
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

4251
10.1186/s12917-024-04251-0
Research
Molecular and in silico analyses for detection of Shiga toxin-producing Escherichia coli (STEC) and highly pathogenic enterohemorrhagic Escherichia coli (EHEC) using genetic markers located on plasmid, O Island 57 and O Island 71
Nemati Ali 1
Askari Badouei Mahdi askari.m@um.ac.ir
microbiology.fum@gmail.com

13
Hashemi Tabar Gholamreza 1
Morabito Stefano 2
Dadvar Ali 1
1 https://ror.org/00g6ka752 grid.411301.6 0000 0001 0666 1211 Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran
2 https://ror.org/02hssy432 grid.416651.1 0000 0000 9120 6856 European Union Reference Laboratory (EURL) for Escherichia coli including Shiga toxin-producing E. coli (STEC), Department of Food Safety, Nutrition and Veterinary Public Health, Istituto Superiore di Sanità, Rome, Italy
3 https://ror.org/00g6ka752 grid.411301.6 0000 0001 0666 1211 Azadi Square, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad Campus, P.O. Box: 9177948974, 0513, 3880 5642 Tel, Iran
13 9 2024
13 9 2024
2024
20 41312 11 2023
26 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Due to the diversity of Shiga toxin-producing Escherichia coli (STEC) isolates, detecting highly pathogenic strains in foodstuffs is challenging. Currently, reference protocols for STEC rely on the molecular detection of eae and the stx1 and/or stx2 genes, followed by the detection of serogroup-specific wzx or wzy genes related to the top 7 serogroups. However, these screening methods do not distinguish between samples in which a STEC possessing both determinants are present and those containing two or more organisms, each containing one of these genes. This study aimed to evaluate ecf1, Z2098, Z2099, and nleA genes as single markers and their combinations (ecf1/Z2098, ecf1/Z2099, ecf1/nleA, Z2098/Z2099, Z2098/nleA, and Z2099/nleA) as genetic markers to detect potentially pathogenic STEC by the polymerase chain reaction (PCR) in 96 animal samples, as well as in 52 whole genome sequences of human samples via in silico PCR analyses.

Results

In animal isolates, Z2098 and Z2098/Z2099 showed a strong association with the detected top 7 isolates, with 100% and 69.2% of them testing positive, respectively. In human isolates, Z2099 was detected in 95% of the top 7 HUS isolates, while Z2098/Z2099 and ecf1/Z2099 were detected in 87.5% of the top 7 HUS isolates.

Conclusions

Overall, using a single gene marker, Z2098, Z2099, and ecf1 are sensitive targets for screening the top 7 STEC isolates, and the combination of Z2098/Z2099 offers a more targeted initial screening method to detect the top 7 STEC isolates. Detecting non-top 7 STEC in both animal and human samples proved challenging due to inconsistent characteristics associated with the genetic markers studied.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-024-04251-0.

Keywords

Shiga toxin-producing Escherichia coli
STEC
Plasmid
HUS
Genetic markers
http://dx.doi.org/10.13039/501100003121 Ferdowsi University of Mashhad FUM. 57299 FUM. 57299 FUM. 57299 FUM. 57299 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Enterohemorrhagic Escherichia coli (EHEC), a subset of Shiga toxin-producing E. coli (STEC), cause severe human illnesses such as hemorrhagic colitis and hemolytic uremic syndrome (HUS) [1]. The contamination of food products by EHEC remains a global concern, potentially leading to outbreaks of human disease [2–4]. STEC comprises more than 400 serotypes, many of which have been reported in foodstuffs and animals. However, in most cases, severe human illness is attributed to one of the seven well-defined EHEC serogroups, namely O26, O45, O103, O111, O121, O145, and O157 [5, 6]. These serogroups are considered adulterants in beef trim by the U.S. Department of Agriculture’s (USDA) Food Safety and Inspection Service (FSIS), which routinely conducts verification testing for these strains in domestic and imported beef manufacturing trimmings [7].

The top 7 EHEC serogroups typically possess the stx and eae genes and are classified as having high virulence potential [8, 9]. The ISO/TS 13,136 (EU) and MLG5B.05 (US) reference methods include an initial screening for the presence of the stx1/stx2 and eae genes. Presumptive-positive samples are then examined for genes associated with the top 5 (O157, O26, O103, O111, and O145) or top 7 serogroups, depending on whether the ISO/TS 13,136 or MLG5B.05 protocols are used, respectively [10, 11]. One of the main drawbacks of these reference methods is that many eae-negative STEC, enteropathogenic E. coli (EPEC), E. albertii, and free stx-converting phages can also react with these genetic targets, leading to false-positive results, especially in food, feces, and environmental samples [12–14]. Therefore, new genetic markers that specifically target EHEC (stx-positive and eae-positive strains of the top 7 E. coli serotypes) may improve the testing of food when this subpopulation of STEC must be detected in compliance with specific regulations, thereby reducing the rate of false positive results.

Various studies have reported potential genetic markers for EHEC. In 2014, Luedtke et al. at the U.S. Department of Agriculture evaluated the use of the EHEC-specific target E. coli attaching and effacing gene-positive conserved fragment 1 (ecf1) for the detection of EHEC directly from cattle feces [15]. The ecf1 gene is located on a unique conserved 5.6-kb fragment on the enterohemolysin-encoding plasmid of eae- and ehxA-positive STEC [16]. This fragment is part of the ecf operon, which consists of four genes (ecf1 to ecf4) and encodes four proteins involved in cell wall synthesis [17]. Other targets have been derived from several pathogenicity islands (PAIs) located on chromosomal regions. PAIs harbor genes that can serve as genetic signatures. The suitability of Z2098 and Z2099 genes, on the genomic O island 57 (OI-57), which may be associated with increased virulence of STEC strains in humans [18], has been tested for the identification of human-virulent STEC strains, particularly those of the top 7 EHEC serotypes [5]. Another chromosomally located gene, nleA (espI) on O island 71 (OI-71), has also been proposed as a candidate to distinguish EHEC from EPEC and STEC strains that may not be associated with severe and epidemic diseases [19].

The ecf1, Z2098, Z2099, and nleA genes may indeed have intrinsic value in identifying the top 7 EHEC [20]. The association of such genetic markers with highly pathogenic EHEC strains would be of interest to increase the specificity of the EHEC screening step in food, fecal, and environmental samples [21]. To clarify this relationship, we identified the presence of each of these genetic markers in STEC and EHEC strains belonging to different serogroups associated with animal hosts in Iran. Furthermore, we evaluated their combinations to find the best approach for a more specific and sensitive detection of the top 7 EHEC strains. Additionally, in silico PCR (polymerase chain reaction) analyses were conducted on whole-genome sequences of the top 7 and other emerging STEC/EHEC serotypes in human HUS patients retrieved from the NCBI GenBank database to explore the suitability of this approach for application to culture-independent NGS-based methods.

Methods

STEC isolates investigated

A total of 50 STEC collection strains were utilized. These isolates were gathered from various provinces in Iran, including Tehran, Razavi Khorasan, Semnan, Mazandaran, and Khuzestan. They were obtained from different animal hosts (cattle, sheep, goats, and pigeons) during the period from 2018 to 2020, as documented in our previous studies (refer to Table S1 in the supplementary materials). Moreover, 46 new STEC strains were added to this study. These strains were collected from a total number of 75 fecal samples from cattle, 70 from sheep, and 15 from goats in Razavi Khorasan province during the period from April 2022 to June 2022 (Strains’ features are provided in Table S1).

DNA extraction

All E. coli isolates were confirmed through culturing on MacConkey agar, Eosin-Methylene Blue (EMB) agar and subsequent biochemical tests. Afterward, a pure colony of each isolate was cultured on Luria Bertani (LB) agar and incubated for 24 h at 37 °C. After overnight culture on LB agar, total genomic DNA was extracted by the boiling method. In brief, a loopful from confluent growth area in LB agar culture was suspended in sterile microtubes containing 350 µL molecular grade water and boiled for 10 min. Then, samples were centrifuged at 5000×g for 5 min, and the supernatants were used as templates for end-point PCR assays. The quality and quantity of the extracted total genomes were evaluated using the NanoDrop-1000 spectrophotometer (ThermoFisher). DNA templates were kept at − 20 °C until the further analyses.

Strain characterization

To confirm the STEC genotype, a multiplex-PCR (Table 1) targeting stx1, stx2, eae, and ehxA was used as described previously [22]. For detection of stx in pigeon isolates, a single primers pair was used (Table 1) to amplify the stx2f [23]. E. coli O157:H7 strain (ATCC 35218) and E. coli O157:H7 strain Sakai (ATCC BAA-460) were used as positive controls. The strain PG90 from the Ferdowsi University of Mashhad (FUM) collection was included as a control for stx2f.

Table 1 Primers used for identification of virulence/genetic markers and serogroups of studied STEC/EHEC isolates

Primer name	Sequence (5’-3’ direction)	Amplicon size (bp)	Reference	
Virulence markers				
stx1	ATAAATCGCCATTCGTTGACTAC	180	[22]	
	AGAACGCCCACTGAGATCATC			
stx2	GGCACTGTCTCTCTGAAACTGCTCC	255		
	TCGCCAGTTATCTGACATTCTG			
stx2f	AGATTGGGCGTCATTCACTGGTTG	428	[23]	
	TACTTTAATGGCCGCCCTGTCTCC			
eae	GACCCGGCACAAGCATAAGC	384	[22]	
	CCACCTGCAGCAACAAGAGG			
ehxA	GCATCATCAAGCGTACGTTCC	534		
	AATGAGCCAAGCTGGTTAAGCT			
ecf1	TATCAGCACCAAAGAGCGGGAACA	99	[30]	
	CCCTTATGAAGAGCCAGTACTGAA			
Z2098	ACATCACAGGCTTCCTGAGC	423	[31]	
	GGAACGTGCCTCCGAGATAG			
Z2099	TTCAACAGTAGCGCAGGCAA	266		
	CAAGCAGGGGCGGTTACTTT			
nleA	ATGAACATTCAACCGACCATACAATCTG	1326	[32]	
	TTAGACTCTTGTTTCTTGGATTATATCA			
Serogroups				
O26	CAATGGGCGGAAATTTTAGA	155	[26]	
	ATAATTTTCTCTGCCGTCGC			
O45	TGCAGTAACCTGCACGGGCG	238		
	AGCAGGCACAACAGCCACTACT			
O55	TCCTTATTTGTGTCGGGGG	207	[27]	
	CCAGGAAAGCTGCCAATTATC			
O80	TGAGAGCCAAGATCCAAGCA	158	[29]	
	TGGGCCATATTCGAAGTTTGAA			
O91	TTGCATCTGGCGCAATAAACACGG	616	[26]	
	ACACCATCCCAAATACCTGCTTGC			
O103	TTGGAGCGTTAACTGGACCT	321		
	GCTCCCGAGCACGTATAAAG			
O104	TGAACTGATTTTTAGGATGG	351		
	AGAACCTCACTCAAATTATG			
O111	TGTTTCTTCGATGTTGCGAG	438		
	GCAAGGGACATAAGAAGCCA			
O113	TGCCATAATTCAGAGGGTGAC	514		
	AACAAAGCTAATTGTGGCCG			
O121	TCCAACAATTGGTCGTGAAA	628		
	AGAAAGTGTGAAATGCCCGT			
O128	ATGATTTCTTACGGAGTGC	782		
	CTCTAACCTAATCCCTCCC			
O145	TTCATTGTTTTGCTTGCTCG	750		
	GGCAAGCTTTGGAAATGAAA			
O146	ATTCGGGTAACGACCCTGTGTTGA	378	[28]	
	AGACTGCTAATGCAAGGAACATGG			
O157	TCGAGGTACCTGAATCTTTCCTTCTGT	894	[26]	
	ACCAGTCTTGGTGCTGCTCTGACA			

Based on the data collected annually by the European Centre for Disease Prevention and Control (ECDC), the 14 serogroups more frequently associated with the disease in humans in the EU include O26, O45, O55, O80, O91, O103, O104, O111, O113, O121, O128, O145, O146, and O157 [24]. Serogroups O26, O45, O55, O91, O103, O104, O111, O113, O121, O128, and O145 were determined [25] by PCR using the primers shown in Table 1 [26–28]. Additionally, the serogroups of O80 and O146 were tested as described elsewhere [29]. E. coli O157:H7 (295 EC-TMU) and FUM collection strains were used as positive controls.

PCR for ecf1 gene

A PCR assay (Table 1), was used to amplify the ecf1 gene as described previously [30]. Amplification was performed in a final volume of 20 µL containing 2 µL template DNA, 1 unit Taq DNA polymerase, 0.5 µM of each primer, 1.5 mM MgCl2, and 200 µM dNTP mix in 1× PCR buffer as follows: initial denaturation at 94 °C for 3 min; 35 cycles of 94 °C for 30 s, 57 °C for 50 s and 72 °C for 30 s; and a final elongation step at 72 °C for 5 min. Amplicons were visualized after running at 100 V for 45 min on a 1.5% agarose gel containing green viewer safe stain. A 100 bp DNA ladder (CinnaGen, Iran) was used as a size marker. E. coli O157:H7 strain Sakai (ATCC BAA-460) was used as positive control in every PCR reaction (Table 1).

PCR for O Island 57 markers (Z2098 and Z2099 genes)

Amplification of Z2098 and Z2099 genes was carried out by a duplex-PCR assay (Table 1) according to our previous study [31]. Total DNA (2 µL) was used as template in a final volume of 25 µL mixture containing, 1 unit Taq DNA polymerase, 0.75 µM of each primer, 1.5 mM MgCl2, and 200 µM dNTP mix in 1× PCR buffer as follows: initial denaturation at 94 °C for 5 min; 35 cycles of 94 °C for 40 s, 56 °C for 30 s and 72 °C for 45 s; and a final elongation step at 72 °C for 7 min. Amplicons were visualized after running at 100 V for 1 h on a 1.5% agarose gel containing green viewer safe stain. A 100 bp DNA ladder (CinnaGen, Iran) was used as a size marker. The positive control was E. coli O157:H7 strain Sakai (ATCC BAA-460) that was used in every PCR reaction.

PCR for O island 71 marker (nleA gene)

The presence of nleA gene was evaluated using the uniplex-PCR (Table 1) designed by Mundy et al. [32]. PCR was carried out in 20 µL using 2 µL template DNA, 1 unit Taq DNA polymerase, 0.5 µM of each primer, 1.5 mM MgCl2, and 200 µM dNTP mix in 1× PCR buffer as follows: initial denaturation at 94 °C for 3 min; 35 cycles of 94 °C for 30 s, 52 °C for 55 s and 72 °C for 1 min; and a final elongation step at 72 °C for 5 min. Amplicons were visualized after running at 100 V for 45 min on a 1.5% agarose gel containing green viewer safe stain. A 100 bp DNA ladder (CinnaGen, Iran) was used as a size marker. E. coli O157:H7 strain Sakai (ATCC BAA-460) was used as positive control.

In silico PCR evaluation of genetic marker combinations in the top 7 and other important STEC/EHEC serotypes related to HUS patients

A total of 52 complete genome sequences of the top 7 (n = 40) and other emerging (n = 12) STEC/EHEC serotypes originating from human HUS patients were retrieved from NCBI GenBank database [33–36] (Accession numbers are provided in Table 2). Primer sequences of the genetic marker combinations, ecf1/Z2098, ecf1/Z2099, ecf1/nleA, Z2098/Z2099, Z2098/nleA, and Z2099/nleA were used to blast the genomes of the studied isolates to find the exact annealing sites and to extract the sequences corresponding the amplification products using CLC Genomics Workbench version 20.0 (https://digitalinsights.qiagen.com/products-overview/discovery-insights-portfolio/analysis-and-visualization/qiagen-clc-genomics-workbench/). The complete genome sequence of strain Sakai (ATCC BAA-460) was used as a reference.

Table 2 Metadata of the 52 whole genomes of the top 7 (n = 40) and other important (n = 12) EHEC serotypes originating from HUS patients

Strain	Pathotype	Serotype	Collection date	Location	ecf1	Z2098	Z2099	nleA	Accession number	
SEH1101	EHEC	O26:H11	2011	Sweden	+	+	+	+	JABWFR000000000		
SEH0404	EHEC	O26:H11	2004	Sweden	+	+	+	+	JABWEW000000000		
SEH1407	EHEC	O26:H11	2014	Sweden	+	+	+	+	JABWGD000000000		
SEH1004	EHEC	O26:H11	2010	Sweden	-	-	-	-	JABWFP000000000		
FWSEC0003	EHEC	O45:H2	2019	Canada	+	+	+	-	CP031916		
2011 C-4251	EHEC	O45:H2	2018	USA	+	+	+	-	CP027388		
SJ7	EHEC	O45:H16	2020	USA	-	+	+	-	CP044315		
SEH1403	EHEC	O103:H2	2014	Sweden	+	+	+	-	JABWFZ000000000		
SEH0702	EHEC	O103:H8	2007	Sweden	+	-	+	+	JABWFJ000000000		
2013 C-4225	EHEC	O103:H11	2018	USA	+	+	+	+	CP027578		
2013 C-3264	EHEC	O103:H25	2018	USA	+	+	+	-	CP027544		
SEH1201	EHEC	O111:H8	2012	Sweden	-	-	-	+	JABWFT000000000		
SEH0801	EHEC	O111:H8	2008	Sweden	+	+	+	-	JABWFK000000000		
SEH0601	EHEC	O121:H19	2006	Sweden	+	+	+	+	JABWFF000000000		
SEH1301	EHEC	O121:H19	2013	Sweden	+	+	+	+	JABWFW000000000		
SEH0504	EHEC	O121:H19	2005	Sweden	+	+	+	+	JABWFA000000000		
SEH0301	EHEC	O121:H19	2003	Sweden	+	+	+	+	JABWER000000000		
SEH9705	EHEC	O121:H19	1997	Sweden	+	+	+	+	JABWEN000000000		
SEH1002	EHEC	O121:H19	2010	Sweden	+	+	+	+	JABWFN000000000		
SEH1402	EHEC	O121:H19	2014	Sweden	+	+	+	+	JABWFY000000000		
SEH9401	EHEC	O121:H19	1994	Sweden	+	+	+	+	JABWEH000000000		
SEH1404	EHEC	O121:H19	2014	Sweden	+	+	+	+	JABWGA000000000		
SEH1202	EHEC	O121:H19	2012	Sweden	+	+	+	+	JABWFU000000000		
CFSAN004176	EHEC	O145:H25	2003	USA	-	-	+	-	CP014583		
CFSAN004177	EHEC	O145:H25	2004	USA	-	-	+	-	CP014670		
RM13514	EHEC	O145:H28	2010	USA	+	+	+	-	NZ_CP006027.1		
RM13516	EHEC	O145:H28	2007	Belgium	+	+	+	-	NZ_CP006262.1		
SEH1003	EHEC	O145:H28	2010	Sweden	+	+	+	-	JABWFO000000000		
TW14359	EHEC	O157:H7	2006	USA	+	+	+	+	NC_013008.1		
Sakai	EHEC	O157:H7	1996	Japan	+	+	+	+	NC_002695.1		
Xuzhou21	EHEC	O157:H7	1999	China	+	+	+	+	NC_017906.1		
SEH9901	EHEC	O157:H7	1999	Sweden	+	+	+	+	JABWEO000000000		
SEH9701	EHEC	O157:H7	1997	Sweden	+	+	+	+	JABWEJ000000000		
SEH0602	EHEC	O157:H7	2006	Sweden	+	+	+	+	JABWFG000000000		
SEH9501	EHEC	O157:H7	1995	Sweden	+	+	+	+	JABWEI000000000		
SEH0302	EHEC	O157:H7	2003	Sweden	+	+	+	+	JABWES000000000		
SEH0507	EHEC	O157:H7	2005	Sweden	+	+	+	+	JABWFD000000000		
SEH0202	EHEC	O157:H7	2002	Sweden	+	+	+	+	JABWEQ000000000		
SEH0402	EHEC	O157:H7	2004	Sweden	+	+	+	+	JABWEU000000000		
SEH1802	EHEC	O157:H7	2018	Sweden	+	+	+	+	JABWGI000000000		
115,237	STEC	O10:H25	2015	Finland	+	-	-	-	JAKYSD000000000		
54,748	STEC	O25:H4	2000	Finland	-	-	-	-	JAKYQQ000000000		
93,628	STEC	O55:H7	2009	Finland	-	-	-	-	JAKYOF000000000		
118,916	STEC	O55:H7	2016	Finland	-	-	-	-	JAKYRB000000000		
SEH1401	EHEC	O59:H19	2014	Sweden	-	-	-	-	JABWFX000000000		
94,076	STEC	O78:H4	2009	Finland	-	-	-	-	JAKYOE000000000		
2011C_3493	EAHEC	O104:H4	2011	USA	-	-	-	-	NC_018658.1		
SEH1203	EHEC	O109:H21	2012	Sweden	-	-	-	-	JABWFV000000000		
105,246	STEC	O146:H28	2013	Finland	-	-	-	-	JAKYVV000000000		
SEH1405	EHEC	O165:H25	2014	Sweden	+	-	+	-	JABWGB000000000		
SEH1501	EHEC	O165:H25	2015	Sweden	+	-	+	-	JABWGE000000000		
96,308	STEC	O182:H25	2010	Finland	+	+	+	-	JAKYOB000000000		

Results

STEC/EHEC serogroups of animal strains

Overall, the 96 animal STEC/EHEC isolates belonged to the serogroups O5 (n = 13), O26 (n = 6), O80 (n = 2), O91 (n = 3), O103 (n = 12), O111 (n = 3), O113 (n = 13), and O128 (n = 9). For 35 isolates, the O-groups were not defined based on the included serogroups surveyed.

STEC/EHEC serotypes of human genomes

The 52 whole genome sequences retrieved from the GenBank belonged to serotypes O26:H11 (n = 4), O45:H2 (n = 2), O45:H16 (n = 1), O103:H2 (n = 1), O103:H8 (n = 1), O103:H11 (n = 1), O103:H25 (n = 1), O111:H8 (n = 2), O121:H19 (n = 10), O145:H25 (n = 2), O145:H28 (n = 3), O157:H7 (n = 12), O10:H25 (n = 1), O25:H4 (n = 1), O55:H7 (n = 2), O59:H19 (n = 1), O78:H4 (n = 1), O104:H4 (n = 1), O109:H21 (n = 1), O146:H28 (n = 1), O165:H25 (n = 2), and O182:H25 (n = 1).

Distribution of ecf1, Z2098, Z2099, and nleA in Animal STEC/EHEC strains

Overall, the genetic marker ecf1 was detected in eight isolates: four O26 (4/6, 66.6%), three O111 (3/3, 100%), and one isolate for which the serogroup could not be identified (Fig. 1). All the eight ecf1-positive isolates were identified as EHEC strains (stx and eae positive) (8 of 32 EHEC, 25.0%) (Fig. 2). The genetic marker Z2098 was present in 15 isolates: five strains of each of the O26 (5/6, 83.3%) and O103 (5/12, 41.6%) serogroups, three O111 (3/3, 100%), and two not defined serotypes (Fig. 1). Of the 15 Z2098-positive isolates, 9 strains were identified as EHEC (9/32, 28.1%) (Fig. 2). The Z2099 genetic marker was detected in 38 isolates belonging to serogroups O5 (12 strains, 12/13, 92.3%), O26 (5 strains, 5/6, 83.3%), O111 (three strains, 3/3, 100%), O91 (three strains, 3/3, 100%), two isolates of each O113 (2/13, 15.3%) and O103 (2/12, 16.6%), and in 11 strains of not defined serogroup (Fig. 1). Among the 38 Z2099-positive isolates, 9 strains were identified as EHEC (9/32, 28.1%) (Fig. 2). The nleA genetic marker was detected in six isolates: five strains of O26 (5/6, 83.3%), and one isolate of a not defined serogroup (Fig. 1). All the nleA-positive isolates were identified as EHEC (6/32, 18.7%) (Fig. 2). More details are provided in Table 3.

Table 3 Presence of genetic/virulence markers in 42/96 STEC and EHEC isolates included in this study

Serogroup	No. of isolates	Host	Genetic/Virulence markers		
			ecf1	Z2098	Z2099	nleA	stxa	eae	ehxA	
Top 7											
O26	4	Cattle		+	+	+	+	+1	+	+	
O26	1	Cattle		-	+	+	+	+1	+	-	
O111	2	Cattle		+	+	+	-	+1	+	+	
O111	1	Cattle		+	+	+	-	+1	+	-	
O103	3	Sheep		-	+	-	-	+1	-	-	
O103	1	Goat		-	+	+	-	+1/2	-	+	
O103	1	Goat		-	+	+	-	+1	-	-	
O157b	1	Human		+	+	+	+	+1/2	+	+	
Others											
O113	1	Cattle		-	-	+	-	+1/2	-	+	
O113	1	Goat		-	-	+	-	+1/2	-	+	
O5	8	Sheep		-	-	+	-	+1/2	-	+	
O5	3	Sheep		-	-	+	-	+1	-	+	
O5	1	Goat		-	-	+	-	+1/2	-	+	
O91	2	Sheep		-	-	+	-	+1/2	-	+	
O91	1	Goat		-	-	+	-	+1/2	-	+	
NDc	1	Cattle		+	+	+	+	+1	+	+	
ND	4	Cattle		-	-	+	-	+2	-	-	
ND	1	Goat		-	-	+	-	+2	-	-	
ND	2	Cattle		-	-	+	-	+1	-	+	
ND	2	Sheep		-	-	+	-	+1	-	+	
ND	1	Sheep		-	+	+	-	+1	-	-	
a +1 = stx1, +2 = stx2, and + 1/2 = stx1 + stx2

b Positive control: Escherichia coli O157:H7 strain Sakai (ATCC BAA-460)

c Not Defined

Fig. 1 Distribution of the genetic markers ecf1, Z2098, Z2099, and nleA in different STEC/EHEC serogroups. Isolates lacking defined serogroups were excluded

Fig. 2 Distribution of the genetic markers ecf1, Z2098, Z2099, and nleA in STEC and EHEC isolates

The genetic markers were also explored to identify combinations possibly associated with the top 7 EHEC ensuring a better sensitivity and specificity. As shown in Table 4, we detected the combined presence of Z2098/Z2099 with 100% frequency rate for O26, O111, O157 and 40.0% for O103; ecf1/Z2098 and ecf1/Z2099 presented a 100% distribution in the O111 and O157 strains and genomes tested, and 80% in O26; Z2098/nleA and Z2099/nleA combination showed 100% presence in O26 and O157; and ecf1/nleA a 100% distribution in O157 and 80% in O26. Interestingly, the non-top 7 isolates (O113, O5, and O91) were negative for all of these genetic marker combinations.

Table 4 Frequencies of the genetic marker combinations according to the top 7 and other important serogroups in studied STEC/EHEC isolates

Serogroupa	STEC/EHEC	Host	ecf1/Z2098	ecf1/Z2099	ecf1/nleA	Z2098/Z2099	Z2098/nleA	Z2099/nleA	
Top 7									
O26	EHEC	Cattle	80.0%	80.0%	80.0%	100.0%	100.0%	100.0%	
O111	EHEC	Cattle	100.0%	100.0%	0.0%	100.0%	0.0%	0.0%	
O103	STEC	Sheep/Goat	0.0%	0.0%	0.0%	40.0%	0.0%	0.0%	
Others									
O113	STEC	Cattle/Goat	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O5	STEC	Sheep/Goat	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O91	STEC	Sheep/Goat	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
a No. of isolates: O26 (n = 5), O111 (n = 3), O103 (n = 5), O157 (n = 1), O113 (n = 2), O5 (n = 12), and O91 (n = 3)

In silico PCR analyses for distribution of the single genetic markers and their combinations in the top 7 and emerging STEC/EHEC serotypes in HUS patients

In total, the ecf1, Z2098, Z2099, and nleA were present as single genetic markers in 75.0%, 69.2%, 78.8%, and 53.8% of all the 52 STEC/EHEC serotypes related to HUS patients. Among these, Z2099 showed the highest presence (95%) in the top 7 EHEC serotypes and nleA had the lowest distribution (70%). For non-top 7 serotypes, ecf1 was detected as the most abundant single genetic marker in 33.3%, while none of the non-top 7 isolates were positive for nleA marker (Table 2).

Distribution of the genetic marker combinations ecf1/Z2098, ecf1/Z2099, ecf1/nleA, Z2098/Z2099, Z2098/nleA, and Z2099/nleA among the different genomes of STEC/EHEC serotypes is shown in Table 5. Overall, the combinations of Z2098/Z2099 (77.0%) and ecf1/Z2099 (77.0%) had the highest frequency rate among the top 7 EHEC serotypes while Z2098/nleA (31.2%) were observed as the lowest. Interestingly, the genetic markers investigated were less commonly associated with non-top 7 serotypes; we only detected ecf1/Z2099 in O165:H25 and ecf1/Z2098, ecf1/Z2099, and Z2098/Z2099 combinations in O182:H25 (Tables 5 and 2). The protocol chart in Fig. 3 illustrates the summary of methods and results.

Table 5 Distribution of the genetic marker combinations in the top 7 and other important STEC/EHEC serotypes related to HUS patients based on the in silico PCR analyses

Serotype	STEC/EHEC	No. of isolates	ecf1/Z2098	ecf1/Z2099	ecf1/nleA	Z2098/Z2099	Z2098/nleA	Z2099/nleA	
Top 7									
O26:H11	EHEC	4	75.0%	75.0%	75.0%	75.0%	75.0%	75.0%	
O45:H2	EHEC	2	100.0%	100.0%	0.0%	100.0%	0.0%	0.0%	
O45:H16	EHEC	1	0.0%	0.0%	0.0%	100.0%	0.0%	0.0%	
O103:H2	EHEC	1	100.0%	100.0%	0.0%	100.0%	0.0%	0.0%	
O103:H8	EHEC	1	0.0%	100.0%	100.0%	0.0%	0.0%	100.0%	
O103:H11	EHEC	1	100.0%	100.0%	100.0%	100.0%	100.0%	100.0%	
O103:H25	EHEC	1	100.0%	100.0%	0.0%	100.0%	0.0%	0.0%	
O111:H8	EHEC	2	50.0%	50.0%	0.0%	50.0%	0.0%	0.0%	
O121:H19	EHEC	10	100.0%	100.0%	100.0%	100.0%	100.0%	100.0%	
O145:H25	EHEC	2	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O145:H28	EHEC	3	100.0%	100.0%	0.0%	100.0%	0.0%	0.0%	
O157:H7	EHEC	12	100.0%	100.0%	100.0%	100.0%	100.0%	100.0%	
Others									
O10:H25	STEC	1	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O25:H4	STEC	1	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O55:H7	STEC	2	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O59:H19	EHEC	1	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O78:H4	STEC	1	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O104:H4	EAHECa	1	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O109:H21	EHEC	1	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O146:H28	STEC	1	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	
O165:H25	EHEC	2	0.0%	100.0%	0.0%	0.0%	0.0%	0.0%	
O182:H25	STEC	1	100.0%	100.0%	0.0%	100.0%	0.0%	0.0%	
a Enteroaggregative haemorrhagic Escherichia coli

Fig. 3 The proposed single and combination of markers for searching the possible pathogenic strains in two categories of isolates (Animal STEC, human HUS) based on the findings of the current study

Discussion

Rapid and specific detection of EHEC strains is urgently needed by public health authorities to establish monitoring programs that track EHEC contamination in animals and foodstuffs. Generally, the ISO/TS 13,136 and MLG5B.05 reference methods rely on the presence of eae and the stx1 and/or stx2 genes, followed by the detection of O antigen genes (wzx or wzy) related to the top 5 and top 7 serogroups, respectively. These methods include screening for the detection of two genetic markers (eae and stx) in enrichment cultures, and presumptive positive results can be obtained from samples containing two or more organisms, each containing one of these genes [10, 11]. To this end, we examined the use of ecf1, Z2098, Z2099, and nleA genes as single markers, and ecf1/Z2098, ecf1/Z2099, ecf1/nleA, Z2098/Z2099, Z2098/nleA, and Z2099/nleA as genetic marker combinations to characterize a panel of STEC strains of animal origin and genomes from human cases of HUS to identify possible markers for the direct screening of food and animals for the presence of strains associated with severe human disease.

Z2098 and ecf1 as the best single genetic marker for screening of the top 7 EHEC/STEC isolates in animal hosts

In this study, we sought to investigate the use of genetic markers ecf1, Z2098, Z2099, and nleA to screen the top 7 and other STEC/EHEC serotypes originating from animal hosts. In this regard, we found a strong linkage between Z2098 and the top 7 STEC isolates, with an association of 100% (O26, O103, O111). Another gene marker, Z2099, showed significant potential to identify the top 7 isolates, as 76.9% of the O26, O103, and O111 serogroups were positive for the presence of this gene. Importantly, Z2099 was also an excellent genetic marker for some emerging STEC isolates, as we detected the marker in 100% of the O113 STEC strains. Similar data were reported by Delannoy et al., who described that the Z2098 and Z2099 gene markers had a detection range of 89.6–95.5% for the top six serogroups and a range of 67.6–96.8% for emerging STEC from other serogroups [5]. Another gene marker, ecf1, was detected in 53.8% of the top 7 animal EHEC isolates (O26 and O111), while all of the non-top 7 serogroups were negative for the gene marker. The use of ecf1 as a genetic marker to detect STEC isolates was examined by Livezey et al. (2015), who reported that 94.8% of the top 7 STEC strains were ecf1 positive [30]. Although ecf1 was more specific for the top 7 serotypes, the low incidence (53.8%) found in this work places this marker as the second choice for screening the top 7 STEC/EHEC serotypes after the Z2098 gene marker. Moreover, ecf1 is a plasmid gene marker that might be lost, leading to false negative results. Our animal samples were also screened for the presence of the nleA gene marker. Based on the results, this gene seems to have low potential for use as a marker, since only 38.4% of the top 7 serotypes (O26) were positive for nleA, and all of the non-top 7 serogroups were negative. However, a study conducted in the UK reported that 86% of the EHEC isolates from the patients with HUS and diarrhea were positive for the nleA gene marker [32]. These differences in the results obtained might be linked to the source of the samples studied, as the UK study was conducted on human samples instead of animal isolates. Hence, we also surveyed all the studied markers in highly pathogenic EHEC isolates originating from HUS patients via in silico PCR analyses to generate a comparison with animal isolates. Moreover, it has been reported that the nleA gene marker is associated with O26:H11, which confirms our results, as all of the nleA-positive isolates in our study were of the O26 serogroup [37, 38].

Z2098/Z2099 as the best genetic marker combination for detecting of the top 7 EHEC/STEC isolates in animal hosts

Our study showed that the combinations of the genetic markers ecf1/Z2098, ecf1/Z2099, ecf1/nleA, Z2098/Z2099, Z2098/nleA, and Z2099/nleA were detected in 53.8%, 53.8%, 30.7%, 69.2%, 38.4%, and 38.4% of the top 7 EHEC/STEC isolates, respectively. To date, this is the first report on the evaluation of these genetic marker combinations as a tracking method for the top 7 EHEC/STEC isolates of animal origin. None of the combinations identified all the top 7 isolates, but Z2098/Z2099 showed a percentage of 69.2% for the top 7 EHEC/STEC isolates. Nevertheless, Z2098/Z2099 and other studied combinations were not capable of detecting non-top 7 isolates, especially the important serogroup O113, highlighting the need for complementary studies to investigate other genetic marker combinations for important non-top 7 O-groups.

Diagnostic application of single and combination of studied genetic markers in HUS isolates

In addition to animal hosts, the studied genetic markers were also investigated via in silico PCR analyses in the genomes of top 7 and emerging EHEC/STEC serotypes related to HUS patients. A comparison of the animal and human results revealed that among the studied markers, Z2099 is more prevalent in the top 7 HUS isolates, with 95% of the strains testing positive, whereas ecf1 and Z2098 were detected in 87.5% and nleA in 70% of the top 7 serotypes. Such data are in accordance with a study by Delannoy et al., which showed a prevalence rate of 87% for Z2098 and 91% for Z2099 in EHEC and EHEC-like strains [5]. Combinations of the genetic markers also revealed that Z2098/Z2099 and ecf1/Z2099 are the most prevalent double markers for detecting the top 7 HUS isolates, with a positive rate of 87.5%. Considering these points, none of the single genetic markers were capable of detecting all EHEC isolates; thus, Z2098/Z2099 or ecf1/Z2099 offers a better choice for identifying the highly pathogenic EHEC with greater confidence. However, since we failed to detect the presence of these markers in 5 out of 40 strains, these combinations need to be investigated in a much wider panel of isolates to confirm their suitability as markers for highly pathogenic STEC. In contrast to the top 7 isolates, the other STEC/EHEC serotypes studied were not identified by the genetic marker combinations. Only one STEC strain (O182:H25) was positive for ecf1/Z2098, Z2098/Z2099, and ecf1/Z2099. Among the single markers, ecf1 and Z2099 had a very low frequency (33.3% and 25%, respectively) in the studied non-top 7 STEC/EHEC strains, with none of them positive for the nleA gene marker. Our study pointed out the need for additional markers to be tested in future research to find more sensitive and specific gene markers for non-top 7 HUS isolates.

We did not investigate these markers and their combinations in other pathogenic E. coli such as EPEC and other E. coli pathogroups. However, in Delannoy’s report, the distribution of the studied markers was significantly more prevalent in EHEC than in EPEC and apathogenic E. coli [7]. In the investigation conducted by Delannoy et al., it was demonstrated that 23.2% of the examined EPEC isolates exhibited positivity for the Z2098 marker. This phenomenon is attributed to the presence of stx-negative variants of EHEC, particularly those belonging to the top 7 EHEC serotypes, as outlined by the authors. It is noteworthy that, to avoid presumptive positive results, we propose analyzing the single markers in enrichment cultures; if positive, testing for combination markers can be applied to pure isolates. This approach may be particularly suitable in low- and middle-income countries where NGS facilities to characterize isolated STEC strains are not widely available.

Conclusions

Our study identified alternative genetic markers (Z2098, Z2099, and ecf1) that are effective for screening the top 7 STEC/EHEC strains, providing a specific method for detection without relying on traditional stx and eae markers. However, these markers should be used on pure cultures to avoid false positives. Detecting emerging non-top 7 EHEC strains remains challenging, highlighting the need for further research to find additional markers for these strains.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Acknowledgements

We appreciate our colleagues and technicians in Escherichia coli Research Lab at Ferdowsi University of Mashhad, who assisted us in this research project.

Author contributions

A.N. collected samples, carried out the analysis of samples, data analysis, and wrote the manuscript. M.A., Gh.H. and S.M. designed the study, supervised the project, revised the data analysis, and critically revised all parts of the manuscript. A.D. formal analysis, writing—review and editing. All authors read and approved the final manuscript.

Funding

This project was supported by Ferdowsi University of Mashhad under the Grant No. FUM. 57299.

Data availability

We confirm that all data and findings of this study are available within the Article/Supplementary material.

Declarations

Ethics approval and consent to participate

All procedures involving animals and their care in this study were approved (No. IR140257299) by Iran National Committee for Ethics in Biomedical Research. Moreover, a written or verbal informed consent was obtained from all participants for human experimentation and verbal informed consent was obtained from the owners of the companion animals. The research committee of Ferdowsi University of Mashhad reviewed and approved that all the study protocols were conducted in accordance with the related guidelines and regulations (No. FUM57299). The study was carried out in accordance with the ARRIVE guidelines (http://www.nc3rs.org.uk/page.asp?id=1357).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Im H, Hwang SH, Kim BS, Choi SH. Pathogenic potential assessment of the Shiga toxin-producing Escherichia coli by a source attribution-considered machine learning model. Proc Natl Acad Sci U S A. 2021;118.
2. Kaper JB Nataro JP Mobley HLT Pathogenic Escherichia coli Nat Rev Microbiol 2004 2 123 40 10.1038/nrmicro818 15040260
Kaper JB, Nataro JP, Mobley HLT. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123–40.15040260 10.1038/nrmicro818
3. Martin C Saint, Jubelin G Darsonval M Leroy S Leneveu-Jenvrin C Hmidene G Genetic, physiological, and cellular heterogeneities of bacterial pathogens in food matrices: consequences for food safety Compr Rev Food Sci Food Saf 2022 21 4294 326 10.1111/1541-4337.13020 36018457
Martin C, Saint, Jubelin G, Darsonval M, Leroy S, Leneveu-Jenvrin C, Hmidene G, et al. Genetic, physiological, and cellular heterogeneities of bacterial pathogens in food matrices: consequences for food safety. Compr Rev Food Sci Food Saf. 2022;21:4294–326. 10.1111/1541-4337.13020.36018457 10.1111/1541-4337.13020
4. Tomeh R Nemati A Hashemi Tabar G Tozzoli R Badouei MA Antimicrobial resistance, β-lactamase genotypes, and plasmid replicon types of Shiga toxin-producing Escherichia coli isolated from different animal hosts J Appl Microbiol 2024 135 lxae059 10.1093/jambio/lxae059 38467395
Tomeh R, Nemati A, Hashemi Tabar G, Tozzoli R, Badouei MA. Antimicrobial resistance, β-lactamase genotypes, and plasmid replicon types of Shiga toxin-producing Escherichia coli isolated from different animal hosts. J Appl Microbiol. 2024;135:lxae059. 10.1093/jambio/lxae059.38467395 10.1093/jambio/lxae059
5. Delannoy S Beutin L Fach P Towards a molecular definition of enterohemorrhagic Escherichia coli (EHEC): detection of genes located on O island 57 as markers to distinguish EHEC from closely related enteropathogenic E. Coli strains J Clin Microbiol 2013 51 1083 8 10.1128/JCM.02864-12 23325824
Delannoy S, Beutin L, Fach P. Towards a molecular definition of enterohemorrhagic Escherichia coli (EHEC): detection of genes located on O island 57 as markers to distinguish EHEC from closely related enteropathogenic E. Coli strains. J Clin Microbiol. 2013;51:1083–8.23325824 10.1128/JCM.02864-12
6. Pakbin B Brück WM Brück TB Allahyari S Ashrafi Tamai I A quantitative prevalence of Escherichia coli O157 in different food samples using real-time qPCR method Food Sci Nutr 2022 10.1002/fsn3.3055 36655112
Pakbin B, Brück WM, Brück TB, Allahyari S, Ashrafi Tamai I. A quantitative prevalence of Escherichia coli O157 in different food samples using real-time qPCR method. Food Sci Nutr. 2022. 10.1002/fsn3.3055.;n/a n/a.36655112 10.1002/fsn3.3055
7. Delannoy S Beutin L Fach P Discrimination of enterohemorrhagic Escherichia coli (EHEC) from Non-EHEC strains based on detection of various combinations of type III effector genes J Clin Microbiol 2013 51 3257 62 10.1128/JCM.01471-13 23884997
Delannoy S, Beutin L, Fach P. Discrimination of enterohemorrhagic Escherichia coli (EHEC) from Non-EHEC strains based on detection of various combinations of type III effector genes. J Clin Microbiol. 2013;51:3257–62.23884997 10.1128/JCM.01471-13
8. Eppinger M Mammel MK Leclerc JE Ravel J Cebula TA Genomic anatomy of Escherichia coli O157:H7 outbreaks Proc Natl Acad Sci U S A 2011 108 20142 7 10.1073/pnas.1107176108 22135463
Eppinger M, Mammel MK, Leclerc JE, Ravel J, Cebula TA. Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc Natl Acad Sci U S A. 2011;108:20142–7.22135463 10.1073/pnas.1107176108
9. Haque M Bosilevac JM Chaves BD A review of shiga-toxin producing Escherichia coli (STEC) contamination in the raw pork production chain Int J Food Microbiol 2022 377 109832 10.1016/j.ijfoodmicro.2022.109832 35834920
Haque M, Bosilevac JM, Chaves BD. A review of shiga-toxin producing Escherichia coli (STEC) contamination in the raw pork production chain. Int J Food Microbiol. 2022;377:109832. 10.1016/j.ijfoodmicro.2022.109832.35834920 10.1016/j.ijfoodmicro.2022.109832
10. ISO (International Organization for Standardization). Microbiology of food and animal feed. Real-time polymerase chain reaction (PCR)-based method for the detection of food-borne pathogens. Horizontal method for the detection of Shiga toxin-producing Escherichia coli (STEC) and the determination of O157, O11. Available online https://www.iso.org/standard/53328.html. 2012;ISO/TS 131.
11. Anonymous. Detection, isolation and identification of top seven Shiga toxin-producing Escherichia coli (STECs) from meat products and carcass and environmental sponges. Available online at https//www.fsis.usdagov/sites/default/files/media_file/2021-08/MLG-5C02.pdf. 2021.
12. Beutin L Jahn S Fach P Evaluation of the GeneDisc real-time PCR system for detection of enterohaemorrhagic Escherichia coli (EHEC) O26, O103, O111, O145 and O157 strains according to their virulence markers and their O- and H-antigen-associated genes J Appl Microbiol 2009 106 1122 32 10.1111/j.1365-2672.2008.04076.x 19191965
Beutin L, Jahn S, Fach P. Evaluation of the GeneDisc real-time PCR system for detection of enterohaemorrhagic Escherichia coli (EHEC) O26, O103, O111, O145 and O157 strains according to their virulence markers and their O- and H-antigen-associated genes. J Appl Microbiol. 2009;106:1122–32.19191965 10.1111/j.1365-2672.2008.04076.x
13. Delannoy S Beutin L Fach P Use of clustered regularly interspaced short palindromic repeat sequence polymorphisms for specific detection of enterohemorrhagic Escherichia coli strains of serotypes O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 by real-time PCR J Clin Microbiol 2012 50 4035 40 10.1128/JCM.02097-12 23035199
Delannoy S, Beutin L, Fach P. Use of clustered regularly interspaced short palindromic repeat sequence polymorphisms for specific detection of enterohemorrhagic Escherichia coli strains of serotypes O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 by real-time PCR. J Clin Microbiol. 2012;50:4035–40.23035199 10.1128/JCM.02097-12
14. Dadvar A Hashemi Tabar G Askari Badouei M Nemati A Farsiani H An Improved multiplex-polymerase chain reaction method for simultaneous identification and discrimination of emerging Escherichia and Shigella species Int J Enteric Pathog 2023 11 128 33 10.34172/ijep.5621
Dadvar A, Hashemi Tabar G, Askari Badouei M, Nemati A, Farsiani H. An Improved multiplex-polymerase chain reaction method for simultaneous identification and discrimination of emerging Escherichia and Shigella species. Int J Enteric Pathog. 2023;11:128–33. 10.34172/ijep.5621.10.34172/ijep.5621
15. Luedtke BE Bono JL Bosilevac JM Evaluation of real time PCR assays for the detection and enumeration of enterohemorrhagic Escherichia coli directly from cattle feces J Microbiol Methods 2014 105 72 9 10.1016/j.mimet.2014.07.015 25064761
Luedtke BE, Bono JL, Bosilevac JM. Evaluation of real time PCR assays for the detection and enumeration of enterohemorrhagic Escherichia coli directly from cattle feces. J Microbiol Methods. 2014;105:72–9.25064761 10.1016/j.mimet.2014.07.015
16. Boerlin P Chen S Colbourne JK Johnson R De Grandis S Gyles C Evolution of enterohemorrhagic Escherichia coli hemolysin plasmids and the locus for enterocyte effacement in Shiga toxin-producing E. Coli Infect Immun 1998 66 2553 61 10.1128/IAI.66.6.2553-2561.1998 9596716
Boerlin P, Chen S, Colbourne JK, Johnson R, De Grandis S, Gyles C. Evolution of enterohemorrhagic Escherichia coli hemolysin plasmids and the locus for enterocyte effacement in Shiga toxin-producing E. Coli. Infect Immun. 1998;66:2553–61.9596716 10.1128/IAI.66.6.2553-2561.1998
17. Yoon JW Minnich SA Ahn JS Park YH Paszczynski A Hovde CJ Thermoregulation of the Escherichia coli O157:H7 pO157 ecf operon and lipid a myristoyl transferase activity involves intrinsically curved DNA Mol Microbiol 2004 51 419 35 10.1046/j.1365-2958.2003.03827.x 14756783
Yoon JW, Minnich SA, Ahn JS, Park YH, Paszczynski A, Hovde CJ. Thermoregulation of the Escherichia coli O157:H7 pO157 ecf operon and lipid a myristoyl transferase activity involves intrinsically curved DNA. Mol Microbiol. 2004;51:419–35.14756783 10.1046/j.1365-2958.2003.03827.x
18. Imamovic L Tozzoli R Michelacci V Minelli F Marziano ML Caprioli A OI-57, a genomic island of Escherichia coli O157, is present in other seropathotypes of Shiga toxin-producing E. Coli associated with severe human disease Infect Immun 2010 78 4697 704 10.1128/IAI.00512-10 20823207
Imamovic L, Tozzoli R, Michelacci V, Minelli F, Marziano ML, Caprioli A, et al. OI-57, a genomic island of Escherichia coli O157, is present in other seropathotypes of Shiga toxin-producing E. Coli associated with severe human disease. Infect Immun. 2010;78:4697–704.20823207 10.1128/IAI.00512-10
19. Coombes BK Wickham ME Mascarenhas M Gruenheid S Finlay BB Karmali MA Molecular analysis as an aid to assess the public health risk of non-O157 shiga toxin-producing Escherichia coli strains Appl Environ Microbiol 2008 74 2153 60 10.1128/AEM.02566-07 18245257
Coombes BK, Wickham ME, Mascarenhas M, Gruenheid S, Finlay BB, Karmali MA. Molecular analysis as an aid to assess the public health risk of non-O157 shiga toxin-producing Escherichia coli strains. Appl Environ Microbiol. 2008;74:2153–60.18245257 10.1128/AEM.02566-07
20. Delannoy S Tran M-L Fach P Insights into the assessment of highly pathogenic Shiga toxin-producing Escherichia coli in raw milk and raw milk cheeses by high Throughput Real-time PCR Int J Food Microbiol 2022 366 109564 10.1016/j.ijfoodmicro.2022.109564 35151054
Delannoy S, Tran M-L, Fach P. Insights into the assessment of highly pathogenic Shiga toxin-producing Escherichia coli in raw milk and raw milk cheeses by high Throughput Real-time PCR. Int J Food Microbiol. 2022;366:109564.35151054 10.1016/j.ijfoodmicro.2022.109564
21. McMahon TC, Blais BW, Wong A, Carrillo CD. Multiplexed single intact cell droplet digital PCR (MuSIC ddPCR) method for specific detection of enterohemorrhagic E. coli (EHEC) in food enrichment cultures. Front Microbiol. 2017;8 MAR:332.
22. Paton AW, Paton JC. Detection and characterization of shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfb (O111), and rfb (O157). J Clin Microbiol. 1998;36:598–602. 10.1128/jcm.36.2.598-602.1998
23. Schmidt H Scheef J Morabito S Caprioli A Wieler LH Karch H A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons Appl Environ Microbiol 2000 66 1205 8 10.1128/AEM.66.3.1205-1208.2000 10698793
Schmidt H, Scheef J, Morabito S, Caprioli A, Wieler LH, Karch H. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl Environ Microbiol. 2000;66:1205–8.10698793 10.1128/AEM.66.3.1205-1208.2000
24. Authority EFS European Centre for Disease Prevention and Control The European Union One Health 2021 Zoonoses Report EFSA J 2022 20 e07666 10.2903/j.efsa.2022.7666 36524203
European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union One Health 2021 Zoonoses Report. EFSA J. 2022; 20, e7666. https://doi.org/10.2903/j.efsa.2022.7666 36524203 10.2903/j.efsa.2022.7666
25. Badouei MA Taban H Nemati A Santos LF Dos Molecular serotyping of Shiga toxin-producing Escherichia coli (STEC) of animal origin in Iran reveals the presence of important non-O157 seropathotypes Vet Res Forum 2023 14 267 74 37342291
Badouei MA, Taban H, Nemati A, Santos LF, Dos. Molecular serotyping of Shiga toxin-producing Escherichia coli (STEC) of animal origin in Iran reveals the presence of important non-O157 seropathotypes. Vet Res Forum. 2023;14:267–74.37342291
26. DebRoy C Roberts E Fratamico PM Detection of O antigens in Escherichia coli Anim Heal Res Rev 2011 12 169 85 10.1017/S1466252311000193
DebRoy C, Roberts E, Fratamico PM. Detection of O antigens in Escherichia coli. Anim Heal Res Rev. 2011;12:169–85.10.1017/S1466252311000193
27. Iguchi A Iyoda S Seto K Morita-Ishihara T Scheutz F Ohnishi M Escherichia coli O-genotyping PCR: a comprehensive and practical platform for molecular O serogrouping J Clin Microbiol 2015 53 2427 32 10.1128/JCM.00321-15 25926488
Iguchi A, Iyoda S, Seto K, Morita-Ishihara T, Scheutz F, Ohnishi M. Escherichia coli O-genotyping PCR: a comprehensive and practical platform for molecular O serogrouping. J Clin Microbiol. 2015;53:2427–32.25926488 10.1128/JCM.00321-15
28. Liu Y DebRoy C Fratamico P Sequencing and analysis of the Escherichia coli serogroup O117, O126, and O146 O-antigen gene clusters and development of PCR assays targeting serogroup O117-, O126-, and O146-specific DNA sequences Mol Cell Probes 2007 21 295 302 10.1016/j.mcp.2007.03.002 17452091
Liu Y, DebRoy C, Fratamico P. Sequencing and analysis of the Escherichia coli serogroup O117, O126, and O146 O-antigen gene clusters and development of PCR assays targeting serogroup O117-, O126-, and O146-specific DNA sequences. Mol Cell Probes. 2007;21:295–302.17452091 10.1016/j.mcp.2007.03.002
29. Istituto Superiore di Sanità. Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes. EU Ref Lab E Coli. 2020;:1–8.
30. Livezey KW Groschel B Becker MM Use of the ecf1 gene to detect Shiga toxin-producing Escherichia coli in beef samples J Food Prot 2015 78 675 84 10.4315/0362-028X.JFP-14-417 25836391
Livezey KW, Groschel B, Becker MM. Use of the ecf1 gene to detect Shiga toxin-producing Escherichia coli in beef samples. J Food Prot. 2015;78:675–84.25836391 10.4315/0362-028X.JFP-14-417
31. Askari Badouei M Morabito S Najafifar A Mazandarani E Molecular characterization of enterohemorrhagic Escherichia coli hemolysin gene (EHEC-hlyA)-harboring isolates from cattle reveals a diverse origin and hybrid diarrheagenic strains Infect Genet Evol 2016 39 342 8 10.1016/j.meegid.2016.02.002 26855346
Askari Badouei M, Morabito S, Najafifar A, Mazandarani E. Molecular characterization of enterohemorrhagic Escherichia coli hemolysin gene (EHEC-hlyA)-harboring isolates from cattle reveals a diverse origin and hybrid diarrheagenic strains. Infect Genet Evol. 2016;39:342–8.26855346 10.1016/j.meegid.2016.02.002
32. Mundy R Jenkins C Yu J Smith H Frankel G Distribution of espI among clinical enterohaemorrhagic and enteropathogenic Escherichia coli isolates J Med Microbiol 2004 53 1145 9 10.1099/jmm.0.45684-0 15496394
Mundy R, Jenkins C, Yu J, Smith H, Frankel G. Distribution of espI among clinical enterohaemorrhagic and enteropathogenic Escherichia coli isolates. J Med Microbiol. 2004;53:1145–9.15496394 10.1099/jmm.0.45684-0
33. Hua Y Chromek M Frykman A Jernberg C Georgieva V Hansson S Whole-genome characterization of hemolytic uremic syndrome-causing Shiga toxin-producing Escherichia coli in Sweden Virulence 2021 12 1296 305 10.1080/21505594.2021.1922010 33939581
Hua Y, Chromek M, Frykman A, Jernberg C, Georgieva V, Hansson S, et al. Whole-genome characterization of hemolytic uremic syndrome-causing Shiga toxin-producing Escherichia coli in Sweden. Virulence. 2021;12:1296–305.33939581 10.1080/21505594.2021.1922010
34. Zhang Y, Liao Y-T, Sun X, Wu VCH. Is Shiga Toxin-Producing Escherichia coli O45 no longer a Food Safety threat? The Danger is still out there. Microorganisms. 2020;8.
35. Bai X Ylinen E Zhang J Salmenlinna S Halkilahti J Saxen H Comparative Genomics of Shiga Toxin-Producing Escherichia coli strains isolated from Pediatric patients with and without hemolytic uremic syndrome from 2000 to 2016 in Finland Microbiol Spectr 2022 10 e0066022 10.1128/spectrum.00660-22 35730965
Bai X, Ylinen E, Zhang J, Salmenlinna S, Halkilahti J, Saxen H, et al. Comparative Genomics of Shiga Toxin-Producing Escherichia coli strains isolated from Pediatric patients with and without hemolytic uremic syndrome from 2000 to 2016 in Finland. Microbiol Spectr. 2022;10:e0066022.35730965 10.1128/spectrum.00660-22
36. Lorenz SC Gonzalez-Escalona N Kotewicz ML Fischer M Kase JA Genome sequencing and comparative genomics of enterohemorrhagic Escherichia coli O145:H25 and O145:H28 reveal distinct evolutionary paths and marked variations in traits associated with virulence & colonization BMC Microbiol 2017 17 1 15 10.1186/s12866-017-1094-3 28049431
Lorenz SC, Gonzalez-Escalona N, Kotewicz ML, Fischer M, Kase JA. Genome sequencing and comparative genomics of enterohemorrhagic Escherichia coli O145:H25 and O145:H28 reveal distinct evolutionary paths and marked variations in traits associated with virulence & colonization. BMC Microbiol. 2017;17:1–15.28049431 10.1186/s12866-017-1094-3
37. Douëllou T Delannoy S Ganet S Fach P Loukiadis E Montel MC Molecular characterization of O157:H7, O26:H11 and O103:H2 Shiga toxin-producing Escherichia coli isolated from dairy products Int J Food Microbiol 2017 253 59 65 10.1016/j.ijfoodmicro.2017.04.010 28499121
Douëllou T, Delannoy S, Ganet S, Fach P, Loukiadis E, Montel MC, et al. Molecular characterization of O157:H7, O26:H11 and O103:H2 Shiga toxin-producing Escherichia coli isolated from dairy products. Int J Food Microbiol. 2017;253:59–65.28499121 10.1016/j.ijfoodmicro.2017.04.010
38. Krüger A, Lucchesi PMA, Mariel Sanso A, Etcheverría AI, Bustamante AV, Burgán J et al. Genetic characterization of Shiga toxin-producing Escherichia coli O26: H11 strains isolated from animal, food, and clinical samples. Front Cell Infect Microbiol. 2015;5 OCT:74.
