
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)12721-1
10.1016/j.heliyon.2024.e36690
e36690
Research Article
Assessment of the presence of multidrug-resistant Escherichiacoli, Salmonella and Staphylococcus in chicken meat, eggs and faeces in Mymensingh division of Bangladesh
Rafiq Kazi kazirafiq@bau.edu.bd
a⁎
Sani Aminatu Abubakar ab
Hossain Muhammad Tofazzal c
Hossain Md Tarek a
Hadiuzzaman Md c
Bhuiyan Mohammad Abdus Sattar ad
a Department of Pharmacology, Bangladesh Agricultural University, Mymensingh, 2202, Bangladesh
b Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Usmanu Danfodiyo University Sokoto, Nigeria
c Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh, 2202, Bangladesh
d Department of Cardiology, Mymensingh Medical College, Mymensingh, 2202, Bangladesh
⁎ Corresponding author. kazirafiq@bau.edu.bd
23 8 2024
15 9 2024
23 8 2024
10 17 e3669014 5 2024
19 8 2024
20 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
The emergence of bacteria that is resistant to several drugs of clinical importance poses a threat to successful treatment, a phenomenon known as multidrug resistance that affects diverse classes of antibiotics. The purpose of this study was to evaluate the prevalence of multidrug-resistant Escherichiacoli, Salmonella spp. and Staphylococcusaureus in chicken egg, meat and faeces from four districts of Bangladesh. A total of 120 chicken samples were collected from different poultry farms. Conventional culture and molecular detection methods were used for identification of bacterial isolates from the collected samples followed by antibiotic susceptibility test through the disc diffusion method, finally antibiotic resistant genes were detected by PCR. E. coli, Salmonella spp. and Staphylococcusaureus were detected in meat, egg and faecal samples. Antimicrobial susceptibility results revealed isolates from faeces were 100 % resistant to amoxicillin, while all S.aureus and Salmonella sp. from faeces were resistant to doxycycline, tetracycline and erythromycin. Salmonella spp. isolates from eggs indicated 100 % resistance to erythromycin, amoxycillin, while E.coli were 100 % resistant to erythromycin. E.coli and S.aureus from meat were 100 % resistant to amoxicillin and erythromycin. However, Salmonella spp. from eggs were 100 % susceptible to doxycycline, gentamicin, levofloxacin and tetracycline. The mecA and aac(3)-IV genes were only found in S.aureus and E.coli, respectively. The Sul1,tetB, and aadA1 were highest in Salmonella spp. and S.aureus, while the sul1,tetA and blaSHV were higher in E.coli. Isolates from all samples were multidrug resistant. These findings indicate a high risk of transmission of resistance genes from microbial contamination to food of animal origin. The study emphasizes the need for effective biosecurity measures, responsible antibiotic use, and strict regulations in poultry production to prevent the spread of antibiotic resistance.

Keywords

Foodborne pathogens
Poultry
MDR bacteria
AMR
Bangladesh
==== Body
pmc1 Introduction

Large amounts of antimicrobials are used to prevent, treat diseases, and serve as growth promoters. This has led to the indiscriminate use of antibiotics in poultry production. Nearly, all the antibiotic classes that are important for human medicine are extensively used in livestock production, not only as therapeutic agents but also for prevention purpose [1]. Foodborne resistant pathogens, particularly those originating from poultry, pose a significant risk to human health as a result of the abuse of antibiotics in the animal production sector [2]. These antibiotics can remain in the food chain and help to develop resistant microbes that provide enabling environment for transmission of resistance factors. These bacteria thrive well in the tissues and proteins we consume, and they easily gain entry into our body from contamination. Antimicrobial residues may not always degrade appreciably, even after conventional cooking procedures [3]. As a result, drug metabolites can cause bone marrow toxicity, allergy and mutagenicity [4]. The potential for drug residues to persist in soil or drainage water, thus contributing to the development of microbial resistance is a cause for concern [5]. More serious is the ability of the drug residues to remain in the soil or drainage water and help to develop microbial resistance in the agricultural chain [6]. These resistant bacteria have become difficult to treat leading to a global health challenge. The different ways that bacteria become resistant are by intrinsic or acquired means, prevention of access to target site, inactivation of the antibiotic and change in target structure [7].

Poultry meat and eggs are a major source of dietary protein and earnings in middle- and low-income countries around the world. Bangladesh is no exception as meat and eggs are cheap sources of protein that are accepted by many faiths and cultures [8]. However, the quest to provide affordable and profitable sources of protein, such as those from poultry, comes with a great risk because of the use of antibiotics in the production chain. The meat, eggs, and faeces from poultry can be a source of multidrug resistant Escherichia coli, Salmonella spp. and Staphylococcus aureus, which are among the bacteria frequently implicated in foodborne illnesses. These three bacteria are known to be associated with the contamination of poultry sourced-proteins and bi products like faeces [9]. They can be transmitted from animal sourced food to human hence zoonotic in nature. The selection pressure to develop resistance in commensal bacteria like E. coli, Salmonella spp. and Staphylococcus from poultry is high, thus increasing the burden of antimicrobial resistance [10,11]. These bacteria are part of the normal human flora that can harbor resistance genes or plasmids which can migrate and affect both human and animals, by causing drug-resistance [12].

E.coli and Staphylococcus are present in the alimentary system of man and animals as commensals but they can cause infections [13]. E. coli can have detrimental effects on poultry health causing diseases like colibacillosis, meningitis, diarrhoea, septicaemia, etc. that could lead to economic losses [14]. Although most strains do not cause problem, nearly 15 % of them can be pathogenic [15]. The pathogenic E. coli is divided into enterohemorrhagic, enterotoxigenic, enteropathogenic, enteroaggregative, and enteroinvasive categories based on the mechanism of illness manifestation [16]. Furthermore, commensals, intraintestinally pathogenic, and extraintestinally pathogenic E. coli are the three primary types of E. coli based on virulence determinants. Certain virulence factors, such as the synthesis of toxins, hemolysins, siderophores, proteases, and adhesions, are unique to each pathotype and are important in the development of the disease [17]. The primary cause of multidrug resistance (MDR) in E. coli is the presence of antimicrobial resistance genes, including blaTEM, blaCTX-M, tetA and tetB, qnrA, qnrB, and qnrS, and sul1 [18].

Staphylococcus can also be pathogenic in both man and animal under favourable conditions [19,20]. Certain strains of S. aureus produce enterotoxins that cause food poisoning. Antimicrobial resistance (AMR) is primarily caused by a mutated penicillin-binding protein (PBP2a), which is encoded by the mecA gene [21,22]. S. aureus has a variety of virulence factors, including extracellular toxins [23]. Among these, enterotoxins are the source of food poisoning, while other toxins can produce a wide range of clinical symptoms in both humans and animals. When humans eat contaminated food, enterotoxins, which are thermostable, result in food poisoning [24]. The third most common cause of foodborne diseases worldwide is S. aureus and its enterotoxins [25]. It is capable of colonizing and surviving in various media, inanimate objects, and environments [26]. A major contributor to pathogenicity are virulence factors, which include adhesins and surface proteins including proteins A, β-hemolysin (Hlb), and Staphylococcal enterotoxins (SEs) [27].

Salmonellosis is one of the most deadly bacterial illnesses in the poultry industry, causing considerable financial losses from mortality and decreased productivity [28,29]. Almost all known Salmonellas serovars can cause illness in animals and man alike [30]. The two most frequent serovars of Salmonella enterica that cause salmonellosis are Enteritidis and Typhimurium. A serovar known as infantis affects people globally. Each year, salmonella infections affect around 20 million people and animals. It results in 150,000 animal and human deaths annually and lowers animal productivity. Infection with typhoid fever is more prevalent in south-central and south-east Asia [31]. Therefore, Salmonella is probably the most prevalent food-borne pathogen that is known to cause around 155,500 deaths worldwide annually [32]. Poultry meat is reported to be one of the major sources of this food borne pathogen [33,34].

AMR now poses a serious worldwide threat since it affects every aspect of public health [35]. By 2050, it is predicted that the AMR issue will result in hundreds of millions of human deaths worldwide, a severe financial crisis, and significant harm to the livestock industry [36]. Bangladesh and other low- and middle-income nations will suffer tremendously as a result of the consequences [37]. In addition, several recent investigations reported the emergence of multidrug-resistant bacterial pathogens from different origins that is considered a public health threat which increase the necessity of the proper use of antibiotics. Besides, the routine application of the antimicrobial susceptibility testing to detect the antibiotic of choice as well as the screening of the emerging MDR strains [18,21,22,[38], [39], [40]].

Studies have shown the occurrence of different food borne bacteria in poultry meat from different parts of the chicken [[41], [42], [43], [44]]. However, enough data needs to be gathered with respect to the multiple drug resistance profile of these bacteria because it is of great importance to the global public health. This research was aimed to investigate the occurrence of multidrug resistant E. coli, Salmonella spp. and S. aureus in chicken egg, meat and faeces from four districts of Bangladesh.The study would help to provide evidence-based policy interventions to address the multidrug resistance epidemic scenario from zoonotic pathogens.

2 Materials and methods

2.1 Sampling

Samples were collected from four districts under Mymensingh division (Mymensingh, Jamalpur, Netrokona, and Sherpur) of Bangladesh. A total of 120 samples comprising 40 faeces (20 each from broiler and layer chickens), 40 meat samples (20 each from broiler and layer chickens) and 40 egg samples (30 from layer chickens and 10 from ducks) (Table 1). The samples were collected using sterile instruments and aseptic with a simple random sampling technique. Immediately after collection, samples were transferred to sterile eppendorf tubes or zipper bags, placed in transport boxes kept at 4 °C, and then transported to the laboratory for microbiological analysis.Table 1 Distribution of samples collected from poultry in Mymensingh division of Bangladesh.

Table 1Name of the district	Sample Type	Total	
Broiler	Layer	Duck	
Faeces	Meat	Faeces	Meat	Egg	Egg	
Mymensingh	5	5	5	5	8	3	31	
Netrokona	5	5	5	5	8	3	31	
Sherpur	5	5	5	5	7	2	29	
Jamalpur	5	5	5	5	7	2	29	
Total	20	20	20	20	30	10	120	

2.2 Culture and identification of Escherichiacoli,Salmonella spp. and Staphylococcusaureus

Broth containing faeces samples, egg surface washings and processed meat samples were incubated aerobically at 37 °C overnight for the growth of bacteria [41,[45], [46], [47]]. Each broth culture was streaked onto eosin methylene blue agar (EMB) (HI media, Maharashtra, India), Salmonella Shigella (SS) agar (HI media, Maharashtra, India) and mannitol salt (MS) agar (HI media, Maharashtra, India) media for the isolation of E. coli, Salmonella and Staphylococcus, respectively. Initially, freshly grown broth culture of each sample was streaked on EMB, SS and MS agar media using sterile platinum loop. Then the inoculated agar plates were aerobically incubated at 37 °C overnight to obtain pure colonies. Single green-colored metallic-sheen colonies on EMB agar media, black-centered colonies on SS agar media and rounded colonies with metallic yellow colour of MS agar media represented the growth of E. coli, Salmonella spp. and Staphylococcus, respectively [41,46,47]. For further confirmation, selected colonies were subjected to morphological study by Gram staining [48,49]. Pure culture of E. coli, Salmonella and Staphylococcus was obtained by inoculating individual colonies into fresh nutrient broth followed by streaking onto respective selective agar media [41,46,47].

2.3 Genotypic confirmation of E.coli,Salmonella spp. and Staphylococcusaureus

Genomic DNA was extracted from pure cultures of E. coli, Salmonella and Staphylococcus using the conventional boiling method [45,46,50]. Isolates from pure colonies were inoculated into respective broth and incubated at 37 °C for 8–12 h. After incubation 1 ml of cultured broth was transferred into an Eppendorf tube followed by centrifugation for 5 min at 10,000 rpm. The bottom content was suspended in 100 μl of distilled water after carefully discarding the supernatant and centrifugation repeated. Supernatant was discarded and 100 μl distilled water was added. Then Eppendorf tubes were again vortexed and boiled for 20 min. After boiling the samples in the Eppendorf tubes were immediately maintained in cold shock for 10 min and centrifuged at 10,000 rpm for 10 min. The template DNA was stored at −20 °C for further use.

PCR assay was performed to detect E. coli, Salmonella spp. and Staphylococcus aureus with primers of fliC, inv A and nuc genes, respectively using the conditions and methods described by different authors under standard operating procedures [[51], [52], [53]]. The forward primer F’CCCCCTGGACGAAGACTGAC and a reverse primer R′ ACCGCTGGCAACAAAGGATA was used for the amplification of fliC gene (401bp) for E. coli [51]. Similarly, primers F′ ATCAGTACCAGTCGTCTTATCTTGAT and R’TCTGTTTACCGGGCATACCAT were used to amplify invA gene (211bp) for Salmonella spp., and primers F′ AGCGGGGGATAACTATTGGA and R’TACGCATTTCACCGCTACAC for the amplification of the nuc gene (284bp) for Staphylococcus aureus [52,53]. The PCR amplification was carried out in a 25 μl reaction mixture, consisting of 12.5 μl of master mixture (Promega, Madison, WI 53711 USA), 1 μl of forward primer, 1 μl of reverse primer, 3 μl of DNA template and 7.5 μl of nuclease free water. A thermal cycler (Thermo Fisher scientific, Waltham, MA USA) was used for the amplification with different PCR thermal conditions as validated by different authors [[51], [52], [53]] and the PCR products were visualized in gel (1.5 %) by UV-Trans illuminator.

2.4 Antimicrobial susceptibility pattern for E.coli,Salmonella spp. and Staphylococcusaureus

The disc diffusion method was used to determine the antibiotic susceptibility of E. coli, Salmonella and Staphylococcus isolates [54]. A total of ten antibiotics under six classes namely tetracycline (30 μg) and doxycycline (30 μg) of tetracycline, ciprofloxacin (5 μg), levofloxacin (5 μg) and enrofloxacin (5 μg) of fluroquinolones, amoxicillin (30 μg) of penicillin, erythromycin (25 μg) of macrolide, gentamicin (25 μg) and neomycin (30 μg) of aminoglycosides, and sulphur (25 μg) of sulphonamide were selected based on findings from a survey we carried out [55]. The McFarland standard (1.5 × 106 CFU/ml) of turbidity was used to measure the colonies’ turbidity suspended in saline. All freshly suspended bacteria were gently spread onto Mueller Hinton Agar (HI media, Maharashtra, India). The antibiotic discs were gently placed onto the Mueller Hinton agar plates and incubated for 24 h at 37 °C. The zones of inhibition that were observed were measured to the nearest millimetre and used to determine the susceptibility pattern of the isolates according to the Clinical and Laboratory Standards Institute standard guidelines [56]. Basis on inhibition zone, isolates were categorized to susceptible (S), Intermediate (I), or Resistant (R). Whereas basis on the susceptibility or resistance pattern, the isolates were also categorized to multidrug resistant (MDR), extensively drug resistant (XDR) and pandrug resistant (PDR) bacteria [57].

2.5 Detection of resistance genes

PCR Detection of Antibiotic resistance genes was done using genomic DNA extracted and preserved from the bacterial isolates. Screening for antimicrobial resistance genes in Salmonella, E. coli and Staphylococcus isolates was performed by validated PCR conditions and methods described by different authors [[58], [59], [60]] (Table 2).Table 2 List of primers used to detect antibiotic resistant genes using polymerase chain reaction (PCR).

Table 2Antibiotic	Target gene	Primer	Sequence (5′-3′)	Amplicon size (bp)	References	
Tetracycline	tetA	F	GGT TCA CTC GAA CGA CGT CA	577	[58]	
R	CTGTCCGACAAGTTGCATGA	
Tetracycline	tetB	F	CCTCAGCTTCTCAACGCGTG	634	[58]	
R	GCACCTTGCTGATGACTCTT	
Tetracycline	tetC	F	AAC AAT GCG CTC ATC GT	1138	[59]	
R	GGA GGC AGA CAA GGT AT	
Erythromycin	ereA	F	GCCGGTGCTCATGAACTTGAG	419	[58]	
R	CGACTCTATTCGATCAGAGGC	
Beta lactam	blaTEM	F	ATA AAA TTC TTG AAG AC	1076	[59]	
R	TTA CCA ATG CTT AATCA	
Beta lactam	blaSHV	F	TCGCCTGTGTATTATCTCCC	768	[58]	
R	CGCAGATAAATCACCACAATG	
Beta lactam	blaCMY	F	TGGCCAGAACTGACAGGCAAA	462	[58]	
R	TTTCTCCTGAACGTGGCTGGC	
Sulphur	sul1	F	TTCGGCATTCTGAATCTCAC	822	
R	ATGATCTAACCCTCGGTCTC	
Streptomycin	aadA1	F	TATCCAGCTAAGCGCGAACT	447	
R	ATTTGCCGACTACCTTGGTC	
Methicillin	mecA	F	AAAATCGATGGTAAAGGTTGGC	533	[60]	
R	AGTTCTGGAGTACCGGATTTGC	
Gentamicin	aac(3)-IV	F
R	CTTCAGGATGGCAAGTTGGT
TCATCTCGTTCTCCGCTCAT	286	[58]	

2.6 Statistical analysis

The entry of results was done using Excel 2013 spreadsheet (Microsoft Office 2013, Microsoft, Los Angeles, CA, USA) and the analysis was performed using the Statistical Package for Social Science- SPSS (IBM SPSS 25, IBM, Chicago, IL, USA). Frequencies, and percentage occurrence for each isolate or resistance gene were used to summarize the result and presented using Tables and Figures [61].

3 Results

3.1 Isolation and identification of E. coli, Salmonella spp. andS. aureus

Three bacterial species were isolated from the poultry samples collected in the four districts of Mymensingh division. Out of 120 samples analyzed, 90 (50 %) were suspected as E. coli, 31(17 %) as Salmonella spp. and 58 (32 %) as S. aureus based on their cultural and staining properties (Table 3).Table 3 Bacterial isolation rate from poultry samples based on culture and staining properties.

Table 3Sample type	No. of samples	E.coli	Bacteria
Salmonella spp.	S.aureus	
Broiler faeces	20	19	16	8	
Broiler meat	20	17	1	12	
Layer faeces	20	18	10	4	
Layer meat	20	20	Nil	3	
Layer egg	30	10	2	23	
Duck egg	10	6	2	8	
Total	120	90 (50 %)	31 (17 %)	58 (32 %)	

3.2 Phenotypic characteristics of the recovered isolates

The E. coli produced black colored colonies with metallic sheen, Salmonella spp. produced black centered, smooth, small and round colonies while Staphylococcus produced small rounded colonies which changed the color of media to metallic yellow. Both E. coli and Salmonella spp. were gram-negative rods while S. aureus was gram-positive cocci with cluster arrangement.

3.3 Genotypic detection of the recovered isolates based on PCR assay

The PCR amplification of fliC gene for the detection of E. coli confirmed all isolates to be positive by the amplification of fliC gene at the 401bp. Similarly, the PCR amplification of invA gene for the detection of Salmonella genus confirmed the suspected genus isolates at 284 bp. The S. aureus isolates were confirmed by the amplification of nuc gene at the 155 bp. All the 90 culture positive E. coli isolates were confirmed by PCR with the detection rate of 100 %. Sixteen isolates out of 31 suspected Salmonella isolates were confirmed by PCR and the isolation rate was 51.6 %. Among the 58 culture positive isolates, 53 (91.3 %) were PCR positive for Staphylococcus aureus.

3.4 Overall antimicrobial resistance pattern of E.coli, Salmonella spp. and S.aureus isolated from poultry faeces in Mymensingh division

The result of the antimicrobial resistance pattern of isolates from poultry faeces showed that all (100 %) isolates of the E. coli, Salmonella spp. and S. aureus were resistant to Amoxicillin. In addition, all (100 %) of the Salmonella and S. aureus were resistant to Doxycycline, while (100 %) of the Salmonella isolates were resistant to Enrofloxacin. It was also observed that (100 %) each of Salmonella spp. and S. aureus were resistant to erythromycin and tetracycline. The study also revealed that all (100 %) Salmonella spp. isolates were susceptible to gentamycin (Fig. 1). Relatively lower susceptibility of E. coli to neomycin and gentamicin was observed. Salmonella also showed decreased susceptibility to levofloxacin and neomycin. Staphylococcus also showed decreased susceptibility to neomycin, levofloxacin and gentamicin. The results of this study revealed that all of the isolates had multiple antibiotic resistance index (MAR) above 0.2, with the exception of one isolate that had an MAR index of 0.2.Fig. 1 Antimicrobial resistance pattern of E. coli,Salmonella spp. and S.aureus isolated from poultry faeces in Mymensingh division. Infectious agents (bacteria) are classified as "susceptible as S," "intermediate as I," or "resistant as R″ to specific antibiotics.

Fig. 1

3.5 Antimicrobial resistance pattern of E.coli and S.aureus isolated from poultry meat in Mymensingh division

The result of the antimicrobial resistance pattern of isolates from poultry meat showed that all (100 %) E. coli isolates were resistant to Amoxycillin, while all (100 %) S. aureus isolates were resistant to Amoxicillin, Ciprofloxacin, Doxycycline, Enrofloxacin, Erythromycin, Levofloxacin, Tetracycline and Sulphur drug (Fig. 2).Fig. 2 Antimicrobial resistance pattern of E. coli and S.aureus isolated from poultry meat in Mymensingh division. Infectious agents (bacteria) are classified as "susceptible as S," "intermediate as I," or "resistant as R″ to specific antibiotics.

Fig. 2

3.6 Antimicrobial resistance pattern of E. coli, Salmonella spp. and S. aureus isolated from poultry eggs in Mymensingh division

The result of the antimicrobial resistance pattern of isolates from poultry egg showed that all (100 %) of E. coli, Salmonella spp. and S. aureus isolates were resistant to Amoxicillin. While all the Salmonella isolates (100 %) were susceptible to Gentamicin, Levofloxacin and Tetracycline (Fig. 3).Fig. 3 Resistance pattern of E. coli,Salmonella spp. and S.aureus isolated from poultry eggs in Mymensingh division. Infectious agents (bacteria) are classified as "susceptible as S," "intermediate as I," or "resistant as R″ to specific antibiotics.

Fig. 3

3.7 The occurrence of MDR and XDR among the recovered isolates from poultry faeces, meat and eggs in Mymensingh division

A total of 89 isolates were found MDR and 68 isolates were found XDR among the 179 isolates of E. coli, Salmonella spp. and S. aureus isolated from faeces, meat and egg (Table 4). Highest percentage of MDR was observed by the S. aureus isolates recovered from poultry faeces and meat.Table 4 The occurrence of MDR and XDR among the recovered isolates from poultry faeces, meat and eggs.

Table 4Name of sample	Source of sample	Name of isolate	No. of isolate	No. of drug resistant isolate (%)	
MDR	XDR	
Faeces	Broiler	E.coli	19	5 (26.3 %)	14 (73.7 %)	
Salmonella	16	2 (12.5 %)	13 (81.3 %)	
S.aureus	8	8 (100 %)	–	
Layer	E.coli	18	9 (50 %)	8 (44.4 %)	
Salmonella	10	1 (10 %)	9 (90 %)	
S.aureus	4	4 (100 %)	–	
Meat	Broiler	E.coli	17	16 (94.1 %)	1 (5.9 %)	
Salmonella	1	1 (100 %)	–	
S.aureus	12	12 (100 %)	–	
Layer	E.coli	20	15 (75 %)	5 (255)	
Salmonella	–	–	–	
S.aureus	3	3 (100 %)	–	
Egg	Layer	E.coli	10	2 (20 %)	6 (60 %)	
Salmonella	2	–	2 (100 %)	
S.aureus	23	16 (69.6 %)	2 (8.7 %)	
Duck	E.coli	6	2 (33.3 %)	4 (66.7 %)	
Salmonella	2	–	1 (50 %)	
S.aureus	8	3 (37.5 %)	3 (37.5 %)	
Total	179	89 (49.7 %)	68 (38 %)	
MDR: Multidrug resistance, XDR: Extensively drug resistance.

3.8 Resistance genes detection

For E. coli the sul1 gene was the most abundant followed by tetA (13 %) and then tetB (10 %) and blaSHV (10 %). The least occurring resistant genes in E. coli were the blaCMY and aac (3)-IV with (2 %) occurrence each. Salmonella isolates also had 55 % and 35 % of sul1 and tetB genes with highest occurrence followed by the aadA1(25 %) and blaTEM (24 %) genes. The least occurring was the blaSHV at (3 %). Resistance encoding genes found in Staphylococcus aureus were sul1(41 %), tetB (17 %) while blaCMY and mecA had (2 %) occurrence each. The mecA and aac(3)-IV genes were only found in Staphylococcus aureus and E. coli respectively. The sul1, tetB and aadA1 were highest in Salmonella spp. and Staphylococcus aureus while the sul1, tetA and blaSHV were higher in E. coli. The genotypic resistance pattern in E. coli, Salmonella spp. and Staphylococcus aureus are shown in Fig. 4, Fig. 5, Fig. 6, respectively.Fig. 4 Genotypic resistance pattern in E.coli.

Fig. 4

Fig. 5 Genotypic resistance pattern in Salmonella spp.

Fig. 5

Fig. 6 Genotypic resistance pattern in Staphylococcusaureus.

Fig. 6

4 Discussion

Antibiotic resistant pathogens and other disease causing organisms can be found in the environment from farm effluence or agricultural manure that eventually find their way into the food chain [62]. Insufficient documented data in the poultry sector of Bangladesh, hinders safe poultry production, despite the importance of the sector to the national economy [63]. In this study E. coli, Salmonella spp., and Staphylococcus species were isolated from poultry food product and by-product. Many researches have shown multidrug resistant Salmonella spp. emanating from overuse of antibiotics [64,65]. In fact many countries have reported the prevalence of extended-spectrum β-lactamases from poultry sourced protein [[66], [67], [68]].

Methicillin-resistant Staphylococcus is known to invade food animals of great public health significance [69]. Staphylococcus aureus from eggs and faeces of poultry have been reported to cause problems in many instances [20,70]. Salmonella spp. from infected poultry faeces may contaminate the egg shells and penetrate the interior of eggs, causing bacteria to grow inside [71]. It has been established that the presence of Salmonella spp. in more than 25 % of poultry meat is considered unsafe for human consumption [72]. In this study we found 28.9 % Salmonella spp. from eggs samples. However, Fearnley et al. [73], studied the presence of Salmonella spp. in chicken meat, eggs and humans, in Adelaide, South Australia and reported the absence of Salmonella spp. in all eggs sampled.

Poultry meat should be completely free from E. coli before consumption because of the nature and severity of the disease that can be caused by the bacteria in human [72]. E. coli is often used as a safety indicator for microbiological significance in food borne pathogens screening [74]. In this research there was an isolation rate of (56.6 %) for E. coli which is close to the (63.5 %) detection rate obtained by Rahman et al., [75]. In the study of Rahman et al. [75], the overall prevalence of E. coli in chicken meat was 63.5 %, which is similar to the findings of this study which was 41.1 %. In our study 85 % of the meat samples from broiler and all 100 % of the meat samples from layer birds tested positive for E. coli. In this regard previous study showed 65.67 % broiler meat and 61.33 % layer meat samples tested positive for E. coli [75]. However, Jakaria et al. [76], reported that in Bangladesh, the prevalence rates of E. coli in layer and broiler chicken were 78.67 % and 82 % respectively.

S.aureus is among the most common cause of clinical infections globally and has attracted substantial public attention due to the increased mortality associated with the multidrug resistant bacteria. Contrary to this study where the isolation rate for S. aureus was 33.3 %, the isolation rate of S. aureus was 14 % in the previous study by Al-Humam and Mohamed [77], when they monitored Escherichia coli, Salmonella spp. and Staphylococci aureus found in poultry based fast foods. However, our finding was lower than the isolation rate (100 %) from chicken meat in another study reported by Lika et al., [78].

This variation in isolation rate of the three bacterial organisms in the present study and other previous studies from various locations may be due to differences in study methodology, gene-specific involvement, sample types, sample size and hygiene practices in farms, and geographic locations. The difference in prevalence reported might also be attributed to the collection of samples from apparently healthy birds [79]. The isolation of three bacterial species in the present study is an indication of the level of contamination in the poultry products.

The detection of invA gene in poultry samples as seen in this study, implies that these isolates have the ability to invade cells and survive in macrophages [80]. WHO [81], stated that Salmonella spp. has serovars harbouring the virulent invA gene causing salmonellosis globally. The isolation of Salmonella spp. carrying invasion invA gene in this study may indicate the poor sanitation of the poultry farms environment under which birds are kept with an increased burden for foodborne infections.

The detection of S. aureus from poultry samples in this current study is similar to the detection rate obtained by Islam et al. [82], in chicken from Bangladesh. In addition, detection of nuc gene in this study is similar to the previously published report by Islam et al., [82].

The antibiotic susceptibility pattern of the collected isolates from poultry faeces revealed that all (100 %) E. coli isolates were resistant to amoxicillin, while all the (100 %) Salmonella isolates were resistant to amoxicillin, doxycycline, Enrofloxacin, erythromycin and tetracycline. The S. aureus isolates were all (100 %) resistant to amoxicillin, doxycycline and erythromycin. The Salmonella spp. isolates were all (100 %) susceptible to gentamycin and 86 % to neomycin. A previous study conducted by Akond et al. [83], reported a prevalence of 82 % for E. coli from poultry samples in Bangladesh, while 67.7 % and 69.8 % from Nigeria in poultry and cloacal swabs, respectively [84,85]. A possible explanation for the difference between the studies carried out in northern Nigeria by Akond et al. [83], and our present study could be due to the sample types collected as our study isolated E. coli from freshly dropped chicken faecal samples as opposed to cloacal swabs. The similarity observed between our present study findings and that of other studies may be due to similarities in poultry farming practices. The susceptibility result of the isolates from poultry meat in the current study showed that all (100 %) of the E. coli isolates from poultry meat were resistant to amoxicillin, enrofloxacin, erythromycin, levofloxacin and tetracycline, while all (100 %) the S. aureus isolates from poultry meat were resistant to amoxicillin, ciprofloxacin, doxycycline, enrofloxacin, erythromycin, levofloxacin, tetracycline and sulphur drugs.

The result of the E. coli isolates from poultry eggs in the present study showed that all (100 %) isolates were resistant to amoxicillin and erythromycin, while all (100 %) of the E. coli isolates were resistant to ciprofloxacin and erythromycin. All (100 %) Salmonella isolates were susceptible to doxycycline, gentamicin, levofloxacin and tetracycline. For the S. aureus isolates from poultry egg the susceptibility result revealed that all (100 %) of the isolates were resistant to amoxicillin. In this study all (100 %) Staphylococcus aureus isolates were resistant to Amoxycillin, which is contrary to the previous study by Elsohaby et al. [86], who reported that all the Staphylococcus aureus isolates were susceptible to Amoxycillin.

Serious human health concerns worldwide have been attributed to multi-drug resistant producing E. coli strains from poultry meat [87]. All the bacterial isolates in this study were multidrug resistant showing resistance to between 5 and 6 different classes of antibiotics, is similar to that report by Afayibo et al. [88], from Eastern China where all E. coli isolates were multi-drug resistant (MDR). Bamidele et al. [89], reported that the prevalence of MDR was highest in E. coli as compared to Pseudomons, Salmonella or Klebsiella, even though all were MDR with multiple antibiotic resistant index (MAR) ≥ 0.2. Awosan et al. [90], reported high level of MDR E. coli to be resistant to aminoglycosides, quinolones, tetracycline, sulfonamides classes of antibiotics. High resistance rates of E. coli isolates to beta-lactams, tetracyclines, macrolides, and sulfonamides was also previously reported by Briñas et al., [91]. This finding is not surprising as these antimicrobials are easily accessible and commonly used in poultry production for preventive as well as therapeutic purposes especially in the absence of antimicrobial stewardship programs [91]. Talebiyan et al. [92], also reported multidrug resistance (MDR) of all E. coli isolates from diseased poultry. In another study Tadesse et al. [93], reported that E. coli isolates from human clinical samples carry the same resistant genes as those found in livestock probably due to indiscriminate discharge of residues into the environment [94].

The emergence of multi drug resistant food borne and environmental pathogens reflects evolutionary process that might have taken place as the animals were being exposed to antibiotics [95,96]. The resistance of bacterial pathogens to antibiotics can also occur due to inheritance and horizontal gene transfer, which is more likely to be happen in locations where antibiotics use is frequent [96]. The implication of a multidrug resistant pathogen is that; it becomes more pathogenic compared to non-multidrug resistant pathogens [97]. They also make treatment difficult in infected patients [98] and there is additional cost of treatment, as well as additional days in hospital stay [99]. Multi drug resistant pathogens have a greater risk of causing death e.g. Methicillin resistant Staphylococcus aureus (MRSA) of infected individuals have been estimated to be 64 % more likely to die than Methicillin Susceptible Staphylococcus aureus (MSSA) infected individuals. The spread of bacterial resistance in the population can be revealed by measurement of multiple antibiotic resistances (MAR) index [100]. The result of MAR index of the isolates revealed that all the isolates had MAR index above 0.2, with the exception of one isolate that had an MAR index of 0.2, an indication that these isolates originated from a high-risk source of contamination e.g., farm animals that are frequently exposed to antibiotics [101]. Any bacterial strain exhibiting MAR index values lower than 0.2 is thought to originate from sources, in which antibiotics are seldom or never used (lower risk). Multiple antibiotic resistance in bacterial spp. has been attributed to antimicrobial selective pressure and gene transfer mechanisms between and among isolates and close relatives. Infections caused by resistant microorganisms may result in failure to respond to treatment, result in prolonged illness, higher health care expenditure and greater risk of death [102].

In this study, the presence of tetA (32 %) and tetB (8 %) genes may be attributed to the high resistance rates against tetracycline. In a previous study by Enany et al. [103], from Egypt, high resistance rates were also observed against amoxicillin (100.0 %) and tetracycline (100 %) which is in line with our present study. They stated that the presence of the tetA and tetB genes may be responsible for this high resistance to tetracycline. The prevalence of tetA and tetB, suggests that tetracycline is frequently used on these poultry farms from the study area.

We detected beta lactam resistance encoding genes (blaTEM, blaSHV, and blaCMY). The blaTEM, a β-lactamase gene, is the most common mechanism of resistance in E. coli, and was previously detected in resistant E. coli isolates from foods, humans, and healthy animals [91], as found in the present study. Murray et al. [104], also detected extended spectrum beta lactamase (blaTEM, blaSHV, and blaCMY) in their isolates. Cheng et al. [105], also reported market sourced chicken samples to be potential reservoirs of antibiotic resistant genes (ARGs). The quinolone-resistance genes, aac (8.0 %) was reported in this study, which is less frequent than the report of Abdullah et al., [106].

Our study revealed the Sul1 gene to be the most frequently found resistance gene in the isolates studied (E. coli, Salmonella spp. and Staphylococcus aureus). These results are in agreement with a similar work that reported the presence of the Sul1 gene in all isolated E. coli strains from raw chicken meat sold in supermarkets in the city of Taif of Saudi Arabia by Soufi et al., [107]. Kim and Cho [108] also detected sulphonamide harbouring the resistance gene (Sul1) in E. coli strains isolated from chicken and turkey meat sampled from a food processing plant in Tunisia.

The low (36 %) and high (100 %) susceptibility of the Salmonella isolates from poultry faeces and egg, respectively towards ciprofloxacin in this study provokes questions about the efficiency of this antibiotic in future which is also similar to the result of Kim and Cho [108] where they studied the resistance of Salmonella isolates from poultry farms, hatcheries and slaughter houses and found high resistance to ciprofloxacin, levofloxacin, and nalidixic acid.

Indiscriminate use of antimicrobials led to growth and spreading the MDR pathogens causes financial losses not only in the poultry production but also public health sector in Bangladesh; however, the precise data regarding these financial losses are not well documented. Economic losses are due to high treatment and management costs, loss of production and mortality in poultry farm [28].

Based on our current finding, we believed that further research can look into the use of new techniques that have been developed to tackle drug resistance problem in human and animals which may include the use of nanotechnology for effective drug delivery. In this regard, Chitosan, which is a cockle shell sugar derivative that can be used in nanotechnology backed drug delivery has anti-microbial activity, low molecular weight and economically low cost [109]. Therefore, further work can be done to look into the use of chitosan or other low molecular weight particles for cost-effective antibiotics drug delivery aimed at challenging the existing mechanisms of resistance in a wide range of antibiotic agents. Finally, the current study data indicated that there is a high risk of transmitting antibiotic resistance genes or MDR pathogens in foods of poultry origin from microbial contamination. Strict monitoring measures need to be taken to tackle the indiscriminate use of antibiotics in the poultry production cycle, which could mitigate the detrimental effects of antibiotic resistance.

5 Conclusions

The role of food products from poultry for the spread of antibiotic resistant pathogens and genes cannot be underestimated. Based on the result of our study, raw poultry products and by-products (faeces) from farm remain a potential source of transmitting pathogenic and antibiotic resistant bacteria. The isolation rate for E. coli, Salmonella spp. and Staphylococcus aureus were higher in raw poultry products and by-products. All the samples were resistant to most antibiotics tested indicating MDR pathogen regardless of the sample source. The study also revealed that all the isolates had an MAR index above 0.2, with the exception of one isolate. In addition, the collected isolates harboured tetA, tetB, blaTEM, blaSHV, blaCMY, sul1, aadA1, ereA and aac(3) resistant genes. Although the antibiotics gentamycin, neomycin, levofloxacin, doxycycline and tetracycline remained effective against the isolated isolates. Finally, we conclude that poultry products (meat and eggs) and their by-products (faeces) could be a source and disseminator of antibiotic resistant foodborne pathogens not only in poultry farming environment but also human and environment. This result highlights the importance of performing sensitivity test before prescribing antimicrobials, continued surveillance, policy formulation, implementation and awareness building training of poultry farmers to reduce the detrimental effects of MDR pathogens in humans, animals and the environment.

Additional information

No additional information is available for this manuscript.

Funding

The research was funded by the Project Based Research Grant (PBRG) support of National Agricultural Technology Project-2 (NATP-2) of 10.13039/100020982 Bangladesh Agricultural Research Council to Professor Dr. Kazi Rafiqul Islam (Kazi Rafiq) [Project ID-138 ].

Institutional review board statement

The study protocol was authorized by the Animal Welfare and Experimentation Ethics Committee of Bangladesh Agricultural University, Mymensingh, Bangladesh [approval number: AWEEC/BAU/2018(31); date 30. 12. 2018].

Data availability

Upon reasonable request, the corresponding author will provide the data Grant this work.

CRediT authorship contribution statement

Kazi Rafiq: Writing – review & editing, Writing – original draft, Supervision, Project administration, Investigation, Funding acquisition, Data curation, Conceptualization. Aminatu Abubakar Sani: Writing – original draft, Investigation, Formal analysis, Data curation. Muhammad Tofazzal Hossain: Writing – review & editing, Validation, Supervision, Resources, Methodology, Formal analysis, Data curation, Conceptualization. Md Tarek Hossain: Writing – review & editing, Methodology, Formal analysis, Data curation. Md Hadiuzzaman: Visualization, Validation, Methodology, Investigation, Formal analysis, Data curation. Mohammad Abdus Sattar Bhuiyan: Writing – review & editing, Software, Resources, Investigation, Data curation.

Declaration of competing interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Kazi Rafiq reports financial support, administrative support, and equipment, drugs, or supplies were provided by 10.13039/100020982 Bangladesh Agricultural Research Council , Dhaka, Bangladesh. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

The authors acknowledge the Project Based Research Grant (PBRG) support from National Agricultural Technology Project-2 (NATP-2), 10.13039/100020982 Bangladesh Agricultural Research Council (10.13039/100020982 BARC ), Dhaka, Bangladesh, and 10.13039/100019278 Bangladesh Agricultural University Research System (10.13039/100019278 BAURES ), BAU, Mymensingh for project management & monitoring.
==== Refs
References

1 Tiseo K. Huber L. Gilbert M. Robinson T.P. Van Boeckel T.P. Global trends in antimicrobial use in food animals from 2017 to 2030 Antibiotics 9 12 2020 918 33348801
2 Aworh M.K. Kwaga J. Okolocha E. Mba N. Thakur S. Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria PLoS One 14 11 2019 0225379
3 Ferdous M.R. Ahmed M.R. Khan S.H. Mukta M.A. Anika T.T. Hossain M.T. Islam M.Z. Rafiq K. Effect of discriminate and indiscriminate use of oxytetracycline on residual status in broiler soft tissues Vet. World 13 1 2020 61 32158152
4 Nisha A.R. Antibiotic residues - a global health Hazard Vet. World 1 2008 375 377
5 Singh S. Shukla S. Tandia N. Kumar N. Paliwal R. Antibiotic residues: a global challenge Pharma Sci. Monit. 5 2014 184 197
6 Tajick M.A. Shohreh B. Detection of antibiotics residue in chicken meat using TLC Int. J. Poultry Sci. 5 2006 611 612
7 Blair J.M. Webber M. Baylay A.J. Ogbolu D.O. Piddock L.J. Molecular mechanisms of antibiotic resistance Nat. Rev. Microbiol. 13 1 2015 42 51 25435309
8 Loveday S.M. Food proteins: technological, nutritional, and sustainability attributes of traditional and emerging proteins Annu. Rev. Food Sci. Technol. 110 2019 311 339
9 Rouger A. Tresse O. Zagorec M. Bacterial contaminants of poultry meat: sources, species, and dynamics Microorganisms 5 3 2017 50 28841156
10 Hedman H.D. Vasco K.A. Zhang L. A review of antimicrobial resistance in poultry farming within low-resource settings Animals 10 8 2020 1264 32722312
11 Castro-Vargas R.E. Herrera-Sánchez M.P. Rodríguez-Hernández R. Rondón-Barragán I.S. Antibiotic resistance in Salmonella spp. isolated from poultry: a global overview Vet. World 13 10 2020 2070 33281339
12 Argudín M.A. Deplano A. Meghraoui A. Dodémont M. Heinrichs A. Denis O. Nonhoff C. Roisin S. Bacteria from animals as a pool of antimicrobial resistance genes Antibiotics 6 2 2017 12 28587316
13 Singer R.S. Urinary tract infections attributed to diverse ExPEC strains infood animals: evidence and data gaps Front. Microbiol. 6 2015 28 25699025
14 Daini O.A. Ogbulo O.D. Ogunledun A. Quinolones Resistance and R-Plasmids of some Gram-negative enteric bacilli Afr. J. Clin. Exp. Microbiol. 6 2005 14 20
15 Barnes H.J. Gross W.B. Colibacillosi B.W. Calnek Barnes H.J. Beard C.W. McDougald L.R. Saif Y.M. Diseases of Poultry tenth ed. 1997 Iowa State University Press Iowa City, IA, USA
16 Kaper J.B. Nataro J.P. Mobley H.L.T. Pathogenic Escherichia coli Nat. Rev. Microbiol. 2 2 2024 123 140
17 Pitout J. Extraintestinal pathogenic Escherichia coli: a combination of virulence with antibiotic resistance Front. Microbiol. 3 2012 9 22294983
18 Algammal A.M. El-Tarabili R.M. Alfifi K.J. Al-Otaibi A.S. Hashem M.E.A. El-Maghraby M.M. Mahmoud A.E. Virulence determinant and antimicrobial resistance traits of Emerging MDR Shiga toxigenic E. coli in diarrheic dogs Amb. Express 12 1 2022 34 35298727
19 Lee A.S. De Lencastre H. Garau J. Kluytmans J. Malhotra-Kumar S. Peschel A. Harbarth S. Methicillin-resistant Staphylococcus aureus Nat. Rev. Dis. Prim. 4 1 2018 1 23 29930242
20 Devriese L.A. Devos A.H. Van Damme H.L.R. Quantitative aspects of the Staphylococcus aureus flora of poultry Poult. Sci. 514 1975 95 101
21 Algammal A.M. El-Tarabili R.M. Abd El-Ghany W.A. Almanzalawi E.A. Alqahtani T.M. Ghabban H. Al-Otaibi A.S. Alatfeehy N.M. Abosleima N.M. Hetta H.F. Badawy G.A. Resistance profiles, virulence and antimicrobial resistance genes of XDR S. Enteritidis and S. Typhimurium Amb. Express 13 1 2023 110 37817026
22 Badawy B. Elafify M. Farag A.M.M. Moustafa S.M. Sayed-Ahmed M.Z. Moawad A.A. Algammal A.M. Ramadan H. Eltholth M. Ecological distribution of virulent multidrug-resistant Staphylococcus aureus in livestock, environment, and dairy products Antibiotics (Basel, Switzerland) 11 11 2022 1651 36421295
23 Sadat A. Shata R. Farag A. Ramadan H. Alkhedaide A. Soliman M. Elbadawy M. Abugomaa A. Awad A. Prevalence and characterization of PVL-positive Staphylococcus aureus isolated from raw cow's milk Toxins 14 2022 97 35202125
24 Schelin J. Wallin-Carlquist N. Cohn M.T. Lindqvist R. Barker G.C. Rådström P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment Virulence 2 2011 580 592 22030860
25 Akineden O. Annemüller C. Hassan A.A. Lämmler C. Wolter W. Zschöck M. Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis, Clin. Diagn Lab. Immunol. 8 2001 959 964
26 Balasubramanian D. Harper L. Shopsin B. Torres V.J. Staphylococcus aureus pathogenesis in diverse host environments Pathog. Dis. 75 2017 ftx005
27 Mun S.H. Kong R. Seo Y. Zhou T. Kan O. Shin D. Kwon D.Y. Subinhibitory concentrations of punicalagin reduces expression of virulence-related exoproteins by Staphylococcus aureus FEMS Microbiol. Lett. 363 2016 fnw253 27974390
28 Hossain M.J. Attia Y. Ballah F.M. Islam M.S. Sobur M.A. Islam M.A. Ievy S. Rahman A. Nishiyama A. Islam M.S. Zoonotic significance and antimicrobial resistance in Salmonella in poultry in Bangladesh for the heriod of 2011–2021 Zoonotic Dis 1 2021 3 24
29 Attia Y.A. Ellakany H.F. El-Hamid A.A. Bovera F. Ghazaly S. Control of Salmonella enteritidis infection in male layer chickens by acetic acid and/or prebiotics, probiotics and antibiotics Arch. Geflügelk. 76 2012 239 245
30 Guibourdenche M. Roggentin P. Mikoleit M. Fields P.I. Bockemuhl J. Grimont P.A.D. Supplement 2003-2007 (No. 47) to the white-kauffmann-le minor scheme Res. Microbiol. 161 2010 26 29 19840847
31 El-Ghany W.A.A. Salmonellosis: a food borne zoonotic and public health disease in Egypt J. Infect. Dev. Ctries. 14 2020 674 678 32794452
32 Tan S.J. Nordin S. Esah E.M. Mahror N. Salmonella spp. in Chicken: prevalence, antimicrobial resistance, and detection methods Microbiol. Res. 13 4 2022 691 705
33 Vo A.T.T. van Duijkeren E. Fluit A.C. Heck M.E.O.C. Verbruggen A. Maas H.M.E. Distribution of Salmonella enterica serovars from humans, livestock and meat in Vietnam and the dominance of Salmonella Typhimurium phage type 90 Vet. Microbiol. 113 2006 153 158 16337754
34 Jackson B.R. Griffin P.M. Cole D. Walsh K.A. Chai S.J. Outbreak-associated Salmonella enterica serotypes and food commodities, United States, 1998-2008 Emerg. Infect. Dis. 19 2013 1239 1244 23876503
35 Rahman M.T. Sobur M.A. Islam M.S. Ievy S. Hossain M.J. El Zowalaty M.E. Rahman A.T. Ashour H.M. Zoonotic diseases: etiology, impact, and control Microorganisms 8 2020 1405 32932606
36 Islam M.S. Nayeem M.M.H. Sobur M.A. Ievy S. Islam M.A. Rahman S. Kafi M.A. Ashour H.M. Rahman M.T. Virulence determinants and multidrug resistance of Escherichia coli isolated from migratory birds Antibiotics 10 2021 190 33671995
37 Orubu E.S.F. Samad M.A. Rahman M.T. Zaman M.H. Wirtz V.J. Mapping the antimicrobial supply chain in Bangladesh: a scoping-review-based ecological assessment ppproach Glob. Health Sci. Pract. 28 2021 5963 5970
38 Algammal A.M. Ibrahim R.A. Alfifi K.J. Ghabban H. Alghamdi S. Kabrah A. Khafagy A.R. Abou-Elela G.M. Abu-Elala N.M. Donadu M.G. El-Tarabili R.M. A first report of molecular typing, virulence traits, and phenotypic and genotypic resistance patterns of newly emerging XDR and MDR aeromonas veronii in Mugil seheli Pathogens 11 11 2022 1262 36365013
39 Algammal A.M. Eidaroos N.H. Alfifi K.J. Alatawy M. Al-Harbi A.I. Alanazi Y.F. Ghobashy M.O.I. Khafagy A.R. Esawy A.M. El-Sadda S.S. Hetta H.F. El-Tarabili R.M. oprL gene sequencing, resistance patterns, virulence genes, euorum sensing and antibiotic resistance genes of XDR Pseudomonas aeruginosa isolated from broiler chickens Infect. Drug Resist. 16 2023 853 867 36818807
40 Elbehiry A. Marzouk E. Aldubaib M. Moussa I. Abalkhail A. Ibrahem M. Hamada M. Sindi W. Alzaben F. Almuzaini A.M. Algammal A.M. Rawway M. Pseudomonas species prevalence, protein analysis, and antibiotic resistance: an evolving public health challenge Amb. Express 12 1 2022 53 35532863
41 Rafiq K. Islam M.R. Siddiky N.A. Samad M.A. Chowdhury S. Hossain K.M.M. Rume F.I. Hossain M.K. Mahbub-E-Elahi A. Ali M.Z. Antimicrobial resistance profile of common foodborne pathogens recovered from livestock and poultry in Bangladesh Antibiotics 11 2022 1551 36358208
42 Uddin J. Hossain K. Hossain S. Saha K. Jubyda F.T. Haque R. Billah B. Talukder A.A. Parvez A.K. Dey S.K. Bacteriological assessments of foodborne pathogens in poultry meat at different super shops in Dhaka, Bangladesh, Ital J. Food Saf. 8 2019 6720
43 Alam B. Uddin N. Mridha D. Akhter A.H.M.T. Islam S.K.S. Haque A.K.M.Z. Kabir S.M.L. Occurrence of Campylobacter spp. in selected small scale commercial broiler farms of Bangladesh related to good farm practices Microorganisms 8 2020 1778 33202712
44 Hoque M.N. Mohiuddin R.B. Khan M.M. Hannan A. Alam M.J. Outbreak of salmonella in poultry of Bangladesh and possible remedy J. Adv. Biotechnol. Exp. Ther. 2 2019 87
45 Haque M.A. Hossain M.T. Islam M.S. Islam M.Z. Islam P. Shaha S.N. Sikder M.H. Rafiq K. Isolation of multidrug resistant Escherichia coli and Salmonella spp. from sulphonamide treated diarrheic calves Vet. World 15 12 2022 2870 2876 36718340
46 Tawyabur M. Islam M.S. Sobur M.A. Hossain M.J. Mahmud M.M. Paul S. Hossain M.T. Ashour H.M. Rahman M.T. Isolation and characterization of multidrug-resistant Escherichia coli and Salmonella spp. from healthy and diseased turkeys Antibiotics 9 2020 770 33147736
47 Jahan M. Rahman M. Parvej M.S. Chowdhury S.M.Z.H. Haque M.E. Talukder M.A.K. Ahmed S. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh J. Adv. Vet. Anim. Res. 2 2014 49 55
48 Bergey D.H. Buchanan R.E. Gibbons N.E. American Society for Microbiology. Bergey's Manual of Determinative Bacteriology 1974 Williams and Wilkins Co Baltimore
49 Sobur A. Haque Z.F. Sabuj A.A. Ievy S. Rahman A.T. El Zowalaty M.E. Rahman M.T. Molecular detection of multidrug and colistin-resistant Escherichia coli isolated from house flies in various environmental settings Future Microbiol. 14 2019 847 858 31373221
50 Hossain M.T. Kim E.Y. Kim Y.R. Kim D.G. Kong I.S. Application of groEL gene for the species-specific detection of Vibrio parahaemolyticus by PCR Lett. Appl. Microbiol. 54 2012 67e72 22053713
51 Ferasyi T.R. Abrar M. Subianto M. Afrianandra C. Hambal M. Razali R. Ismail I. Nurliana N. Rastina R. Sari W.E. Isolation, identification, and critical points of risk of Escherichia coli O157:H7 contamination at Aceh Cattle Breeding Centre E3S Web Conf. 151 2020 01021
52 Mthembu T.P. Zishiri O.T. El Zowalaty M.E. Molecular detection of multidrug-resistant Salmonella isolated from livestock production systems in South Africa Infect. Drug Resist. 12 2019 3537 31814742
53 Wang Z. Zuo J. Gong J. Hu J. Jiang W. Mi R. Huang Y. Chen Z. Phouthapane V. Qi K. Development of a multiplex PCR assay for the simultaneous and rapid detection of six pathogenic bacteria in poultry Amb. Express 9 2019 185 31728678
54 Bauer R.W. Kirby M.D.K. Sherris J.C. Turck M. Antibiotic susceptibility testing by standard single disc diffusion method American Journal of Chemical Pathology 45 1966 493 496
55 Sani A. Rafiq K. Hossain M.T. Islam P. Islam M.D. Islam M.D. Rahaman M.D.T. Islam M.R. Influence of knowledge on the practice and attitude of poultry farmers on their use of antimicrobial drugs Resistance and Residues in Mymensingh Division of Bangladesh 2023 PhD thesis, Unpublished Data)
56 Clinical Laboratory Standards Institute (CLSI) Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard- 9th Ed. CLSI Document M2-A9. 26:1 2018 Clinical Laboratory Standards Institute Wayne, PA
57 Magiorakos A.P. Srinivasan A. Carey R.B. Carmeli Y. Falagas M.E. Giske C.G. Harbarth S. Hindler J.F. Kahlmeter G. Olsson-Liljequist B. Paterson D.L. Rice L.B. Stelling J. Struelens M.J. Vatopoulos A. Weber J.T. Monnet D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance Clin. Microbiol. Infection 18 3 2012 268 281
58 Momtaz H. Rahimi E. Moshkelani S. Molecular detection of antimicrobial resistance genes in E. coli isolated from slaughtered commercial chickens in Iran Vet. Med. 57 2012 193 197
59 Kim B. Kim J. Seo M.R. Wie S.H. Cho Y.K. Lim S.K. Lee J.S. Kwon K.T. Lee H. Cheong H.J. Clinical characteristics of community-acquired acute pyelonephritis caused by ESBL-producing pathogens in South Korea Infection 41 2013 603 612 23504297
60 Pournajaf A. Ardebili A. Goudarzi L. Khodabandeh M. Narimani T. Abbaszadeh H. PCR-based identification of methicillin–resistant Staphylococcus aureus strains and their antibiotic resistance profiles Asian Pac. J. Trop. Biomed. 4 2014 S293 S297 25183100
61 Dancey C.P. Reidy J. Statistics without Maths for Psychology 2017 Pearson London 632 632
62 Conan A. Goutard F.L. Sorn S. Vong S. Biosecurity measures for backyard poultry in developing countries: a systematic review BMC Vet. Res. 8 1 2012 1 10 22217360
63 Hamid M.A. Rahman M.A. Ahmed S. Hossain K.M. Status of poultry industry in Bangladesh and the role of private sector for its development Asian J. Poultry Sci. 11 1 2017 1 13
64 Barza M. Potential mechanisms of increased disease in humans from antimicrobial resistance in food animals Clin. Infect. Dis. 34 2002 S123 S125 11988882
65 Zhang L. Fu Y. Xiong Z. Ma Y. Wei Y. Qu X. Zhang H. Zhang J. Liao M. Highly prevalent multidrug-resistant Salmonella from chicken and pork meat at retail markets in Guangdong, China Front. Microbiol. 10 9 2018 2104
66 Dahms C. Hubner N.O. Kossow A. Mellmann A. Dittmann K. Kramer A. Occurrence of ESBL-producing Escherichia coli in livestock and farm workers in Mecklenburg-western Pomerania, Germany PLoS One 10 2015 e0143326
67 Ibrahim D.R. Dodd C.E.R. Stekel D.J. Ramsden S.J. Hobman J.L. Multidrug resistant, extended spectrum beta-lactamase (ESBL)-producing Escherichia coli isolated from a dairy farm FEMS Microbiol. Ecol. 92 2016 13
68 Zhao X. Ye C. Chang W. Sun S. Serotype distribution, antimicrobial resistance, and class 1 integrons profiles of Salmonella from animals in slaughterhouses in Shandong Province, China Front. Microbiol. 8 2017 1049 28680418
69 Lee A.S. De Lencastre H. Garau J. Kluytmans J. Malhotra-Kumar S. Peschel A. Harbarth S. Methicillin-resistant Staphylococcus aureus Nat. Rev. Dis. Prim. 4 1 2018 1 23 29930242
70 Syed M.A. Ullah H. Tabassum S. Fatima B. Woodley T.A. Ramadan H. Jackson C.R. Staphylococci in poultry intestines: a comparison between farmed and household chickens Poultry Sci. 99 9 2020 4549 4557 32867999
71 AbouElez R.M.M. Elsohaby I. El-Gazzar N. Tolba H.M.N. Abdelfatah E.N. Abdellatif S.S. Antimicrobial resistance of Salmonella enteritidis and Salmonella typhimurium isolated from laying hens, table eggs, and humans with respect to antimicrobial activity of biosynthesized silver nanoparticles Animal 11 12 2021 3554
72 Adeyenju G.T. Ishola O. Salmonella and Escherichia coli contamination of poultry meat from a processing plant and retail markets in Ibadan Oyo State 3 2014 139 Nigeria, Springer plus
73 Fearnley E. Raupach J. Lagala F. Cameron S. Salmonella in chicken meat, eggs and humans; Adelaide, South Australia Int. J. Food Microbiol. 146 3 2011 219 227 21429610
74 Foddai A.C. Grant I.R. Methods for detection of viable foodborne pathogens: current state-of-art and future prospects Appl. Microbiol. Biotechnol. 104 10 2020 4281 4288 32215710
75 Rahman M.M. Husna A. Elshabrawy H.A. Alam J. Runa N.Y. Badruzzaman A.T.M. Banu N.A. Al Mamun M. Paul B. Das S. Rahman M.M. Mahbub-E-Elahi A.T.M. Khairalla A.S. Ashour H.M. Isolation and molecular characterization of multidrug-resistant Escherichia coli from chicken meat Sci. Rep. 10 2020 21999
76 Jakaria A. Islam M.A. Khatun M.M. Prevalence, characteristics and Antibiogram profiles of Escherichia coli isolated from apparently healthy chickens in Mymensingh, Bangladesh Microb. Health 1 1 2012 27 29
77 Al-Humam N. Mohamed A. Monitoring of Escherichia coli, Salmonella spp. and Staphylococci in poultry meat-based fast food in Saudi Arabia Adv. Microbiol. 12 2022 159 176
78 Lika E. Puvǎca N. Jeremić D. Stanojević S. ShtyllaKika T. Cocoli S. de Llanos Frutos R. Antibiotic susceptibility of Staphylococcus species isolated in raw chicken meat from retail ftores Antibiotics 10 2021 904 34438954
79 Tizard I. Salmonellosis in wild birds, aemin. Avian sxot Pet Med. 13 2004 50 66
80 Gole V.C. Chousalkar K.K. Roberts J.R. Survey of Enterobacteriaceae contamination of table eggs collected from layer flocks in Australia Int. J. Food Microbiol. 164 2–3 2013 161 165 23680799
81 World Health Organization Global Salm-SurvProgress Report (2000-2005): Building Capacity for Laboratory-Based Foodborne Disease Surveillance and Outbreak Detection and Response 2015 World Health Organization Geneva
82 Islam N.N. Akter M. Kader Z.F.A. Inkeyas Uddin A.M.A.M. Siddiki Z. Kamaruddin K.M. Detection of Staphylococcus aureus in frozen chicken rinse through bacteriological and nuc gene specific PCR methods and their drug resistance patterns in southern Chittagong, Bangladesh Res. J. Microbiol. 9 2014 251 264
83 Akond M.A. Alam S. Hassan S.M.R. Shirin M. Antibiotic resistance of Escherichia coli Isolated from poultry and poultry environment of Bangladesh Am. J. Environ. Sci. 5 1 2009 47 52
84 Kwoji I.D. Musa J.A. Daniel N. Mohzo D.L. Bitrus A.A. Ojo A.A. Extended-spectrum beta-lactamase-producing Escherichia coli in chickens from small-scale (backyard) poultry farms in Maiduguri, Nigeria Int. J. One Health 5 2019 26 30
85 Geidam Y.A. Ambali A.G. Onyeyili P.A. Detection and antibiotic sensitivity pattern of avian pathogenic Escherichia coli strains among rural chickens in the arid region of north-eastern Nigeria Vet. World 5 2012 325
86 Elsohaby I. Samy A. Elmoslemany A. Alorabi M. Alkafafy M. Aldoweriej A. Al-Marri T. Elbehiry A. Fayez M. Migratory wild birds as a potential disseminator of antimicrobial-resistant bacteria around Al-Asfar Lake, Eastern Saudi Arabia Antibiotic 10 2021 260
87 Trkov M. Molecular Characterization of Escherichia coli strains isolated from different food sources Food Technol. Biotechnol. 52 2 2014 255 262
88 Afayibo D.J.A. Zhu H. Zhang B. Yao L. Abdelgawad H.A. Tian M. Qi J. Liu Y. Wang S. Isolation, molecular characterization, and antibiotic resistance of avian pathogenic Escherichia coli in Eastern China Vet. Sci. 9 2022 319 35878336
89 Bamidele O. Yakubu A. Joseph E.B. Amole T.A. Antibiotic resistance of bacterial isolates from smallholder poultry droppings in the Guinea Savanna Zone of Nigeria Antibiotics 11 7 2022 973 35884227
90 Awosan K.J. Ibitoye P.K. Abubakar A.K. Knowledge, risk perception and practices related to antibiotic resistance among patent medicine vendors in Sokoto metropolis, Nigeria, Niger J. Clin. Pract. 21 11 2018 1476 1483
91 Briñas L. Zarazaga M. Sáenz Y. Ruiz-Larrea F. Torres C. β-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals Antimicrob. Agents Chemother. 46 2002 3156 3163 12234838
92 Talebiyan R. Kheradmand M. Khamesipour F. Rabiee-Faradonbeh M. Multiple antimicrobial resistance of Escherichia coli isolated from chickens in Iran Vet. Med. Int. 2014 1 4
93 Tadesse D.A. Zhao S. Tong E. Ayers S. Singh A. Bartholomew M.J. McDermott P.F. Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950–2002 Emerg. Infect. Dis. 18 2012 741 22515968
94 Samtiya M. Matthews K.R. Dhewa T. Puniya A.K. Antimicrobial resistance in the food chain: trends, mechanisms, pathways, and possible regulation strategies Foods 11 19 2022 2966 36230040
95 Levy S.B. Balancing the drug- resistance equation Trends Microbiol. 2 1994 341 342 7850197
96 Witte W. International dissemination of antibiotics resistant strains of bacterial pathogens Japanese Journal of Infectious Disease 63 2004 317 322
97 Foley S.L. Lynne A.M. Food animal- associated Salmonella challenges: pathogenicity and antimicrobial resistance J. Anim. Sci. 86 2008 173 187 17911232
98 Adzitey F. Huda Ali N.G.R.R. Manual C.S. Isolation and characterisation of unidentified Listeria strains showing phenotypic and genetic similarities to a novel group of Listeria species from Malysian Pekin ducks J. Biol. Sci. 13 2013 614 620
99 Buzby J.C. Roberts T. Economic costs and trade impacts of microbial foodborne illness World Health Organisation Statistic Quarterly 50 1–2 1997 57 66
100 Krumperman P.H. Multiple antibiotics resistance indexing Escherichia coli to identify risk sources of faecal contamination of foods Appl. Environ. Microbiol. 46 1993 165 170
101 Wong W.C. Pui C.F. Tunung R. Ubong A. Noor Hidayah M.S. Farinazleen M.G. Noorlis A. Cheah Y.K. Son R. Antibiogram pattern among cultures of Listeria monocytogenes isolated from frozen burger patties in Malaysia Pertanika J. Trop. Agric. Sci. 35 4 2012 793 804
102 AbouElez R.M.M. Elsohaby I. El-Gazzar N. Tolba H.M.N. Abdelfatah E.N. Abdellatif S.S. Antimicrobial resistance of Salmonella enteritidis and Salmonella typhimurium isolated from laying hens, table eggs, and humans with respect to antimicrobial activity of biosynthesized silver nanoparticles Animal 11 12 2021 3554
103 Enany M.E. Algammal A.M. Nasef S.A. Abo-Eillil S.A.M. Bin-Jumah M. Taha A.E. The occurrence of the multidrug resistance (MDR) and the prevalence of virulence genes and QACs resistance genes in E. coli isolated from environmental and avian sources Amb. Express 9 2019 192 31797067
104 Murray M. Salvatierra G. Dávila-Barclay A. Ayzanoa B. Castillo-Vilcahuaman C. Huang M. Pajuelo M.J. Lescano A.G. Cabrera L. Calderón M. Berg D.E. Market chickens as a source of antibiotic-resistant Escherichia coli in a Peri-urban community in Lima, Peru Front. Microbiol. 12 2021 635871
105 Cheng P. Yang Y. Li F. Li X. Liu H. Fazilani S.A. Guo W. Xu G. Zhang X. The prevalence and mechanism of fluoroquinolone resistance in Escherichia coli isolated from swine farms in China BMC Vet. Res. 16 1 2020 1 9 31900161
106 Abdullah D.A. Youssuf A.G. Sabry A.H. Antibiotic Resistance in Escherichia coli isolated from retail raw chicken meat in Taif, Saudi Arabia Food borne Pathogens and Disease 7 3 2010 281 285
107 Soufi L. Abbassi M.S. Sáenz Y. Vinué L. Somalo S. Zarazaga M. Abbas A. Dbaya R. Khanfir L. Ben Hassen A. Hammami S. Torres C. Prevalence and diversity of integrons and associated resistance genes in Escherichia coli isolates from Poultry Meat Foodborne Pathogens in Tunisia and Disease 6 9 2009 1067 1073
108 Kim K. Cho H.J.K. Prevalence and characterization of plasmid-mediated quinolone resistance genes in Salmonella isolated from poultry in Korea Avian Pathol. 42 3 2013 221 229 23607509
109 Ghosh D. Pramanik A. Sikdar N. Ghosh S.K. Pramanik P. Amelioration studies on optimization of low molecular weight chitosan nanoparticle preparation, characterization with potassium per sulphate and silver nitrate combined action with aid of drug delivery to tetracycline resistant bacteria Int. J. Pharmaceut. Sci. Drug Res. 2 4 2010 247 253
