
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)12860-5
10.1016/j.heliyon.2024.e36829
e36829
Research Article
Optimal liquid-based DNA preservation for DNA barcoding of field-collected fungal specimens
Lee Yu-Ja a1
Phang Guan Jie a1
Chen Che-Chih cd
Ou Jie-Hao de
Fan Yu-Hsuan a
Huang Yin-Tse ythuangmyco@gmail.com
ythuangmyco@kmu.edu.tw
ab⁎
a Department of Biomedical Science and Environment Biology, Kaohsiung Medical University, Kaohsiung, 80708, Taiwan
b Department of Medical Research, Kaohsiung Medical University Hospital, Kaohsiung, 80708, Taiwan
c Department of Biology, National Museum of Natural Science, Taichung, 404605, Taiwan
d Department of Plant Pathology, National Chung Hsing University, Taichung, 402202, Taiwan
e Tohoku Agricultural Research Center, National Agriculture and Food Research Organization (NARO), Morioka, 0200123, Japan
⁎ Corresponding author. Department of Biomedical Science and Environment Biology, Kaohsiung Medical University, Kaohsiung, 80708, Taiwan. ythuangmyco@gmail.comythuangmyco@kmu.edu.tw
1 co-first authorship.

24 8 2024
15 9 2024
24 8 2024
10 17 e3682920 12 2023
22 8 2024
22 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Preserving fungal tissue DNA in the field is essential for molecular ecological research, enabling the study of fungal biodiversity and community dynamics. This study systematically compares two liquid-based preservation solutions, RNAlater and DESS, for their effectiveness in maintaining macrofungi DNA integrity during field collection and storage. The research encompasses both controlled experiments and real-world field collections. In the controlled experiments, two fungal species were preserved in RNAlater and DESS at different temperatures and durations. DNA extraction success rates were high, but DNA quality and quantity metrics exhibited variations across samples. However, both preservation solutions demonstrated their viability for preserving fungal DNA, with no significant differences between them. In the field-collected macrofungi experiment, 160 paired fungal specimens were preserved in RNAlater and DESS, respectively. Including a drying process to facilitate tissue lysis for DNA extraction significantly impacted the outcomes. RNAlater showed a higher success rate and better DNA quality and quantity compared to DESS. Statistical analysis, including paired and independent t-tests, confirmed significant differences in DNA quality and quantity between the two preservation methods for field-collected samples. This study evaluates RNAlater and DESS for preserving macrofungi DNA in field conditions. Both methods are effective, but RNAlater is superior when a drying step is included in DNA extraction. Researchers can choose based on their specific needs without compromising DNA integrity. These findings advance fungal molecular ecology and DNA preservation strategies in ecological and environmental studies.

Keywords

Liquid-based preservation
Field specimen storage
Macrofungi
Fungal biodiversity
==== Body
pmc1 Introduction

Preservation of fungal tissue DNA in the field is a crucial aspect of molecular ecological research, enabling the study of fungal biodiversity, community dynamics, and their functional roles in natural ecosystems. However, the challenge lies in effectively preserving fungal tissue DNA in the field, where the samples are exposed to various factors that can degrade DNA integrity. The choice of preservation method, the biological characteristics of the sample, and the duration of exposure to adverse conditions also play critical roles in ensuring successful DNA preservation for subsequent analysis.

Over the years, researchers have made significant efforts in developing preservation methods to maintain the quality and quantity of fungal DNA during collection and transportation. Conventionally, freezing samples at low temperatures (−180 or −20 °C) has been a common practice to prevent DNA degradation. However, this approach is often impractical in remote field settings where access to freezing facilities is limited. Consequently, alternative preservation methods, such as card-based (FTA® cards, FTA Elute® cards) and liquid-based [DNAgard™, DMSO/EDTA/saturated sodium chloride (DESS), RNAlater®] preservation methods have gained attention for their potential to stabilize nucleic acids under field conditions.

FTA technology employs FTA cards containing cell-lysis and nucleic acid-preserving chemicals [1]. For extended storage, tissues can be immersed in a high-salt solution like RNAlater®, which has demonstrated superior DNA yield compared to FTA® cards and effectively preserves RNA [1]. Additionally, a nonproprietary solution DESS has been utilized for DNA preservation. In a comparative study, liquid-based preservatives, including DNAgard™, RNAlater®, and DESS, outperformed card-based methods without one liquid technique showing a clear advantage [1].

Prior research has extensively investigated the efficacy of these reagents in safeguarding DNA extracted from a wide range of biological specimens, spanning plant tissues [2,3], animal tissues [4,5], and the microbial communities residing within host tissues [[6], [7], [8]]. Nevertheless, while some investigations have delved into their utility in preserving microbe's, including fungal DNA, there exists a substantial knowledge gap pertaining specifically to the preservation of macrofungi tissues, such as mushrooms. This gap pertains to our comprehension of how these liquid-based preservation methods affect the integrity, quantity, and PCR amplification success of DNA extracted from such macrofungi specimens.

We opted for RNAlater and DESS over other card-based methods due to their superior DNA preservation capabilities [1], cost-effectiveness, and ease of specimen transport. This study conducts a systematic comparison of these two preservation reagents, RNAlater and DESS, specifically targeting varied macrofungi tissue DNA. Our experiment encompasses both short-term and long-term preservation scenarios, allowing us to assess DNA quality, quantity, and PCR success rates at multiple time points (day 1 to day 30). By undertaking this analysis, we seek to provide insights into the most effective preservation method for maintaining macrofungi DNA integrity in the field over extended periods. This research not only contributes to the advancement of fungal molecular ecology but also has broader implications for DNA preservation strategies in ecological and environmental studies.

2 Materials and methods

2.1 Sample collection and preservation

We prepared two liquid-based preservation solutions, DESS and RNAlater, following the methods outlined in Ref. [9] and a patent of [10], respectively. For the DESS solution, we added 60 mL of deionized water to 0.25 M (27.9 g) EDTA-2Na (Ethylenediaminetetraacetic acid disodium salt dihydrate, molecular weight 372.24), stirring continuously with a magnetic stirrer, which resulted in noticeable precipitation. Subsequently, we adjusted the pH to 7.5 using 1N NaOH, utilizing approximately 80 mL, which facilitated the gradual dissolution of EDTA-2Na. We then topped up the mixture with deionized water to attain a total volume of 240 mL, before adding 60 mL DMSO (Dimethyl Sulfoxide) and 30 g Sodium Chloride. Thereafter, the solution was autoclaved for sterilization and left to settle overnight at 16 °C, allowing the excess NaCl to precipitate. The following day, the clear supernatant was meticulously aliquoted into 2 mL tubes, dispensing 1 mL per tube. To ensure sterility, the tubes were subjected to a subsequent round of autoclaving. For RNAlater (5 mM Sodium Citrate, 10 mM EDTA, 70 % ammonium sulfate, pH 5.2), we mixed 40 mL of 0.5 M EDTA, 25 mL of 1 M trisodium citrate, 700 g ammonium sulfate, and 935 mL deionized water, adjusted the pH to 5.2 using 1 M sulfuric acid, and let it cool to room temperature.

In this study, we conducted two experiments: 1) focusing on short- and long-term preservation at 25 °C and −20 °C (the controlled experiment) and 2) assessing the effectiveness of these methods with field-collected macrofungi samples.

In the controlled experiment, we purchased two commercially available mushrooms (Pleurotus ostreatus and Lentinula edodes) and preserved their fungal tissues in DESS and RNAlater tubes, storing them at either 25 °C or −20 °C. At designated intervals (day 1, 10, 20, and 30), we extracted DNA from 20 mg of the preserved samples (triplicate per sample) using our in-house DNA extraction workflow outlined below.

For the field-collected macrofungi experiment, conducted from February to July 2023, we engaged citizen scientists to collect fungal samples across Taiwan. These volunteers used collecting tubes containing DESS and RNAlater, dividing each fungal sample into two parts, one placed in DESS and the other in RNAlater. For the DESS samples, they were kept at room temperature (20–25 °C) according to previous studies [9,11] as a recommended preservation condition before shipping to the laboratory. For RNAlater samples, they were kept at 4 °C or −20 °C by citizen scientists for short-term storage, and at −20 °C for mid-to long-term storage before shipping to the laboratory for secure preservation at −20 °C.

2.2 DNA extraction, PCR, sequence analysis

For DNA extraction in the controlled experiment, fungal tissues (5–20 mg) underwent lysis with a combination of mechanical beads (1 mm and 0.5 mm zirconia beads in a 1:1 ratio) subjected to agitation at 3200 rpm for 4 min using a Vortex-Genie 2 (Scientific Industries, Inc., NY, USA) on its Horizontal Microtube Holder accessory. For DNA extraction from field-collected macrofungi samples, a drying step at 50 °C overnight was implemented to fully desiccate the samples. This ensured successful grinding using the Retsch Mixer Mill MM400, with a 3 mm stainless steel grinding ball in each tube, effectively preparing the macrofungi samples (both hard and soft fungal specimens) for DNA extraction. DNA extraction of lysed cells was carried out using a magnetic-bead-based approach [12] adapted from BOMB protocol [13] on a ZiXpress 32 automated nucleic acid purification instrument (New Taipei City, Taiwan). The quantity and quality of the eluted DNA were assessed using an Agilent BioTek Take3 Multi-Volume Plate following the manufacturer's instructions. For each metric, triplicate measurements were conducted, and the resulting values were averaged.

For molecular identification, we performed amplification of the entire rDNA regions, encompassing the 18S small subunit (SSU), ITS, and 28S large subunit (LSU). The amplification followed a two-step barcoding procedure as outlined by Ref. [14]. In the first-step PCR reaction, with a volume of 25 μl, we included 0.25–2 μl of DNA template, 0.5 μl of the forward NS1B1ngs_H1 (GCTATGCGCGAGCTGCCCTNGTTGATYCTGCCAGT) primer (including the universal head sequence) adapted from Ref. [15], 0.5 μl of the reverse LR5_H1 (GCTATGCGCGAGCTGCTCCTGAGGGAAACTTCG) primer (including the universal head sequence) adapted from Ref. [16], 12.5 μl of PowerPol 2X PCR Mix (CAT#RK20718) (Woburn, MA, USA), and 9.5 μl of deionized water. The amplification protocol entailed an initial denaturation at 98 °C for 45 s, followed by 25–30 cycles of denaturation at 98 °C for 10 s, annealing at 64 °C for 30 s, primer extension at 72 °C for 2.5 min, and a final extension step at 72 °C for 5 min. Amplified products underwent purification using DNA Select Isolation BeaverBeads™ (Beaver, China) with a 0.45X product-to-bead volume ratio, following the manufacturer's protocol. In the second-step PCR reaction, totaling 15 μl in volume, we used 0.75 μl of the first-step purified DNA product as the template, 0.6 μl of barcoded primers, 7.5 μl of 2 × ZEJUFast PCR Master Mix (Kaohsiung, Taiwan), and 6.15 μl of deionized water. The second-step PCR amplification protocol entailed an initial denaturation at 98 °C for 30 s, followed by 12 cycles of denaturation at 98 °C for 15 s, annealing at 65 °C for 15 s, primer extension at 72 °C for 20 s, and a final extension step at 72 °C for 3.5 min. Subsequently, the barcoded amplicons were sequenced on an Oxford Nanopore Technologies (ONT) MinION sequencer (Oxford, UK) using the manufacturer's Ligation Sequencing Kit V14 (SQK-LSK114).

The generated ONT sequence data underwent processing through dorado (https://github.com/nanoporetech/dorado) and an in-house compiled pipeline, nanoACT (https://github.com/Raingel/nanoACT). In brief, the process involved basecalling of the ONT raw reads with the model dna_r10.4.1_e8.2_400bps_sup@v5.0.0 using dorado; quality filtering with qualityfilt() (QSCORE = 9, MIN_LEN = 400, MAX_LEN = 8000); demultiplexing of barcoded sequences with singlebar(); trimming of artificial sequences such as head and adapter sequences using trim_reads(); de novo clustering of sequences via mmseqs_cluster(); consensus generation of the clustered sequences with mafft_consensus().Statistical analysis.

Outliers were identified using the Interquartile Range (IQR) method for metrics, A260/280, A260/230, and DNA concentrations. In short, the bounds for outliers were set at Q1 -1.5✕IQR for lower bound and Q3+1.5✕IQR for upper bound. If a sample exceeded these bounds for any metric, this sample and its paired sample were removed from the dataset.

In the exploration of DNA preservation efficacy across distinct conditions, we statistically investigate the impact of various storage temperatures and preservation methods on DNA quality and quantity for two fungal species over multiple days of preservation. The Mann-Whitney U Test, a non-parametric method, was employed to discern statistically significant disparities in DNA metrics (A260/A280, A260/A230, and DNA concentration) amongst groups delineated by the combination of preservation method (DESS and RNAlater) and storage temperature (−20 °C and 25 °C). This was conducted separately for each day in the preservation timeline, for each species, and for each DNA metric. P-values obtained from the Mann-Whitney U Test provided insights into the days and conditions where significant differences were observed, guiding further in-depth pairwise comparisons using Dunn's post-hoc test.

To assess the preserving effectiveness of field-collected macrofungi samples preserved in DESS and RNAlater, we carried out paired and independent t-tests on quality metrics, namely A260/A280, A260/A230, and quantity metric, i.e. DNA concentration. The paired t-tests were executed for matched samples within each preserving solution, while the independent t-tests compared the metrics between the two preserving solutions. We visualized the metrics using a boxplot with independent t-test results. In addition, connected scatter plots were generated to illustrate pairwise comparisons of the metrics to show the pattern.

3 Results

3.1 Sample collection, preservation, DNA extraction, and PCR

In the controlled experiment, a total of 96 fungal samples were obtained, encompassing two fungal species, two temperature conditions, four-day intervals, two preservation methods, and three replicates for each. DNA of all preserved samples in both DESS and RNAlater preservatives were successfully extracted. Notably, the quality and quantity metrics exhibited variations across samples, with A260/280 ratios ranging from 0.64 to 2.39, A260/230 ratios spanning 0.04 to 2.11, and DNA concentrations ranging from 1.27 to 957.20 (Fig. 1).Fig. 1 Lineplots illustrate the trajectory of DNA quality metrics [A260/A280 (A) and A260/A230 (B)] and DNA concentration (C) over distinct preservation durations (days) for two fungal species under various storage temperatures (−20 °C and 25 °C) and preservation methods (DESS and RNAlater) in the controlled experiment. * denotes groups that had significantly different values among the others from the same day of preservation.

Fig. 1

In the field-collected macrofungi experiment, 160 fungal specimens were gathered, with 80 isolates preserved in each of the DESS and RNAlater solutions. Among these, 78 distinct species were morphologically identified as belonging to the Basidiomycota. DNA extractions showed variability (Fig. 2), with RNAlater samples exhibiting A260/A280 ratios from 1.24 to 4.72, A260/A230 ratios from 0.03 to 2.89, and DNA concentrations from 2.37 to 2070.71 ng/μL. DESS samples showed A260/A280 ratios from 1.26 to 3.13, A260/A230 ratios from 0 to 1.04, and DNA concentrations from 0 to 372.82 ng/μL. The significantly different DNA quality and quantity between the solutions (Fig. 3) mirrored the PCR success rates: 77.5 % for RNAlater samples and 40.5 % for DESS samples (Fig. 4). The consensus sequences of each fungal specimen were deposited in NCBI under the accession number PP840236–PP840297.Fig. 2 Boxplot showing the comparison of DNA quality [A260/A280 (A) and A260/A230 (B)] and quantity (C) in field-collected fungal samples preserved in RNAlater and DESS solutions, p-value of independent T-test of two groups were shown on plots.

Fig. 2

Fig. 3 Connected scatterplot showing the pairwise comparison of DNA quality [A260/A280 (A) and A260/A230 (B)] and quantity (C) in field-collected fungal samples preserved in RNAlater and DESS solutions. The blue dots represent RNAlater samples and red crosses represent DESS samples; gray lines connect the value of paired samples in each preservation method.

Fig. 3

Fig. 4 PCR success rates for DNA extraction from field-collected fungal samples preserved in RNAlater and DESS solutions.

Fig. 4

3.2 Statistical analysis

In the controlled experiment, investigating the variation in DNA metrics across different preservation conditions, the Mann-Whitney U Test was employed to discern statistically significant disparities in the DNA quality and quantity metrics (A260/A280, A260/A230, and DNA concentration) across distinct groups, defined by a combination of preservation methods and storage temperatures, for each day of preservation. When comparing preservation methods, DESS and RNAlater showed no significant differences in the A260/A280, A260/A230, and DNAconc measurements, with p-values of 0.214, 0.124, and 0.051 respectively (Table 1). In terms of storage temperature, samples stored at −20 °C and 25 °C were comparable across all metrics. Comparisons between two different mushroom species, L. edodes and P. ostreatus, revealed no significant difference in the metrics across the preservation methods, indicating that the effect of preservation might be consistent across these species. Notably, certain conditions and time points revealed significant variations (p value ≤ 0.05) (Supplementary Table 1). For instance, for L. edodes on day 1, there was a significant difference in the A260/A280 metric with a p-value of 0.03. For P. ostreatus, a significant result was observed on day 10 for the DNA concentration with a p-value of 0.03. To pinpoint where these differences lie among the groups, a posthoc Dunn's test with Bonferroni correction was performed. The results indicated that for L. edodes on day 1, using the A260/A280 metric, the DESS stored at −20 °C and DESS stored at 25 °C had a significant difference with a p-value of 0.03. However, for P. ostreatus on day 10 considering the DNA concentration, there was a marginally notable difference between the DESS stored at −20 °C and RNAlater stored at −20 °C with a p-value of 0.07.Table 1 Mann-Whitney U Test comparing DESS and RNAlater on preserving DNA of L. edodes and P. ostreatus tissues across varied temperatures and durations (controlled experiment).

Table 1Comparison	Metric	U statistic	P-Value	
DESS vs RNAlater	A260_A280	982	0.214	
A260_A230	941.5	0.124	
DNAconc	885	0.051	

In the assessment of DNA quality and quantity of field-collected macrofungi preserved in RNAlater and DESS, we conducted both paired and independent t-tests for three metrics: A260/A280, A260/A230, and DNA concentration. For the paired t-test, which compares the same sample preserved in both methods, the results yielded p-values of 4.36e-14, 6.97e-24, and 3.82e-06 for A260/A280, A260/A230, and DNA concentration, respectively (Table 1). Similarly, the independent t-test, which evaluates samples across the two preservation methods without pairing, produced p-values of 1.73e-16, 3.26e-27, and 2.82e-06 for the same metrics (Table 2). The small p-values provide strong evidence of significant differences in DNA preservation quality between the two methods for the field-collected fungal samples.Table 2 Independent and paired t-tests on the metrics measured in field-collected fungal samples preserved in DESS and RNAlater.

Table 2Type of test	Metrics	t statistic	p-value	
independent	A260/A280	9.203	4.36E-14	
A260/A230	14.522	6.98e-24	
DNA concentration	4.974	3.82e-06	
paired	A260/A280	9.240	1.73e-16	
A260/A230	13.208	3.26e-27	
DNA concentration	4.861	2.82e-06	

4 Discussion

Preserving fungal tissue DNA in the field is pivotal for advancing molecular ecological research. This study scrutinized the efficacy of two liquid-based preservation solutions, RNAlater and DESS, in safeguarding the integrity, quantity, and PCR amplification success of DNA extracted from macrofungi samples exposed to diverse field conditions. The choice of preservation method, the inherent characteristics of the biological sample, and the duration of exposure to adverse environmental conditions all contribute significantly to the success of DNA preservation for subsequent molecular analysis.

4.1 Effectiveness of RNAlater and DESS for DNA preservation

Our results, which encompassed two key experiments, provide valuable insights into the effectiveness of RNAlater and DESS as DNA preservation solutions for fungal samples. In the controlled experiment, where we evaluated preservation efficacy over various timeframes and temperature conditions, both RNAlater and DESS demonstrated their viability for preserving fungal DNA. This finding suggests that researchers can confidently choose between these two methods based on their specific needs, without compromising the integrity of the DNA.

Our field-collected macrofungi experiment extended our investigation to real-world scenarios, mirroring the conditions researchers may encounter during ecological studies. Remarkably, including an overnight drying step before DNA extraction significantly impacts the choice of DNA preservation reagents, affecting DNA quality and PCR success. DESS samples exhibited extensive salt crystal formation, complicating processing and reducing DNA quality and quantity, as reflected in low A260/A280, A260/A230 ratios, and DNA concentrations. In contrast, RNAlater samples did not suffer from salt crystal formation, maintaining high DNA quality and quantity, likely due to efficient tissue lysis. Statistical analysis, including paired and independent t-tests, confirmed significant differences in DNA quality and quantity between RNAlater and DESS for field-collected samples (Fig. 1, Fig. 2, and Table 1). This finding reassures researchers seeking cost-effective, reliable DNA preservation methods for macrofungi studies. Boxplots and connected scatterplots further illustrate these differences, emphasizing the superior performance of RNAlater. In addition, salt crystals in DESS samples significantly reduced the PCR success rate, with only 40.5 % success compared to 77.5 % in RNAlater samples. Therefore, if a drying step is essential for high-quality DNA extraction, RNAlater is recommended to avoid downstream processing difficulties.

4.2 Preservation of tissue morphology

In addition to preserving nucleic acids, maintaining tissue morphology is crucial for analyzing field-collected samples. However, there's limited research on this aspect. The impact of RNAlater on tissue morphology remains uncertain. While [17] achieved excellent HE staining results with RNAlater for human prostate tissue, other studies reported adverse effects on human ovary tissue. DESS appears effective for preserving cartilage morphology over the long term [18]. Furthermore, DESS preserves nematode adult [19] and egg [20] structures similarly to traditional methods like formaldehyde and low temperatures [21,22], unlike ethanol, which can distort parasite egg morphology.

Although our study didn't focus on macrofungi specimen morphology, we observed no significant distortion in spore shape and size. Further research is needed to explore the effects of nucleic acid preservatives on fungal specimen morphology.

5 Conclusion

Our study addresses a critical knowledge gap by investigating the effectiveness of RNAlater and DESS as DNA preservation solutions for macrofungi. The results indicate that both preservation methods offer reliable and cost-effective options for maintaining DNA integrity over time, if drying samples overnight before DNA extraction is not part of the lab sample processing procedure. If so, we recommend RNAlater over DESS for preservation. Researchers working with macrofungi in field conditions can confidently choose between RNAlater and DESS based on their specific needs, considering factors such as cost, ease of transport, and logistical constraints. This research contributes to the field of fungal molecular ecology and provides valuable guidance for DNA preservation strategies in ecological and environmental studies.

Data availability

The consensus sequences for each fungal specimen have been deposited in the National Center for Biotechnology Information (NCBI) under accession numbers PP840236–PP840297. The analysis code is available upon request.

CRediT authorship contribution statement

Yu-Ja Lee: Investigation. Guan Jie Phang: Methodology, Investigation. Che-Chih Chen: Writing – review & editing, Writing – original draft, Resources, Methodology, Investigation, Data curation, Conceptualization. Jie-Hao Ou: Writing – review & editing, Writing – original draft, Methodology, Investigation, Data curation, Conceptualization. Yu-Hsuan Fan: Investigation. Yin-Tse Huang: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Software, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following is the supplementary data to this article:Multimedia component 1

Multimedia component 1

Acknowledgments

The study is funded by 10.13039/100020595 National Science and Technology Council , R.O.C (110-2621-B-037-002-MY3 ).

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e36829.
==== Refs
References

1 Gray M.A. Pratte Z.A. Kellogg C.A. Comparison of DNA preservation methods for environmental bacterial community samples FEMS Microbiol. Ecol. 83 2013 468 477 10.1111/1574-6941.12008 22974342
2 Mbogori M.N. Kimani M. Kuria A. Lagat M. Danson J.W. Optimization of FTA technology for large scale plant DNA isolation for use in marker assisted selection Ajb 5 2006 10.4314/ajb.v5i9.42773
3 Kruse C.P.S. Basu P. Luesse D.R. Wyatt S.E. Transcriptome and proteome responses in RNAlater preserved tissue of Arabidopsis thaliana PLoS One 12 2017 e0175943 10.1371/journal.pone.0175943
4 Régnier C. Gargominy O. Falkner G. Puillandre N. Foot mucus stored on FTA® cards is a reliable and non-invasive source of DNA for genetics studies in molluscs Conserv. Genet. Resour. 3 2011 377 382 10.1007/s12686-010-9345-8
5 Allen-Hall A. McNevin D. Human tissue preservation for disaster victim identification (DVI) in tropical climates Forensic Sci. Int. Genet. 6 2012 653 657 10.1016/j.fsigen.2011.12.005 22269964
6 Ndunguru J. Taylor N.J. Yadav J. Aly H. Legg J.P. Aveling T. Thompson G. Fauquet C.M. Application of FTA technology for sampling, recovery and molecular characterization of viral pathogens and virus-derived transgenes from plant tissues Virol. J. 2 2005 45 10.1186/1743-422X-2-45 15904535
7 Carvalhais L.C. Dennis P.G. Poudel A. Birt H.W.G. Bhuiyan S.A. Card S.D. Joyce P.A. Simple solution to preserve plant samples for microbiome analyses Mol. Ecol. Resour. 22 2022 1055 1064 10.1111/1755-0998.13538 34695303
8 Lee K.M. Adams M. Klassen J.L. Evaluation of DESS as a storage medium for microbial community analysis PeerJ 7 2019 e6414 10.7717/peerj.6414
9 Seutin G. White B.N. Boag P.T. Preservation of avian blood and tissue samples for DNA analyses Can. J. Zool. 69 1991 82 90 10.1139/z91-013
10 Lader E.S. Methods and Reagents for Preserving RNA in Cell and Tissue Samples 2012 US Patent https://patents.google.com/patent/US8178296
11 Sharpe A. Barrios S. Gayer S. Allan-Perkins E. Stein D. Appiah-Madson H.J. Falco R. Distel D.L. DESS deconstructed: is EDTA solely responsible for protection of high molecular weight DNA in this common tissue preservative? PLoS One 15 2020 e0237356 10.1371/journal.pone.0237356
12 Phang G.J. Hung T.-C. Huang Y.-T. DNA extraction v9.0 (modified BOMB) 10.17504/protocols.io.e6nvwdbb7lmk/v1 2023
13 Oberacker P. Stepper P. Bond D.M. Höhn S. Focken J. Meyer V. Schelle L. Sugrue V.J. Jeunen G.-J. Moser T. Hore S.R. von Meyenn F. Hipp K. Hore T.A. Jurkowski T.P. Bio-On-Magnetic-Beads (BOMB): open platform for high-throughput nucleic acid extraction and manipulation PLoS Biol. 17 2019 e3000107 10.1371/journal.pbio.3000107
14 Herbold C.W. Pelikan C. Kuzyk O. Hausmann B. Angel R. Berry D. Loy A. A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes Front. Microbiol. 6 2015 731 10.3389/fmicb.2015.00731 26236305
15 Tedersoo L. Tooming-Klunderud A. Anslan S. PacBio metabarcoding of Fungi and other eukaryotes: errors, biases and perspectives New Phytol. 217 2018 1370 1385 10.1111/nph.14776 28906012
16 Vilgalys R. Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species J. Bacteriol. 172 1990 4238 4246 10.1128/jb.172.8.4238-4246.1990 2376561
17 Jhavar S.G. Fisher C. Jackson A. Reinsberg S.A. Dennis N. Falconer A. Dearnaley D. Edwards S.E. Edwards S.M. Leach M.O. Cummings C. Christmas T. Thompson A. Woodhouse C. Sandhu S. Cooper C.S. Eeles R.A. Processing of radical prostatectomy specimens for correlation of data from histopathological, molecular biological, and radiological studies: a new whole organ technique J. Clin. Pathol. 58 2005 504 508 10.1136/jcp.2004.021808 15858122
18 Staff S. Kujala P. Karhu R. Rökman A. Ilvesaro J. Kares S. Isola J. Preservation of nucleic acids and tissue morphology in paraffin-embedded clinical samples: comparison of five molecular fixatives J. Clin. Pathol. 66 2013 807 810 10.1136/jclinpath-2012-201283 23750036
19 Yoder M. De Ley I.T. King I.W. Mundo-Ocampo M. Mann J. Blaxter M. Poiras L. De Ley P. DESS: a versatile solution for preserving morphology and extractable DNA of nematodes Nematology 8 2006 367 376 10.1163/156854106778493448
20 Gonzálvez M. Ruiz de Ybáñez R. Rodríguez-Caro R.C. Maíz-García A. Gómez L. Giménez A. Graciá E. Assessing DESS solution for the long-term preservation of nematodes from faecal samples Res. Vet. Sci. 153 2022 45 48 10.1016/j.rvsc.2022.10.010 36308790
21 Crawley J.A.H. Chapman S.N. Lummaa V. Lynsdale C.L. Testing storage methods of faecal samples for subsequent measurement of helminth egg numbers in the domestic horse Vet. Parasitol. 221 2016 130 133 10.1016/j.vetpar.2016.03.012 27084484
22 Aldeen W.E. Shisenant J. Hale D. Matsen J. Carroll K. Comparison of pooled formalin-preserved fecal specimens with three individual samples for detection of intestinal parasites J. Clin. Microbiol. 31 1993 144 145 10.1128/jcm.31.1.144-145.1993 8417020
