
==== Front
BMC Microbiol
BMC Microbiol
BMC Microbiology
1471-2180
BioMed Central London

39271999
3472
10.1186/s12866-024-03472-5
Research
Distribution of chaperone-usher fimbriae and curli fimbriae among uropathogenic Escherichia coli
Golpasand Taha
Keshvari Mohammad
Behzadi Payam behzadipayam@yahoo.com
p.behzadi@qodsiau.ac.ir

grid.411463.5 0000 0001 0706 2472 Department of Microbiology, Shahr-E-Qods Branch, Islamic Azad University, Tehran, 37541-374 Iran
14 9 2024
14 9 2024
2024
24 3448 5 2024
21 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

In the present study, we aimed to determine the frequency of the csgA, fimH, mrkD, foc, papaGI, papGII and papGIII genes, to provide and to design fimbrial adhesin gene (FAG) patterns and profiles for the isolated uropathogenic Escherichia coli (UPEC) strains.

Methods

The enrollment of 108 positive urine samples was performed during seven months, between January 2022 and July 2022. The UPEC strains were confirmed through the standard microbiological and biochemical tests. The antimicrobial susceptibility test was performed through the Kirby–Bauer disc diffusion method. Molecular screening of FAGs was done through the polymerase chain reaction technology. The statistical analyses including chi square and Fisher’s exact tests were performed to interpret the obtained results in the present study.

Results

As the main results, the antimicrobial resistance (AMR) patterns,

multi- (MDR) and extensively drug-resistance (XDR) patterns and FAG patterns were designed and provided. fimH (93.3%), csgA (90.4%) and papG (37.5%) (papGII (30.8%)) genes were recognized as the top three FAGs, respectively. Moreover, the frequency of csgA-fimH gene profile was identified as the top FAG pattern (46.2%) among the others. The isolates bearing csgA-fimH gene profile were armed with a versatile of phenotypic AMR patterns. In the current study, 27.8%, 69.4% and 1.9% of the UPEC isolates were detected as extended-spectrum ß-lactamases (ESBLs) producers, MDR and XDR strains, respectively.

Conclusions

In conclusion, detection, providing and designing of patterns and profiles in association with FAGs, AMR feature in UPEC strains give us an effective option to have a successful and influential prevention for both of UTIs initiation and AMR feature.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-024-03472-5.

Keywords

Uropathogenic Escherichia coli
Urinary tract infections
Fimbrial adhesins
Virulence genes
Antimicrobial drug resistance
Multidrug resistance
Extensively drug resistance
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Indeed, the urinary tract infections (UTIs) are known as one of the most important infectious diseases, worldwide. In addition, the UTIs are common among both men and women with different age range. Up to date, uropathogenic Escherichia coli (UPEC) and Klebsiella pneumoniae are recognized as the most important Gram-negative bacterial agents of UTIs [1–7]. The pan-genomic plasticity in bacterial strains of E. coli makes them armed with a wide arsenal of virulence genes (VGs) (e.g., adhesins, siderophores, toxins, etc.) and antibiotic resistance genes (ARGs) to have a successful attachment, colonization, biofilm formation, invasion and dissemination within the human host body [6, 8–10]. Thus, bacterial fimbriae and the related fimbrial adhesins in UPEC strains including curli and chaperone-usher fimbriae are effective virulence factors (VFs) which play pivotal role in initiation of bacterial pathogenesis in association with UTIs through adhesion [6, 9–12]. The amyloid fiber of curli, contributes to bacterial attachment and colonization and this organelle supports the bacterial cells to form strong biofilms. A strong biofilm covers its constructive bacterial cells from death and devastation in exposure to antibiotics; hence, the bacterial cells within a biofilm structure will be changed into resistant cells to antibiotics which leads to appearance of drug-resistant strains [9, 10, 13, 14]. CsgA amyloids act as curli fimbrial major subunit. This extracellular matrix component (CsgA) makes the bacterial cells resistant to antibiotics within the biofilm [13]. Curli fimbriae which are produced through the Curli pathway, participate in all types of UTIs [10]. On the other hand, there are several adhesive fimbriae (including Type 1, Type 3, F1C and P fimbriae) which are produced via the Chaperone-Usher (CU) fimbrial pathway. These adhesive fibers are known as CU fimbriae and are recognized as effective VFs that support UPEC bacterial cells to have successful attachment, colonization, biofilm formation, dissemination and invasion in human host’s urinary system to initiate different types of UTIs pathogenesis [2, 6, 9, 10]. Type 1 fibers are known as effective CU fibers which contribute to invasion, adhesion, colonization and biofilm formation of UPEC bacterial cells upon the human host’s urothelial cells by the adhesin subunit of FimH. The painful signs of UTIs like dysuria is the result of induced inflammatory responses by the attachment of FimH to the huma host’s urothelial receptors. Type 1 fimbriae are common between UPEC and K. pneumonia strains [6, 9, 15–18]. Type 3 fibers which belong to CU fimbriae are involved in adhesion, colonization and biofilm formation of UPEC and K. pneumonia bacterial cells upon the biotic surface like human host’s urothelial cells and abiotic surfaces like urinary catheters which may lead to catheter-associated UTIs (CAUTIs). The bacterial cells’ attachment to abiotic and biotic surfaces is achieved via the fimbrial adhesin subunit of MrkD. Type 3 fimbriae are normally involved in CAUTIs; however, they can be involved in non-CAUTIs, too [6, 9, 10, 16, 18–20]. F1C as another CU fibers are detectable among 30% of the UPCE pathotypes. it seems that F1C fimbriae have cross-talk with type 1 and P fibers. FocH as the adhesin subunit of F1C fiber is involved in bacterial adhesion, colonization and biofilm formation. Although F1C fibers participate in different types of UTIs, they have strong role in cystitis, pyelonephritis and renal failure in association with UTIs [6, 9, 10, 16, 21, 22]. P fibers via their PapG adhesins, contribute to bacterial adhesion upon the urothelial cells and are involved in all types of UTIs pathogenesis. Up to date, four different variants have been detected for PapG subunits including PapGI, PapGII, PapGIII and PapGIV [6, 9–11, 23]. PapGI has a pale role in UTIs pathogenesis and the related clinical syndromes while, PapGII is related to pyelonephritis (both in adult females and children), acute prostatitis (in males) and invasive infections which may lead to bacteremia in patients with UTIs [6, 9–11, 23]. PapGIII is associated with cystitis both in adults and children while the role and frequency of PapGIV has not been clearly, recorded [11, 24]. In accordance with the aforementioned background, the fimbrial adhesins are considered as bifunctional arsenal for UPEC strains which act as both of VFs and antimicrobial resistant factors (AMRFs). As the raise of antimicrobial resistance (AMR) feature is a global concern, detection and designing of fimbrial adhesin gene (FAG) patterns and profiles together with the AMR-, multi- and extensively drug-resistance patterns and profiles may inspire us to change our treatment procedures rather than the use of antibiotics. In recent years, our global colleagues are trying to provide effective agonists to prevent both of initiation of UTIs and promotion of AMR feature. Thus, in the current investigation the authors aimed to find out the prevalence of FAGs and to provide and to design FAG patterns and profiles, phenotypic AMR patterns and profiles, phenotypic MDR and XDR patterns and profiles for the UPEC isolates. This investigation would be an effective resource for scientists who work in the field of agonists to prevent the initiation of UTIs and to replace them instead of antibiotics and drugs.

Materials and methods

Sample collection

The enrollment of clinical samples of midstream (clean-catch) urines for UPEC in this cross-sectional study was performed from four different labs and hospital during seven months, between January 2022 and July 2022. Because of COVID-19 infection concerns, we requested the laboratories’ technicians and experts not to collect the positive urine samples for UPEC from patients with COVID-19 infection. The anonymous positive urine samples were belonged to 108 in- and out-patients. Only positive cases of urine samples (≥ 105 colony forming units (CFUs)/mL) which were confirmed by the laboratories’ technicians and experts were obtained by the authors. Patients with COVID-19 infection were recognized as exclusion criterion and non-COVID-19 patients with UTIs (≥ 105 colony forming units (CFUs)/mL) were recognized as inclusion criterion. Neither patients nor their information excluding their age range and gender were accessible to us. As everything was anonymous to us, we have no data about the clinical signs and symptoms of the patients and their destinies. Since, all materials excluding the age range and the gender of the patients were anonymous to us and the confirmed positive urine samples were enrolled by the Labs’ and hospital’s technicians and experts no ethical approval was needed for this project. This study was achieved according to the Declaration of Helsinki guidelines. This scientific investigation has been performed under the permission number of DP/97/220 (97/12/12), issued by the Research Council of the Islamic Azad University, Shahr-e-Qods Branch.

Bacterial identification

MacConkey agar (Quelab, Quebec), EMB agar (IBRESCO, Italy) (to obtain typical green metallic colonies of UPEC cells) and blood agar (IBRESCO, Italy) (to enrich bacterial growth) were used to inoculate the specimens. Then, they were incubated at 37 °C during 24 h. In follow, the well-grown bacterial colonies of UPEC were confirmed through the standard microbiological and biochemical tests e.g., Gram staining, SIM, TSI, IMViC (IBRESCO, Italy) and urease hydrolysis (Merck, Germany) [18, 25]. In continue, the Luria–Bertani (LB) culture medium (IBRESCO, Italy) was used to be inoculated by the confirmed bacterial isolates of UPEC. Then, the inoculated culture media were incubated at 37 °C during 24 h. Finally, the well-grown bacterial colonies of UPEC isolates were employed for antimicrobial susceptibility test (AST) and DNA extraction procedures [18, 26].

Antimicrobial susceptibility test (AST)

In the present study, the AST was run on Mueller–Hinton agar (IBRESCO, Italy) in accordance with Kirby–Bauer disc diffusion method [27]. Due to this fact, 14 mono antibiotic discs (Padtan-Teb, Iran) including of aminoglycosides (Amikacin (AN).

(30 μg/disc), Kanamycin (K) (30 μg/disc), Gentamicin (G) (10 μg/disc)), penicillins (Ampicillin (10 μg/disc)), glycols (Chloramphenicol (30 μg /disc)), organophosphonates (Fosfomycin (Phosphomycin) (FOS) (200 μg/disc)), carbapenems (Imipenem (IPM) (10 μg/disc)), tetracyclines (Tetracycline (TE).

(30 μg/disc), nitrofurans (Nitrofurantoin (NFT) (300 μg/disc)), sulfonamides (Trimethoprim-Sulfamethoxazole (Co-trimoxazole) (SXT) (1.25/23.75 μg/disc), fluoroquinolones (Ciprofloxacin (CIP) (5 μg /disc)), cephalosporins (Cefepime (FEP) (30 μg/disc), Ceftazidime (CAZ) (30 μg/disc), Cefotaxime (CTX) (30 μg/disc)) were recruited. The bacterial strain of E. coli ATCC 25922 was employed as the negative control. As Table 2 shows, the AST results were interpreted according to CLSI 2021 [27].

Extended-spectrum beta-lactamases (ESBL) phenotypic detection test

Moreover, the ESBL phenotypic detection test [27] was performed for those isolates which were resistant to one of the cephalosporins such as FEP, CAZ or CTX in AST. In this regard, three combined ß-lactam-ß-lactamase inhibitor discs (Padtan-Teb, Iran) comprising Cefepime + Clavulanate (FEC) (30 μg + 10 μg/disc), Ceftazidime + Clavulanate (CZC) (30 μg + 10 μg/disc) and Cefotaxime + Clavulanate (CTC) (30 μg + 10 μg/disc) were used. I1 was presumed as the diameter of inhibition zone for mono cephalosporin disc and I2 was presumed as the diameter of inhibition zone for combined ß-lactam-ß-lactamase inhibitor disc, then the I2-I1 ≥ 5 mm was recognized as ESBL positive isolate. The bacterial strain of E. coli ATCC 25922 was employed as the negative control. In addition, the Multidrug-resistance (MDR) isolates (nonsusceptibility to ≥ 1 agent in ≥ 3 antimicrobial categories); the Extensively drug-resistant (XDR) isolates (susceptibility limited to ≤ 2 antimicrobial categories); and the Pan drug-resistance (PDR) isolates (nonsusceptibility to entire agents in association with all the antimicrobial categories) were screened in the present study [28, 29].

DNA extraction and polymerase chain reaction

In the present study, the bacterial DNA templates pertaining to 108 clinical UPEC strains were harvested through the boiling method. For this purpose, the well-grown colonies of UPEC isolates on LB agar were suspended within 100 μl RNase- and DNase free double distilled water (ddw). Then, each suspension was boiled (within the water bath) for 10 min. In follow, the boiled suspension was centrifuged at 13,000 rpm for another 10 min. The obtained supernatant, contained harvested DNA templates. The purity and quality of extracted DNA templates were evaluated through NanoDrop™ spectrophotometer. The harvested genomic DNA were kept.

at -20 °C [5, 18, 25, 26]. Then, further molecular procedures were done.

Molecular screening of CU and curli fimbriae genes via PCR technology

In the present study, seven FAGs in association with five fimbriae including curli fimbriae which are known as non-CUF and four CUF involving type 1, type 3, F1C and P fimbriae. In this regard, the applied primers and the related PCR thermal profile are indicated in Table 1. Table 1 A list of target genes, employed PCR primers and PCR thermal profile

Fimbrial type	Target genes	Primers sequences (5’ to 3’)	Product size (bp)	PCR thermal profile (30 cycles)	References	
Denaturation (°C)	Annealing (°C)	Extension (°C)	
Curli fimbriae	csgA	F: GTAGCAGCAATTGCAGCAATCG

R: TTAGATGCAGTCTGGTCAACAG

	383	94

60S

	55

60S

	72

120S

	[30, 31]	
CUF	Type 1 fimbriae	fimH	F: CATTCGCCTGTAAAACCGCC

R: ATAACACGCCGCCATAAGCC

	207	94

60S

	50

60S

	72

60S

	[32]	
Type 3 fimbriae	mrkD	F: CTGACGCTTTTTATTGGCTTAATGGCGC

R: GATGATTTGCTTTTCTGGCCTTTAAGACG

	757	94

30S

	58

30S

	72

60S

	[18]	
F1C fimbriae	foc	F: GGTGGAACCGCAGAAAATAC

R: GAACTGTTGGGGAAAGAGTG

	388	94

60S

	55

60S

	72

120S

	[31–33]	
P fimbriae	papGI	F: TCGTGCTCAGGTCCGGAATTT

R: TGGCATCCCCCAACATTATCG

	461	94

60S

	68

120S

	72

180S

	[32, 34]	
papGII	F: GGGATGAGCGGGCCTTTGAT

R: CGGGCCCCCAAGTAACTCG

	190	
papGIII	F: GGCCTGCAATGGATTTACCTGG

R: CCACCAAATGACCATGCCAGAC

	258	

In the present study, the monoplex PCR was recruited for the target genes of csgA, fimH, mrkD, and foc, separately. The PCR cocktail with a final volume of 25 μL was prepared by adding 12.5 μL Master Mix (2 ×) (Tris- HCl; pH = 8.5, 3 mM MgCl2),

3 μL template DNA, 1 μL primers (0.5 μL F, 0.5 μL R) (csgA: 0.2 μM) and 8.5 μL sterile DNase/RNase free distilled water, for each target gene. This procedure was done for fimH, mrkD, and foc with the similar protocol. The PCR cycling program was run in accordance with the PCR thermal profile in Table 1.

As aforementioned, the multiplex PCR was employed for the target genes of papG alleles including papGI, papGII and papGIII. Due to this knowledge, The PCR cocktail with a final volume of 25 μL was prepared by adding 12.5 μL Master Mix (2 ×) (Tris- HCl; pH = 8.5, 3 mM MgCl2), 3 μL template DNA, 1 μL primers (0.5 μL F, 0.5 μL R/per each primer) (papGI: 0.2 μM, papGII: 0.2 μM, papGIII: 0.2 μM) and 6.5 μL sterile DNase/RNase free distilled water. The PCR cycling program was done in accordance with Table 4. Next after, the obtained PCR products were run on 1% agarose gel electrophoresis. Ethidium bromide was used as the fluorochrome. The characteristics of genes, fibers and fimbrial subunits are shown in Supplementary Table 1.

Statistical analysis

The obtained results have been described in the format of descriptive statistics in association with the related frequency. Also, the values have been indicated in the form of percentages of the variables [5]. Moreover, the Chi square (χ2) test and Fisher’s exact test were recruited in present study. A P-value of < 0.05 was considered as statistically significant. The statistical analyses were calculated through both of SPSS version 26 software tool and the https://www.icalcu.com/ website.

Results

The age range and the gender of the patients with UTIs

In the current investigation, 108 UPEC strains were isolated from 96 (88.9%) female patients with UTIs and 12 (11.1%) male patients with UTIs. The age range of the patients was between 0 (infants) and 100 years old (Fig. 1).Fig. 1 X- and Y axes show the percentages and the age range of the patients with UTIs, respectively. The highest number of patients (n = 23 (19 females and 4 males) (21.3%)) belongs to the age range of 51–60 while, the lowest one (n = 1 (female) (0.9%)) belongs to the age range of 91–100. The others were 0–10 (n = 8 (7 females and 1 male) (7.4%)), 11–20 (n = 6 (females) (5.6%)), 21–30 (n = 10 (females) (9.3%)), 31–40 (n = 18 (17 females and 1 male) (16.7%)), 41–50 (n = 21 (females) (19.4%)), 61–70 (n = 10 (7 females and 3 males) (9.3%)), 71–80 (n = 9 (7 females and 2 males) (8.3%)) and 81–90 (n = 2 (1 female and 1 male) (1.9%))

Antimicrobial resistance patterns

The results obtained from AST are shown in Table 2. As Table 2 shows, the first three most influential antibiotics in association with 108 UPEC isolates were nitrofurantoin (93.5%) (with no significant statistical correlation (P > 0.05) between antibiotic susceptibility and gender), chloramphenicol (90.7%) (with no significant statistical correlation (P > 0.05) between antibiotic susceptibility and gender) and gentamicin (88.9%) (with significant statistical correlation (P < 0.05) between antibiotic susceptibility and gender), respectively; while the first three most uninfluential antibiotics were respectively as ampicillin (80.6%) (with no significant statistical correlation (P > 0.05) between antibiotic resistance and gender), fosfomycin (64.8%) (with no significant statistical correlation (P > 0.05) between antibiotic resistance and gender), tetracycline and sulfamethoxazole-trimethoprim (53.7%) (with no significant statistical correlation (P > 0.05) between antibiotic resistance (neither tetracycline nor sulfamethoxazole and trimethoprim) and gender). Table 2 Results of antibiotic susceptible and non-susceptible UPEC isolates based on Magirakos et al. [29]

*Green star depicts the first three most influential antibiotics

*Red star depicts the first three most uninfluential antibiotics

ESBL producing UPEC Isolates

Thirty strains from 108 isolates (27.8%) were detected as ESBL producing UPEC bacterial cells. Four and 26 ESBL producing UPEC strains were isolated from male and female patients, respectively (with no significant statistical correlation (P > 0.05) between ESBL producing UPEC isolates and gender). As Table 3 shows, the first three most influential antibiotics in association with 30 ESBL producing UPEC isolates were chloramphenicol (93.3%), nitrofurantoin (83.3%) and gentamicin (76.7%), respectively; while the first three most uninfluential antibiotics were respectively as amikacin (93.3%), cefotaxime (83.3%) and sulfamethoxazole-trimethoprim (73.3%). Table 3 Results of antibiotic susceptibility test in association with UPEC producing ESBL isolates based on CLSI 2021 [27]

*Green star depicts the first three most influential antibiotics

*Red star depicts the first three most uninfluential antibiotics

Multidrug-resistance (MDR) and extensively drug-resistance (XDR) patterns

The results obtained from AST were screened, rigorously. Seventy-five/108 (69.4%) UPEC strains were identified as MDR strains. Sixty-eight and seven MDR strains were isolated from females and males, respectively. The chi square test shows a significant statistical correlation (P < 0.05) between MDR characteristic and the gender of the UTIs patients. In this regard, 57 different MDR patterns were identified among 75 MDR clinical isolates of UPEC strains (Table 4). The most three predominant MDR patterns were AM-TE-FOS-SXT (8.0%), AM-TE-FOS (7.0%) and AM-TE-SXT (4.0%), respectively. in addition, seven MDR patterns including AM-CTX-CIP-TE-FOS (2.7%), AM-CTX-TE-FOS-SXT (2.7%), AM-CIP-TE-FOS-SXT (2.7%), AM-FEP-CTX-CAZ-CIP-TE-FOS-SXT (2.7%), AM-FEP-CTX-CAZ-CIP-IPM-TE-SXT (2.7%), AM-AN-FEP-CTX-CAZ-CIP-IPM-K-TE-SXT (2.7%) and AM-AN-FEP-CTX-CAZ-C-CIP-IPM-K-TE-FOS (2.7%) ranked fourth. As Table 4 shows, other MDR patterns were unique among the left MDR isolates. In addition to MDR strains, two UPEC isolate (2/108) (1.9%) were recognized as XDR strain (Table 5). No PDR isolate was detected among 108 isolated UPEC strains in the present study. Table 4 Categorization of Multidrug-resistance (MDR) patterns in UPEC isolates into nine groups and 57 patterns

Groups	Resistance pattern	Phenotypic resistance	Resistant isolates n (%)
n = 75	
1	I	AM-TE-FOS	5 (7.0%)	
II	AM-TE-SXT	3 (4.0%)	
III	AM-CTX-SXT	1 (1.3%)	
IV	AM-CTX-IPM	1 (1.3%)	
V	AM-CTX-FOS	1 (1.3%)	
VI	AM-AN-FOS	1 (1.3%)	
VII	IMP-FOS-SXT	1 (1.3%)	
VIII	CTX-TE-SXT	1 (1.3%)	
IX	CIP-TE-FOS	1 (1.3%)	
X	CIP-FOS-SXT	1 (1.3%)	
II	XI	AM-TE-FOS-SXT	6 (8.0%)	
XII	AM-CTX-FOS-SXT	1 (1.3%)	
XIII	AM-C-FOS-SXT	1 (1.3%)	
XIV	AM-C-TE-SXT	1 (1.3%)	
XV	AM-CIP-NFT-SXT	1 (1.3%)	
XVI	FEP-TE-FOS-SXT	1 (1.3%)	
XVII	CIP-TE-FOS-SXT	1 (1.3%)	
III	XVIII	AM-CTX-CIP-TE-FOS	2 (2.7%)	
XIX	AM-CTX-TE-FOS-SXT	2 (2.7%)	
XX	AM-CIP-TE-FOS-SXT	2 (2.7%)	
XXI	AM-CTX-CIP-FOS-SXT	1 (1.3%)	
XXII	AM-C-CIP-K-SXT	1 (1.3%)	
XXIII	AM-FEP-CTX-CIP-IPM	1 (1.3%)	
XXIV	AM-CTX-CAZ-FOS-SXT	1 (1.3%)	
XXV	AM-CTX-CAZ-NFT-TE	1 (1.3%)	
XXVI	AM-CTX-CIP-TE-SXT	1 (1.3%)	
XXVII	AM-IPM-K-TE-FOS	1 (1.3%)	
XXVIII	AM-CAZ-CIP-IPM-SXT	1 (1.3%)	
XXIX	AM-CAZ-IPM-FOS-SXT	1 (1.3%)	
IV	XXX	AM-CTX-CIP-GM-K-FOS	1 (1.3%)	
XXXI	AM-FEP-CIP-IPM-TE-FOS	1 (1.3%)	
XXXII	AM-CTX-CIP-IPM-TE-FOS	1 (1.3%)	
XXXIII	AM-C-CIP-TE-FOS-SXT	1 (1.3%)	
XXXIV	AM-CIP-K-NFT-FOS-SXT	1 (1.3%)	
XXXV	AM-FEP-CIP-IPM-FOS-SXT	1 (1.3%)	
XXXVI	AM-C-IPM-K-TE-FOS	1 (1.3%)	
V	XXXVII	AM-AN-CTX-CAZ-IPM-FOS-SXT	1 (1.3%)	
XXXVIII	AM-FEP-CTX-CIP-TE-FOS-SXT	1 (1.3%)	
XXXIX	AM-CAZ-CIP-K-NFT-TE-FOS	1 (1.3%)	
XL	AM-CAZ-CIP-IPM-TE-FOS-SXT	1 (1.3%)	
XLI	AM-CTX-CIP-IPM-TE-FOS-SXT	1 (1.3%)	
VI	XLII	AM-FEP-CTX-CAZ-CIP-TE-FOS-SXT	2 (2.7%)	
XLIII	AM-FEP-CTX-CAZ-CIP-IPM-TE-SXT	2 (2.7%)	
XLIV	AM-FEP-CTX-CAZ-CIP-NFT-TE-SXT	1 (1.3%)	
XLV	AM-AN-CTX-CIP-GM-K-TE-SXT	1 (1.3%)	
XLVI	AM-CTX-CAZ-CIP-GM-K-FOS-SXT	1 (1.3%)	
XLVII	AM-FEP-CTX-CAZ-CIP-GM-K-FOS	1 (1.3%)	
VII	XLVIII	AM-FEP-CTX-CIP-GM-IPM-K-FOS-SXT	1 (1.3%)	
VIII	XLIX	AM-AN-FEP-CTX-CAZ-CIP-IPM-K-TE-SXT	2 (2.7%)	
L	AM-AN-FEP-CTX-CIP-GM-K-NFT-FOS-SXT	1 (1.3%)	
LI	AM-AN-FEP-CTX-CAZ-IPM-K-TE-FOS-SXT	1 (1.3%)	
LII	AM-AN-FEP-CTX-CAZ-CIP-GM-IPM-TE-FOS	1 (1.3%)	
LIII	AM-FEP-CTX-CAZ-CIP-GM-K-TE-FOS-SXT	1 (1.3%)	
IX	LIV	AM-AN-FEP-CTX-CAZ-C-CIP-IPM-K-TE-FOS	2 (2.7%)	
LV	AM-AN-CTX-CAZ-C-CIP-K-NFT-TE-FOS-SXT	1 (1.3%)	
LVI	AM-AN-FEP-CTX-CAZ-GM-IPM-K-TE-FOS-SXT	1 (1.3%)	
LVII	AM-AN-FEP-CTX-CAZ-C-GM-IPM-K-TE-FOS	1 (1.3%)	

Table 5 Extensively drug-resistance (XDR) patterns pertaining to UPEC isolates. The first and second XDR patterns have been recognized in UPEC isolates from patients with UTIs; a male and a female, respectively

Resistance pattern	Phenotypic resistance	Resistant isolates n (%)
n = 108	
I	AM-AN-FEP-CTX-CAZ-C-CIP-GM-IPM-K-TE-SXT	1 (0.9%)	
II	AM-AN-FEP-CTX-CAZ-CIP-GM-IPM-K-NFT-TE-FOS-SXT	1 (0.9%)	

PCR investigation of CU and curli fimbriae genes

In accordance with the obtained results from PCR assay (Supplementary Fig. 1), the highest frequency and distribution of the FAGs belong to fimH (93.3%) (with no significant statistical correlation (P > 0.05) between the frequency of fimH gene and gender) (P < 0.05), csgA (90.4%) (with no significant statistical correlation (P > 0.05) between the frequency of csgA gene and gender) and papG (37.5%) (papGII (30.8%)) (with no significant statistical correlation (P > 0.05) between the frequency of papG gene and gender) (Table 6). Table 6 Frequency of the FAGs among 104* UPEC isolates

Target gene	Total number of
UPEC isolates (%) n = 104	Females	Males	
csgA	94 (90.4%)	85	9	
fimH	97 (93.3%)	88	9	
mrkD	3 (2.9%)	3	0	
focG/focH	21 (20.2%)	19	2	
papG	39 (37.5%)	34	5	
papGI	3 (2.9%)	2	1	
papGII	32 (30.8%)	29	3	
papGIII	4 (3.8%)	3	1	

As four FAG patterns belonging to four UPEC isolates were missed; the left 104 FAGs are presented within the current table (Table 6).

Moreover, 19 different FAG patterns were identified among 104 UPEC strains (Table 7). The most three predominant FAG patterns were. Table 7 FAG patterns pertaining to UPEC isolates

Fimbrial pattern	Molecular gene pattern	Gender	Fimbrial isolates
n (%)
n = 104	
Females	Males	
I	none	1	0	1 (0.96%)	
II	fimH	2	1	3 (2.9%)	
III	papGII	0	1	1 (0.96%)	
IV	fimH-papGII	3	0	3 (2.9%)	
V	fimH-foc	1	0	1 (0.96%)	
VI	fimH-foc-papGII	1	0	1 (0.96%)	
VII	csgA	3	1	4 (3.8%)	
VIII	csgA-fimH	44	4	48 (46.2%)	
IX	csgA-fimH-papGI	1	0	1 (0.96%)	
X	csgA-fimH-papGII	18	1	19 (18.3%)	
XI	csgA-fimH-papGIII	0	1	1 (0.96%)	
XII	csgA-fimH-foc	7	0	7 (6.7%)	
XIII	csgA-fimH-foc-papGI	0	1	1 (0.96%)	
XIV	csgA-fimH-foc-papGII	5	1	6 (5.8%)	
XV	csgA-fimH-foc-papGIII	3	0	3 (2.9%)	
XVI	csgA-fimH-foc-papGI-papGII	1	0	1 (0.96%)	
XVII	csgA-fimH-mrkD	1	0	1 (0.96%)	
XVIII	csgA-fimH-foc-papGII-mrkD	1	0	1 (0.96%)	
XIX	csgA-mrkD	1	0	1 (0.96%)	
Four FAG patterns were missed	

csgA-fimH (46.2%), csgA-fimH-papGII (18.3%), and csgA-fimH-foc (6.7%), respectively.

According to the Fisher’s exact test there is no significant statistical correlation (P > 0.05) between the frequency of csgA-fimH, csgA-fimH-papGII, csgA-fimH-foc gene patterns and gender, respectively.

In the current study, several profiles including molecular FAG patterns, phenotypic AMR patterns, ESBL production patterns together with MDR and XDR patterns were provided in accordance with Table 8. As Table 8 indicates, the csgA-fimH FAG pattern encompasses the highest number of phenotypic AMR patterns (36 cases), 30 MDR and 12 ESBL producing strains. According to chi square test, a significant statistical correlation (P < 0.05) between the MDR and ESBL producing UPEC strains can be recognized within the. Table 8 A full profile of the isolated UPEC strains in the present study

Molecular fimbrial gene pattern	Phenotypic resistance and ESBL producing patterns	MDR	XDR	
None	SXT	-	-	
fimH	AM-FEP-CTX-CAZ-CIP-GM-K-FOS (ESBL +)	Yes	-	
AM-FEP-CTX- CAZ-CIP-GM-K-TE-FOS-SXT (ESBL +)	Yes	
AM-IPM-K-TE-FOS	Yes	
papGII	AM-CTX-CIP-GM-K-FOS	Yes	-	
fimH-papGII	AM-TE-FOS-SXT	Yes	-	
SENSITIVE TO ALL THE USED ANTIBIOTICS	-	
fimH-foc	AM-CTX-SXT (ESBL +)	Yes	-	
fimH-foc-papGII	THE COMPLETE PROFILE IS MISSING (ESBL +)	Yes	-	
csgA	AM-AN-FEP-CTX-CAZ-C-CIP-GM-IPM-K-TE-SXT	-	XDR	
AM-FOS	-	-	
AM-C-IPM-K-TE-FOS	Yes	
AM-CTX-CAZ-NFT-TE (ESBL +)	Yes		
csgA-fimH	AM-FEP-CTX-CAZ-CIP-NFT-TE-SXT	Yes	-	
AM-CIP-K-NFT-FOS-SXT	Yes	
AM-FOS	-	
AM-AN-FEP-CTX-CAZ-CIP-GM-IPM-K-NFT-TE-FOS-SXT (ESBL +)	-	XDR	
AM-TE-FOS-SXT	Yes	-	
AM-CIP	-	
CIP-FOS-SXT	Yes	
AM-C-FOS-SXT	Yes	
AM-FEP-CTX-CIP-IPM (ESBL +)	Yes	
AM-FEP-CTX-CIP-TE-FOS-SXT (ESBL +)	Yes	
AM-FEP-CTX-CAZ-CIP-IPM-TE-SXT (ESBL +) (2 CASES)	Yes	
AM	-	
AM-CIP-NFT-SXT	Yes	
SENSITIVE TO ALL THE USED ANTIBIOTICS	-	
AM-FEP-CIP-IPM-TE-FOS	Yes	
CTX-TE-SXT	Yes	
CIP-TE-FOS	Yes	
AM-TE-FOS	Yes	
AM-CTX-IPM	Yes	
AM-AN-FEP-CTX-CAZ-C-CIP-IPM-K-TE-FOS (ESBL +)	Yes	
AM-AN-FEP-CTX-CAZ-C-CIP-IPM-K-TE-FOS

AM-FEP-CTX-CAZ-CIP-TE-FOS-SXT (ESBL +)

	Yes

Yes

	
AM-SXT	-	
AM-CTX-TE-FOS-SXT (ESBL +) (2 CASES)	Yes	
AM-CTX-CAZ-FOS-SXT (ESBL +)	Yes	
CIP-TE-FOS-SXT	Yes	
AM-CIP-TE-FOS-SXT (2 CASES)	Yes	
AM-C-TE-SXT	Yes	
AM-AN-FEP-CTX-CAZ-C-GM-IPM-K-TE-FOS	Yes	
TE-FOS	-	
AM-CTX-CIP-TE-FOS (ESBL +)	Yes	
AM-C-CIP-TE-FOS-SXT	Yes	
AM-CTX-FOS	Yes	
AM-TE-SXT	Yes	
AM-CTX-CIP-IPM-TE-FOS-SXT	Yes	
AM-CTX-CIP-IPM-TE-FOS	Yes	
	THE COMPLETE PROFILE IS MISSING (ESBL +)	Yes		
csgA-fimH-papGI	AN	-	-	
csgA-fimH-papGII	AM-AN-CTX-CAZ-C-CIP-K-NFT-TE-FOS-SXT (ESBL +)	Yes	-	
AM-TE	-	
SENSITIVE TO ALL THE USED ANTIBIOTICS (2 CASES)	-	
AM-AN-CTX-CAZ-IPM-FOS-SXT (ESBL +)	Yes	
AM-CTX-FOS-SXT (ESBL +)	Yes	
AM-C-CIP-K-SXT	Yes	
AM-TE-FOS	Yes	
AM-FEP-CTX-CAZ-CIP-TE-FOS-SXT (ESBL +)	Yes	
FOS-SXT

AM-AN-CTX-CIP-GM-K-TE-SXT (ESBL +)

	-

Yes

	
AM-CAZ-CIP-IPM-TE-FOS-SXT	Yes	
AM-AN-FEP-CTX-CAZ-CIP-IPM-K-TE-SXT (ESBL +) (2 CASES)	Yes	
TE-FOS	-	
FEP-TE-FOS-SXT	Yes	
AM-TE-FOS-SXT	Yes	
AM-AN-FEP-CTX-CAZ-CIP-GM-IPM-TE-FOS	Yes	
csgA-fimH-papGIII	FOS	-	-	
csgA-fimH-foc	AM	-	-	
FOS-SXT	-	
AM-CTX-CIP-FOS-SXT (ESBL +)	Yes	
AM-TE-FOS	Yes	
AM-CTX-CAZ-CIP-GM-K-FOS-SXT	Yes	
AM-CTX-CIP-TE-SXT	Yes	
AM-FEP-CTX-CIP-GM-IPM-K-FOS-SXT (ESBL +)	Yes	
csgA-fimH-foc-papGI	SENSITIVE TO ALL THE USED ANTIBIOTICS	-	-	
csgA-fimH-foc-papGII	FOS	-	-	
CIP-FOS	-	
AM-AN-FOS	Yes	
AM-TE-FOS	Yes	
AM-TE-FOS-SXT	Yes	
csgA-fimH-foc-papGIII	AM	-	-	
AM-AN	-	
AM-AN-FEP-CTX-CAZ-IPM-K-TE-FOS-SXT	Yes	
csgA-fimH-foc-papGI-papGII	AM-AN-FEP-CTX-CIP-GM-K-NFT-FOS-SXT (ESBL +)	Yes	-	
csgA-fimH-mrkD	AM-TE-SXT	Yes	-	
csgA-fimH-foc-papGII-mrkD	AM-CTX-CIP-TE-FOS (ESBL +)	Yes	-	
csgA-mrkD	AM-AN-FEP-CTX-CAZ-GM-IPM-K-TE-FOS-SXT (ESBL +)	Yes	-	
THE COMPLETE PROFILES ARE MISSING	AM-CAZ-CIP-K-NFT-TE-FOS (ESBL +)	Yes	-	
AM-FOS	-	-	
IPM-FOS-SXT	Yes		
AM-FEP-CTX-CAZ-CIP-GM-K-TE-FOS-SXT (ESBL +)	Yes	-	

csgA-fimH FAG pattern. Moreover, an XDR strain has been detected among the isolates bearing the csgA-fimH FAG pattern. The csgA-fimH-papGII FAG pattern includes 16 different phenotypic AMR patterns, 12 MDR isolates and seven ESBL producing strains. The csgA-fimH-foc FAG pattern includes seven different phenotypic AMR patterns, five MDR isolates and two ESBL producing strains. The second XDR strain belongs to the isolate bearing csgA FAG pattern.

Discussion

The genomic plasticity of the bacterial cells of E. coli is significantly high [35]. The bacterial genomic pool or pan-genome is composed of core genome, adaptive (dispensable, flexible, accessory) genome, and singleton genes. The core genome contains housekeeping genes and those genes that are involved in vital activities of the cell [10, 36, 37]. In contrast to core genome, the flexible genome is mostly composed of VGs (virulome) and ARGs (resistome) which play pivotal role in bacterial adaptation [36–38]. These genes and the singletons (the unique genes that encode VFs and participate in bacterial pathogenicity) may be acquired through the horizontal genetic transfer (HGT) via the mobile genetic elements (MGE) (mobilome) such as plasmids, transposons, integrons (ints), insertion sequences (ISs), phages, etc. [36–38]. Due to this knowledge, the pan-genomic content of E. coli strains ranges from ~ 4.5 Mb (the intestinal commensal strains of E. coli as a population of gut microbiota) to ≥ 5 Mb (the Extraintestinal pathogenic E. coli (ExPEC) like UPEC strains) [9, 12, 37, 39–41].

The Gram-negative bacteria of UPEC and K. pneumoniae strains are known as the most important causative bacterial agents of UTIs, respectively [2–4, 7, 18, 35, 37]. On the other hand, the rise of AMR feature is a prominent concern, worldwide [42–44]. The Gram-negative uropathogens like UPEC encompasses a plastic genome which has a significant potential in association with acquiring a wide range of VGs and ARGs through MGEs via the process of HGT [3, 10, 35, 36, 44, 45]. Due to this knowledge, transmission of antibiotic resistance and virulence factors e.g., bacterial fimbriae can be performed among different strains of UPEC bacterial cells.

In accordance with previous reports, UPEC, K. pneumoniae, uropathogenic Pseudomonas aeruginosa (UPPA), uropathogenic Enterococcus spp., and uropathogenic Enterobacter spp. strains are known as the typical AMR uropathogens that are recognized as the top ten prominent pathogens which may lead to mortality [44, 46]. The rise of production of.

ß-lactamases among UPEC strains is a significant concern; because it leads to increase the number of ESBL producing strains. Resistance to third generation of cephalosporins e.g., ceftazidime and cefotaxime is a clear example in this regard [18, 44]. Sometimes, both of ARGs and VGs are located upon the similar MGEs and this feature may lead to increase the pathogenesis of the uropathogens; however, the genes encoding the studied adhesins in the current survey are normally found on PAIs [36, 44, 47–50]. In accordance with previous reports, 65% and 75% of the complicated and uncomplicated UTIs and 95% and 50% of the community-acquired UTIs and nosocomial UTIs are respectively, caused by UPEC [42, 51]. The UPEC pathotypes ability in association with bacterial invasion, colonization and biofilm formation in human host urinary system is directly related to fimbriae as adhesion factors [6, 7, 9, 10, 51]. As aforementioned, the high plasticity of UPEC genome and the utilization of HGT to transfer VGs and ARGs in UPEC pathotypes, make this bacterial agent unique to have effective adaptation and rapid evolutionary mechanisms to respond to its own environmental factors including human host immune system biomolecules like interleukins and toll-like receptors and bacterial attachment to specific receptors and bacterial dissemination within human host urinary system [2, 7, 40, 41, 51–55]. The adhesive fimbriae in uropathogens like UPEC are extracellular proteinaceous appendages that support bacterial cells of UPEC to attach to urothelial and bladder cells in human host urinary system. Moreover, these fimbriae empower the attachment of UPEC cells against urine flow. The type 1 fimbriae with a length of 2 μm and a width of 10 nm are located upon the entire surface of UPEC bacterial cells. According to reported results from previous investigations, type 1 fimbriae are detectable in 82% to 100% of the UPEC pathotypes [6, 56–59]. In the present study, the prevalence of fimH was 93.3%. The FimH as the adhesin subunit of type 1 fimbria is encoded by fimH gene as a part of chromosomal operon of fimBEAICDFGH. Type 1 fimbriae are attached to uroplakins and their expression can be switch on or switch off via the environmental factors [6].

Type 3 fimbria is another member of CUF that has pivotal role in UPEC strains colonization and biofilm formation. These CU fibers have a length of 0.5–2 μm and a width of 2–4 nm [6, 9, 10, 18]. The mrkABCDF operon in UPEC pathotypes originates from K. pneumoniae which normally are transferred via HGT. The mrk operons are located on different positions e.g., transposon, conjugative plasmid or chromosome [6, 18–20, 60]. MrkD is the adhesin subunit of type 3 fibers. The presence of mrkD gene in UPEC strains varies from 2% (isolated from patients with non-CAUTIs) to 93.3% (isolated from patients with CAUTIs [18, 61]. In present study, the prevalence of mrkD gene (type 3 fimbriae) was 2.9%.

F1C fimbriae are encoded by the chromosomal operon of focAICDFGH. In accordance with previous studies, a close homology has been recognized between F1C and type 1 fimbriae. FocG is the minor subunit and FocH acts as adhesin. These proteins are encoded by the focG and focH genes. F1C fibers are involved in different types of UTIs via contribution to sticky bacterial colonization and biofilm formation which support the UPEC bacterial cells against urine flow. F1C fibers have high activities in the absence of type 1 and P fimbriae. Normally, they have 1 μm length and 7 nm width [6, 9, 10]. The prevalence of F1C fibers varies from 0 to 30% [6, 57, 62]. Indeed, there are cross-talks between fimbrial structures of F1C fimbriae, type 1fimbriae, P fimbriae and bacterial motility structures of flagella. By the UPEC strains colonization, the expression of those genes that encode flagellar subunits get reduced [16, 63–65]. In the present study, the prevalence of focGH genes was 20.2%.

P fimbriae are encoded by the operon of papIBAHCDJKEFG which are located on pathogenicity islands (PAIs). PapG as the tip adhesin of P fiber is encoded by three alleles of papGI, papGII and papGIII for the most [6, 10, 51]. Although the allele gene of papGIV has been detected, its prevalence and function has not been described, in details [11, 24, 51]. PapGII class has been recognized as the most frequent adhesin among UPEC strains. The P fimbriae contribute in upper UTIs for the most [6, 10, 51]. In an investigation, the prevalence of PapG among UPEC isolates was reported as 23.2% (PapGIII > PapGII > PapGI) [66]. As the reported results from previous studies show, the prevalence of papG operon varies from 5–7% among commensal isolates of E. coli to 14%-28% and 71%-91% in UPEC strains isolated from patients with cystitis and pyelonephritis, respectively [51, 67]. In a recent survey, the prevalence of papGII and papGIII genes in isolated UPEC strains from patients with pyelonephritis and cystitis relating to UTI was 68% and 31%, respectively; while, the prevalence of papGI and papGIV genes in isolated UPEC strains from patients with cystitis relating to UTI was only 1% (PapGII > PapGIII > PapGI and PapGIV) [11]. In our study, the prevalence of papG, papGI, papGII and papGIII genes was identified as 37.5%, 2.9%, 30.8% and 3.8% (PapGII > PapGIII > PapGI), respectively.

Curli fibers are known as effective functional amyloids which significantly contribute to bacterial biofilm formation and development [68, 69]. The extracellular and superficial proteaceous curli fibers have similar structural and biochemical characteristics with eukaryotic amyloid fibers. The presence of these straight and unbranched curli fibers which are enriched by ß-sheet structures is related to important diseases e.g., Alzheimer's and Parkinson's diseases in humans [68–72]. The CsgA protein is the major curli subunit which have effective role in curli fibers polymerization upon the bacterial cell surface [51]. In one study, the prevalence of csgA gene among UPEC strains isolated from patients with UTI (cystitis) was reported as 100% [68], while in another study, the prevalence of csgA gene among UPEC strains isolated from patients with UTI was reported as 30% [67]. In the present investigation, the prevalence of the csgA gene was 90.4% (P < 0.05).

In our study, we were able to represent 19 different FAG patterns in association with the isolated UPEC strains. One of the isolates had no related genes at all. Although the prevalence of the FAG pattern relating to fimH and csgA genes was respectively 2.9% and 3.8%, the FAG pattern belonging to csgA-fimH with the prevalence of 46.2% ranks first among 19 different FAG patterns. The second and third FAG patterns belong to.

csgA-fimH-GII (18.3%) and csgA-fimH-foc (6.7%).

Moreover, we have obtained interesting results in association with phenotypic AMR patterns, phenotypic ESBL, MDR and XDR strains among isolated UPEC in present study (Tables 2, 3, 4 and 5). As we know, the AMR feature ranks as the top ten threats in association with public health, worldwide [43]. Therefore, it is recommended to administer and use antibiotics only regarding to symptomatic UTIs [73]. Moreover, there are thousands of studies that present different antibiotic resistance patterns in isolated microbial uropathogens including UPEC, worldwide. There are several global guidelines which are published during certain intervals including European Association of Urology (https://uroweb.org/) and Clinical and Laboratory Standards Institute (CLSI) (https://clsi.org/) in association with the use of antibiotics.

In recent years, our major concern is about of the increase of the MDR, XDR and PDR pathogens which are appeared through the prolonged use of antibiotics for treating different types of infectious diseases e.g., UTIs. By the increase of global drug resistance pathogens, the cost of treatments rises up. Due to this knowledge, significant number of scientists are trying to develop new strategies regarding the non-antibiotic therapeutic alternatives [74]. In this regard several strategies including the use of probiotics, microbiota transplantation, nanoparticles, phage therapy, nutraceuticals, herbal medicine, immunomodulant compounds, vaccination and anti-adhesive therapeutics have been suggested [39, 42, 74–76]. The authors believe that recruitment of anti-adhesive therapeutics can be an effective choice in this regard; because, fimbriae are the main weapons that initiate bacterial adherence that may lead to bacterial invasion, colonization, biofilm formation and AMR feature. Neutralization of these effective fimbrial adhesins leads to ejection of bacterial pathogens like UPEC from the human host body without any attachment. Moreover, these fimbrial adhesins are common among a wide range of uropathogens. Due to this knowledge, the feature of microbial drug resistance will be neutralized by the time. So, working on effective anti-adhesive agonists and antagonists against important and pivotal fimbrial adhesins including curli fibers, type 1 and P fimbriae is worthy to reduce the rate of UTIs, infectious morbidity and mortality, cost of public health systems and drug resistance feature.

Conclusions

In conclusion, detection, providing and designing of patterns and profiles in association with FAGs, AMR feature in UPEC strains give us an effective option to have a successful and influential prevention for both of UTIs initiation and AMR feature.

Limitations of the study

In some cases, we missed the data in association with bacterial genes and phenotypic antibiotic resistance profiles which have been mentioned within the tables.

Strength of the study

Fortunately, we were able to provide 19 effective FAG patterns, a versatile of phenotypic resistance patterns, 57 MDR patterns and two XDR pattern in association with clinical isolates of UPEC strains to provide influential data and information through tables from Tehran, the Capital city of Iran.

Supplementary Information

Supplementary Material 1.

Acknowledgements

We have special thanks to Cyrus Chegini (the research laboratory expert, college of basic sciences, Shahr-e-Qods branch, Islamic Azad University, Tehran, Iran), Ali Samadi, Mohammad Hossein Heydargoy, Reza Seifollahi, Amir Cheraghi, Samira Alizad Paydar, Yasaman Bahramvand, Hasan Mohammadnezhad Pahmedani for their sincere full support and kind help in this investigation.

Author’s contributions

Conceptualization: P.B.; Methodology: P.B.; Software: P.B., T.G., M.K.; Statistical Analysis: P.B., T.G.; Validation: P.B., T.G., M.K.; Formal analysis: P.B., T.G., M.K.; Investigation: P.B., T.G., M.K.; Resources: P.B., T.G., M.K.; Data curation: P.B., T.G., M.K.; Writing—Original Draft preparation: P.B., T.G., M.K.; Writing—Review and Editing: P.B.; Visualization: P.B., T.G.; Supervision: P.B.; Project administration: P.B.; Research assistant: T.G.; Team Leadership: P.B.; Funding acquisition: None; Financial Sponsorship: P.B.; All authors have read and agreed to the published version of the manuscript.”

Funding

This research received no funding.

Availability of data and materials

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

This scientific investigation has been performed under the permission number of DP/97/220 (97/12/12), issued by the Research Council of the Islamic Azad University, Shahr-e-Qods Branch. Since, the urine samples and the related information in association with the patients with UTIs were enrolled by the Labs’ and hospital’s technicians and experts and all these materials were anonymous to the authors, no ethical approval was needed for this project. This study was achieved according to the Declaration of Helsinki guidelines.

Consent for publication

Not applicable.

Competing interests

Payam BEHZADI is the BMC Microbiology Editorial Board Member.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Vollset, S.E.; Ababneh, H.S.; Abate, Y.H.; Abbafati, C.; Abbasgholizadeh, R.; Abbasian, M.; Abbastabar, H.; Abd Al Magied, A.H.; Abd ElHafeez, S.; Abdelkader, A. Burden of disease scenarios for 204 countries and territories, 2022–2050: a forecasting analysis for the Global Burden of Disease Study 2021. The Lancet. 2024;403:2204–2256.
2. Behzadi P García-Perdomo HA Autrán Gómez AM Pinheiro M Sarshar M Uropathogens, urinary tract infections, the host-pathogen interactions and treatment Front Microbiol 2023 14 1183236 10.3389/fmicb.2023.1183236 37032879
Behzadi P, García-Perdomo HA, Autrán Gómez AM, Pinheiro M, Sarshar M. Uropathogens, urinary tract infections, the host-pathogen interactions and treatment. Front Microbiol. 2023;14:1183236.37032879 10.3389/fmicb.2023.1183236
3. Issakhanian L Behzadi P Antimicrobial agents and urinary tract infections Curr Pharm Des 2019 25 1409 1423 10.2174/1381612825999190619130216 31218955
Issakhanian L, Behzadi P. Antimicrobial agents and urinary tract infections. Curr Pharm Des. 2019;25:1409–23.31218955 10.2174/1381612825999190619130216
4. Behzadi, P., Behzadi, E. The microbial agents of urinary tract infections at central laboratory of Dr. Shariati Hospital, Tehran, Iran. Turk Klin Tip Bilim. 2008;28:445–449.
5. Yazdansetad S, Alkhudhairy MK, Najafpour R, Farajtabrizi E, Al-Mosawi RM, Saki M, Jafarzadeh E, Izadpour F, Ameri A. Preliminary survey of extended-spectrum β-lactamases (ESBLs) in nosocomial uropathogen Klebsiella pneumoniae in north-central Iran. Heliyon. 2019;5(9):e02349. 10.1016/j.heliyon.2019.e02349.
6. Behzadi P Classical chaperone-usher (CU) adhesive fimbriome: uropathogenic Escherichia coli (UPEC) and urinary tract infections (UTIs) Folia Microbiol 2020 65 45 65 10.1007/s12223-019-00719-x 31165977
Behzadi P. Classical chaperone-usher (CU) adhesive fimbriome: uropathogenic Escherichia coli (UPEC) and urinary tract infections (UTIs). Folia Microbiol. 2020;65:45–65.31165977 10.1007/s12223-019-00719-x
7. Behzadi P, Behzadi E, Pawlak-Adamska EA. Urinary tract infections (UTIs) or genital tract infections (GTIs)? It's the diagnostics that count. GMS Hyg Infect Control. 2019;14:Doc14. 10.3205/dgkh000320.
8. Barrios-Villa E, Picón LR, Reynaga RB, Arenas-Hernández MM. An updated overview on the resistance and virulence of UPEC. Trending Topics in Escherichia coli Research: The Latin American Perspective. 2023:249–76.
9. Behzadi P, Behzadi E. Uropathogenic Escherichia coli: An ideal resource for DNA microarray probe designing. In Proceedings of the Bioinformatics and Biomedical Engineering: 5th International Work-Conference, IWBBIO 2017, Granada, Spain, April 26–28, 2017, Proceedings, Part II 5, 2017; pp. 12–19.
10. Jahandeh N Ranjbar R Behzadi P Behzadi E Uropathogenic Escherichia coli virulence genes: invaluable approaches for designing DNA microarray probes CEJU 2015 68 452 458 26855801
Jahandeh N, Ranjbar R, Behzadi P, Behzadi E. Uropathogenic Escherichia coli virulence genes: invaluable approaches for designing DNA microarray probes. CEJU. 2015;68:452–8.26855801
11. Kudinha T Kong F Distribution of papG alleles among uropathogenic Escherichia coli from reproductive age women J Biomed Sci 2022 29 66 10.1186/s12929-022-00848-5 36068602
Kudinha T, Kong F. Distribution of papG alleles among uropathogenic Escherichia coli from reproductive age women. J Biomed Sci. 2022;29:66.36068602 10.1186/s12929-022-00848-5
12. Flores-Oropeza MA Ochoa SA Cruz-Córdova A Chavez-Tepecano R Martínez-Peñafiel E Rembao-Bojórquez D Zavala-Vega S Hernández-Castro R Flores-Encarnacion M Arellano-Galindo J Comparative genomic analysis of uropathogenic Escherichia coli strains from women with recurrent urinary tract infection Front Microbiol 2024 14 1340427 10.3389/fmicb.2023.1340427 38328583
Flores-Oropeza MA, Ochoa SA, Cruz-Córdova A, Chavez-Tepecano R, Martínez-Peñafiel E, Rembao-Bojórquez D, Zavala-Vega S, Hernández-Castro R, Flores-Encarnacion M, Arellano-Galindo J. Comparative genomic analysis of uropathogenic Escherichia coli strains from women with recurrent urinary tract infection. Front Microbiol. 2024;14:1340427.38328583 10.3389/fmicb.2023.1340427
13. Bu F, Dee DR, Liu B. Structural insight into Escherichia coli CsgA amyloid fibril assembly. mBio. 2024;15(4):e0041924. 10.1128/mbio.00419-24. Epub 2024 Mar 19.
14. Lebeaux D Ghigo J-M Beloin C Biofilm-related infections: bridging the gap between clinical management and fundamental aspects of recalcitrance toward antibiotics Microbiol Mol Biol Rev 2014 78 510 543 10.1128/MMBR.00013-14 25184564
Lebeaux D, Ghigo J-M, Beloin C. Biofilm-related infections: bridging the gap between clinical management and fundamental aspects of recalcitrance toward antibiotics. Microbiol Mol Biol Rev. 2014;78:510–43.25184564 10.1128/MMBR.00013-14
15. Baby S Karnaker VK Geetha R Adhesins of uropathogenic Escherichia coli (UPEC) Int J Med Microbiol Trop Dis 2016 2 10 18
Baby S, Karnaker VK, Geetha R. Adhesins of uropathogenic Escherichia coli (UPEC). Int J Med Microbiol Trop Dis. 2016;2:10–8.
16. Chahales P, Thanassi DG. Structure, function, and assembly of adhesive organelles by uropathogenic bacteria. Urinary Tract Infections: Molecular Pathogenesis and Clinical Management. 2017;277–329.
17. Gerlach G-F Clegg S Allen BL Identification and characterization of the genes encoding the type 3 and type 1 fimbrial adhesins of Klebsiella pneumoniae J Bacteriol 1989 171 1262 1270 10.1128/jb.171.3.1262-1270.1989 2563996
Gerlach G-F, Clegg S, Allen BL. Identification and characterization of the genes encoding the type 3 and type 1 fimbrial adhesins of Klebsiella pneumoniae. J Bacteriol. 1989;171:1262–70.2563996 10.1128/jb.171.3.1262-1270.1989
18. Khonsari MS Behzadi P Foroohi F The prevalence of type 3 fimbriae in Uropathogenic Escherichia coli isolated from clinical urine samples Meta Gene 2021 28 100881 10.1016/j.mgene.2021.100881
Khonsari MS, Behzadi P, Foroohi F. The prevalence of type 3 fimbriae in Uropathogenic Escherichia coli isolated from clinical urine samples. Meta Gene. 2021;28:100881.10.1016/j.mgene.2021.100881
19. Ong, C.-l.Y.; Beatson, S.A.; Totsika, M.; Forestier, C.; McEwan, A.G.; Schembri, M.A. Molecular analysis of type 3 fimbrial genes from Escherichia coli, Klebsiella and Citrobacter species. BMC Microbiology. 2010;10:1–12.
20. Ong C-LY Ulett GC Mabbett AN Beatson SA Webb RI Monaghan W Nimmo GR Looke DF McEwan AG Schembri MA Identification of type 3 fimbriae in uropathogenic Escherichia coli reveals a role in biofilm formation J Bacteriol 2008 190 1054 1063 10.1128/JB.01523-07 18055599
Ong C-LY, Ulett GC, Mabbett AN, Beatson SA, Webb RI, Monaghan W, Nimmo GR, Looke DF, McEwan AG, Schembri MA. Identification of type 3 fimbriae in uropathogenic Escherichia coli reveals a role in biofilm formation. J Bacteriol. 2008;190:1054–63.18055599 10.1128/JB.01523-07
21. Spurbeck RR Mobley HL Uropathogenic escherichia coli 2013 In Escherichia coli Elsevier 275 304
Spurbeck RR, Mobley HL. Uropathogenic escherichia coli. In Escherichia coli: Elsevier; 2013. p. 275–304.
22. Klemm P Hancock V Schembri MA Fimbrial adhesins from extraintestinal Escherichia coli Environmental microbiology reports 2010 2 628 640 10.1111/j.1758-2229.2010.00166.x 23766248
Klemm P, Hancock V, Schembri MA. Fimbrial adhesins from extraintestinal Escherichia coli. Environmental microbiology reports. 2010;2:628–40.23766248 10.1111/j.1758-2229.2010.00166.x
23. Cuénod A Agnetti J Seth-Smith HM Roloff T Wälchli D Shcherbakov D Akbergenov R Tschudin-Sutter S Bassetti S Siegemund M Bacterial genome-wide association study substantiates papGII of Escherichia coli as a major risk factor for urosepsis Genome Medicine 2023 15 89 10.1186/s13073-023-01243-x 37904175
Cuénod A, Agnetti J, Seth-Smith HM, Roloff T, Wälchli D, Shcherbakov D, Akbergenov R, Tschudin-Sutter S, Bassetti S, Siegemund M. Bacterial genome-wide association study substantiates papGII of Escherichia coli as a major risk factor for urosepsis. Genome Medicine. 2023;15:89.37904175 10.1186/s13073-023-01243-x
24. Manning SD Zhang L Foxman B Spindler A Tallman P Marrs CF Prevalence of known P-fimbrial G alleles in Escherichia coli and identification of a new adhesin class Clinical Diagnostic Laboratory Immunology 2001 8 637 640 10.1128/CDLI.8.3.637-640.2001 11329472
Manning SD, Zhang L, Foxman B, Spindler A, Tallman P, Marrs CF. Prevalence of known P-fimbrial G alleles in Escherichia coli and identification of a new adhesin class. Clinical Diagnostic Laboratory Immunology. 2001;8:637–40.11329472 10.1128/CDLI.8.3.637-640.2001
25. Hozzari A Behzadi P Kerishchi Khiabani P Sholeh M Sabokroo N Clinical cases, drug resistance, and virulence genes profiling in Uropathogenic Escherichia coli J Appl Genet 2020 61 265 273 10.1007/s13353-020-00542-y 31950434
Hozzari A, Behzadi P, Kerishchi Khiabani P, Sholeh M, Sabokroo N. Clinical cases, drug resistance, and virulence genes profiling in Uropathogenic Escherichia coli. J Appl Genet. 2020;61:265–73.31950434 10.1007/s13353-020-00542-y
26. Ranjbar R Behzadi P Najafi A Roudi R DNA microarray for rapid detection and identification of food and water borne bacteria: from dry to wet lab The open microbiology journal 2017 11 330 10.2174/1874285801711010330 29290845
Ranjbar R, Behzadi P, Najafi A, Roudi R. DNA microarray for rapid detection and identification of food and water borne bacteria: from dry to wet lab. The open microbiology journal. 2017;11:330.29290845 10.2174/1874285801711010330
27. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 31st ed. 2021.
28. Cosentino F Viale P Giannella M MDR/XDR/PDR or DTR? Which definition best fits the resistance profile of Pseudomonas aeruginosa? Curr Opin Infect Dis 2023 36 564 571 10.1097/QCO.0000000000000966 37930070
Cosentino F, Viale P, Giannella M. MDR/XDR/PDR or DTR? Which definition best fits the resistance profile of Pseudomonas aeruginosa? Curr Opin Infect Dis. 2023;36:564–71.37930070 10.1097/QCO.0000000000000966
29. Magiorakos A-P Srinivasan A Carey RB Carmeli Y Falagas M Giske CG Harbarth S Hindler J Kahlmeter G Olsson-Liljequist B Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance Clin Microbiol Infect 2012 18 268 281 10.1111/j.1469-0691.2011.03570.x 21793988
Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas M, Giske CG, Harbarth S, Hindler J, Kahlmeter G, Olsson-Liljequist B. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18:268–81.21793988 10.1111/j.1469-0691.2011.03570.x
30. Wojnicz D Kucharska AZ Sokół-Łętowska A Kicia M Tichaczek-Goska D Medicinal plants extracts affect virulence factors expression and biofilm formation by the uropathogenic Escherichia coli Urol Res 2012 40 683 697 10.1007/s00240-012-0499-6 22915095
Wojnicz D, Kucharska AZ, Sokół-Łętowska A, Kicia M, Tichaczek-Goska D. Medicinal plants extracts affect virulence factors expression and biofilm formation by the uropathogenic Escherichia coli. Urol Res. 2012;40:683–97.22915095 10.1007/s00240-012-0499-6
31. Khafipour E Plaizier J Aikman PC Krause D Population structure of rumen Escherichia coli associated with subacute ruminal acidosis (SARA) in dairy cattle J Dairy Sci 2011 94 351 360 10.3168/jds.2010-3435 21183045
Khafipour E, Plaizier J, Aikman PC, Krause D. Population structure of rumen Escherichia coli associated with subacute ruminal acidosis (SARA) in dairy cattle. J Dairy Sci. 2011;94:351–60.21183045 10.3168/jds.2010-3435
32. Tseng C-C Huang J-J Ko W-C Yan J-J Wu J-J Decreased predominance of papG class II allele in Escherichia coli strains isolated from adults with acute pyelonephritis and urinary tract abnormalities J Urol 2001 166 1643 1646 10.1016/S0022-5347(05)65644-3 11586193
Tseng C-C, Huang J-J, Ko W-C, Yan J-J, Wu J-J. Decreased predominance of papG class II allele in Escherichia coli strains isolated from adults with acute pyelonephritis and urinary tract abnormalities. J Urol. 2001;166:1643–6.11586193 10.1016/S0022-5347(05)65644-3
33. Mitsumori K Terai A Yamamoto S Yoshida O Identification of S, F1C and three PapG fimbrial adhesins in uropathogenic Escherichia coli by polymerase chain reaction FEMS Immunol Med Microbiol 1998 21 261 268 10.1111/j.1574-695X.1998.tb01173.x 9752998
Mitsumori K, Terai A, Yamamoto S, Yoshida O. Identification of S, F1C and three PapG fimbrial adhesins in uropathogenic Escherichia coli by polymerase chain reaction. FEMS Immunol Med Microbiol. 1998;21:261–8.9752998 10.1111/j.1574-695X.1998.tb01173.x
34. Johnson JR Stapleton AE Russo TA Scheutz F Brown JJ Maslow JN Characteristics and prevalence within serogroup O4 of a J96-like clonal group of uropathogenic Escherichia coli O4: H5 containing the class I and class III alleles of papG Infect Immun 1997 65 2153 2159 10.1128/iai.65.6.2153-2159.1997 9169745
Johnson JR, Stapleton AE, Russo TA, Scheutz F, Brown JJ, Maslow JN. Characteristics and prevalence within serogroup O4 of a J96-like clonal group of uropathogenic Escherichia coli O4: H5 containing the class I and class III alleles of papG. Infect Immun. 1997;65:2153–9.9169745 10.1128/iai.65.6.2153-2159.1997
35. Behzadi P Najafi A Behzadi E Ranjbar R Microarray long oligo probe designing for Escherichia coli: an in-silico DNA marker extraction CEJU 2016 69 105 111 27123336
Behzadi P, Najafi A, Behzadi E, Ranjbar R. Microarray long oligo probe designing for Escherichia coli: an in-silico DNA marker extraction. CEJU. 2016;69:105–11.27123336
36. Karampatakis T Tsergouli K Behzadi P Pan-Genome Plasticity and Virulence Factors: A Natural Treasure Trove for Acinetobacter baumannii Antibiotics 2024 13 257 10.3390/antibiotics13030257 38534692
Karampatakis T, Tsergouli K, Behzadi P. Pan-Genome Plasticity and Virulence Factors: A Natural Treasure Trove for Acinetobacter baumannii. Antibiotics. 2024;13:257.38534692 10.3390/antibiotics13030257
37. Behzadi P Urbán E Matuz M Benkő R Gajdács M The role of gram-negative bacteria in urinary tract infections: current concepts and therapeutic options Advances in Microbiology, Infectious Diseases and Public Health: 2021 15 35 69
Behzadi P, Urbán E, Matuz M, Benkő R, Gajdács M. The role of gram-negative bacteria in urinary tract infections: current concepts and therapeutic options. Advances in Microbiology, Infectious Diseases and Public Health: 2021;15:35–69.
38. Mbelle NM Feldman C OseiSekyere J Maningi NE Modipane L Essack SY The resistome, mobilome virulome and phylogenomics of multidrug-resistant Escherichia coli clinical isolates from Pretoria South Africa Scientific Reports. 2019 9 16457 10.1038/s41598-019-52859-2 31712587
Mbelle NM, Feldman C, OseiSekyere J, Maningi NE, Modipane L, Essack SY. The resistome, mobilome virulome and phylogenomics of multidrug-resistant Escherichia coli clinical isolates from Pretoria South Africa. Scientific Reports. 2019;9:16457.31712587 10.1038/s41598-019-52859-2
39. Behzadi, P.; Dodero, V.I.; Golubnitschaja, O. Systemic Inflammation as the Health-Related Communication Tool Between the Human Host and Gut Microbiota in the Framework of Predictive, Preventive, and Personalized Medicine. In All Around Suboptimal Health: Advanced Approaches by Predictive, Preventive and Personalised Medicine for Healthy Populations; Springer: 2024; pp. 203–241.
40. Behzadi P. "The role of Toll-like receptor (TLR) polymorphisms in urinary bladder cancer." Genetic Polymorphism and cancer susceptibility. 2021:281–317.
41. Behzadi P Toll-like receptor (TLR) polymorphisms in prostate cancer 2022 In Genetic Polymorphism and Disease CRC Press 379 399
Behzadi P. Toll-like receptor (TLR) polymorphisms in prostate cancer. In Genetic Polymorphism and Disease: CRC Press; 2022. p. 379–99.
42. Sarshar M Behzadi P Ambrosi C Zagaglia C Palamara AT Scribano D FimH and anti-adhesive therapeutics: a disarming strategy against uropathogens Antibiotics 2020 9 397 10.3390/antibiotics9070397 32664222
Sarshar M, Behzadi P, Ambrosi C, Zagaglia C, Palamara AT, Scribano D. FimH and anti-adhesive therapeutics: a disarming strategy against uropathogens. Antibiotics. 2020;9:397.32664222 10.3390/antibiotics9070397
43. Algammal A Hetta HF Mabrok M Behzadi P Emerging multidrug-resistant bacterial pathogens “superbugs”: A rising public health threat Front Microbiol 2023 14 1135614 10.3389/fmicb.2023.1135614 36819057
Algammal A, Hetta HF, Mabrok M, Behzadi P. Emerging multidrug-resistant bacterial pathogens “superbugs”: A rising public health threat. Front Microbiol. 2023;14:1135614.36819057 10.3389/fmicb.2023.1135614
44. Von Vietinghoff S Shevchuk O Dobrindt U Engel DR Jorch SK Kurts C Miethke T Wagenlehner F The global burden of antimicrobial resistance–urinary tract infections Nephrol Dial Transplant 2024 39 581 588 10.1093/ndt/gfad233 37891013
Von Vietinghoff S, Shevchuk O, Dobrindt U, Engel DR, Jorch SK, Kurts C, Miethke T, Wagenlehner F. The global burden of antimicrobial resistance–urinary tract infections. Nephrol Dial Transplant. 2024;39:581–8.37891013 10.1093/ndt/gfad233
45. Behzadi P García-Perdomo HA Karpiński TM Issakhanian L Metallo-ß-lactamases: a review Mol Biol Rep 2020 47 6281 6294 10.1007/s11033-020-05651-9 32654052
Behzadi P, García-Perdomo HA, Karpiński TM, Issakhanian L. Metallo-ß-lactamases: a review. Mol Biol Rep. 2020;47:6281–94.32654052 10.1007/s11033-020-05651-9
46. Behzadi P Ambrosi C Scribano D Zanetti S Sarshar M Gajdács M Donadu MG Current perspectives on Pseudomonas aeruginosa: epidemiology, virulence and contemporary strategies to combat multidrug-resistant (MDR) pathogens Front Microbiol 2022 13 975616 10.3389/fmicb.2022.975616 35958138
Behzadi P, Ambrosi C, Scribano D, Zanetti S, Sarshar M, Gajdács M, Donadu MG. Current perspectives on Pseudomonas aeruginosa: epidemiology, virulence and contemporary strategies to combat multidrug-resistant (MDR) pathogens. Front Microbiol. 2022;13:975616.35958138 10.3389/fmicb.2022.975616
47. Fonseca-Martínez SA Martínez-Vega RA Farfán-García AE González Rugeles CI Criado-Guerrero LY Association Between Uropathogenic Escherichia coli Virulence Genes and Severity of Infection and Resistance to Antibiotics Infect Drug Resist. 2023 16 3707 3718 10.2147/IDR.S391378 37333681
Fonseca-Martínez SA, Martínez-Vega RA, Farfán-García AE, González Rugeles CI, Criado-Guerrero LY. Association Between Uropathogenic Escherichia coli Virulence Genes and Severity of Infection and Resistance to Antibiotics. Infect Drug Resist. 2023;16:3707–18.37333681 10.2147/IDR.S391378
48. Wang M-C Fan Y-H Zhang Y-Z Bregente CJB Lin W-H Chen C-A Lin T-P Kao C-Y Characterization of uropathogenic Escherichia coli phylogroups associated with antimicrobial resistance, virulence factor distribution, and virulence-related phenotypes Infect Genet Evol 2023 114 105493 10.1016/j.meegid.2023.105493 37634856
Wang M-C, Fan Y-H, Zhang Y-Z, Bregente CJB, Lin W-H, Chen C-A, Lin T-P, Kao C-Y. Characterization of uropathogenic Escherichia coli phylogroups associated with antimicrobial resistance, virulence factor distribution, and virulence-related phenotypes. Infect Genet Evol. 2023;114:105493.37634856 10.1016/j.meegid.2023.105493
49. D’Incau S Atkinson A Leitner L Kronenberg A Kessler TM Marschall J Bacterial species and antimicrobial resistance differ between catheter and non–catheter-associated urinary tract infections: Data from a national surveillance network Antimicrobial Stewardship & Healthcare Epidemiology 2023 3 e55 10.1017/ash.2022.340 36970431
D’Incau S, Atkinson A, Leitner L, Kronenberg A, Kessler TM, Marschall J. Bacterial species and antimicrobial resistance differ between catheter and non–catheter-associated urinary tract infections: Data from a national surveillance network. Antimicrobial Stewardship & Healthcare Epidemiology. 2023;3:e55.36970431 10.1017/ash.2022.340
50. Mitra SD Irshad P Anusree M Rekha I Shailaja S Suresh J Aishwarya G Shrestha S Shome BR Whole genome global insight of antibiotic resistance gene repertoire and virulome of high-risk multidrug-resistant Uropathogenic Escherichia coli Microb Pathog 2021 161 105256 10.1016/j.micpath.2021.105256 34695556
Mitra SD, Irshad P, Anusree M, Rekha I, Shailaja S, Suresh J, Aishwarya G, Shrestha S, Shome BR. Whole genome global insight of antibiotic resistance gene repertoire and virulome of high-risk multidrug-resistant Uropathogenic Escherichia coli. Microb Pathog. 2021;161:105256.34695556 10.1016/j.micpath.2021.105256
51. Whelan S Lucey B Finn K Uropathogenic Escherichia coli (UPEC)-Associated Urinary Tract Infections: The Molecular Basis for Challenges to Effective Treatment Microorganisms 2023 11 2169 10.3390/microorganisms11092169 37764013
Whelan S, Lucey B, Finn K. Uropathogenic Escherichia coli (UPEC)-Associated Urinary Tract Infections: The Molecular Basis for Challenges to Effective Treatment. Microorganisms. 2023;11:2169.37764013 10.3390/microorganisms11092169
52. Mukherjee S Patra R Behzadi P Masotti A Paolini A Sarshar M Toll-like receptor-guided therapeutic intervention of human cancers: molecular and immunological perspectives Front Immunol 2023 14 1244345 10.3389/fimmu.2023.1244345 37822929
Mukherjee S, Patra R, Behzadi P, Masotti A, Paolini A, Sarshar M. Toll-like receptor-guided therapeutic intervention of human cancers: molecular and immunological perspectives. Front Immunol. 2023;14:1244345.37822929 10.3389/fimmu.2023.1244345
53. Behzadi E Behzadi P The role of toll-like receptors (TLRs) in urinary tract infections (UTIs) CEJU 2016 69 404 410 28127459
Behzadi E, Behzadi P. The role of toll-like receptors (TLRs) in urinary tract infections (UTIs). CEJU. 2016;69:404–10.28127459
54. Behzadi P Sameer AS Nissar S Banday MZ Gajdács M García-Perdomo HA Akhtar K Pinheiro M Magnusson P Sarshar M The Interleukin-1 (IL-1) superfamily cytokines and their single nucleotide polymorphisms (SNPs) J Immunol Res. 2022 2022 2054431 10.1155/2022/2054431 35378905
Behzadi P, Sameer AS, Nissar S, Banday MZ, Gajdács M, García-Perdomo HA, Akhtar K, Pinheiro M, Magnusson P, Sarshar M. The Interleukin-1 (IL-1) superfamily cytokines and their single nucleotide polymorphisms (SNPs). J Immunol Res. 2022;2022:2054431.35378905 10.1155/2022/2054431
55. Behzadi P Kim C-H Pawlak EA Algammal A The innate and adaptive immune system in human urinary system Front Immunol 2023 14 1294869 10.3389/fimmu.2023.1294869 37876936
Behzadi P, Kim C-H, Pawlak EA, Algammal A. The innate and adaptive immune system in human urinary system. Front Immunol. 2023;14:1294869.37876936 10.3389/fimmu.2023.1294869
56. Rahdar M Rashki A Miri HR Ghalehnoo MR Detection of pap, sfa, afa, foc, and fim adhesin-encoding operons in uropathogenic Escherichia coli isolates collected from patients with urinary tract infection Jundishapur J Microbiol 2015 8 e22647 10.5812/jjm.22647 26464770
Rahdar M, Rashki A, Miri HR, Ghalehnoo MR. Detection of pap, sfa, afa, foc, and fim adhesin-encoding operons in uropathogenic Escherichia coli isolates collected from patients with urinary tract infection. Jundishapur J Microbiol. 2015;8:e22647.26464770 10.5812/jjm.22647
57. Naziri Z Kilegolan J Moezzi M Derakhshandeh A Biofilm formation by uropathogenic Escherichia coli: a complicating factor for treatment and recurrence of urinary tract infections J Hosp Infect 2021 117 9 16 10.1016/j.jhin.2021.08.017 34428502
Naziri Z, Kilegolan J, Moezzi M, Derakhshandeh A. Biofilm formation by uropathogenic Escherichia coli: a complicating factor for treatment and recurrence of urinary tract infections. J Hosp Infect. 2021;117:9–16.34428502 10.1016/j.jhin.2021.08.017
58. Yazdi M Bouzari M Ghaemi EA Detection of fim, pap, sfa and afa adhesin-encoding operons in Escherichia coli strains isolated from urinary tract infections Medical Laboratory Journal 2018 12 10 15 10.29252/mlj.12.5.10
Yazdi M, Bouzari M, Ghaemi EA. Detection of fim, pap, sfa and afa adhesin-encoding operons in Escherichia coli strains isolated from urinary tract infections. Medical Laboratory Journal. 2018;12:10–5.10.29252/mlj.12.5.10
59. Baldiris-Avila R Montes-Robledo A Buelvas-Montes Y Phylogenetic classification, biofilm-forming capacity, virulence factors, and antimicrobial resistance in uropathogenic Escherichia coli (UPEC) Curr Microbiol 2020 77 3361 3370 10.1007/s00284-020-02173-2 32910213
Baldiris-Avila R, Montes-Robledo A, Buelvas-Montes Y. Phylogenetic classification, biofilm-forming capacity, virulence factors, and antimicrobial resistance in uropathogenic Escherichia coli (UPEC). Curr Microbiol. 2020;77:3361–70.32910213 10.1007/s00284-020-02173-2
60. Schroll C Barken KB Krogfelt KA Struve C Role of type 1 and type 3 fimbriae in Klebsiella pneumoniae biofilm formation BMC Microbiol 2010 10 1 10 10.1186/1471-2180-10-179 20051107
Schroll C, Barken KB, Krogfelt KA, Struve C. Role of type 1 and type 3 fimbriae in Klebsiella pneumoniae biofilm formation. BMC Microbiol. 2010;10:1–10.20051107 10.1186/1471-2180-10-179
61. Zadeh FM Zarei H Jahromy SH Type1 and 3 fimbriae phenotype and genotype as suitable markers for uropathogenic bacterial pathogenesis via attachment, cell surface hydrophobicity, and biofilm formation in catheter-associated urinary tract infections (CAUTIs) Iran J Basic Med Sci 2021 24 1098 34804427
Zadeh FM, Zarei H, Jahromy SH. Type1 and 3 fimbriae phenotype and genotype as suitable markers for uropathogenic bacterial pathogenesis via attachment, cell surface hydrophobicity, and biofilm formation in catheter-associated urinary tract infections (CAUTIs). Iran J Basic Med Sci. 2021;24:1098.34804427
62. Kim B Kim J-H Lee Y Virulence factors associated with Escherichia coli bacteremia and urinary tract infection Ann Lab Med 2022 42 203 10.3343/alm.2022.42.2.203 34635614
Kim B, Kim J-H, Lee Y. Virulence factors associated with Escherichia coli bacteremia and urinary tract infection. Ann Lab Med. 2022;42:203.34635614 10.3343/alm.2022.42.2.203
63. Bessaiah H Anamalé C Sung J Dozois CM What flips the switch? Signals and stress regulating extraintestinal pathogenic Escherichia coli type 1 fimbriae (pili) Microorganisms 2021 10 5 10.3390/microorganisms10010005 35056454
Bessaiah H, Anamalé C, Sung J, Dozois CM. What flips the switch? Signals and stress regulating extraintestinal pathogenic Escherichia coli type 1 fimbriae (pili). Microorganisms. 2021;10:5.35056454 10.3390/microorganisms10010005
64. Firoozeh F Zibaei M Badmasti F Khaledi A Virulence factors, antimicrobial resistance and the relationship between these characteristics in uropathogenic Escherichia coli Gene Reports 2022 27 101622 10.1016/j.genrep.2022.101622
Firoozeh F, Zibaei M, Badmasti F, Khaledi A. Virulence factors, antimicrobial resistance and the relationship between these characteristics in uropathogenic Escherichia coli. Gene Reports. 2022;27:101622.10.1016/j.genrep.2022.101622
65. Khandige S Møller-Jensen J Fimbrial phase variation: stochastic or cooperative? Curr Genet 2016 62 237 241 10.1007/s00294-015-0529-3 26537821
Khandige S, Møller-Jensen J. Fimbrial phase variation: stochastic or cooperative? Curr Genet. 2016;62:237–41.26537821 10.1007/s00294-015-0529-3
66. Rezatofighi SE Mirzarazi M Salehi M Virulence genes and phylogenetic groups of uropathogenic Escherichia coli isolates from patients with urinary tract infection and uninfected control subjects: a case-control study BMC Infect Dis 2021 21 1 11 10.1186/s12879-021-06036-4 33390160
Rezatofighi SE, Mirzarazi M, Salehi M. Virulence genes and phylogenetic groups of uropathogenic Escherichia coli isolates from patients with urinary tract infection and uninfected control subjects: a case-control study. BMC Infect Dis. 2021;21:1–11.33390160 10.1186/s12879-021-06036-4
67. Qin X Hu F Wu S Ye X Zhu D Zhang Y Wang M Comparison of adhesin genes and antimicrobial susceptibilities between uropathogenic and intestinal commensal Escherichia coli strains PLoS ONE 2013 8 e61169 10.1371/journal.pone.0061169 23593422
Qin X, Hu F, Wu S, Ye X, Zhu D, Zhang Y, Wang M. Comparison of adhesin genes and antimicrobial susceptibilities between uropathogenic and intestinal commensal Escherichia coli strains. PLoS ONE. 2013;8:e61169.23593422 10.1371/journal.pone.0061169
68. Cordeiro MA Werle CH Milanez GP Yano T Curli fimbria: an Escherichia coli adhesin associated with human cystitis Braz J Microbiol. 2016 47 414 416 10.1016/j.bjm.2016.01.024 26991275
Cordeiro MA, Werle CH, Milanez GP, Yano T. Curli fimbria: an Escherichia coli adhesin associated with human cystitis. Braz J Microbiol. 2016;47:414–6.26991275 10.1016/j.bjm.2016.01.024
69. Dueholm MS Albertsen M Otzen D Nielsen PH Curli functional amyloid systems are phylogenetically widespread and display large diversity in operon and protein structure PLoS ONE 2012 7 e51274 10.1371/journal.pone.0051274 23251478
Dueholm MS, Albertsen M, Otzen D, Nielsen PH. Curli functional amyloid systems are phylogenetically widespread and display large diversity in operon and protein structure. PLoS ONE. 2012;7:e51274.23251478 10.1371/journal.pone.0051274
70. Barnhart MM Chapman MR Curli biogenesis and function Annu Rev Microbiol 2006 60 131 147 10.1146/annurev.micro.60.080805.142106 16704339
Barnhart MM, Chapman MR. Curli biogenesis and function. Annu Rev Microbiol. 2006;60:131–47.16704339 10.1146/annurev.micro.60.080805.142106
71. Chapman MR Robinson LS Pinkner JS Roth R Heuser J Hammar M Normark S Hultgren SJ Role of Escherichia coli curli operons in directing amyloid fiber formation Science 2002 295 851 855 10.1126/science.1067484 11823641
Chapman MR, Robinson LS, Pinkner JS, Roth R, Heuser J, Hammar M, Normark S, Hultgren SJ. Role of Escherichia coli curli operons in directing amyloid fiber formation. Science. 2002;295:851–5.11823641 10.1126/science.1067484
72. Siri M Mangiarotti A Vázquez-Dávila M Bidan CM Curli amyloid fibers in Escherichia coli biofilms: the influence of water availability on their structure and functional properties Macromolecular Bioscience 2024 24 2300234 10.1002/mabi.202300234
Siri M, Mangiarotti A, Vázquez-Dávila M, Bidan CM. Curli amyloid fibers in Escherichia coli biofilms: the influence of water availability on their structure and functional properties. Macromolecular Bioscience. 2024;24:2300234.10.1002/mabi.202300234
73. Bartoletti R Cai T Wagenlehner FM Naber K Johansen TEB Treatment of urinary tract infections and antibiotic stewardship Eur Urol Suppl 2016 15 81 87 10.1016/j.eursup.2016.04.003
Bartoletti R, Cai T, Wagenlehner FM, Naber K, Johansen TEB. Treatment of urinary tract infections and antibiotic stewardship. Eur Urol Suppl. 2016;15:81–7.10.1016/j.eursup.2016.04.003
74. Loubet P Ranfaing J Dinh A Dunyach-Remy C Bernard L Bruyère F Lavigne J-P Sotto A Alternative therapeutic options to antibiotics for the treatment of urinary tract infections Front Microbiol 2020 11 1509 10.3389/fmicb.2020.01509 32719668
Loubet P, Ranfaing J, Dinh A, Dunyach-Remy C, Bernard L, Bruyère F, Lavigne J-P, Sotto A. Alternative therapeutic options to antibiotics for the treatment of urinary tract infections. Front Microbiol. 2020;11:1509.32719668 10.3389/fmicb.2020.01509
75. Zagaglia C Ammendolia MG Maurizi L Nicoletti M Longhi C Urinary tract infections caused by uropathogenic Escherichia coli strains—new strategies for an old pathogen Microorganisms 2022 10 1425 10.3390/microorganisms10071425 35889146
Zagaglia C, Ammendolia MG, Maurizi L, Nicoletti M, Longhi C. Urinary tract infections caused by uropathogenic Escherichia coli strains—new strategies for an old pathogen. Microorganisms. 2022;10:1425.35889146 10.3390/microorganisms10071425
76. Scribano D Sarshar M Fettucciari L Ambrosi C Urinary tract infections: Can we prevent uropathogenic Escherichia coli infection with dietary intervention? Int J Vitam Nutr Res. 2021 91 391 395 10.1024/0300-9831/a000704 33880966
Scribano D, Sarshar M, Fettucciari L, Ambrosi C. Urinary tract infections: Can we prevent uropathogenic Escherichia coli infection with dietary intervention? Int J Vitam Nutr Res. 2021;91:391–5.33880966 10.1024/0300-9831/a000704
