
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00796-X
10.1016/j.psj.2024.104217
104217
IMMUNOLOGY, HEALTH AND DISEASE
Trimethyltin chloride induces oxidative damage and apoptosis in chicken liver
Su Jianming 1
Tang Meiwen 1
Liu Qing
He Jian
Wang Tianjie
Yin Aiyun
Wang Jiangping
Li Qing
Zhou Lihua
Lei Hongyu leihy77@hunau.edu.cn
2
Provincial Key Laboratory of Protein Engineering in Animal Vaccines, College of Veterinary Medicine, Hunan Agricultural University, Changsha, 410128, China
2 Corresponding author: leihy77@hunau.edu.cn
1 These authors contributed equally to this work.

14 8 2024
11 2024
14 8 2024
103 11 10421722 1 2024
9 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Trimethyltin chloride (TMT) is widespread in the environment and is harmful to both humans and animals. In order to investigate the toxicity mechanism of TMT exposure on chicken liver, We established an in vivo experimental model by giving chickens oral administration of different concentrations of TMT dilution solution and vitro experiments of treating leghorn male hepatoma (LMH) cells for 12 h. The results showed that Albumin (ALB), total protein (TP) and alanine aminotransferase (ALT) in the blood of TMT-treated chickens, as well as ALT and aspartate aminotransferase (AST) in the liver, were dose-dependently increased, and different degrees of necrosis of hepatocytes were observed in histology. Meanwhile, TMT exposure led to a significant decrease in glutathione (GSH) content in chicken liver tissues and LMH cells, what's more a significant increase in malondialdehyde (MDA) content in cell supernatants. The expression of apoptosis-related genes Caspase8, Caspase3 and Caspase9 were increased in chicken liver tissues and LMH cells after treated by TMT, and an increased in the percentage of late apoptosis in LMH cells. This suggests that TMT can cause oxidative stress and apoptosis in chicken livers and cells, resulting in liver injury.

Key words

TMT
oxidative damage
apoptosis
chicken
==== Body
pmcINTRODUCTION

Trimethyltin chloride (TMT) is a major by-product in the synthesis of heat stabilizer which often used in the manufacture of PVC plastic products (Hoch 2001). PVC materials with added heat stabilizers are used in a wide range of applications, and are raw materials for the production of profiles, pipes, daily necessities, packaging films, flooring, containers and other products (Ling et al., 2023). Some studies have shown that organotin compounds can be leached from items made of PVC such as pipes (Forsyth and Jay 1997), bags (Hoch 2001), and may contaminate food, drinking water and sewage. Organotin pollutants in water often accumulate in organisms (You et al., 2022). It has been shown that the occurrence of organotin compounds in fishmeal, fish oil and fish feeds (Suominen et al., 2011). Fishmeal made from low value fish and fish processing waste is one of the sources of protein for animal feed (Selaledi et al., 2020). Therefore, organotin compounds such as TMT may cause contamination in animal production through PVC material products, posing a threat to animal health, as well as a risk to human health through the food chain.

TMT is one of the more toxic organotin compounds, has good fat solubility and water solubility, and is easily absorbed by the skin, lungs and gastrointestinal (Barnes & Stoner 1958). In addition, it has some toxic effects on the nervous, urinary, digestive, circulatory and immune systems (Kamaltdinova et al., 2021, Liu et al., 2020, Snoeij et al., 1986, Tang et al., 2013, Yu et al., 2010). Current studies on the mechanism of toxic effects of TMT mainly focus on the induction of oxidative stress (Yoneyama et al., 2008), apoptosis (Buck-Koehntop et al., 2005) and interference with intracellular Ca2+ (Florea et al., 2005).

Oxidative stress is a phenomenon caused by an imbalance between the production and accumulation of oxygen reactive substances (ROS) and the ability to detoxify these reactive products, negatively affecting a wide range of cellular structures such as cell membranes, lipids, proteins, lipoproteins and deoxyribonucleic acid (Pizzino et al., 2017). The redox state is involved in the process of inflammatory, metabolic and proliferative liver diseases, which is an important background in many liver diseases and an initiator of TMT-induced apoptotic cell death (Cichoż-Lach 2014, Zhang et al., 2006). Apoptosis is a programmed and controlled process of cellular self-destruction that requires protein synthesis and specific cellular signals and proteins (Ketelut-Carneiro & Fitzgerald 2022). It is considered to be an important component of various processes, and changes in apoptosis are a factor in many diseases (Elmore 2007). Many studies have found that TMT produces cellular oxides associated with apoptosis (Gunasekar et al., 2001, Jenkins & Barone 2004).

The liver is the detoxification organ and one of the main target organs for TMT (Snoeij et al., 1987). Studies have found that the concentration of TMT in the liver reaches its peak after 1 hour of intraperitoneal injection of TMT diluents in mice, and remains at its maximum at 16 h of animal death (Doctor et al., 1983). Poultry farming is particularly widespread in the world, and poultry meat and its derivatives are one of the most popular food groups, so poultry health also deserves our attention. Therefore, in this study, we used chicken liver and initially explore the effects of TMT on oxidative stress and apoptosis in liver and LMH cells to provide a basis for exploring the hepatotoxicity of TMT.

MATERIALS AND METHODS

Animal Treatments

The study design was approved by the Experimental Ethics Committee of Hunan Agricultural University, and all animals were kept according to the university policy (Approval No. 2021 [92]). According to the previous experiments, Twenty-four 1-day-old healthy chicks were purchased from Hunan Shuncheng Industry Company (Changsha, China), were divided into 4 groups of 6 chicks each in the same wire cage and kept at an ambient temperature of 24°C to 27°C and 16/8 h of light/dark conditions. During the experimental period, the chickens had free access to nonantibiotic treated water and commercial feed. After 7 d of acclimatization, chickens in the 4 groups were orally administered 0, 2, 4, and 8 mg/kg of a diluted solution of TMT (Sinopharm Chemical Reagent Co., Inc, Shanghai, China) in sterilized saline. Blood and liver were collected 24 h after TMT treatment.

Cell Culture and Treatment

The leghorn male hepatoma (LMH) cells were purchased from Shanghai Binsui Biotechnology Company (Shanghai, China), were cultured in DMEM/F12 (Cat. ZQ-600, Zhong Qiao Xin Zhou, Shanghai, China) supplemented with 10% fetal bovine serum and maintained at 37°C and 5% CO2. Cells were inoculated into 6-well plates or 96-well plates and treated with different concentrations of TMT (0.5, 1, 5, and 10 µg/mL as determined by preliminary experiments) for 12 h, and then collected for further experiments.

Analysis of Blood Chemistry Parameters

Albumin (ALB), total protein (TP), total bilirubin (TBIL), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were measured using an SMT-120V automatic blood biochemical analyzer (Seamaty, Chengdu, China).

Determination of Liver Aamage and Oxidative Stress Index

The activity of glutathione (GSH), AST, ALT in serum, liver, and cells were determined according to the kit instructions (NJJCBIO, Nanjing, China). The content of malondialdehyde (MDA) and super oxide dismutase (SOD) in cells were determined according to the kit instructions (NJJCBIO, Nanjing, China).

Histopathological Examination

Liver specimens were fixed in 4% paraformaldehyde, dehydrated, embedded in paraffin. Sections were stained with hematoxylin and eosin (H&E) Staining Solution (SERVICEBIO, Wuhan, China) and observed under light microscope.

Cell apoptosis of liver tissue was detected using the Situ TUNEL Apoptosis Detection Kit (NJJCBIO, Nanjing, China). The prepared slices were removed the wax, then digested with Proteinase K. Proteinase K. HRP-dUTP Labeling Mix and recombinant TdT enzyme were added for labeling, finally visualized by DAB solution. The apoptotic cells in the liver appeared brownish yellow and light microscope was used for observation.

Quantitative PCR Analysis

Total RNA was isolated from liver of chicks and LMH cells by using a reverse transcription kit (TransGen Biotech, Beijing, China). Then, cDNA was synthesized using a reverse transcription kit according to manufacturer's instructions. Real-time PCR was performed using Taq Pro Universal RT-qPCR SYBR Green Mix (Vazyme, Nanjing, China) and oligonucleotide primers (Table 1) on a Real-Time PCR Detection System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA), and gene expression was calculated by the 2−∆∆Ct method. GAPDH was used as internal reference for standardization.Table 1 Oligonucleotide primers used for real-time PCR.

Table 1Primer name	Primer Sequences (5′–3′)	Accession number	
Bcl-2	F:5′–3′ ATCGTCGCCTTCTTCGAGTT	NM_205339.2	
R:5′–3′ ATCCCATCCTCCGTTGTCCT	
Bax	F:5′–3′ GTGATGGCATGGGACATAGCTC	XM_046922136.1	
R:5′–3′ TGGCGTAGACCTTGCGGATAA	
Caspase 3	F:5′–3′ CTGAAGGCTCCTGGTTTA	NM_204725.1	
R:5′–3′ TGCCACTCTGCGATTTAC	
Caspase 8	F:5′–3′ CCATTTGGCTGGCATCAT	NM_204592.3	
R:5′–3′ CACTGCTTCCCTGGCTTT	
Caspase 9	F:5′–3′ CCGAAGGAGCAAGCACG	NM_001044654.1	
R:5′–3′ AGGTTGGACTGGGATGGAC	
β-actin	F:5′–3′ CCTTCTTGGGTATGGAGTCTTG	NM_205518.1	
R:5′–3′ AGAGTATTTACGCTCAGGTGGG	

Liver tissue or LMH cells were ground, and total RNA was extracted using an RNA extraction kit. Then mRNA was reversed transcribe into cDNA by a reverse transcription kit (TransGen Biotech, Beijing, China) according to manufacturer's instructions. Subsequently, using cDNA as a template, real-time PCR was performed with aq Pro Universal RT qPCR SYBR Green Mix (Vazyme, Nanjing, China) and oligonucleotide primers (Table 1). The reaction procedure was: predenaturation at 94 °C for 30 seconds, denaturation at 94 °C for 5 seconds, annealing at 60 °C for 30 seconds, 40 cycles, and extension at 65°C. The gene expression was calculated by the 2−∆∆Ct method and GAPDH was used as internal reference for standardization.

Cell Viability Assay

The viability of TMT-treated LMH cells was detected by CCK8 kits (Vazyme, Nanjing, China). Cells were inoculated in cell culture plates, and the supernatant was discarded after 12 h. Added DMEM medium containing different concentrations of TMT, cultured for 6, 12, and 24 h. The absorbance of the solution was measured at 450 nm with a spectrophotometer. The activity of each group of cells was calculated according to the formula: cell viability (%) = (A test − A blank)/ (A control − A blank) × 100%.

Cell Apoptosis Assay

Apoptosis of LMH cells was analyzed by flow cytometry. Briefly, cells were treated with TMT at the above concentrations for 24 h and then washed by ice-cold PBS. Cells were stained with propidium iodide (PI) and samples were incubated in the dark for 30 min, followed by flow cytometry at an excitation wavelength of 488 nm.

Statistical Analysis

All quantitative data were expressed as means ± standard deviation (SD). Data were analyzed by single factor analysis and T-test using GraphPad Prism 6.01 software. Differences were considered statistically significant when P < 0.05.

RESULTS

TMT Causes Liver Function Indicators Changes in Chickens

To find out whether TMT induces impairment of liver function in chicken, we examined the serum biochemical indices of TMT-treated chickens. The results showed that different doses of TMT tainted chickens for 24 h resulted in elevated levels of ALB, TP, AST and ALT in chicken serum, and there was a dose-dependent increase in ALT (Figure 1A). Compared with the control group, the contents of ALT and AST in liver tissue in the 4 and 8 mg/kg TMT treatment groups were significantly increased (Figure 1B). These results indicated that TMT-induced impairment of liver function in chickens.Figure 1 (A) The effect of TMT on biochemical parameters of chicken serum. (B) The effect of different doses of TMT on ALT and AST levels in chicken liver. The data are expressed as mean ± SD. The same letters on the column indicate insignificant differences, different letters indicate significant differences, and the representation method for the following figures is the same.

Figure 1

TMT-induced Oxidative Damage in Chicken Liver

To understand whether TMT exposure induces oxidative damage in chicken liver, we measured GSH levels in the liver and serum. The GSH content in the liver of chickens treated with different doses of TMT showed a dose-dependent decrease (Figure 2A). In the 4 mg/kg and 8 mg/kg TMT-treated groups, the serum GSH levels were slightly decreased (Figure 2B). At the same time, we detected the contents of SOD and MDA in the liver. The results showed that with the increase of the TMT dose, the SOD content significantly decreased and the MDA content significantly increased compared to the control group (Figures 2C–D). It indicated that TMT may induce oxidative damage in chicken liver.Figure 2 TMT induces oxidative stress in chicken liver. (A) GSH content in liver. (B) GSH content in serum. (C) SOD content in liver. (D) MDA content in liver. The data are expressed as mean ± SD.

Figure 2

TMT Induces Pathological Changes in the Liver of Chickens

Pathological examination showed that the livers in the control group had normal appearance with typical histological structure. After 24 h of TMT treatment, the livers in the experimental group became swelling, yellowing in color, softening and fragility in texture, blurred sectional structure, and appeared hemorrhage in some cases (Figure 3). Histological observation showed the liver of TMT treated chickens all had pathological changes. The main histological damage to the liver was filled with a large amount of blood in the blood vessels, degeneration and necrosis of liver cells. Focal necrosis and hemorrhagic lesions could also be seen in the liver, with a small amount of inflammatory cell infiltration, which were most obvious in the 4 and 8mg/kg treatment groups (Figure 3).Figure 3 Pathological changes in the chicken livers exposed to different doses of TMT for 24 h. (A) 0 mg/kg; (B) 2 mg/kg; (C) 4 mg/kg.; (D) 8 mg/kg. Bar = 20 μm).

Figure 3

TMT Induces Apoptosis in Chicken Liver Cells

To investigate the effect of TMT on cell apoptosis, we observed the changes of cell apoptosis in liver tissue in each group of chickens after treatment. In the control group, there were only a very small number of apoptotic lymphocytes stained with brownish yellow, while a large number of cells stained with brownish yellow were observed in the treatment groups. Especially in the 4 and 8 treatment groups, there was a significant increase in apoptotic cells (Figures 4A–D).Figure 4 TMT induces apoptosis of chicken liver. (A–D) The results of apoptosis cell in the liver by the tunnel method. (Bar = 20 μm) E: The relative expression of Bax, caspase3, caspase8, caspase9 and Bcl-2 mRNA). The data are expressed as mean ± SD.

Figure 4

TMT treatment resulted in changes in the relative mRNA expression of apoptosis-related genes in chicken liver. Compared to control group, TMT caused a relative increase in the mRNA of apoptosis-related genes Bax, Caspase-3, Caspase-8, Caspase-9 and Bcl-2 (Figures 4A–E).

Effect of TMT on the Viability and Function of LMH Cells

To further investigate the toxic effect of TMT on chicken liver, LMH cells were selected for this study. Cell viability was measured 6, 12 and 24 h after LMH cells were exposed to TMT (Figure 5A). There was no significant change in cell viability exposed to 0.5, 1, 5, and 10 µg/mL TMT for 6 h. Cell viability was significantly reduced after 12 h of exposure to 5 and 10 µg/mL TMT. After 24 h of exposure to 10 µg/mL TMT, cell viability was significantly reduced. It indicated that TMT treatment of LMH cells would lead to a gradual decrease in cell viability, and the damage of LMH cells would gradually increase with the increasing of concentration and action time. Cell morphology was observed under microscope after TMT exposure for 12 h (Figure 5B). As the concentration of TMT increased, the number of cells gradually decreased, the cells shrank, becoming round and floating up. This indicates that TMT could reduce cell survival and lead to cell damage. After the cells were treated with different doses of TMT for 12 h, the ALT and AST activities of LMH cells were measured (Figure 5C). After TMT treatment, the activities of AST and ALT were significantly increased, indicating that TMT treatment had an impairing effect on LMH cells.Figure 5 TMT decreases hepatocyte viability and affects their functions. (A) Cell viability after TMT exposure for 6, 12, and 24 h. (B) Morphological changes of cells after TMT treatment for 12 h. (C) ALT and AST viability of LMH cells treated with TMT. The data are expressed as mean ± SD. * P < 0.05.

Figure 5

TMT Induces the Oxidation Stress of in LMH Cells

In order to verify whether the TMT will induce the oxidation stress of LMH cells, we used different concentrations of TMT to treat LMH cells for 12 h, the GSH and SOD contents in LMH cells and the MDA content in cell supernatant were also detected. The results showed that both GSH and SOD contents of LMH cells in the TMT-treated group were reduced (Figures 6A, 6B). When the TMT concentration was 5 µg/ml, the MDA content in the supernatant of LMH cells significantly increased compared to the control group (Figure 6C).Figure 6 TMT induces oxidative stress in LMH cells. (A) GSH content in cells. (B) SOD content in cells. (C) MDA content in cell supernatant. The data are expressed as mean ± SD.

Figure 6

TMT Induces LMH Cells for Late Apoptosis

In order to study the effect of TMT treatment on the apoptosis of LMH cells, we treated LMH cells with different concentrations of TMT for 12 h, and analyzed the late apoptosis of LMH cells by flow cytometer. Compared with the control group, the late apoptosis rate increased in the different concentrations of TMT treated groups, and the late apoptosis rate of 5 and 10 µg/ml TMT groups increased to 10.07% and 20.66% (Figures 7A, 7B). After LMH cells were treated with TMT for 12 h, the relative expression of the apoptosis related genes was detected (Figure 7C). We found that the expressions of apoptosis-related genes caspase3, caspase8 and Bax were all increased after TMT treatment.Figure 7 TMT induces apoptosis of LMH cells. (A) Flow cytometry study of late cell apoptosis in LMH. (B) Percentage of total cells after TMT treated. (C) The mRNA expression of apoptosis genes in LMH cell treated with TMT. The data are expressed as mean ± SD.

Figure 7

DISCUSSION

TMT is widely used as a component of fungicides and plastic stabilizers in industry and agriculture (Lee et al., 2016), and is readily absorbed through the skin, lungs and gastrointestinal tract (Barnes and Stoner 1958). Therefore, TMT has caused many poisonings around the world, and TMT poisoning has become a current environmental health problem (Du 2021).

It was reported to rapidly distribute and persist in tissues 16 h after TMT treatment, with the highest concentration detected in liver tissues (Doctor et al., 1983). Our results showed that ALB, TP, AST and ALT in chicken serum were significantly increased after 24 h of treatment with 8mg/kg of TMT compared with the control group. And the content of AST and ALT in chicken liver increased in a dose-dependent manner compared with the control group, which was consistent with the results in serum. The above results indicated that TMT treatment caused changes in chicken liver function, and exposure to TMT results in liver damage, which could be directly reflected by histopathological analysis. In our study, we found that histological changes in the liver were observed in all TMT treatments, and the degree of liver degeneration and necrosis gradually increased in a dose-dependent manner, suggesting that TMT treatment caused morphological changes in chicken livers, consistent with previous functional changes. In addition, our results showed that the cell viability of all experimental groups decreased when the cells were treated with different concentrations of TMT for 12 h, and the LMH cells viability of 5, 10 µg/mL TMT group decreased significantly. It was also found from the morphological changes that treatment of LMH cells with different concentrations of TMT for 12 h changed the morphology of the cells in a dose-dependent manner for all TMT concentrations of 1 µg/mL and above. Previous studies have shown that treatment of rat hepatic epithelial IAR20 cells at different concentrations of TMT resulted in a concentration-dependent decrease in cell viability (Wang et al., 2008). The viability of human hepatocellular carcinoma HepG2 cells was significantly reduced by TMT treatment (Cai et al., 2009). Zhu et al. found that the cell viability of grass carp hepatocytes L8824 decreased with the increase of TMT concentration and showed a significant dose-dependence (Zhu et al., 2023), which was similar to the results of this study. It showed that TMT caused a decrease in LMH cell viability in a concentration and time dependent manner, suggesting that TMT induces LMH cell death.

Oxidative stress contributes to the development of most diseases in organisms. When various etiological act on the body, the animal body will produce excessive ROS, causing irreversible damage to cellular macromolecules such as proteins, lipids and DNA (Schieber and Chandel 2014), which is an important background for many liver diseases (Cichoż-Lach 2014). This study found that after treating chickens with different doses of TMT for 24 h, the content of GSH and SOD in chicken liver decreased in a dose-dependent manner, while MDA increased significantly in a dose-dependent manner. Compared with the control group, the serum GSH content of chickens in the 4 and 8mg/kg TMT dose groups slightly decreased. Kim et al. found that intravenous injection of TMT for 3 d caused a decrease in plasma GSH content in mice (Kang et al., 2016), which was similar to the results of the present experiment. Kang et al. found that intraperitoneal injection of TMT in mice led to an increase in MDA content of brain tissues, a significant decrease in SOD content, and an increase in oxidized GSH/total GSH (Kim et al., 2018). In this study, we also found that treating LMH cells with 5µg/mL TMT for 12 h resulted in a significant increase in the MDA content of the culture medium supernatant, a relative decrease in the intracellular SOD content, and a significant decrease in the GSH content as compared to the control group, which suggests that TMT leads to oxidative stress in LMH cells.

Oxidative stress is closely related to cell apoptosis. Apoptosis is a coordinated, programmed form of cell death that involves the activation of a group of enzymes called cysteine proteases and links the initial stimulus to the eventual death of the cell (Ketelut-Carneiro and Fitzgerald 2022). The large amount of reactive oxygen species in oxidative stress can attack the lipids of cells, causing lipid peroxidation of the cell membrane and leading to cell damage. Moreover, it can activate Caspase family, regulate the expression and activity of Bcl-2 family proteins, and induce cell apoptosis (Sinha et al., 2013; Hou et al., 2023). Our results showed that TMT significantly promoted the up-regulation of Caspase8, Caspase3, Caspase9, Bax and Bcl-2 genes and increased the proportion of late apoptotic cells in chicken liver tissue and LMH cells. Previous studies have shown that TMT leads to increased mRNA in the expression of Caspase3, Caspase9 in mouse liver tissues and mouse hepatocytes AML12 cells (Wang et al., 2022). In human hepatoma G2 (HepG2) cells, TMT increased cellular caspase3 activity in a concentration-dependent manner, and Bax, Bcl-2 protein expression also increased (Cai et al., 2009). It was found that TMT treatment of grass carp hepatocyte L8824 cells resulted in increased expression of caspase3 and caspase12 genes (Zhu et al. 2023). The results of this experimental study were similar to previous studies, indicating that TMT induced apoptosis in liver cells. In conclusion, TMT was able to induce oxidative stress and apoptosis in chicken liver.

CONCLUSIONS

Our studies on TMT-treated chickens and LMH cells showed that TMT triggers oxidative stress in liver cells, leading to an increased apoptosis rate of hepatocytes and consequent damage to the liver. This helps us to further understand the toxicity of TMT and provides a research basis for in-depth investigation of its toxicity mechanism.

DISCLOSURES

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ACKNOWLEDGMENTS

This work was supported by the Natural Science Foundation of Hunan Province, China (2022JJ30022, 2022JJ30293 ) and Hunan Province Technology Breakthrough Project of 2021 for the open competition mechanism to select the best candidates (No. 2021NK1030 ).
==== Refs
REFERENCES

Barnes J.M. Stoner H.B. Toxic properties of some dialkyl and trialkyl tin salts Br. J. Industr. Med. 15 1958 15 22
Buck-Koehntop B.A. Mascioni A. Buffy J.J. Veglia G. Structure, dynamics, and membrane topology of stannin: A mediator of neuronal cell apoptosis induced by trimethyltin chloride J. Mol. Biol. 354 2005 652 665 16246365
Cai J. Wang M. Li B. Wang C. Chen Y. Zuo Z. Apoptotic and necrotic action mechanisms of trimethyltin in human hepatoma G2 (HepG2) cells Chem. Res. Toxicol. 22 2009 1582 1587 19655806
Cichoż-Lach H. Oxidative stress as a crucial factor in liver diseases World J. Gastroenterol. 20 2014 8082 25009380
Doctor S.V. Sultatos L.G. Murphy S.D. Distribution of trimethyltin in various tissues of the male mouse Toxicol. Lett. 17 1983 43 48 6623508
Du Y. Acute trimethyltin poisoning caused by exposure to polyvinyl chloride production: 8 cases Am. J. Med. Sci. 362 2021 92 98 33587910
Elmore S. Apoptosis: A review of programmed cell death Toxicol. Pathol 35 2007 495 516 17562483
Florea A.M. Dopp E. Busselberg D. Elevated Ca2+(i) transients induced by trimethyltin chloride in HeLa cells: types and levels of response Cell Calcium 37 2005 251 258 15670872
Forsyth D.S. Jay B. Organotin leachates in drinking water from chlorinated poly (vinyl chloride) (CPVC) pipe Appl. Organomet. Chem. 11 1997 551 558
Gunasekar P. Li L. Prabhakaran K. Eybl V. Borowitz J.L. Isom G.E. Mechanisms of the apoptotic and necrotic actions of trimethyltin in cerebellar granule cells Toxicol. Sci. 64 2001 83 89 11606804
Hoch M. Organotin compounds in the environment — an overview Appl. Geochem. 16 2001 719 743
Hou L. Gu T. Weng K. Zhang Y. Zhang Y. Chen G. Xu Q. Effects of oxidative stress on the autophagy and apoptosis of granulosa cells in broody geese Int J Mol Sci 24 2023 2154 36768482
Jenkins S.M. Barone S. The neurotoxicant trimethyltin induces apoptosis via caspase activation, p38 protein kinase, and oxidative stress in PC12 cells Toxicol. Lett. 147 2004 63 72 14700529
Kamaltdinova E. Pershina E. Mikheeva I. Bugaev-Makarovskiy N. Arkhipov V. Different activation of IL-10 in the hippocampus and prefrontal cortex during neurodegeneration caused by trimethyltin chloride J. Mol. Neurosci. 71 2021 613 617 32803646
Kang J.Y. Park S.K. Guo T.J. Ha J.S. Lee D.S. Kim J.M. Lee U. Kim D.O. Heo H.J. Reversal of trimethyltin-induced learning and memory deficits by 3,5-dicaffeoylquinic acid Oxidative Med. Cell. Longev. 2016 2016 1 13
Ketelut-Carneiro N. Fitzgerald K.A. Apoptosis, pyroptosis, and necroptosis—oh my! The many ways a cell can die J. Mol. Biol. 434 2022 167378
Kim J. Park S. Kang J. Park S. Yoo S. Han H. Kim C. Lee U. Kim S. Heo H. Ethyl acetate fraction from persimmon (diospyros kaki) ameliorates cerebral neuronal loss and cognitive deficit via the jnk/akt pathway in tmt-induced mice Int. J. Mol. Sci. 19 2018 1499 29772805
Lee S. Yang M. Kim J. Kang S. Kim J. Kim J.C. Jung C. Shin T. Kim S.H. Moon C. Trimethyltin-induced hippocampal neurodegeneration: A mechanism-based review Brain Res. Bull. 125 2016 187 199 27450702
Ling M. Ma D. Hu X. Liu Z. Wang D. Feng Q. Hydrothermal treatment of polyvinyl chloride: Reactors, dechlorination chemistry, application, and challenges Chemosphere 316 2023 137718
Liu Z. Tian Z. Lv J. Liu W. Ma Y. Hu M. Huang M. Mechanism in bradycardia induced by Trimethyltin chloride: Inhibition activity and expression of Na(+)/K(+)-ATPase and apoptosis in myocardia J. Toxicol. Sci. 45 2020 549 558 32879254
Pizzino G. Irrera N. Cucinotta M. Pallio G. Mannino F. Arcoraci V. Squadrito F. Altavilla D. Bitto A. Oxidative Stress: Harms and Benefits for Human Health Oxidative Med. Cell. Longev. 2017 2017 1 13
Schieber M. Chandel N.S. ROS function in redox signaling and oxidative stress Curr. Biol. 24 2014 R453 R462 24845678
Selaledi L. Mbajiorgu C.A. Mabelebele M. The use of yellow mealworm (T. Molitor) as alternative source of protein in poultry diets: a review Trop. Anim. Health Prod. 52 2020 7 16 31392553
Sinha K. Das J. Pal P.B. Sil P.C. Oxidative stress: the mitochondria-dependent and mitochondria-independent pathways of apoptosis Arch. Toxicol 87 2013 1157 1180 23543009
Snoeij N.J. Penninks A.H. Seinen W. Biological activity of organotin compounds–an overview Environ. Res. 44 1987 335 3319574
Snoeij N.J. van Iersel A.A. Penninks A.H. Seinen W. Triorganotin-induced cytotoxicity to rat thymus, bone marrow and red blood cells as determined by several in vitro assays Toxicology 39 1986 71 83 3008380
Suominen K. Hallikainen A. Ruokojärvi P. Airaksinen R. Koponen J. Rannikko R. Kiviranta H. Occurrence of PCDD/F, PCB, PBDE, PFAS, and organotin compounds in fish meal, fish oil and fish feed Chemosphere 85 2011 300 306 21777935
Tang X. Li N. Kang L. Dubois A.M. Gong Z. Wu B. Lai G. Yang A. Ruan X. Gao H. Zhu G. Ge Y. Zhang J. Lin Z. Olson J.R. Ren X. Chronic low level trimethyltin exposure and the risk of developing nephrolithiasis Occup. Environ. Med. 70 2013 561 567 23703823
Wang M. Li B. Wang C. Chen Y. Zuo Z. The concentration-dependent induction of cell death by trimethyltin chloride in rat liver epithelial IAR20 cells Toxicol. Vitro 22 2008 1136 1142
Wang Y. Liu X. Jing H. Ren H. Xu S. Guo M. Trimethyltin induces apoptosis and necroptosis of mouse liver by oxidative stress through YAP phosphorylation Ecotox. Environ. Safe. 248 2022 114327
Yoneyama M. Nishiyama N. Shuto M. Sugiyama C. Kawada K. Seko K. Nagashima R. Ogita K. In vivo depletion of endogenous glutathione facilitates trimethyltin-induced neuronal damage in the dentate gyrus of mice by enhancing oxidative stress Neurochem. Int. 52 2008 761 769 17949856
You J. Gao J. Fu P. LeBlanc G.A. Guo J. Zhang L.X. Li M.Q. Organotins in a food web from the Three Gorges Reservoir, China: Trophic enrichment and potential health risk Sci. Total Environ. 845 2022 157276 35835194
Yu H. Chen S. Yang Z. Pan A. Zhang G. Zhang G. Shan J. Tang X. Zhou W. Trimethyltin chloride induced chloride secretion across rat distal colon Cell Biol. Int. 34 2010 99 108
Zhang L. Li L. Prabhakaran K. Borowitz J. Isom G. Trimethyltin-induced apoptosis is associated with upregulation of inducible nitric oxide synthase and Bax in a hippocampal cell line Toxicol. Appl. Pharmacol. 216 2006 34 43 16797631
Zhu H. Gao M. Sun W. Liu H. Xu S. Li X. ROS/ER stress contributes to trimethyltin chloride-mediated hepatotoxicity; Tea polyphenols alleviate apoptosis and immunosuppression Comp. Biochem. Physiol. C-Toxicol. Pharmacol. 263 2023 109505
