
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00711-9
10.1016/j.psj.2024.104132
104132
IMMUNOLOGY, HEALTH AND DISEASE
In vitro and in vivo evaluation of antibacterial activity and mechanism of luteolin from Humulus scandens against Escherichia coli from chicken
Liu Xia *†1
Dong Wenwen *1
Zhang Yuxia *
Tian Ye *
Xiao Yaqing *‡
Yang Menghao *†
Yuan Xiaoyuan *
Li Guiming *§
Liu Jianzhu †
Kai Meng mengkai1215@163.com
*2
⁎ Poultry Breeding Engineering Technology Center of Shandong Province, Poultry Institute, Jinan Key Laboratory for Agricultural Experimental Animal and Comparative Medicine, Shandong Academy of Agricultural Sciences, Shandong Provincial Key Laboratory of Poultry Diseases Diagnosis and Immunology, Jinan 250023, China
† College of Animal Science and Veterinary Medicine, Shandong Agricultural University, 271018, Taian, China
‡ College of Veterinary Medicine, Hebei Agricultural University, Baoding 071000, China
§ Shandong Blue Sea ecological agriculture Co., LTD, Dongying 257100, China
2 Corresponding author: mengkai1215@163.com
1 These authors have contributed equally to this work.

06 8 2024
11 2024
06 8 2024
103 11 10413214 3 2024
24 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
ABSRTACT

Resistance of Escherichia coli (E.coli) to antibiotics has steadily increased over time; hence, there is an urgent need to develop safer alternatives to antibiotics. The present study aimed to evaluate the effect of luteolin (Lut) on E. coli from chicken. The bioactive compound Lut from Humulus scandens was selected by network pharmacology and molecular docking analyses. Scanning electron microscopy (SEM), transmission electron microscopy (TEM), and confocal laser scanning microscopy (CLSM) were used to observe the effects of Lut on the morphology and structure of E. coli cells. The data-independent acquisition (DIA) method was used to analyze protein expression level of E. coli before and after Lut treatment. The in vivo evaluation of the antibacterial, anti-inflammatory, and oxidative effects of Lut on E.coli was conducted using E.coli isolated strains infected the SPF chicken model. The network pharmacology analysis revealed 19 distinctive bioactive compounds such as Lut and β-sitosterol in H. scandens; furthermore, 30 core targets were selected from H. scandens. The KEGG enrichment analysis showed that the PI3K-Akt, TNF, MAPK, IL-17, JAK-STAT, and HIF-1 pathways were related from H. scandens. Based on the results of the network pharmacology analysis, Lut was subjected to screening by molecular docking analysis to determine its antibacterial effect on E. coli and the associated mechanism of action. The minimum inhibitory concentration (MIC) of Lut against E. coli standard strains was 500 µg/mL. SEM, TEM, and CLSM results indicated that Lut damaged the cell wall and cell membrane of E. coli strains and destroyed the cell structure, leading to cell death.The expression level of membrane structure, Phenylalanine metabolism and some other metabolic pathways in E.coli changed after treatment with Lut (P < 0.05). In vivo experiments in the SPF chicken model showed that Lut treatment alleviated the decline in the growth performance of chickens (P < 0.05), prevented pathological changes in the correspond ding organs and suppressed the inflammatory response induced by E. coli infection (P < 0.05), improved the immunity and antioxidant capacity of chickens (P < 0.05), and protected them against infection with E. coli strains. To summarize, Lut from H. scandens can inhibit E. coli growth by damaging the cell membrane structureand affecting the expression level of some metabolic proteins. In vivo experiments also showed that Lut can significantly reduce the damage caused by E. coli isolates on SPF chickens, improve their antioxidant capacity and immunity, and reduce inflammatory responses following E. coli infection.

Key words

Escherichia coli
luteolin
antibacterial effect
SPF chicken
in vivo
==== Body
pmcINTRODUCTION

Escherichia coli (E.coli) is a common bacterial pathogen in the poultry industry. As an opportunistic pathogen, the prevalence of E. coli in poultry is often closely associated with improper feeding management. E. coli infections cause massive economic losses to the poultry industry each year, which currently stand at 300 million yuan per year (Wang, 2023). Because of the occurrence of other infectious diseases, intensive aquaculture, and antibiotic treatment, the incidence of E. coli infections has greatly increased, thereby showing a progressively serious trend each year. Presently, various broad-spectrum antibiotics are mainly used to prevent and cure E. coli infection in poultry production and to simultaneously eliminate multiple pathogens. However, the excessive use of antibiotics leads to bacterial resistance and even causes the frequent occurrence of “superbug” as well as the presence of drug residues in animal products; this issue is seriously affecting the treatment of bacterial diseases in humans and animals and is currently one of the main global concerns. Hence, it has become imperative for researchers to find safer alternatives to antibiotics, particularly those that are natural, nontoxic, and do not induce resistance.

Herb-based traditional Chinese medicine (TCM) has been confirmed to have good effects on enhancing the body's immunity, preventing and treating diseases, improving poultry production performance, and increasing feed palatability (Luo et al., 2019). Compared to antibiotics,TCM has the advantages of low toxicity, no drug resistance,and diversefunctions. Humulus scandens (H. scandens), also known as Humulus japonicus and Japanese hop in English, belongs to the family Cannabaceae and is widely distributed in nature (https://en.wikipedia.org/wiki/Humulus_japonicus; http://www.efloras.org/florataxon.aspx?flora_id=2%26taxon_id=242325576). H. scandens has a long history of application in herb-based TCM. The bioactive components of H. scandenshave been identified and include terpenes (Peng et al., 2014), phenols (Chen et al., 2015), and sterols (Li et al., 2010). It can be used to treat inflammation, dysentery, tuberculosis, etc. (Zhang et al., 2021). H. scandens also exhibits immunosuppressive effects in vitro and in vivo by inhibiting CD4+ T cell activation (Feng et al., 2014). Moreover, H. scandenscan increase the abundance of Lactobacillus, Ruminococcaceae, Enterococcus, and Pseudomonas in the intestine (Hao et al., 2022).

Luteolin (Lut), a natural flavonoid, is isolated from various plants such as H. scandens, orchids, and peanut shells. Lut is weakly acidic and soluble in alkaline solutions. Due to its high lipid solubility, it is difficult to dissolve in water, which hinders its absorption and utilization in the body. In response to this issue, many scholars have conducted research in recent years to increase the solubility of lut, such as biopolymerized microspheres (Di Capua et al., 2017), nano micelles (Liu et al., 2021), metal complexes (Demetgül and Beyazit, 2018), nanoparticles (Wang et al., 2019) etc., and have significantly improved their antioxidant activity and bioavailability, which is conducive to promoting its clinical applications. Lut is mainly used as an expectorant to relieve cough, as an anti-inflammatory agent, and as a natural compound to treat chronic obstructive pulmonary disease, bronchial asthma, chronic pharyngitis, chronic cough, and other diseases (Zhao et al., 2014; Liu and Han, 2015).Lut can regulate the HIF-2α-Arg-NO axis and the PI3K-AKT-eNOS-NO signaling pathway to improve pulmonary arterial hypertension (Ji et al., 2022) and has been frequently studied as an anticancer agent in recent years (Franza et al., 2021). However, to date, few studies have been conducted on the antibacterial effect of Lut and the underlying mechanism of action.

Network pharmacology method is a new model for TCM research. At present, the research on TCM in network pharmacology mainly includes 2 aspects. On the 1 hand, it comprehensively collects the components of TCM through databases; On the other hand, it analyze the potential targets of the screened components through computational biology methods. By using the above methods to construct a network of "TCM - components - targets - signaling pathways," to preliminarily understand the specific targets and pathways of the components, which facilitates a comprehensive analysis of the pharmacological effects and molecular mechanisms of TCM.

In the present study, we identified Lut as the main antimicrobial component in H. scandens by network pharmacology analysis and investigated its antibacterial effect and influence on E. coli through in vitro and in vivo experiments. The study aimed to provide a new direction for developing novel and safer antibiotics to prevent E. coli infections in poultry.

MATERIALS AND METHODS

Ethical Approval

All animal experiments were conducted in accordance with the Guidelines for Experimental Animals, established by the Ministry of Science and Technology (Beijing, China). Animal experiments were approved by theInstitutional Review Board of the Institutional AnimalCare and Use Committee of the Shandong Academy of Agricultural Science (protocol code SAAS-2021-018).

Bacterial Strains

E. coli ATCC 25922 was purchased from the National Institute for Food and Drug Control. The clinical isolates were obtained previously and preserved in the laboratory. E. coli isolates were identified by colony morphology on MacConkey and XLD agar, gram staining, and standard biochemical tests. All bacterial isolates were stored at -80°C and cultured in Luria-Bertani (LB) medium .

Network Pharmacology

Acquisition of Components and Potential targets of H. scandens. The traditional Chinese medicine systems pharmacology database and analysis platform (TCMSP, https://tcmsp.com/tcmsp.php) was used to retrieve all H. scandens plants with related chemical composition. The chemical ingredients of H. scandens that met the selection criteria for oral bioavailability (OB) ≥30% and drug-likeness (DL) ≥0.02 were screened. The molecular structures were obtained from the PubChem database (http://pubchem.ncbi.nlm.nih.gov/). The target proteins of these compounds were predicted using the SwissTargetPrediction database (http://www.swisstargetprediction.ch/). The Uniprot database (https://www.uniprot.org/) was used to standardize all relevant targets and obtain their corresponding gene abbreviations.

Construction and Analyses of H. scandensAntibacterial target Networks. By using the keywords “antibacterial” and “bacterial infections” in the GeneCards database, targets with relevance greater than 2-fold the median value were screened. Potential targets for H. scandens antimicrobial resistance were obtained through the MyVenn function in the Comparative Toxicogenomics Database (http://ctd.Mdibl.org/) by mapping component targets of H. scandens to disease targets in a Venn diagram. The potential targets of H. scandens against bacterial infections were imported into the STRING database (http://string-db.org/) to construct a target protein interaction network (PPI), and the PPI results were imported into Cytoscape software for related topological analysis. The analysis results were used the MCC algorithm in cytoHubba to calculate hub genes. Targets with a high degree and proximity to the center were selected as core targets.

Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment Analyses. The DAVID database (https://david.ncifcrf.gov/) was used for biological functional annotation analyses, including Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) pathway enrichment analysis. Bubble map of the major metabolic pathways was created using R software. The clusterProfiler package in R software was used to visualize the process by which a target functions in a critical pathway. Cytoscape software was used to construct the H. scandens active component-core target-pathway network and visually analyze the relationships among the components, targets, and pathways.

Molecular docking Analyses. The 2 active ingredients with the highest degree value were selected for molecular docking with corresponding targets (3 targets with the highest degree value). Molecular docking was performed using AutoDockTools 1.5.6 software (https://mybiosoftware.com/autodock-4-2-3-autodocktools-1-5-6-suite-automated-docking-tools.html), and the binding conformation with the lowest free binding energy was selected as the best binding conformation. Finally, PyMOL 2.5.2 software was used for visualization. In short, the 3D structure of crucial compounds was made by Chem Office software, and then the 3D design of the core protein gene was downloaded from the PDB database. The water molecules and small molecular ligands of protein structure were deleted by PyMol software and introduced into Auto Dock Tools for hydrogenation and other pretreatments. Convert the active ingredient and target protein into a pdbqt format file, and look for the functional pocket. Finally, AutoDockTools were run to dock the active components and target proteins, respectively, and the lowest binding energy data was saved due to molecular docking. Then the critical activity of the 2 is evaluated according to the binding energy, and the Binding energy < 0 indicates spontaneous binding, and ≤ −5 kcal/mol indicates good binding.

In Vitro Assessment of the Antibacterial Effect of Lut

Lut, the active ingredient of H. scandens with the strongest antibacterial activity predicted by the network pharmacology analysis, was selected for subsequent experiments.

Determination of Bacterial Drug Resistance

The clinical E. coli was coated to LB solid medium, susceptibility paper tablets containing antibiotics were added, and the plates were inverted and incubated at 37°C for 12 h to 18 h. To observe the susceptibility of the bacteria to the different antibiotics.

Determination of the Antimicrobial effect of Lut

The minimum inhibitory concentration (MIC) of Lut was determined by the microbroth dilution method with appropriate modifications (Yu et al., 2016). Briefly, diluted Lut with Mueller Hinton medium to the concentration of 1000, 500, 250, 125, 62.5, 31.25, 15.645, and 0 µg/mL, added E.coli and mixed thoroughlyand add to a 96 well plate (final volume of each well was 100 µL). The same volume of phosphate buffer was used as the positive control, and a nonbacteriagroup was used as the negative control. The plates were incubated at 37°C for 12h to 18 h, and measure the value of OD630nm. The minimum concentration that inhibited the bacterial growth was considered the MIC value of Lut.

Time-Kill Kinetics Assay

Time-kill kinetics assay of Lut was performed according to the method of Silva-Angulo (Silva-Angulo et al., 2015). Briefly, Lut was added to 3 test tubes containing LB medium to obtain the final concentrations of 0, 0.5, 1, and 2 × MIC. Freshly cultured E. coli strains were inoculated into the tubes containing Lut, and the tubes were incubated at 37°C for 24 h at 170 rpm. The growth of the strains at each time point (0, 2, 4, 6, 8, 10, 12, 16, 20, and 24 h) was estimated by determining the absorbance value at 630 nm, and the relationship between the amount of bacterial growth and time was plotted.

Confocal Laser Scanning Microscopy

Lut-induced damage of the cell membrane was detected using the fluorescent probe 5(6)-carboxyfluorescein diacetate (CFDA) and propidium iodide (PI) (Zhou et al., 2019). E. coli strainswere cultured at 37°C for 8 h and then centrifuged at 8000 rpm for 10 min; the cell pellet was then rinsed with phosphate buffer (10 mmol/L, pH 8.0)and added to LB medium containing Lut at MIC concentrationfor 2 h. The fluorescent probe 5(6)-CFDA was added to each sample until the final concentration reached 2.5 μmol/L. The reaction was performed in the dark for 10 min. Subsequently, the fluorescent DNA stain (PI) was added until the final concentration of 0.5 μmol/L, and the reaction was performed in the dark for 10 min. Next, 2 to 3 μL of the bacterial solution was placed onto a slide and observed under a confocal laser scanning microscope (CLSM).

Scanning Electron Microscopy and Transmission Electron Microscopy

E. colistrains were inoculated into LB medium containing Lut at sub-MIC values for 4 and 8 h, then centrifuged at 12,000 rpm for 8 min, and washed with phosphate buffer (10 mmol/L, pH=8.0). The cells were then fixed with 2.5% glutaraldehyde at 4°C for 24 h, next, the cells were dehydrated using a gradient ethanol series. Finally, the cells were placed on a slide, sputter-coated with gold for 30 s, and imaged by the scanning electron microscope (SEM).For transmission electron microscopy (TEM), the cell culture procedures were the same as those used for SEM. After washed,the suspension was stained with 2% phosphotungstic acid (PTA) solution (volume fraction: 2%, pH = 7.0) for 10 min and then sprayed onto the copper mesh membrane. The morphology of bacteria was determined by TEM.

Data-Independent Acquisition proteomics Analyses

E. coli strainswere added to the Lut solutionat the sub-MIC value and incubated for 12 h. The strains suspension was then centrifuged with SDT lysis solution to extract proteins and then quantified by the BCA method. SDS-PAGE and Coomassie Brilliant Blue staining were used to confirm protein extraction. Add FASP for protein enzymatic hydrolysis and redissolve with 0.1% formic acid (FA) after the hydrolyzed peptide was dried. The peptide concentration was measured by LC-MS analysis.

The peptide segments of each sample were subjected to chromatographic separation using the Vanquish Neo UHPLC system (Thermo Scientific). All mass spectrometry data were merged using DIA-NN software to complete the retrieval of data-independent acquisition (DIA) mass spectrometry data from the database and quantitative analysis of protein DIA.

The obtained data were statistically analyzed, and the proteins were identified and annotated with the GO database, KEGG database, and Clusters of Orthologous Groups of proteins (COGs) database. Finally, proteins with differences of >3-fold (upregulated and downregulated) in their expression levels and a P-value of <0.05 were considered significant differentially expressed proteins (DEPs).

In Vivo Assessment of the Effect of Lut on E. Coli-Infected Chickens

Diets and experimental Design. A total of 144 specific pathogen-free (SPF) chickens (age: 21 d) were randomly assigned to 6 treatment groups. One group was injected with physiological saline, and another group was fed a basal diet containing 400 mg/kgbody weight Lut; these 2 groups were assigned to an independent room. The remaining 4 groups were assigned to another independent room and injected with E. coli. Following the successful establishment of the disease, the chickens were fed a basal diet added with 100, 200, and 400 mg/kg of Lut for 7 d. During the treatment period, the mental state of each group of chickens was observed, and changes in weight and feed intake were also recorded. The chickens were weighed after a 12-h feed fasting, and feed intake was recorded repeatedly to calculate body weight, average daily feed intake (ADFI), average daily gain (ADG), and feed-to-gain ratio (FCR).

Sample Collection. 3 birds (3 replicates, n = 8 per group) with body weights close to the average weight were selected for blood sampling. Blood was collected by puncturing the heart of the birds by using a disposable blood collection needle. The blood samples were centrifuged at 4,000 rpm for 15 min, and the serum samples were stored at −20°C for further analysis. The selected birds were then killed by severing the jugular vein; the duodenum and heart were collected and preserved in a 4% formaldehyde solution for hematoxylin-eosin (H&E) staining to observe pathological changes.

Evaluation of Serum Immune and Inflammatory and Oxidative stress Parameters. Serum IgG and IgA levels and levels of IL-6, IL-10, IL-1β, and TNF-αweremeasured using ELISA kits (Shanghai Hengyuan Biotechnology Co., Ltd.). Lipid peroxide clearance was determined based on the glutathione-peroxidase (GSH-Px) level. Membrane lipid peroxidation was evaluated based on the malondialdehyde (MDA) level. The degree of cell membrane damage was indirectly measured. The catalase (CAT) level was estimated to evaluate cell oxidative status. The superoxide dismutase (SOD) level was measured to confirm changes in the oxidative stress level in the body. The serum levels of all these indicators were also measured by ELISA kits (Shanghai Hengyuan Biotechnology Co., Ltd.).All measurements were conducted in triplicate and in accordance with the manufacturer's instructions.

Evaluation of Intestinal gene Expression. Duodenal RNA was extracted using RNA-easy isolation reagent (Vazyme, China) in accordance with the manufacturer's instructions. Reverse transcription was performed on ice by using SuperScript III reverse transcriptase (Vazyme, China). The obtained cDNA was stored at -20°C for further analysis. The mRNA expression levels of the IL-17 pathway-related genes, namely IL-17A, IL-17F, IL-6,and NF-κB1, in the duodenum were detected by qRT-PCR. The required primers were generated based on the NCBI data of published genes of chickens as templates; the primers were designed using Primer 5.0 software and synthesized by BGI Genomics Co., Ltd. (China). Table 1 shows the primer sequences. qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme,China) operated on ice in accordance with the manufacturer's instructions.Table 1 Primer sequences used for qRT-PCR.

Table 1Primer	Direction	Sequence (5ʹ–3ʹ)	
IL-17A	F	TGTCTCCGATCCCTTGTTCT	
	R	GTCCTGGCCGTATCACCTT	
IL-17F	F	CTCCGATCCCTTATTCTCCTC	
	R	GTCCTGGCCGTATCACCTT	
IL-6	F	AGGACGAGATGTGCAAGAAGTTC	
	R	TTGGGCAGGTTGAGGTTGTT	
NF-κB	F	AGAAAAGCTGGGTCTTGGCA	
	R	CCATCTGTGTCAAAGCAGCG	
IL-17A:Interleukin 17 A;IL-17F:Interleukin 17 F;IL-6:Interleukin 6;NF-κB:Nuclear Factor Kappa-B.

The final volume of each PCR reaction mixture was 20 µL (Master Mix: 10 µL, forward primer: 0.4 µL, reverse primer: 0.4 µL, RNase-free ddH2O: 8.2 µL, cDNA template: 1 µL). Each sample was tested 3 times in 3 independent experiments, and the average value was considered. The reaction process was as follows: predenaturation at 95°C for 30 s;40 cycles of denaturation at 95°C for 5 s and annealing at 53°C for 30 s; and final extension at 72°C for 15 s.According to the Ct value of the samples obtained from the test, the relative expression level (fold change [FC]) was analyzed by the 2−ΔΔC T method (Livak and Schmittgen, 2001) relative to the control group.

Statistical Analyses

The experimental unit for growth performance data was the bird cage. All tests were performed in triplicate, and the results were analyzed using Origin 2021 and GraphPad Prism 8.0 software. The data were expressed as Mean ± SEM. All data were analyzed by 1-way analysis of variance (ANOVA) using SPSS 23.0 statistical software. Duncan's multiple range test was used to determine the differences among the groups. Differences were considered significant at P < 0.05. The association between network modules and therapeutic diseases was examined by chi-square (χ2) test. The verification of the contribution scoring algorithm based on the information of targets and approved drugs was also conducted by chi-square (χ2) test.

RESULTS

Screening of Active Ingredients and targets of H. Scandens

Seventy chemical ingredients of H. scandens were obtained from the TCMSP database. Of these, 19 chemical components such as β-sitosterol, stigmasterol, and Lut were selected as bioactive ingredients according to OB ≥ 30% and DL ≥ 0.02 (Table 2). Furthermore, 94 common antibacterial targets for H. scandens components were obtained based on the SwissTargetPrediction and Genecards databases.By using Cytoscape 3.7.2 software, the 19 active ingredients and 94 target genes were used to establish the regulatory network of active ingredients and targets. CytoNCA was used to calculate node centrality and screen core targets. The top 10 genes were AKT1, IL6, TNF, FOS, TP53, APP, EGFR, PPARG, ADRB2 and SLC6A3. (Figure 1A).Table 2 Screening of active ingredients of H. scandens based on ADME parameters.

Table 2Number	Components	OB (%)	DL	
MOL000131	EIC	41.90	0.14	
MOL000193	(Z)-caryophyllene	30.29	0.09	
MOL002124	β-asarone	35.61	0.06	
MOL002451	β-humulene	40.36	0.05	
MOL002850	butylated hydroxytoluene	40.02	0.07	
MOL003571	spathulenol	81.61	0.12	
MOL000358	β-sitosterol	36.91	0.75	
MOL000449	stigmasterol	43.83	0.76	
MOL004743	Z-Leu-OH	113.78	0.12	
MOL002003	(-)-caryophyllene oxide	32.67	0.13	
MOL000569	digallate	61.85	0.26	
MOL000057	DIBP	49.63	0.13	
MOL000006	luteolin	36.16	0.25	
MOL006108	synthol	36.82	0.02	
MOL006354	stigmastane一3,6一dione	33.12	0.79	
MOL007180	vitamin-e	32.29	0.70	
MOL007331	2-butyl-4-hydroxyanisole	66.46	0.05	
MOL007333	9-thiafluorene	53.69	0.08	
MOL007336	vitexin	42.66	0.24	

Figure 1 Results of network pharmacological analysis. (A) Screening of antibacterial targets from H. scandens. (B) KEGG enrichment analysis. (C) GO enrichment analysis. (D) Visualization of H. scandens antimicrobial pathways. (E) Molecular docking patterns of bioactive components of H. scandens to target molecules.

Figure 1

KEGG and GO Analyses

According to the DAVID database (http://david.ncifcrf.gov/), cancer pathway, hepatitis B, proteoglycan in cancer, bladder cancer, pertussis, and other specific diseases or other irrelevant items were excluded from the KEGG signaling pathway. Enrichment bubble maps for the first 25 pathways (Figure 1B) were prepared using R software. The circle size represents the number of targets enriched on the pathway, and the circle color represents the P-value of the target enriched on the pathway. A smaller P-value implied a more reliable signaling pathway. The results of KEGG enrichment analysis revealed that H. scandens may exert its antibacterial effect through the PI3K-Akt pathway, apoptosis, tumor necrosis factor, salmonella infection, IL-17, MAPK, YAK-STAT, pathogenic E. coli infection, and NF-κB signaling pathway.

GO enrichment analysis mainly included 3 parts: biological process (BP), cellular component (CC), and molecular function (MF). The top 10 items were visually analyzed (Figure 1C). BP terms were mainly involved in the positive regulation of the apoptotic process and the negative regulation of the apoptotic process and positive regulation of transcription from RNA polymerase II promoter. CC terms were mainly related to cytosol, nucleus, extracellular space,etc. MF terms were mainly related to protein binding and enzyme binding.

Compound-Target-Pathway Network

We performed PPI network analysis of 94 intersection genes between antibacterial and H. scandens (Figure 1D). The network consisted of 94 nodes and 427 edges. Based on the results of the KEGG analysis, we verified the role of the IL-17 signaling pathway in H. scandens. KEGG analysis showed that NF-κB,IL4,IL6,CASP8,IFNG,CASP3,MAPK1,PTGS2,TNF,MMP9, and RELA were enriched in the IL-17 pathway (Figure 1E). We constructed a network diagram of “TCM-compound-target-pathway”. Target genes and the top 25 KEGG enrichment pathways were visually analyzed, and the results are shown in Figure 1F. As shown in the figure, a complex network relationship was observed between bioactive compounds, 30 key targets, and 25 pathways, thus suggesting that the active ingredients Lut and β-sitosterol of H. scandens play a role in multiple pathways through different target proteins.

Molecular Docking Analyses

Molecular docking reflects the binding efficiency between the chemical components of the H. scandens and the corresponding candidate target sites. We selected the top 2 bioactive components (Lut and -sitosterol) and the top 3 targets (AKT1, IL-6 and TNF-α) for molecular docking. In the binding pattern diagram, the active amino acid residues involved in the interaction between Lut and β-sitosterol with the target protein can be visually observed (Figure 1G). Molecular docking studies showed that the target proteins of AKT1, IL-6 and TNF-α could stably bind to Lut compound with interaction energies of −9.8, −7.9, and −6.9 kcal/mol, respectively (Table 3). The results displayed in Table 3 indicate that Lut has better binding activity for target interactions since it has lower docking scores with candidate targets (AKT1, IL-6 and TNF-α) than β-sitosterol. Therefore, we chose Lut for the subsequent experiments.Table 3 Binding energy between the bioactive ingredients and their target molecules.

Table 3Active ingredient	MOL ID	Binding energy(kcal·mol-1)	
		AKT1	IL-6	TNF	
Luteolin	MOL000006	-9.8	-7.9	-6.9	
β-sitosterol	MOL000358	-7.8	-7	-6.4	

Determination of the Antimicrobial Effect of Lut

The MIC values of Lut against the standard E. coli strain and E. coli isolates were 500 and 600 μg/mL, respectively. Figure 2 show the effects of Lut on E. coli strains in terms of time-kill kinetics. The E. coli entered the logarithmic growth phase at 4∼12 h, and the growth rate slowed down after 16 h. Both the standard E. coli and the clinical E. coli isolates showed a significant inhibition in the growth of strains at Lut concentrations of MIC and 2 × MIC. Compared to the control group, the initial growth of E. coli in the treatment group was significantly slower after the treatment with Lut at sub-MIC value; however, the inhibitory effect decreased and even disappeared with the increase in growth rate and amount of strains. After 16 h, a slight increase in the growth was observed in the MIC and 2 × MIC groups of the standard and clinical strains, thus indicating the drug activity may enter a half-life and the weakening of its efficacy. Moreover, the Table 4 showed that the clinical E. coli strains have strong antibiotic resistance, but Lut could completely inhibit the proliferation of E. coli at MIC concentrations.Figure 2 Time-kill kinetics of Lut at 1/2, 1, and 2 × MIC values. Mean values from 3 replicates plotted for all panels; differences were considered significant at P < 0.05.

Figure 2

Table 4 Effects of luteolin on the growth performance of SPF chickens.

Table 4		E. coli-infected chickens treated with luteolin concentration (g/kg)	
Items	Mock	Luteolin	0	100	200	400	
1∼2 d							
BW (g)	30.43	33.31	3.92	
ADG (g/chick.d)	15.22	16.66	1.81	
ADFI (g/chick.d)	23.32	24.71	6.38	
FCR (g/g)	1.53	1.48	3.52	
3∼9 d							
BW (g)	121.51	109.54	70.81	82.03	80.03	117.65	
ADG (g/chick.d)	15.18	12.71	11.15	13.02	12.69	18.95	
ADFI (g/chick.d)	24.47	24.82	14.21	15.07	16.70	18.47	
FCR (g/g)	1.61	1.95	1.27	1.16	1.32	0.97	

CLSM

Intact cell membranes and damaged bacterial cells can be differentiated by staining with the fluorescent probes CFDA and PI. The changes in the cell membrane of E. coli cells after treatment with Lut were observed by CLSM. As shown in Figure 3, strains in the control group showed green fluorescence under the microscope (Figures 3A and 3C). Following treatment with Lut at the MIC value, some strains showed red fluorescence (Figures 3B and 3D). These results indicate that in bacterial cells not treated with Lut, the cell membrane of most cells was intact, and the cells mainly showed green fluorescence; after the treatment of Lut, the cell membrane was damaged, and PI gradually entered the cell. The cells then showed red fluorescence.Figure 3 CLSM findings of E. coli treated with Lut at MIC concentrations. (A) Untreated blank control of E. coli ATCC 25922; (B) E. coli ATCC 25922 treated with Lut at the MIC value; (C) Untreated blank control of the E. coli clinical strain; (D) E.coli clinical strain treated with Lut at the MIC value; magnification: 100X.

Figure 3

SEM and TEM

SEM was used to observe the changes in the surface morphology of E. coli. The strains were treated with Lut at the concentration of MIC for 4 and 8 h, and untreated strains were set as the control group. The results are shown in Figure 5A. The control group exhibited distinctive features with regular rod shape and intact cell surface (Figures 4A-a1,-b1). After treatment with Lut at the MIC value for 4 h, the cells exhibited a significant change in their morphology and became irregular and shriveled (Figures 4A-a2,-b2). After 8 h of treatment, the cell walls of the treated cells showed more severe morphological destruction, cellular damage and leakage of cell content (Figures 4A-a3,-b3).Figure 4 SEM and TEM findings. (A) Result of E. coli ATCC 25922, a1: E. coli ATCC 25922 blank control; a2: E. coli ATCC 25922-Lut 4 h; a3: E. coli ATCC 25922-Lut 8 h. (B) Result of E. coli clinical strain, b1: E. coli clinical strain blank control; b2: E. coli clinical strain-Lut 4 h; b3: E. coli clinical strain Lut 8 h.

Figure 4

To further observe the changes in the submicroscopic structure of the bacterial cells, the cell wall and cell membrane were observed by TEM (Figure 4B). The cells treated with Lut at MIC value for 4 h showed slight separation of the inner and outer membranes (Figures 4B-a2,-b2). Following 8 h of treatment, the cell surface was broken, with more apparent separation of the cell wall and cell membranes; moreover, some cell contents leaked outside the cell (Figures 4B-a3,-b3).

These results further confirmed that Lut can accelerate the death of E. coli strains by destroying their membrane structure and leaking their contents.

DIA

A total of 4217 proteins were isolated. Based on Student's t-test and FC values (the ratio of the average expression levels between 2 groups), 159 proteins with significantly different expression (P < 0.05, FC > 3.0) were screened out; of these, 92 and 67 proteins were upregulated and downregulated, respectively (Figure 5A). Subcellular localization of DEPs revealed that they are mostly related to membrane structure (Figure 5B). GO analysis showed that the DEPs are mainly related to cellular processes, metabolic processes, cellular anatomical entities, and catalytic activities (Figure 5C). KEGG analysis showed that Lut enhanced metabolic pathways such as phenylalanine metabolism, biosynthesis of sideline group nonribosomal peptides, and microbial metabolism in diverse environments and inhibited cationic antimicrobial peptide resistance and propylene metabolism (Figures 5D and 5E), this directly indicated that Lut can reduce bacterial resistance to the host's natural immunity.Figure 5 Results of proteomic analysis.(A) Count of upregulated and downregulated proteins; (B) Subcellular colocalization of differentially expressed proteins; (C) GO analysis of differentially expressed proteins; (D) KEGG pathway enrichment analysis of differentially expressed proteins; (E) Butterfly enrichment plot of KEGG pathway enrichment analysis of differentially expressed proteins. Differences were considered significant at P < 0.05.

Figure 5

Growth Performance

The E.coli-infected chickens showed ruffled feathers, inability to stand, dropped wings, loss of appetite, lethargy, difficulty in breathing, white to yellowish diarrhea, and a high mortality rate of 20%. Table 5 shows the growth performance results. During the construction of the disease model, chickens infected with E. coli showed a significant decrease in body weight (BW), ADG, and ADF1 as compared to the mock group (P < 0.01); furthermore, no significant difference in BW and ADG was observed between the Lut and mock groups (P > 0.05). During the entire experimental period, E. coli-infected chickens showed a significant decrease in BW, ADG, and ADF1 as compared to those in the mock group (P < 0.01). The treatment group showed an increase in BW, ADG, and ADF1 as compared to the group; moreover, the high-dose Lut group showed a significant increase in BW and ADG (P < 0.05). Furthermore, compared to mock group chickens, E. coli-infected chickens showed an increase in FCR (P < 0.05). This results showed that the decrease in growth performance of the experimental chickens caused by E. coli was improved after treatment with luteolin.Table 5 Sensitivity of clinical E. coli on different antibiotics.

Table 5Drug category	Drug name	Drug content	Sensitivity	
Quinolones	Norfloxacin	10μg	R	
Macrolides	Azithromycin	15μg	R	
Acetylspiramycin	30μg	R	
Chloramphenicol	Florfenicol	30μg	R	
Aminoglycosides	Tobramycin	10μg	R	
Tetracyclines	Doxycycline	30μg	R	
Cephalosporins	Ceftizoxime	30μg	R	
R:resistant; I: intermediary; S: sensitive.

Immune Organ Index

Table 6 shows the effects of Lut treatment on the chicken immune organ index. Compared to the mock group, the infected group showed a significant reduction in the thymus index and bursa index (P < 0.05), but showed no significant effect on the spleen index (P > 0.05). Lut treatment improved these changes in each group. The high-dose Lut group showed the best effect (P< 0.05), followed by the medium-dose Lut group (P < 0.05). Figure 6 illustrates the effect of immune organ damage in the experimental chickens.Table 6 Immune organ indices of SPF chickens.

Table 6			E. coli-infected chickens treated with luteolin concentrations (g/kg)	
Items	Mock	Luteolin	0	100	200	400	
Bursa index (%)	0.479 ± 0.030a	0.468 ± 0.025a	0.247 ± 0.016cd	0.231 ± 0.019d	0.276 ± 0.009c	0.366 ± 0.029b	
Thymus index (%)	0.412 ± 0.006a	0.402 ± 0.013a	0.170 ± 0.006d	0.207 ± 0.010c	0.302 ± 0.012b	0.321 ± 0.007b	
Spleen index (%)	0.188 ± 0.004c	0.196 ± 0.007c	0.223 ± 0.007a	0.221 ± 0.005ab	0.198 ± 0.008c	0.204 ± 0.006bc	
Letters a, b, and c indicate that the difference between the groups in the same column is significant (P< 0.05).

Figure 6 Immune organ indices of the experimental chickens. Chickens in groups E.coli-Luteolin (100), E.coli-Luteolin (200), E.coli-Luteolin (400), and E.coli were orally administered for 2 wk with Lut and PBS, respectively. Noninfected chickens treated with PBS served as group Mock. In addition, the drug control group was treated with Luteolin. The bursas, thymuses, and spleens collected at 7 dph in each group were shown. Scale bar, 1.0 cm.

Figure 6

H&E Staining

A histopathological analysis was performed to clarify the protective effects of Lut against Ecoil-induced damage in the duodenum and heart tissues. As Figures 7A and 7B showed that the E. coli-infectedgroup and the mock group showed significant differences in the histological changes in the duodenum and heart. Following infection with E. coli strains, the heart showed severe bleeding, myocardial effusion, inflammatory cell infiltration, and myocardial deformation (Figure 7A-a3), while the duodenum showed duodenal villi atrophy and deformation, intestinal mucosa thickening, and several bleeding points (Figure 7B-a3).Figure 7 H&E staining results of chicken heart and duodenum. (A) Heart and (B) Duodenum. a1,b1: mock; a2, b2: Luteolin; a3, b3: E. coli; a4, b4: E.coli-Luteolin (100); a5, b5: E.coli-Luteolin (200); a6, b6: E.coli-Luteolin (400). The arrows on a3-a4 indicate bleeding, myocardial effusion, inflammatory cell infiltration, and thickening of the cardiac mucosa. The arrows on b3 indicate duodenal villi atrophy and deformation, intestinal mucosal thickening, and bleeding.

Figure 7

Serum Immunoglobulin and Inflammatory Factors

The effects of Lut treatment on the levels of serum immunoglobulins and inflammatory factors were showed in Table 7, Table 8. Compared to the mock group, the E. coli-infected group showed deincreased serum IgA and IgG levels in chickens (P < 0.05), while the Lut treatment group showed increased serum IgA and IgG levels (P < 0.05). In contrast to the mock group, the infected group showed increased levels of serum IL-1β, IL-6, and TNF-α (proinflammatory factors) and a decreased level of IL-10 (an anti-inflammatory factor) (P < 0.05), while the treatment group showed decreased levels of serum IL-1β, IL-6, and TNF-α and increased serum IL-10 level (P < 0.05).Table 7 Serum IgA, IgG levels in SPF chickens.

Table 7			E. coli-infected chickens treated with luteolin concentrations (g/kg)	
Items	Mock	Luteolin	0	100	200	400	
IgA (mg/mL)	6.50 ± 0.08a	5.9 ± 0.14b	4.85 ± 0.17c	5.52 ± 0.12b	5.78 ± 0.21b	5.98 ± 0.14b	
IgG (ng/mL)	67.28 ± 1.31a	61.09 ± 0.94b	43.82 ± 0.57d	54.35 ± 1.04c	56.29 ± 1.22c	60.73 ± 1.38b	
IgA: Immunoglobulin A; IgG: Immunoglobulin G.

Letters a, b, and c indicate that the difference between the groups in the same column is significant (P < 0.05).

Table 8 Serum IL-6, IL-10, IL-1β, and TNF-α levels in SPF chickens.

Table 8			E. coli-infected chickens treated with luteolin concentrations (g/kg)	
Items	Mock	Luteolin	0	100	200	400	
IL-6 (ng/L)	35.54 ± 0.91b	38.60 ± 1.17ab	40.43 ± 1.29a	40.35 ± 1.06a	37.99 ± 0.98ab	36.97 ± 0.83b	
IL-10 (ng/L)	56.73 ± 0.63a	54.67 ± 0.46b	48.05 ± 0.45e	49.88 ± 0.51d	52.19 ± 0.44c	54.89 ± 0.79b	
IL-1β (ng/L)	17.27 ± 0.39d	19.36 ± 0.34bc	22.00 ± 0.59a	18.61 ± 0.64bcd	19.88 ± 0.38b	18.31 ± 0.23cd	
TNF-α (ng/L)	36.54 ± 0.78b	33.46 ± 0.47c	43.60 ± 0.88a	41.95 ± 0.85a	36.52 ± 0.52b	34.51 ± 0.53bc	
IL-6: Interleukin-6; IL-10: Interleukin-10; IL-1β: Interleukin-1β; TNF-α: Tumor necrosis factor-α. Letters a, b, and c indicate that the difference between the groups in the same column is significant (P < 0.05).

Serum Oxidative Status

To assess the antioxidant capacity of Lut in experimental chickens, we measured the levels of MDA, GSH, and T-AOC. Table 9 shows the effects of Lut treatment on the antioxidant activity of chickens infected with E. coli. Compared to the mock group, the infected group showed significantly decreased activity of GSH-PX, T-SOD, and CAT and a significant increase in MDA content (P< 0.05). These changes in the levels of GSH-PX, T-SOD, CAT, and MDA were reversed after treatment with Lut (P < 0.05).Table 9 GSH-Px, MDA, T-SOD, and CAT levels in SPF chickens.

Table 9			E. coli-infected chickens treated with luteolin concentrations (g/kg)	
Items	Mock	Luteolin	0	100	200	400	
GSH-Px(IU/L)	525.09 ± 2.44a	489.36 ± 3.93c	404.33 ± 5.77e	461.37 ± 7.08cd	498.73 ± 6.13b	508.65 ± 5.13b	
MDA(nmol/L)	13.67 ± 0.08d	14.87 ± 0.08c	16.27 ± 0.10a	15.42 ± 0.35b	15.11 ± 0.12bc	13.49 ± 0.08d	
T-SOD(U/mL)	130.70 ± 1.21a	118.62 ± 0.53b	89.47 ± 0.76e	102.12 ± 1.34d	109.52 ± 0.84c	117.91 ± 0.66b	
CAT(U/mL)	55.44 ± 0.44a	49.13 ± 0.55b	41.51 ± 0.56e	45.22 ± 0.52d	47.15 ± 0.47c	50.39 ± 0.40b	
GSH-Px: Glutathione peroxidase; MDA: Malondialdehyde; T-SOD: Total superoxide dismutase; CAT: Catalase. Letters a, b, and c indicate that the difference between the groups in the same column is significant (P < 0.05).

Intestinal Gene Expression

Previous network pharmacological studies have found that IL-17 signaling pathway plays an important role in the antienteritis mechanism of luteolin in Humulus scandens. Figure 8 shows the gene expression results for the IL-17 pathway genes in the duodenum. Compared to the mock group, the infected group showed increased mRNA expression levels of the duodenalgenes IL-6, IL-17A, IL-17B, and NF-κB1 with significant differences (P < 0.05), while the Lut-treated group showed downregulation of the expression of these duodenal genes (P < 0.05). Furthermore, Lut treatment upregulated the mRNA expression level of the duodenal gene IL-17A (P < 0.05).Figure 8 Detection of IL-17 pathway-related factors in the duodenum. Differences were considered significant at P < 0.05. The mRNA expression levels of the IL-17 pathway-related genes, namely IL-17A, IL-17F, IL-6,and NF-κB1, in the duodenum were detected by qRT-PCR. All values shown are expressed as means ± SD. A lowercase letter indicates that the value of the corresponding group was significantly different from that of the control group (P < 0.05).

Figure 8

DISCUSSION

E. coli act as major pathogens causing intestinal or extraintestinal infections posing aserious threat to poultry food safety. The constant evolvement of various antibiotic-resistant bacterial strains has seriously threaten human health and made it difficult to control E. coli infection. Therefore, novel alternative therapeutic approaches that can control and prevent E. coli infection must be investigated, one such possibility is Lut. H. scandens as a Chinese herbal medicine, has several beneficial properties such as prevention of drug resistance and promotion of nutritional immunity. The present study predicted that Lut is the main antimicrobial component of H. scandens by network pharmacology analysis, and revealed the pathways and targets that H. scandensmay exert its effects on. Lut, as a natural flavonoidisolated from H. scandens, has been widely used for treating various clinical diseases because of its excellent anti-inflammatory activities (Cui et al., 2018; Cao et al., 2022; Xue et al., 2022). We conducted further experiments to verified the antibacterial and therapeutic effects of Lut on E. coli through in vitro and in vivo experiments.

Several studies have shown that extracts and bioactive substances from H. scandens exhibit antibacterial effects on various bacterial pathogens such as E. coli, Salmonella, and Staphylococcus aureus (Dang et al., 2023). In our study, it was found that Lut, the main antibacterial component of H. scandens, showed excellent antibacterial activity against the standard and clinical E. coli strains. The MIC values of Lut for the standard and clinical E. coli standards were 500 and 600 μg/mL, respectively. According to Table 4, the clinical E. coli strains are insensitive to all antibiotics and are highly resistant. But Lut can completely inhibit the proliferation of E. coli at the concentration of MIC, therefore, we conducted further experiments to determine its mechanism of inhibition. We speculated that Lut causes damage by inducing the rupture of E. coli, leading to the leakage of its contents. Thus, SEM and TEM were performed to observe changes in form and structure of E. coli treated with Lut. Cell membrane is an important barrier structure to ensure that cells complete various physiological functions, and provides a relatively stable internal environment for cell growth and metabolism. If the cell membrane is damaged, it will affect the normal growth and reproduction of the bacteria. The results showed that Lut treatment disrupted the integrity of cell structure, leading to cell lysis and extravasation of the contents. CLSM also observed the entry of nucleic acid dyes caused by cell membrane rupture. Similar results were reported by other authors, indicating that Lut may damage the cell membrane by inducing rupture (Xi et al., 2022).The results of DIA proteomics analysis showed that Lut may affect E. coli membranes through related biological processes, such as phenylalanine metabolism and propylene metabolism, but the specific mechanism remains to be verified. Futhermore, Lut treatment inhibited the expression of the CAMP resistance protein in E. coli, thus also indicating that Lut can reduce the resistance of E.colistrains to natural immunity and antimicrobial peptides from animals,this encouraged us to test its efect in vivo.

E.coli infection in SPF chickens caused a dramatical suppression in body weight gain and food intake, moreover, the chickens showed persistent symptoms such as coughing and mental lethargy and a high mortality. E. coli causes intestinal morphological damage to the intestinal barrier by adhering to the intestinal epithelium and secreting enterotoxins,promoting pathogen invasion and triggering inflammatory reactions. The duodenum showed atrophy and shedding of duodenal villi, incomplete morphological structure, and infiltration of inflammatory cells. Moreover, villous atrophy and intestinal morphology disorder and consequently reduced nutrients absorption and weight loss in chickens. Inthisstudy, we were surprised to find that Lut can slow down the morphological damage of the duodenum, protect the intestinal barrier, and prevent the invasion of pathogenic microorganisms. Furthermore, Lut was able to alleviate E. coli - induced decreases in production performance, restored theirphysical conditions. This finding provides direct support that Lut can be used as an antibiotic substitute for treating E. coli infection. These findings are in agreement with previous studies (Hassan et al., 2023).

The initial increase of serum immunoglobulins could be associated with antigenic stimulation of the infecting microorganism. However, as the infection getting worse, the immune system is suppressed and immunoglobulin levels decrease (Cao et al., 2013; Wu et al., 2021). The IgA is considered the most important immunoglobulin in the intestinal mucosa which restrict microorganisms and antigens to break into the mucosal barriers (Corthésy, 2013). Therefore, this acts as the first line of defense against infection. The IgG is a crucial index of body humoral immunity, which has antibacterial and neutralizing viruses effects (Crawley and Wilkie, 2003). Our data revealed a significant decrease in serum IgA and IgG levels in E. coli - infected group as compared with the Mock group. And following treatment with Lut, the levels of serum IgA and IgG increased, which suggested that Lut enhanced the humoral immunity of the chickens against E. coli infection. The immune organ index is thought to be positively correlated with animal immunity (Yang et al., 2020). The immune system of the body is closely associated with the development of immune organs. The thymus, bursa, and spleen are the 3 most important immune organs in poultry birds.Our present study showed that following E. coli infection, the thymus and spleen indices significantly decreased, while the change of bursa index is not significant. Consistent with several previous reports (Kamboh et al., 2016), after treated with Lut, the thymus and spleen indices significantly recovered. These present results further suggested that Lut enhanced the immunity of the chickens.

Furthermore, our data also confrmed the anti-infammatory and antioxidant properties of Lut. Cytokines are immunoregulatory peptides that contribute to innate and adaptive immunity, they play an essential role in immunoregulation (Lee et al., 2011). Excessive production of proinflammatory cytokines IL-6, IL-10, IL-1β and TNF-α can aggravate inflammation, whereas anti-inflammatory cytokines play a key role in relieving inflammation. E. coli infection increase the serum levels in IL-6, IL-1β and TNF-α, decrease the serum levels in IL-10. Lut treatment relieve inflammation of birds by improving IL-10 level in serum, and reducing the levels of L-6, IL-1β and TNF-α in serum, which is similar to the results reportedby Fei et al. in rats (Fei et al., 2019). Antioxidant enzymes play a crucial role in reducing oxidative stress caused by xenobiotics (Wu et al., 2016). GSH-PX, T-SOD, and CAT are the main enzymes in the antioxidant system, whose activities indirectly reflect the ability to scavenge ROS (Liu et al., 2020). SOD and GSH-Px can scavenge reactive oxygen species and thus function as antioxidants. CAT level was estimated to evaluate cell oxidative status. MDA is one of the most frequently used indicators of lipid peroxidation. In the current study, E. coli infection decreased T-SOD, CAT and GSH-Px activities and increased MDA concentrations in serum, the treatment with Lut significantly alleviated the changes in these parameters, indicating that Lut enhanced theactivity of antioxidant enzymes. The results of antioxidant effects is similar to the results reported by Pan earlier (Pan et al., 2022).

In the process of molecular mechanism investigation, the enriched IL-17 pathway was targeted by KEGG pathway analyses. IL-17 is discovered as a pro-inflammatory factor that stimulates the production of many chemokines and amplifying the inflammatory response. In IL-17 family. IL-17F shares the highest homology with IL-17A (55%) and is often co-expressed with IL-17A (Akimzhanov et al., 2007). IL-17 is involved in the regulation of NF-kB and activation of Th17 cell-dependent immune response, like the key Th17 polarizing cytokines IL-6 (Brembilla et al., 2018). Studies have reported that Lut alleviates E. coli induced MG proliferation in broilers by inhibiting IL-17/NF-kB expression (Wang et al., 2023). Whether Lut could inhibit E. coli induced enteric infection through the IL-17 pathway to ensure the safety of poultry food has not been investigated. In our study, we evaluated the relative mRNA expression of IL-17A and related factors in duodenum after Lut treatment. Here, we found that Lut effectively inhibited E. coli-induced the increase of IL-6 and NF-kB1 expression, and a similar inhibitory effect was observed for IL-17A and IL-17F. Moreover, the Lut group also showed increase in the expression level of IL-17A; this finding futher indicated that IL-17A is involved in the mechanism through which Lut exerts antibacterial effects. The expression of IL-17F showed no significant change; this might be related to the report of Elshazli which showed that IL-17A has stronger biological effects, resulting in stronger regulatory effects on the downstream genes (Feldman and Wolfe, 2014).

The dose of Lut used in animal experiments is based on research by Amer et al (Amer et al., 2022; El-Ghareeb et al., 2023; Hassan et al., 2023), and the additives or drugs used in the above experiments were flavonoids, which were similar to the structure and effect of Lut. The chickens used in this experiment did not distinguish between gender, but the organ morphology, immunoglobulin and inflammatory factors in the Lut alone treated group were in the normal range with no adverse effects. The high-dose Lut group in this experiment has obvious therapeutic effect, but its safe dose range and optimal therapeutic dose need to be further verified.

CONCLUSIONS

The present study showed that Lut, the main antibacterial component of H. scandens, damaged the cell wall and cell membrane of E. coli, resulting in bacterial death through content leakage; this effect improved the immune status of SPF chickens with E. coli infection. Lut, as an antibacterial and anti-inflammatory agent, shows a significant improvement in treating colitis caused by E. coli.

DISCLOSURES

The authors declare that they have no conflict of interest.

ACKNOWLEDGMENTS

This work was supported by the Project of Natural Science Foundation of Shandong Province (ZR2021MC060 ), Agricultural scientific and technological innovation project of Shandong Academy of Agricultural Sciences(CXGC2024D11 , CXGC2024B07 , CXGC2023A22 , CXGC2023A10 ), Key R&D Program of Shandong Province, China (2022LZGC014 , 2022LZGC013 ), and Taishan Industry Experts Program (TSCX202306046 ).

Ethicals approval: All animal experiments were performed in accordance with the Ethical Principles in Animal Research and were approved by the Committee for Ethics in Shandong Academy of Agricultural Science (approval number: SAAS-2022-G32).

Author contributions: XL, WD, JL, and KM designed the research. XL, WD, YZ, YT,YX, MY, XY, and GL performed the research. XL, WD, YZ, and YX analyzed the data. XL, WD, and KM wrote the paper.
==== Refs
REFERENCES

Akimzhanov A.M. Yang X.O. Dong C. Chromatin remodeling of interleukin-17 (IL-17)-IL-17F cytokine gene locus during inflammatory helper T cell differentiation J. Biol. Chem. 282 2007 5969 5972 17218320
Amer S.A. Al-Khalaifah H.S. Gouda A. Osman A. Goda N.I.A. Mohammed H.A. Darwish M.I.M. Hassan A.M. Mohamed S.K.A. Potential effects of anthocyanin-rich roselle (hibiscus sabdariffa L.) extract on the growth, intestinal histomorphology, blood biochemical parameters, and the immune status of broiler chickens Antioxidants 11 2022 544 35326194
Brembilla N.C. Senra L. Boehncke W.H. The IL-17 Family of Cytokines in Psoriasis: IL-17A and Beyond Front. Immunol. 9 2018 1682 30127781
Cao G.T. Zeng X.F. Chen A.G. Zhou L. Zhang L. Xiao Y.P. Yang C.M. Effects of a probiotic, enterococcus faecium, on growth performance, intestinal morphology, immune response, and cecal microflora in broiler chickens challenged with Escherichia coli K88 Poult. Sci. 92 2013 2949 2955 24135599
Cao L. Xu E. Zheng R. Zhangchen Z. Zhong R. Huang F. Ye J. Sun H. Fan Y. Xie S. Chen Y. Xu Y. Cao J. Cao W. Liu C. Traditional Chinese medicine Lingguizhugan decoction ameliorate HFD-induced hepatic-lipid deposition in mice by inhibiting STING-mediated inflammation in macrophages Chin. Med. 17 2022 7 34983596
Chen Z. Wang X. Zhu Y. Wang L. Wang Y. Nie H. Meng F. Separation and identification of flavonoid constituent in Humulus Scandens and their effects on alveolar fluid clearance in mice Chin. Pharmacol. Bull. 31 2015 1715 1718
Corthésy B. Multi-faceted functions of secretory IgA at mucosal surfaces Front. Immunol. 4 2013 185 23874333
Crawley A. Wilkie B.N. Porcine Ig isotypes: function and molecular characteristics Vaccine 21 2003 2911 2922 12798635
Cui X. Wang S. Cao H. Guo H. Li Y. Xu F. Zheng M. Xi X. Han C. A review: The bioactivities and pharmacological applications of polygonatum sibiricum polysaccharides Molecules 23 2018 1170 29757991
Dang X. Wang H. Li S.H. Fan X.Y. Li D. Application potential of humulus scandens in livestock husbandry J. Anim. Physiol. Anim. Nutr. 107 2023 1392 1401
Demetgül C. Beyazit N. Synthesis, characterization and antioxidant activity of chitosan-chromone derivatives Carbohydr. Polym. 181 2018 812 817 29254040
Di Capua A. Adami R. Reverchon E. Production of luteolin/biopolymer microspheres by supercritical assisted atomization Ind. Eng. Chem. Res. 56 2017 4334 4340
El-Ghareeb W.R. Kishawy A. Anter R. Aboelabbas G.A. Abdelaziz W.S. Alhawas B. Meligy A. Abdel-Raheem S.M. Ismail H. Ibrahim D. Novel antioxidant insights of myricetin on the performance of broiler chickens and alleviating experimental infection with eimeria spp.: crosstalk between oxidative stress and inflammation Antioxidants 12 2023 1026 37237892
Fei J. Liang B. Jiang C. Ni H. Wang L. Luteolin inhibits IL-1β-induced inflammation in rat chondrocytes and attenuates osteoarthritis progression in a rat model Biomed. Pharmacother. 109 2019 1586 1592 30551412
Feldman A.T. Wolfe D. Tissue processing and hematoxylin and eosin staining Methods. Mol. Biol. 1180 2014 31 43 25015141
Feng J. Wu Y. Yang Y. Jiang W. Hu S. Li Y. Yang Y. Humulus scandens exhibits immunosuppressive effects in vitro and in vivo by suppressing CD4(+) T cell activation Am. J. Chin. Med. 42 2014 921 934 25004883
Franza L. Carusi V. Nucera E. Pandolfi F. Luteolin, inflammation and cancer: Special emphasis on gut microbiota Biofactors 47 2021 181 189 33507594
Hao L. Wang C. Wang H. Wang J. Wang Y. Hu H. Effects of supplementing with Humulus scandens on the growth performance and gut microbiota in piglets J. Appl. Microbiol. 133 2022 3546 3557 35988052
Hassan M. Wang Y. Rajput S.A. Shaukat A. Yang P. Farooq M.Z. Cheng Q. Ali M. Mi X. An Y. Qi D. Ameliorative effects of luteolin and activated charcoal on growth performance, immunity function, and antioxidant capacity in broiler chickens exposed to deoxynivalenol Toxins 15 2023 478 37624235
Ji L. Su S. Xin M. Zhang Z. Nan X. Li Z. Lu D. Luteolin ameliorates hypoxia-induced pulmonary hypertension via regulating HIF-2α-Arg-NO axis and PI3K-AKT-eNOS-NO signaling pathway Phytomedicine 104 2022 154329
Kamboh A.A. Hang S.Q. Khan M.A. Zhu W.Y. In vivo immunomodulatory effects of plant flavonoids in lipopolysaccharide-challenged broilers Anim 10 2016 1619 1625
Lee K.W. Li G. Lillehoj H.S. Lee S.H. Jang S.I. Babu U.S. Lillehoj E.P. Neumann A.P. Siragusa G.R. Bacillus subtilis-based direct-fed microbials augment macrophage function in broiler chickens Res. Vet. Sci. 91 2011 e87 e91 21338997
Li T.L. Yin X.H. Pan W.D. Yang J. Liang G.Y. Study on the chemical constituents of Humulus scandens Zhong Yao Cai 33 2010 55 57 20518305
Liu J.B. Yan H.L. Zhang Y. Hu Y.D. Zhang H.F. Effects of stale maize on growth performance, immunity, intestinal morphology and antioxidant capacity in broilers Asian-Australas J. Anim. Sci. 33 2020 605 614 31480160
Liu K. Zha X. Li Q. Pan L. Luo J. Hydrophobic interaction and hydrogen bonding driving the self-assembling of quinoa protein and flavonoids Food Hydrocoll 118 2021 106807
Liu T. Han S. Optimization of monomer combination formula of luteolin, scutellaria baicalensis and quercetin and its anti chronic pharyngitis effect Sci. Technol. Vision 09 2015 22 84
Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T) Method Methods 25 2001 402 408 11846609
Luo H. Vong C.T. Chen H. Gao Y. Lyu P. Qiu L. Zhao M. Liu Q. Cheng Z. Zou J. Yao P. Gao C. Wei J. Ung C. Wang S. Zhong Z. Wang Y. Naturally occurring anti-cancer compounds: Shining from Chinese herbal medicine Chin. Med. 14 2019 48 31719837
Pan Q. Liu Y. Ma W. Kan R. Zhu H. Li D. Cardioprotective effects and possible mechanisms of luteolin for myocardial ischemia-reperfusion injury: A systematic review and meta-analysis of preclinical evidence Front. Cardiovasc. Med. 9 2022 685998
Peng X. Shao J. Liu B. Zhang F. Jin F. Wu J. Volatile oil composition and content in different parts of fresh Guizhou Humulus scandens Guizhou Ag. Sci. 42 2014 178 181
Silva-Angulo A.B. Zanini S.F. Rosenthal A. Rodrigo D. Klein G. Martínez A. Comparative study of the effects of citral on the growth and injury of Listeria innocua and Listeria monocytogenes cells PLos One 10 2015 e114026
Wang L. Zhong C. Zu Y. Zhao X. Deng Y. Wu W. Sun X. Wang L. Wu M. Preparation and characterization of luteolin nanoparticles for enhance bioavailability and inhibit liver microsomal peroxidation in rats J. Funct. Foods. 55 2019 57 64
Wang S. Diagnosis and comprehensive prevention and control measures of chicken Escherichia coli disease Chin. Anim. Health. 25 2023 63 64
Wang T. Jiang G. Lv S. Xiao Y. Fan C. Zou M. Wang Y. Guo Q. Ahsanul K.M. Peng X. Avian safety guardian: Luteolin restores Mycoplasma gallisepticum-induced immunocompromise to improve production performance via inhibiting the IL-17/NF-kB athway Int. Immunopharmacol 124 2023 110946
Wu Y. Zhou Y. Lu C. Ahmad H. Zhang H. He J. Zhang L. Wang T. Influence of butyrate loaded clinoptilolite dietary supplementation on growth performance, development of intestine and antioxidant capacity in broiler chickens PLoS One 11 2016 e154410
Wu Z. Yang K. Zhang A. Chang W. Zheng A. Chen Z. Cai H. Liu G. Effects of lactobacillus acidophilus on the growth performance, immune response, and intestinal barrier function of broiler chickens challenged with escherichia coli O157 Poult. Sci. 100 2021 101323
Xi M. Hou Y. Wang R. Ji M. Cai Y. Ao J. Shen H. Li M. Wang J. Luo A. Potential application of luteolin as an active antibacterial composition in the development of hand sanitizer products Molecules 27 2022 7342 36364167
Xue W. Li Y. Zhao Q. Liang T. Wang M. Sun P. Zhu A. Wu X. Chen L. Zhang T. Huo S. Li Y. Research note: Study on the antibacterial activity of Chinese herbal medicine against aspergillus flavus and aspergillus fumigatus of duck origin in laying hens Poult Sci 101 2022 101756
Yang S. Jin X. Xu Y. The immunomodulatory effect and mechanism of flavonoids on broiler chickens J. Anim. Nutr. 32 2020 4003 4009
Yu Y. Wang L. Gao F. Quantitative analysis and bacteriostasis of polyphenols extracts from peanut shells by ultrahigh pressure extraction. Proceedings of the 2016 4th International Conference on Machinery AER-Adv. Engin. Res. 60 2016 1501 1505
Zhang D. Tan L. Feng Y. Yao L. Yan X. Cao W. Evaluation of antioxidant, anti-inflammatory activity and identification of active compounds of Humulus scandens S. Afr. J. Bot. 141 2021 126 132
Zhao J. Guo M. Liu X. A study on the antitussive, expectorant, and asthmatic effects of peanut shell alcohol extract Chin. J. Ethnomed. Ethnopha. 23 2014 11 12
Zhou Q. Yuan K. Liu F. Du L. The antibacterial effect and mechanism of carvacrol on enterobacter cloacae Food Sci 40 2019 22 27
