLSzewczyk NJ (2018). Greater loss of mitochondrial function with ageing is associated with earlier onset of sarcopenia in C. elegans. Aging 10 , 3382–3396.30455409
Gazda LPokrzywa WHellerschmied DLowe TForne IMueller-Planitz FHoppe TClausen T (2013). The myosin chaperone UNC-45 is organized in tandem modules to support myofilament formation in C. elegans. Cell 152 , 183–195.23332754
Gieseler KQadota HBenian GM (2017). Development, structure, and maintenance of C. elegans body wall muscle. WormBook: the online review of C. elegans biology 2017 , 1–59. 10.1895/wormbook.1.81.2.
Gosselin LEJohnson BDSieck GC (1994). Age-related changes in diaphragm muscle contractile properties and myosin heavy chain isoforms. Amer J Resp & Crit Care Med 150 , 174–178.8025746
Hannak EOegema KKirkham MGönczy PHabermann BHyman AA (2002). The kinetically dominant assembly pathway for centrosomal asters in Caenorhabditis elegans is gamma-tubulin dependent. J Cell Biol 157 , 591–602.12011109
Hansen LComyn SMang YLind-Thomsen AMyhre LJean FEiberg HTommerup NRosenberg TPilgrim D (2014). The myosin chaperone UNC45B is involved in lens development and autosomal dominant juvenile cataract. Eur J Hum Gen 22 , 1290–1297.
Henderson CAGomez CGNovak SMMi-Mi LGregorio CC (2017). Overview of the Muscle Cytoskeleton. Comp Physiol 7 , 891–944.
Herndon LASchmeissner PJDudaronek JMBrown PAListner KMSakano YPaupard MCHall DHDriscoll M (2002). Stochastic and genetic factors influence tissue-specific decline in ageing C. elegans. Nature 419 , 808–814.12397350
Higashitani ATeranishi MNakagawa YItoh YSudevan SSzewczyk NJKudota YAbe TKobayashi T (2023). Increased mitochondrial Ca2+ contributes to health decline with age and Duchenne muscular dystrophy in C. elegans. FASEB J 37 , e22851.36935171
Hoppe TCassata GBarral JMSpringer WHutagalung AHEpstein HFBaumeister R (2004). Regulation of the myosin-directed chaperone UNC-45 by a novel E3/E4-multiubiquitylation complex in C. elegans. Cell 118 , 337–349.15294159
Iannuzzi-Sucich MPrestwood KMKenny AM (2002). Prevalence of sarcopenia and predictors of skeletal muscle mass in healthy, older men and women. J Gerontol A Biol Sci Med Sci 57 , M772–M777. 12456735
Janiesch PCKim JMouysset JBarikbin RLochmuller HCassata GKrause SHoppe T (2007). The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy. Nat Cell Biol 9 , 379–390.17369820
Jiang RWestwater MLNoble SRosenblatt MDai WQi SSui JCalhoun VDScheinost D (2022). Association between grip strength, brain structure, and mental health in >40,000 participants from the UK Biobank. BMC Medicine 20 , 286.36076200
Kachur TMPilgrim DB (2008). Myosin assembly, maintenance and degradation in muscle: Role of the chaperone UNC-45 in myosin thick filament dynamics. Int J Mol Sci 9 , 1863–1875.19325835
Kenyon CChang JGensch ERudner ATabtiang R (1993). A C. elegans mutant that lives twice as long as wild type. Nature 366 , 461–464.8247153
Kenyon CJ (2010). The genetics of ageing. Nature 464 , 504–512.20336132
Klass MR (1983). A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results. Mech Aging & Develop 22 , 279–286.
Kwan P (2013). Sarcopenia, a neurogenic syndrome? J Aging Res 2013 , 791679.23577254
Landsverk MLLi SHutagalung AHNajafov AHoppe TBarral JMEpstein HF (2007). The UNC-45 chaperone mediates sarcomere assembly through myosin degradation in Caenorhabditis elegans. J Cell Biol 177 , 205–210.17438072
Li MOgilvie HOchala JArtemenko KIwamoto HYagi NBergquist JLarsson L (2015). Aberrant post-translational modifications compromise human myosin motor function in old age. Aging Cell 14 , 228–235.25645586
Lin YHFranc VHeck AJR (2018). Similar Albeit Not the Same: In-Depth Analysis of Proteoforms of Human Serum, Bovine Serum, and Recombinant Human Fetuin. J Proteome Res 17 , 2861–2869.29966421
Lowe DASurek JTThomas DDThompson LV (2001). Electron paramagnetic resonance reveals age-related myosin structural changes in rat skeletal muscle fibers. Am J Physiol Cell Physiol 280 , C540–C547 11171573
Marino Perez LIelasi FSBessa LMMaurin DKragelj JBlackledge MSalvi NBouvignies GPalencia AJensen MR (2022). Visualizing protein breathing motions associated with aromatic ring flipping. Nature 602 , 695–700.35173330
Melkani GCBodmer ROcorr KBernstein SI (2011). The UNC-45 chaperone is critical for establishing myosin-based myofibrillar organization and cardiac contractility in the Drosophila heart model. PloS One 6 , e22579.21799905
Miller DM, 3rdOrtiz IBerliner GCEpstein HF (1983). Differential localization of two myosins within nematode thick filaments. Cell 34 , 477–490.6352051
Miller RKQadota HStark TJMercer KBWortham TSAnyanful ABenian GM (2009). CSN-5, a component of the COP9 signalosome complex, regulates the levels of UNC-96 and UNC-98, two components of M-lines in Caenorhabditis elegans muscle. Mol Biol Cell 20 , 3608–3616.19535455
Mitani S (1995). Genetic regulation of mec-3 gene expression implicated in the specification of the mechanosensory neuron cell types in C elegans. Dev Growth Differ 37 , 551–557.37281420
Moncrief TMatheny CJGaziova IMiller JMQadota HBenian GMOberhauser AF (2021). Mutations in conserved residues of the myosin chaperone UNC-45 result in both reduced stability and chaperoning activity. Prot Sci 30 , 2221–2232.
Moody JCQadota HReedy AROkafor CDShanmugan NMatsunaga YChristian CJOrtlund EABenian GM (2020). The Rho-GEF PIX-1 directs assembly or stability of lateral attachment structures between muscle cells. Nature Commun 11 , 5010.33024114
Nonet MLGrundahl KMeyer BJRand JB (1993). Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73 , 1291–1305.8391930
Pearlman SMSerber ZFerrell JE, Jr. (2011). A mechanism for the evolution of phosphorylation sites. Cell 147 , 934–946.22078888
Perez-Mejias GVelazquez-Cruz AGuerra-Castellano ABanos-Jaime BDiaz-Quintana AGonzalez-Arzola KAngel De la Rosa MDiaz-Moreno I (2020). Exploring protein phosphorylation by combining computational approaches and biochemical methods. Comput Struct Biotechnol J 18 , 1852–1863.32728408
Prochniewicz EThompson LVThomas DD (2007). Age-related decline in actomyosin structure and function. Exp Gerontol 42 , 931–938.17706387
Qadota HMercer KBMiller RKKaibuchi KBenian GM (2007). Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell 18 , 4317–4326.17761533
Rennie MJSmith KWatt PW (1994). Measurement of human tissue protein synthesis: an optimal approach. Am J Physiol 266 , E298–E307.8166250
Schmittgen TDLivak KJ (2008). Analyzing real-time PCR data by the comparative C(T) method. Nature Protoc 3 , 1101–1108.18546601
Shmookler Reis RJAyyadevara SCrow WALee TDelongchamp RR (2012). Gene categories differentially expressed in C. elegans age-1 mutants of extraordinary longevity: new insights from novel data-mining procedures. J Geron Series A 67 , 366–375.
Solomon VGoldberg AL (1996). Importance of the ATP-ubiquitin-proteasome pathway in the degradation of soluble and myofibrillar proteins in rabbit muscle extracts. J Biol Chem 271 , 26690–26697.8900146
Squire JMPaul DMMorris EP (2017). Myosin and Actin Filaments in Muscle: Structures and Interactions. Sub-cell. Biochem 82 , 319–371.
Statistics, Federal Interagency Forum on Aging-Related Statistics (2012). Older Americans 2012: Key Indicators of Well-Being. ed. KK Wallman, Washington, DC: U.S. Government Printing Office.
Su ZChang QDrelich AShelite TJudy BLiu YXiao JZhou CHe XJin Y, et al. (2020). Annexin A2 depletion exacerbates the intracerebral microhemorrhage induced by acute rickettsia and Ebola virus infections. PLoS Negl Trop Dis 14 , e0007960.32687500
Szulc PFeyt CChapurlat R (2016). High risk of fall, poor physical function, and low grip strength in men with fracture-the STRAMBO study. J Cach Sarcopenia & Musc 7 , 299–311.
Thorsness PEKoshland DE, Jr. (1987). Inactivation of isocitrate dehydrogenase by phosphorylation is mediated by the negative charge of the phosphate. J Biol Chem 262 , 10422–10425.3112144
Tian YParsons LMJankowska ECipollo JF (2021). Site-Specific Glycosylation Patterns of the SARS-CoV-2 Spike Protein Derived From Recombinant Protein and Viral WA1 and D614G Strains. Fron Chem 9 , 767448.
Venolia LAo WKim SKim CPilgrim D (1999). unc-45 gene of C. elegans encodes a muscle-specific tetratricopeptide repeat-containing protein. Cell Motil Cytoskeleton 42 , 163–177.10098931
Venolia LWaterston RH (1990). The unc-45 gene of Caenorhabditis elegans is an essential muscle-affecting gene with maternal expression. Genetics 126 , 345–353.2245914
Vintila ARSlade LCooke MWillis CRGTorregrossa RRahman MAnupam TVanapalli SAGaffney CJGharahdaghi N, et al. (2023). Mitochondrial sulfide promotes life span and health span through distinct mechanisms in developing versus adult treated C. elegans. Proc Natl Acad Sci USA 120 , e2216141120.37523525
Walker GAWhite TMMcColl GJenkins NLBabich SCandido EPJohnson TELithgow GJ (2001). Heat shock protein accumulation is upregulated in a long-lived mutant of Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 56 , B281–B287.11445592
Welle SBhatt KThornton C (1996). Polyadenylated RNA, actin mRNA, and myosin heavy chain mRNA in young and old human skeletal muscle. Amer J Physiol 270 , E224–E229.8779942
Wilson KJQadota HBenian GM (2012). Immunofluorescent localization of proteins in Caenorhabditis elegans muscle. Methods Mol Biol 798 , 171–181.22130837
Wohlgemuth SLCrawford BDPilgrim DB (2007). The myosin co-chaperone UNC-45 is required for skeletal and cardiac muscle function in zebrafish. Develop Biol 303 , 483–492.17189627
Zembron-Lacny ADziubek WRogowski LSkorupka EDabrowska G (2014). Sarcopenia: monitoring, molecular mechanisms, and physical intervention. Physiol Res 63 , 683–691.25157651
