
==== Front
Transl Oncol
Transl Oncol
Translational Oncology
1936-5233
Neoplasia Press

S1936-5233(24)00232-8
10.1016/j.tranon.2024.102105
102105
Original Research
LncRNA LINC00173 inhibits the development of endometrial cancer by interacting with HNRNPC
Zhu Zhijuan #
Du Rong #
Yu Juan dxhJuan_yu@163.com
⁎
Department of Gynecology, People's Hospital of Dongxihu District, Wuhan 430040, Hubei, China
⁎ Corresponding author at: Department of Gynecology, People's Hospital of Dongxihu District, No. 48, Jinbei No. 1 Road, Jinghe Street, Dongxihu District, Wuhan 430040, Hubei, China. dxhJuan_yu@163.com
# The authors contribute equally to this work.

26 8 2024
11 2024
26 8 2024
49 10210526 12 2023
5 8 2024
16 8 2024
© 2024 Published by Elsevier Inc.
2024

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Highlights

• LINC00173 expression is downregulated in EC.

• LINC00173 upregulation inhibits EC cell malignancy.

• LINC00173 decelerates EC cell growth in vivo.

• HNRNPC combines LINC00173 in EC.

• Overexpressed HNRNPC in EC promotes LINC00173 levels after being knocked down.

• Low levels of HNRNPC inhibit EC cell malignancy.

Background

Previous research has elaborated on the role of long non-coding RNA LINC00173 in the pathogenesis of various cancers; however, our knowledge of its clinical consequences and mechanisms in endometrial cancer (EC) is limited. Our current work is aimed at investigating the effect of LINC00173 in combination with its upstream gene HNRNPC on EC progression.

Methods

LINC00173 and HNRNPC levels were investigated by qRT-PCR or western blotting in EC tissues. The functional roles of HNRNPC and LINC00173 were assessed using transwell, colony formation and CCK-8 assays. A xenograft was used to verify the phenotype of LINC00173 after its overexpression. The regulatory role between HNRNPC and LINC00173 was investigated using RIP and RNA pull-down analysis.

Results

In EC tissues, LINC00173 expression was down-regulated. We observed that increased LINC00173 inhibited EC cell growth and migration. LINC00173 was a downstream target of HNRNPC, and its expression level was elevated by HNRNPC silencing. LINC00173 overexpression shifted part of HNRNPC into the cytoplasm from the nucleus of EC cells. Furthermore, HNRNPC expression was upregulated in EC and its silencing inhibited EC cell malignancy in vitro.

Conclusion

LINC00173 can impair the malignancy of EC cell by interacting with HNRNPC. This finding may contribute to the understanding of the tumorigenic effects of HNRNPC and LINC00173 on EC.

Keywords

HNRNPC
Endometrial cancer
LINC00173
Migration
Proliferation
==== Body
pmcIntroduction

Endometrial cancer (EC) is referred to as a malignant tumor of the endometrial epithelium. It is the sixth most prevalent gynecological tumor in females, with the incidence and fatality rates of EC increasing globally year by year [1]. As per the National Cancer centre of China, the incidence of EC in 2019 was ∼10 per 100,000, while the fatality rate was ∼2 per 100,000 ([2] [3],). In 2020, the EC incidence will exceed 417,000 worldwide [4]. In developed nations, it ranks first among malignancies of the female reproductive system [5]. Molecular testing for personalised cancer therapies is becoming increasingly common, and a variety of targeted therapies based on cancer cell DNA, proliferation, and invasion have been evaluated for the treatment of EC, such as PTEN, CTNNB1, and MMR [6]. However, more clinically valuable molecular therapeutic targets based on the mechanisms of EC development still need to be developed.

Long noncoding RNAs (lncRNAs), which contain transcripts >200 nucleotides, function as a class of regulatory ncRNAs that do not encode proteins [7]. Evidence suggests that lncRNAs are implicated in a myriad of biological processes, including telomere lengthening, retrotransposon silencing, dosage compensation, pluripotency, and cell cycle regulation [7]. In addition, the role of various lncRNAs in EC has been investigated. Yang et al. [8] observed that lncRNA FOXCUT was overexpressed in EC cells, and its upregulation blocked the S phase of EC cells, inhibited apoptosis, and promoted epithelial-mesenchymal transition, invasion, migration, and proliferation. Zhang et al. [9] demonstrated that lncRNA THOR was significantly expressed in EC tissues, positively correlated with pathological grade and poor overall survival, and induced malignancy in cancer cells in vitro. A report by Shan et al. [10] showed that serum lncRNA DLEU1 was significantly elevated in EC patients, predicting advanced clinicopathological features and short disease-free survival. Long intergenic non-protein coding RNA 173 (LINC00173), a more frequently reported lncRNA, is implicated in the regulation of several cancers, such as playing a pro-cancer role in cervical, pancreatic and gastric cancers [11]. However, the role of LINC00173 in EC has not been published to date to the best of our knowledge.

Heterogeneous nuclear ribonucleoprotein C (HNRNPC) belongs to the hnRNP family of proteins and has two isoforms, C1 and C2 [12]. HNRNPC is involved in RNA maturation, stabilization, translocation, and post-transcriptional modification through regulation of RNA splicing/expression/stability, mRNA translation, m6A RNA methylation, and the dsRNA-induced interferon response ([13] [14],). HNRNPC has recently attracted the interest of researchers in the cancer field as its high expression levels are associated with malignancy in cancers such as hepatocellular carcinoma [15], oral squamous cell carcinoma [16], and prostate cancer [17]. Unusually, enhanced protein expression levels of HNRNPC in EC have prognostic value and are associated with shorter overall survival [18]. Therefore, we expect to elucidate the specific regulatory role and molecular mechanisms of HNRNPC in EC.

Here, we sought to demonstrate the regulatory role of LINC00173 on EC development and explore its upstream sites. Our study reveals that HNRNPC worsens EC progression by inhibiting LINC00173 expression, providing a valuable potential marker for improved diagnosis, and treatment of EC.

Methods

Human specimens

EC tissues and nearby healthy endometrial tissues were taken from 40 patients suffering from EC at our institution, all of whom provided signed informed consent. Samples were taken only from those patients who did not undergo radiotherapy or chemotherapy before the procedure. The Ethics Committee of our hospital approved the implementation of this study.

Cell culture and transfection

Human endometrial epithelial cell line (hEEC; Ca# XYXB-2053) and two EC cell lines (HEC-1B; Ca# XYXB-1548 and KLE; Ca# XYXB-2281) were obtained from xuanyabio (China), whereas one EC cell line (HEC-1A; Ca# FS-0125) was sourced from ShanghaiFusheng Industrial (China). Cells were cultured in DMEM (with 10% FBS, 1% penicillin, and 1% streptomycin) that was purchased from Jennio-bio (China). A humidified environment with 5% CO2 and 37 °C was maintained while culturing the cells.

HNRNPC siRNA (si-HNRNPC) and non-targeted siRNA (si-NC) were provided by Ribobio, China. The LINC00173 overexpression vector (LINC00173-OE) and its empty vector (empty vector) were cloned into pcDNA3.1, which was also provided by Ribobio, China. Lipo6000 transfection reagent (Beyotime, China) was utilized for cell transfection. The above 2 μg/ml pcDNA or 50 nM siRNA was transfected into both EC cell lines (HEC-1A and HEC-1B), and the culture medium was changed after 6 h incubation. 48 h later, the efficiency was measured via qRT-PCR.

qRT-PCR

The extraction of total RNA from cells and tissues was carried out using TRIzol reagent obtained from Invitrogen, USA. Next, cDNA synthesis was done by reverse transcription of RNA (1 μg) with HiScript 1st Strand cDNA Synthesis Kit (Vazyme, China), and it was amplified using SYBR Green Kit (Vazyme). GAPDH was utilized as an internal control and the gene expression was determined by 2−ΔΔCT method. The primers are depicted in Table 1.Table 1 Primer sequences used in the study.

Table 1Primer name	Sequence (5` – 3`)	
HNRNPC sense:	GATCTTCAGCTACATTTTCGGC	
HNRNPC antisense:	TGGAGCGAGGATCTGTCTTG	
LINC00173 sense:	TTCTGGGTCCGAGGCTCC	
LINC00173 antisense:	AGCTTTGCTCTTGCACTGAGATG	
GAPDH sense:	GCACCGTCAAGGCTGAGAAC	
GAPDH antisense:	TGGTGAAGACGCCAGTGGA	

CCK-8 assay

The viability of cells was assessed by CCK-8 kit (Dojindo, Japan). The transfected cells were plated in 96-well plates (5000 cells/well) and incubated for 24, 48, 72, and 96 h before administration with CCK-8 (10 μL/well). Subsequently, after 90 min of incubation, with the help of a microplate reader (Molecular Devices, China), the absorbance (OD 450 nm) was taken.

Colony formation assay

The transfected cells were adjusted to 2 × 103/ml and transferred to the corresponding 6-well plates at 1 ml per well for culture. After the colonies grew to the appropriate size, the supernatant was removed by washing, and 700 μl of 4% paraformaldehyde was introduced to each well and fixed at room temperature (RT) for 10 min. Then, 700 μl of crystalline violet staining solution was added to stain the cells at RT for 5 min. The culture plates were air-dried and photographed using an Olympus light microscope (Tokyo, Japan) to count the number of clones in each well.

Transwell migration assay

The migrative capacity of cells was analysed using the transwell assay. The upper chamber of the transwell plate was inoculated with the transfected cells (2 × 104 cells/well) in a medium with no FBS. At the same time, in the lower chamber, complete medium containing 10% FBS was added. Following an incubation of 24 h, cells that had migrated to the lower chamber were fixed in 4% paraformaldehyde for 15 min before being stained with 0.5% crystalline violet for 10 min. These cells were photographed in an inverted light microscope (Leica, Germany) and counted.

Western blotting

The protein was extracted from the cells by using RIPA buffer purchased from Beyotime. The amount of protein was determined by BCA Kit (Beyotime). Following separation of the proteins (10% SDS-PAGE), they were transferred onto PVDF membranes. After that, blocking of the membranes was done with 5% skim milk, and they were treated with primary antibodies overnight at 4 °C. Next day, the membranes were treated with the secondary antibody coupled to HRP (ca# ab6721, 1:2000). Primary antibodies were obtained from Abcam, China and are as follows: anti-HNRNPC (ca# ab75822, 1:5000), anti-GAPDH (ca# ab181603, 1:10,000), and anti-β-actin (ca# ab8226, 1:10,000). Protein band images were then acquired using the ECL kit (Pierce, USA), and quantified by densitometry using ImageJ software.

RNA pull down assay

This assay was done using the RNA Protein Pull Down Kit (Thermo Fisher Scientific). The cells were lysed in RIPA for 30 min to extract total proteins. Biotin-coupled sense against the LINC00173 fragment structure as well as antisense were transcribed utilizing Biotin RNA Labeling Mix (Roche, Switzerland) and T7 High Performance Transcription Kit (Transgen, China). Synthesized RNA (50 pmol) was mixed with protein extracts from the cells and incubated with 50 μL of stranded affinity agarose magnetic beads (Life Technologies) for 1 h at 4 °C. The biotin elution buffer was used to elute RNA-protein complexes prior to boiling in SDS buffer for 10 min. Ultimately, western blotting was carried out to detect the protein levels of extracted HNRNPC.

RIP assay

The Magna RIP RNA Binding Protein Immunoprecipitation Kit (Millipore, USA) was used to do this assay. The cell extracts were incubated with protein A/G phosphate glycan beads conjugated with anti-HNRNPC (ca# ab75822) or IgG antibody (ca# ab172730). The precipitate was eluted and separated and LINC00173 enrichment was determined by qRT-PCR.

Subcellular localization analysis

Cytoplasmic and nuclear RNA from the cells were isolated by utilizing the Cell Nuclear and Cytoplasmic RNA Extraction Kit (NORGEN, USA). Subsequently, qRT-PCR and western blotting of purified RNA was done. The internal reference for the nucleus and cytoplasm were U6/H3 and GAPDH/β-actin, respectively.

Xenograft tumor model

The approval for the xenograft experiment was given by the Ethics Committee of our hospital. The nude mice (Balb/c, male, 4 weeks old) were provided by Nanjing Qinglongshan Experimental Animal Factory. They were housed at the SPF Animal Experiment Center. The HEC-1B cells (1 × 106) were stably transfected with LINC00173-OE or empty vector and injected into the nude mice. Tumor volume (length × width2 × 1/2) was measured every 4 days, and on day 20, the nude mice were euthanized by excess CO2 to harvest tumors for weighing.

Statistical analysis

GraphPad Prism 8 software was employed for all statistical analyses. Student's t-test or ANOVA was done to determine the difference between two or more groups. The experiments were done in triplicate, and the data is presented as mean ± SD. The differences were statistically significant at P < 0.05.

Results

LINC00173 expression is downregulated in EC

LINC00173 was confirmed to be downregulated in uterine corpus endometrial carcinoma (UCEC) samples as per the GEPIA analysis (Fig. 1A). LINC00173 levels were down-regulated in HEC-1A, HEC-1B and KLE cells by 30%, 20% and 40% of hEEC cells, respectively (P < 0.001; Fig. 1B). LINC00173 was reduced by approximately 65% in EC tissue compared to control samples (n = 40; P < 0.0001; Fig. 1C). The subcellular localization of LINC00173 in HEC-1A and HEC-1B was assessed by qRT-PCR after nuclear–cytoplasm separation and observed that LINC00173 was predominantly present in the cytoplasm (Fig. 1D). This indicates that LINC00173 is downregulated in EC and localized mainly in the cytoplasm.Fig. 1 LINC00173 expression is downregulated in EC. (A) LINC00173 expression in UCEC samples was analyzed by GEPIA. *P < 0.01. (B) The levels of LINC00173 in HEC-1A, HEC-1B and HKLE cells and hEEC cells were revealed by qRT-PCR. **P < 0.001 vs. hEEC. (C) The levels of LINC00173 in EC tissues and normal tissues were analyzed via qRT-PCR (n = 40). (D) The levels of LINC00173 in the nucleus and cytoplasm of HEC-1A and HEC-1B cells were revealed via subcellular localization analysis.

Fig. 1:

LINC00173 upregulation inhibits EC cell malignancy

HEC-1A and HEC-1B cells were transfected with the LINC00173-OE and transfection efficiency was measured. The qRT-PCR showed that the LINC00173-OE group showed a more than 4-fold increase in LINC00173 levels in contrast to the empty vector group (P < 0.001; Fig. 2A). The CCK-8 revealed that cell viability was reduced in the LINC00173-OE group contrast to the empty vector group (72 h and 96h: P < 0.001; Fig. 2B). Furthermore, the colony formation analysis showed that LINC00173 overexpression suppressed EC cell proliferation (P < 0.001; Fig. 2C). The transwell assay revealed that LINC00173 upregulation resulted in reduced migration of EC cells (P < 0.001; Fig. 2D). These outcomes reveal that LINC00173 restrains EC cell growth and nuclear migration.Fig. 2 LINC00173 upregulation inhibits EC cell malignancy. (A) The efficiency of LINC00173 overexpression was checked by qRT-PCR in HEC-1A and HEC-1B cells. (B) The effect of LINC00173 overexpression on cell viability was examined using CCK-8 assay. (C) The effect of LINC00173 overexpression on cell proliferation was examined using colony formation assay. (D) The effect of LINC00173 overexpression on cell migration was examined using transwell migration assay. A to D: **P < 0.001 vs. empty vector..

Fig. 2:

LINC00173 decelerates EC cell growth in vivo

We then performed xenograft experiments to check the effect of LINC00173 in vivo. The HEC-1B cells from the LINC00173-OE and empty vector groups were injected into nude mice. The LINC00173-OE group demonstrated a marked reduction in tumor volume and over 70% reduction in tumor weight after 20 days compared with the empty vector group (P < 0.001; Fig. 3). In summary, LINC00173 reduced the growth of EC cells in vivo.Fig. 3 LINC00173 impedes EC cell growth in vivo. (A) The representative images of the tumors developed in nude mice after being injected with HEC-1B cells transfected with LINC00173-OE or empty vector (n = 3). (B) The volume of the tumors calculated after each 4 days by measuring the tumor size by vernier caliper in the LINC00173-OE and empty vector group. (C) The weight of the tumors upon harvesting them after 20 days in the LINC00173-OE and empty vector group. **P < 0.001 vs. empty vector.

Fig. 3:

HNRNPC combines LINC00173 in EC

According to ENCORI database, LINC00173 was predicted to interact with HNRNPC, and their expression showed a negative correlation in UCEC samples (Fig. 4A). The pull-down levels of sense and antisense of the LINC00173 fragment structure with HNRNPC were analyzed by western blotting that showed elevated levels of HNRNPC in sense compared to antisense (Fig. 4B). The RIP assay revealed significant enrichment of LINC00173 in HNRNPC-immunoprecipitate as compared to the IgG control group (P < 0.001; Fig. 4C). Furthermore, subcellular localization showed that in the LINC00173-OE group, HNRNPC was more expressed in the cytoplasm than in the nucleus, indicating that high levels of LINC00173 transferred HNRNPC from the nucleus to the cytoplasm (Fig. 4D). Overall, LINC00173 binds to HNRNPC and regulates the subcellular localization of HNRNPC.Fig. 4 HNRNPC interacts with LINC00173 in EC. (A) ENCORI database showed the correlation between LINC00173 and HNRNPC in UCEC. (B) RNA pull-down experiments were performed using different HNRNPC in vitro transcripts, and western blotting was used to detect HNRNPC proteins in purified proteins and Input. (C) LINC00173 enrichment levels was checked through RIP assay. **P < 0.001. (D) HNRNPC expression in the nucleus and cytoplasm of both EC cells in empty vector and LINC00173-OE groups were revealed via western blot analysis.

Fig. 4

Overexpressed HNRNPC in EC promotes LINC00173 levels after being silenced

Next, HNRNPC expression in EC was examined. The qRT-PCR showed high levels of HNRNPC in EC tissues (P < 0.0001; Fig. 5A) and cell lines (P < 0.001; Fig. 5B). Western blotting results observed an increase in HNRNPC protein levels in HEC-1A (2.1-fold) and HEC-1B cells (2.5-fold), respectively, compared to hEEC cells (P < 0.001; Fig. 5C). Subsequently, HNRNPC was silenced in EC cells and western blotting showed the reduced HNRNPC protein levels in the si-HNRNPC group (P < 0.001; Fig. 5D). Additionally, qRT-PCR detected that LINC00173 levels were up-regulated in the si-HNRNPC group than in the si-NC (P < 0.001; Fig. 5E). These results suggest that HNRNPC is overexpressed in EC, and its knockdown promotes LINC00173 expression.Fig. 5 HNRNPC silencing in EC promotes LINC00173 levels. (A) The levels of HNRNPC in EC tissues and normal tissues were analysed via qRT-PCR. (B) The levels of HNRNPC in HEC-1A and HEC-1B cells and hEEC cells were revealed via qRT-PCR. **P < 0.001 vs. hEEC. (C) The levels of HNRNPC protein in HEC-1A and HEC-1B cells and hEEC cells were revealed via western blotting. **P < 0.001 vs. hEEC (D) The HNRNPC protein levels in HEC-1A and HEC-1B cells with HNRNPC interference was determined by western blotting. (E) The LINC00173 levels in HEC-1A and HEC-1B cells with HNRNPC interference was checked by qRT-PCR. **P < 0.001 vs. si-HNRNPC.

Fig. 5

Low levels of HNRNPC inhibit EC cell malignancy

In cell function assays, the EC cell proliferation and migration levels were examined after HNRNPC knockdown. Analysis showed reduced viability (72 and 96h: P < 0.001; Fig. 6A), colony formation (P < 0.001; Fig. 6B), and migration levels (P < 0.001; Fig. 6C) of both EC cell lines in the si-HNRNPC group as compared to si-NC. These results confirm that HNRNPC inhibition reduce EC cell malignancy.Fig. 6 Low levels of HNRNPC inhibit EC cell malignancy. (A) The effect of HNRNPC interference on the cell viability was examined by CCK-8 assay. (B) The effect of HNRNPC interference on the cell proliferation was determined using colony formation assay. (C) The effect of HNRNPC interference on the cell migration was assessed using transwell assay. **P < 0.001 vs. si- HNRNPC.

Fig. 6

Discussion

Although the overall 5-year survival rate for EC patients with early-stage disease is 81%, it is only 17% and 15% for stage IVA and IVB, respectively [19]. Furthermore, common alterations based on molecular signaling pathways are important for the mechanisms of EC carcinogenesis and metastasis [6]. Therefore, this study is expected to provide valuable molecular targets for early screening and diagnosis of EC from an analytical perspective. In this study, LINC00173 was found to be down-regulated in EC, its expression was inhibited by HNRNPC, which was an oncogene in EC. Moreover, LINC00173 overexpression suppressed EC cell growth and migration.

LINC00173 has been demonstrated to play both pro- and anti-tumorigenic role in various cancers, and the cancer cell variances, combined with inconsistent disease sites, have been attributed to its inconsistent effects. For example, Zhu et al. [20] reported that knockdown of LINC00173 inhibited nephroblastoma cell invasion and promoted apoptosis. A study published by Fan et al. [21] concluded that increased LINC00173 levels in triple negative breast cancer were accompanied by recurrence-free survival and lower overall survival, and that silencing LINC00173 inhibited cancer cell proliferation, colony formation, and invasion. These suggest a pro-carcinogenic role for LINC00173. On the contrary, Li et al. [22] suggested that LINC00173 overexpression inhibited proliferation and invasion of pancreatic cancer cells, thereby playing an anti-carcinogenic role. Another investigation done by Zhang et al. [23] showed that down-regulation of LINC00173 expression in cervical cancer tissues was linked with poor survival, and its up-regulation induced G0/G1 arrest in tumor cells in vitro. In our study, we also found the expression of LINC00173 to be low in EC tissues and its overexpression inhibited EC cell survival and migration. Altogether, the differential expression of LINC00173 in EC was identified for the first time and it was suggested that LINC00173 may be an anti-tumorigenic factor in EC.

There is growing evidence that the function of lncRNAs is closely linked to their subcellular localization [24]. Nucleoplasmic segregation assays indicate that LINC00173 is predominantly located in the cytoplasm, implying that LINC00173 can influence gene expression at the post-transcriptional level. Hence, by using RNA pull-down and RIP analysis, we identified the potential protein that may interact with LINC00173, namely HNRNPC. Nucleoplasmic isolation assay further validated the physical interaction between HNRNPC and LINC00173. In addition, immunoprecipitation showed that HNRNPC inhibited LINC00173 expression. HNRNPC has been shown to play significant role in various types of cancer. In hepatocellular carcinoma, HNRNPC predicted reduced overall survival and increased recurrence rates and was associated with tumor size, microvascular infiltration, tumor differentiation and TNM stage [15]. In pancreatic ductal carcinoma, overexpression of HNRNPC was associated with metastasis, leading to poor patient prognosis, and knockdown of HNRNPC reduced cancer cell invasion in vitro and metastasis in vivo [25]. Here, similar to these cancers, we found that HNRNPC expression was upregulated in EC and its silencing inhibited EC cell survival and migration. In conjunction with reports by Ralser et al. [18] on shortened overall survival in patients with high HNRNPC expression, we suggest that HNRNPC exerts a pro-cancerous effect in EC by inhibiting LINC00173.

LncRNAs are involved in an array of biological functions via different molecular mechanisms, such as interactions with one or more protein partners, or with chromatin modification complexes [26]. Therefore, we may next explore the downstream target of LINC00173. Furthermore, the relevance of HNRNPC and LINC00173 expression to the survival prognosis of EC patients and the histopathological phenotype of tumors will also be investigated.

Conclusion

In conclusion, the outcomes of this study reveal that HNRNPC binds to LINC00173 to facilitate LINC00173 decay, thereby accelerating EC progression. Therefore, HNRNPC-LINC00173 is a promising target for EC screening and treatment.

Funding

This study received no funding in any form.

Ethics approval

The current work was approved by the Ethics Committee of People’ s Hospital of Dongxihu District (Wuhan, China). The handling of clinical tissues adheres strictly to the ethical standards of the Declaration of Helsinki.

This experiments on animals were conducted as per the ARRIVE guidelines and was authorized by the Ethics Committee of People’ s Hospital of Dongxihu District.

Consent to participate and publication

All patients signed written informed consent forms and gave their consent for publication.

Availability of data and material

All data generated or analyzed during this study are included in this article.

CRediT authorship contribution statement

Zhijuan Zhu: Writing – review & editing, Writing – original draft, Formal analysis, Data curation. Rong Du: Writing – review & editing, Writing – original draft, Methodology, Conceptualization. Juan Yu: Writing – review & editing, Writing – original draft, Formal analysis, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix Supplementary materials

Image, application 1

Image, application 2

Image, application 3

Image, application 4

Acknowledgements

None.

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.tranon.2024.102105.
==== Refs
References

1 Makker V. MacKay H. Ray-Coquard I. Levine D.A. Westin S.N. Aoki D. Endometrial cancer Nature reviews Disease primers 7 1 2021 88
2 Cao W. Chen H.D. Yu Y.W. Li N. Chen W.Q. Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020 Chin. Med. J. (Engl) 134 7 2021 783 791 33734139
3 Wu C. Li M. Meng H. Liu Y. Niu W. Zhou Y. Analysis of status and countermeasures of cancer incidence and mortality in China Sci. China Life Sci. 62 5 2019 640 647 30900169
4 Sung H. Ferlay J. Siegel R.L. Laversanne M. Soerjomataram I. Jemal A. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries CA Cancer J. Clin. 71 3 2021 209 249 33538338
5 Siegel R.L. Miller K.D. Jemal A Cancer statistics CA Cancer J. Clin. 69 1 2019 7 34 2019 30620402
6 Yen T.T. Wang T.L. Fader A.N. Shih I.M. Gaillard S. Molecular Classification and Emerging Targeted Therapy in Endometrial Cancer International journal of gynecological pathology: official journal of the International Society of Gynecological Pathologists 39 1 2020 26 35 30741844
7 Bridges M.C. Daulagala A.C. Kourtidis A. LNCcation: lncRNA localization and function J. Cell Biol. 220 2 2021
8 Yang X. Zhao X. Cheng L. Wei R. LncRNA FOXCUT Stimulates the Progression of Endometrial Cancer Crit. Rev. Eukaryot. Gene Expr. 31 5 2021 59 66
9 Zhang H.Q. Li T. Li C. Hu H.T. Zhu S.M. Lu J.Q. LncRNA THOR promotes endometrial cancer progression through the AKT and ERK signaling pathways Med. Oncol. 39 12 2022 207 36175594
10 Shan L. Zhao T. Wang Y. Upregulation of Serum lncRNA DLEU1 Predicts Progression of Premalignant Endometrial Lesion and Unfavorable Clinical Outcome of Endometrial Cancer Technol. Cancer Res. Treat. 19 2020 1533033820965589
11 Ghafouri-Fard S. Safarzadeh A. Hussen B.M. Rasul M.F. Taheri M. Akbari Dilmaghani N A review on the role of LINC00173 in human cancers Pathol. Res. Pract. 243 2023 154351
12 Xia N. Yang N. Shan Q. Wang Z. Liu X. Chen Y. HNRNPC regulates RhoA to induce DNA damage repair and cancer-associated fibroblast activation causing radiation resistance in pancreatic cancer J. Cell Mol. Med. 26 8 2022 2322 2336 35277915
13 Wu Y. Zhao W. Liu Y. Tan X. Li X. Zou Q. Function of HNRNPC in breast cancer cells by controlling the dsRNA-induced interferon response EMBO J. 37 23 2018
14 Wang L.C. Chen S.H. Shen X.L. Li D.C. Liu H.Y. Ji Y.L. M6A RNA Methylation Regulator HNRNPC Contributes to Tumorigenesis and Predicts Prognosis in Glioblastoma Multiforme Front. Oncol. 10 2020 536875
15 Liu D. Luo X. Xie M. Zhang T. Chen X. Zhang B. HNRNPC downregulation inhibits IL-6/STAT3-mediated HCC metastasis by decreasing HIF1A expression Cancer Sci. 113 10 2022 3347 3361 35848884
16 Huang G.Z. Wu Q.Q. Zheng Z.N. Shao T.R. Chen Y.C. Zeng W.S. M6A-related bioinformatics analysis reveals that HNRNPC facilitates progression of OSCC via EMT Aging 12 12 2020 11667 11684 32526707
17 Yang N. Liu L. Liu X. Chen Y. Lu J. Wang Z. hnRNPC Promotes Malignancy in Pancreatic Cancer through Stabilization of IQGAP3 Biomed. Res. Int. 2022 2022 6319685
18 Ralser D.J. Condic M. Klümper N. Ellinger J. Staerk C. Egger E.K. Comprehensive immunohistochemical analysis of N6-methyladenosine (m6A) writers, erasers, and readers in endometrial cancer J. Cancer Res. Clin. Oncol. 149 6 2023 2417 2424 35731272
19 Siegel R.L. Miller K.D. Jemal A. Cancer statistics CA Cancer J. Clin. 68 1 2018 7 30 2018 29313949
20 Zhu Q. Zhan D. Yang Y. Chong Y. Xue H. Zhu P. LINC00173 promotes Wilms' tumor progression through MGAT1-mediated MUC3A N-glycosylation Cell cycle (Georgetown, Tex) 21 17 2022 1795 1810 35491865
21 Fan H. Yuan J. Li X. Ma Y. Wang X. Xu B. LncRNA LINC00173 enhances triple-negative breast cancer progression by suppressing miR-490-3p expression Biomed. PharmacOther 125 2020 109987
22 Li Q. Li X. Yang X. Zhang B. Gu Y. Gu G. Long Intergenic Nonprotein Coding RNA 173 Inhibits Tumor Growth and Promotes Apoptosis by Repressing Sphingosine Kinase 1 Protein Expression in Pancreatic Cancer DNA Cell Biol. 40 6 2021 757 775 33978457
23 Zhang J. Zhou M. Zhao X. Wang G. Li J. Long noncoding RNA LINC00173 is downregulated in cervical cancer and inhibits cell proliferation and invasion by modulating the miR-182-5p/FBXW7 axis Pathol. Res. Pract. 216 8 2020 152994
24 Ali T. Grote P. Beyond the RNA-dependent function of LncRNA genes Elife 9 2020
25 Huang X.T. Li J.H. Zhu X.X. Huang C.S. Gao Z.X. Xu Q.C. HNRNPC impedes m(6)A-dependent anti-metastatic alternative splicing events in pancreatic ductal adenocarcinoma Cancer Lett. 518 2021 196 206 34271104
26 Ferrè F. Colantoni A. Helmer-Citterich M. Revealing protein-lncRNA interaction Brief. Bioinform. 17 1 2016 106 116 26041786
