
==== Front
BMC Infect Dis
BMC Infect Dis
BMC Infectious Diseases
1471-2334
BioMed Central London

9869
10.1186/s12879-024-09869-x
Research
Molecular detection of OXA-48 and NDM-1 carbapenemase genes among clinical isolates of Klebsiella pneumoniae recovered from patients attending a private tertiary hospital in Southwestern Nigeria
http://orcid.org/0009-0008-0480-6649
Onyeji Chisom Blossom 1
http://orcid.org/0000-0001-5993-7920
Enitan Seyi Samson enitans@babcock.edu.ng

1
Kemiki Olalekan Ademola 2
http://orcid.org/0000-0002-1819-5470
Igwe Abigail Chinyere 2
http://orcid.org/0000-0002-5966-9046
Adeniyi Akinbobola Ayokunle 3
http://orcid.org/0000-0001-6138-2573
Iduh Michael Unata 4
http://orcid.org/0000-0002-7821-1727
Itodo Grace Eleojo 5
http://orcid.org/0009-0007-4432-2350
Okuneye Ayomide Oluwatobiloba 1
http://orcid.org/0009-0001-6965-4198
Adamson Precious Oluwatosin 1
http://orcid.org/0009-0001-6754-8922
Kolawole Mofeoluwa Favour 1
1 https://ror.org/00k0k7y87 grid.442581.e 0000 0000 9641 9455 Department of Medical Laboratory Science, School of Public and Allied Health, Babcock University, Ilishan-Remo, Ogun State Nigeria
2 https://ror.org/00k0k7y87 grid.442581.e 0000 0000 9641 9455 Molecular and Tissue Culture Laboratory, Babcock University Teaching Hospital, Ilishan-Remo, Ogun State Nigeria
3 https://ror.org/022yvqh08 grid.412438.8 0000 0004 1764 5403 Department of Medical Microbiology, University College Hospital, Ibadan, Oyo State Nigeria
4 https://ror.org/006er0w72 grid.412771.6 0000 0001 2150 5428 Department of Medical Microbiology, School of Medical Laboratory Science, Usmanu Danfodiyo University, Sokoto, Sokoto State Nigeria
5 grid.412446.1 0000 0004 1764 4216 Department of Microbiology, Federal Teaching Hospital, Lokoja, Kogi State Nigeria
13 9 2024
13 9 2024
2024
24 97017 6 2024
3 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Abstract

There have been increasing reports of Klebsiella pneumoniae resistant to β-lactam antibiotics. This study aimed to determine the prevalence of some selected carbapenemase genes among clinical isolates of Klebsiella pneumoniae recovered from patients attending a private tertiary hospital in Southwestern Nigeria. The study was conducted over two months (February-March 2024). A total of 50 clinical isolates of Klebsiella pneumoniae from different clinical specimens were obtained from the Medical Microbiology Department, Babcock University Teaching Hospital (BUTH). The clinical isolates were then characterized using standard microbiological procedures and were tested for susceptibility to meropenem and other classes of antibiotics according to Clinical and Laboratory Standards Institute (CLSI) guidelines. Polymerase Chain Reaction (PCR) detection for OXA-48 and NDM-1 carbapenemase genes was performed on the 50 clinical isolates. PCR analysis showed that 9 (18%) clinical isolates were positive for the OXA-48 gene, 22 (44%) were positive for the NDM-1 gene, 4 (8%) possessed both the OXA-48 and NDM-1 genes, and 23 (46%) possessed neither the OXA-48 nor NDM-1 genes. Antibiotic Susceptibility Testing (AST) revealed that all the clinical isolates were resistant to meropenem. In conclusion, this study demonstrates the presence of OXA-48 and NDM-1 genes in clinical isolates of Klebsiella pneumoniae recovered from patients attending a private tertiary hospital in Southwestern Nigeria, highlighting the role of ESBL (extended-spectrum beta-lactamase) as a major resistance mechanism alongside other mechanisms. Population-based surveillance programs should be implemented to monitor the prevalence and epidemiology of Klebsiella pneumoniae infections at the community level, facilitating early detection of outbreaks and identification of emerging antimicrobial resistance patterns.

Core Tip

This study highlights the significant prevalence of NDM-1 and OXA-48 carbapenemase genes among Klebsiella pneumoniae clinical isolates in a private tertiary hospital in Southwestern Nigeria, with 44% and 18% of isolates harboring these genes, respectively. Notably, 46% of isolates were resistant to carbapenems despite lacking these genes, suggesting alternative resistance mechanisms. The findings underscore the urgent need for enhanced surveillance, infection control measures, and antibiotic stewardship programs to combat the spread of multidrug-resistant Klebsiella pneumoniae in healthcare settings.

Keywords

Carbapenemase genes
Klebsiella pneumoniae
NDM-1
OXA-48
Southwestern nigeria
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Klebsiella pneumoniae is a Gram-negative pathogen often acquired in the hospital settings despite being part of normal flora. It is commonly present in the environment, such as in soil and water, and has been implicated in pneumonia, urinary tract infections and bloodstream infections [1, 2]. Klebsiella pneumoniae is a significant contributor to healthcare-associated infections, comprising about 8% of all nosocomial infections and up to 14% of primary bacteremia cases [2–5]. The organism plays a substantial role in the spread of antimicrobial resistance among Enterobacteriaceae, posing challenges in clinical settings [6–8]. Over the past decade, the appearance of strains with decreased susceptibility or resistance to carbapenems has become a therapeutic challenge. Identifying its virulence genes is crucial for potential therapies [9–13].

Carbapenem resistance in Klebsiella pneumoniae is primarily driven by the production of carbapenemases, which fall into three categories: (1) metallo-β-lactamases (e.g., NDM-1, IMP, VIM) of molecular class B, which hydrolyze all β-lactams, except monobactams and inhibited by EDTA, but not clavulanic acid; (2) The second type of resistance mechanism involves serine beta-lactamases, including GES and KPC, which are not inhibited by clavulanic acid and (3) OXA-48 carbapenemases which hydrolyze monobactams (and thus monobactam antibiotics are ineffective against bacteria expressing this resistance mechanism).These unique characteristics are used for laboratory identification [14–21]. Carbapenemases, often obtained through mutations or horizontal gene transfer, include common types such as NDM-1 (produced by the blaNDM gene) and OXA-48 (produced by the blaOXA48-like gene) [9, 22–24].

Infections caused by carbapenem-resistant Klebsiella pneumoniae present significant complications associated with various hospital-related risk factors. The prevalence of CRKP isolates in invasive Klebsiella pneumoniae infections varies globally. For example, in India, carbapenem resistance rates increased from 9% in 2008 to 44% in 2010, a surge of 35% in two years, while in Italy, the rates dramatically rose to 60% in 2013 from non-detectable levels in 2008 [25–27]. In a multicenter retrospective study in India, involving 344 Klebsiella pneumoniae isolates from eight centers, the blaOXA48-like gene was found in 73.2% of the isolates, followed by blaNDM-1/5 in 24.4%. However, in several other studies, NDM was identified as the primary cause of carbapenem resistance, with the OXA-48-like group following [9, 28]. NDM is recognized as the most prevalent carbapenemase, and co-production of NDM-1 with other carbapenemases has been observed in Enterobacteriaceae isolates in various regions [26–30].

The rise of carbapenem-resistant K. pneumoniae poses a significant obstacle for antimicrobial treatment [31, 32]. In Nigeria, the epidemiology of antibiotic resistance has become alarming, with a notable increase in carbapenem-resistant infections. Several studies have reported the prevalence of carbapenemase-producing Enterobacteriaceae (CPE) in various regions of the country, underscoring the critical public health threat posed by these pathogens. For instance, in Jos (North-Central Nigeria), a study by Nkup et al. [33] reported a CRKP prevalence of 42.1% from clinical specimens, with the highest occurrence in urine samples (62.5%). In another study carried out in Enugu (South-eastern Nigeria) by Maduakoret al. [34]. , 27.7% of the Klebsiella pneumoniae isolates were resistant to imipenem, with a significant portion producing metallo-beta-lactamases (MBLs). Similarly, in Minna (North-Central of Nigeria), 20.9% of isolates from wound surfaces were carbapenem-resistant [35]. Studies from Lagos and other southwestern regions of Nigeria also indicate high resistance rates, underscoring a national concern [36–38]. The resistance mechanisms of CRKP in Nigeria are diverse, involving various carbapenemase genes and other determinants. In a study carried out in Enugu State (South-eastern, Nigeria), the presence of MBL-producing K. pneumoniae indicates a significant role of MBLs in carbapenem resistance [34]. Whole-genome sequencing in South-West Nigeria identified multiple resistance genes, including blaOKP-B-1 and fosA5 [39], highlighting the complexity of the resistance landscape.

CRKP isolates in Nigeria exhibit high levels of multidrug resistance, complicating treatment options. In Jos (North-Central Nigeria), isolates showed high resistance to gentamicin, ceftriaxone, amoxicillin/clavulanic acid, ciprofloxacin, and cefepime, with some resistance to meropenem [33]. Studies from Lagos (South-West Nigeria) [37] and Kano (North-West Nigeria) [40, 41], also reported significant resistance rates to meropenem and imipenem, with co-production of carbapenemase and extended-spectrum β-lactamases being common. This resistance extends to other antibiotic classes, limiting available treatment options. A national perspective by Olalekan et al. [36] noted a high proportion of carbapenemase-producing K. pneumoniae among ESBL-producing Enterobacteriaceae, with 27.4% being carbapenem-resistant. A systematic review and meta-analysis by Irekeola et al. [42] revealed a progressive increase in carbapenem resistance across Nigeria, with pooled prevalence estimates for resistance to various carbapenems ranging from 11.2 to 37.9%. These findings highlight the growing challenge of carbapenem-resistant K. pneumoniae in Nigeria and call for urgent, coordinated efforts.

Rationale of the study

The OXA-48 and NDM-1 carbapenemase genes are critically important due to their capacity to rapidly disseminate and induce high-level resistance to carbapenems, which significantly limit treatment options for infections caused by Klebsiella pneumoniae. Surveillance data from tertiary hospitals in Nigeria indicate a rising trend in carbapenem resistance, highlighting the urgent need for effective monitoring and control strategies to address the spread of these resistant strains. Despite the growing concerns, there is a notable absence of published research focused on the molecular detection of these carbapenemase genes in Klebsiella pneumoniae clinical isolates from patients at Babcock University Teaching Hospital, Ilishan-Remo, Ogun State, Nigeria. This gap in the literature underscores the necessity of this study to provide critical insights into the prevalence and distribution of OXA-48 and NDM-1 genes in this specific healthcare setting, ultimately contributing to more targeted and effective infection control measures.

Significance of the study

The molecular detection of carbapenemase genes in K. pneumoniae isolates will guide the empirical treatment of infections caused by this drug-resistant pathogen. Moreover, the findings will be invaluable for governmental and non-governmental agencies, the academic community, healthcare workers, and other stakeholders in the health sector, providing diagnostic and treatment services for patients suffering from K. pneumoniae infections. The significance of this study lies in its focus on the molecular detection of OXA-48 and NDM-1 carbapenemase genes among clinical isolates of K. pneumoniae from patients in a private tertiary hospital in Southwestern Nigeria. By identifying the prevalence and distribution of these carbapenemase genes, the study will provide valuable epidemiological data that can inform local and national antimicrobial resistance strategies. The findings can guide infection control policies and antibiotic stewardship programs to curb the spread of these formidable pathogens within healthcare settings. Given the global nature of antimicrobial resistance, data from this study will contribute to the broader understanding of resistance patterns and facilitate international efforts to combat the spread of carbapenem-resistant Klebsiella pneumoniae (CRKP).

Aim of the study

The aim of this study is to determine the prevalence of selected carbapenemase genes among clinical isolates of Klebsiella pneumoniae recovered from patients attending a private tertiary hospital in Southwestern Nigeria.

Methodology

Study design

This is an analytical and epidemiological study.

Study area

This study was carried out at the Medical Microbiology Laboratory, as well as the Molecular and Tissue Culture Laboratory at Babcock University Teaching Hospital (BUTH), Ilishan-Remo, Ogun State. BUTH is a private hospital with over 400-bed capacity and is the only tertiary hospital within the community, whereas Ilishan-Remo is one of the geo-political wards in Ikenne Local Government Area of Ogun State.

Study duration

The study lasted for a period of 2 months (February-March, 2024).

Sample size

A total of 50 non-duplicate clinical isolates of Klebsiella pneumoniae (chosen based on meropenem-resistance within the duration of the study) recovered from the specimens (urine, blood, sputum, pus, tracheal aspirate, and ascitic fluid) of patients attending Babcock University Teaching Hospital (BUTH), Ilishan-Remo, Ogun state, Nigeria, who presented with pneumonia, urinary tract infection, bloodstream infection, and meningitis, stored in separate sterile Bijou bottle containing nutrient agar slant were used for the study.

Laboratory analysis

Culture of clinical isolates of Klebsiella pneumoniae

The clinical isolates were sub-cultured from different media onto differential media, including MacConkey agar (MCA), Eosin Methylene Blue (EMB) agar and Cystine Lactose Electrolyte-Deficient (CLED) agar (Oxoid, LabMal Malaysia), and were re-identified biochemically using standard methods.

Identification of clinical isolates of Klebsiella pneumoniae

Standard methods (macroscopy and microscopy) for identifying Klebsiella pneumoniae isolates were adopted. Colony morphological features such as size, shape, texture, elevation, pigmentation, margins and opacity were recorded. Gram staining was performed to illustrate their morphology. Their biochemical characteristics were determined by carrying out catalase test, coagulase test, oxidase test, indole test, citrate test and urease test. Also, the isolates were placed on Chromogenic agars to help further identification. ESBL-producing Klebsiella pneumoniae formed red and metallic blue colonies on CHROMagar ESBL and CHROMagar Klebsiella (Sigma-Aldrich, United States of America), respectively.

DNA extraction

Genomic DNA isolated from bacterial cells was used for epidemiological or diagnostic purposes. Genomic DNA was extracted using a DNA pure extraction kit (Zymo) according to the manufacturer’s recommendations. The amount and purity of the extracted DNA was measured using a NanodropNDJacoby, 20,090 spectrophotometer (Thermo Fisher Scientific, Waltham, MA USA).

DNA extraction procedure

Sample preparation

A colony of each clinical isolates of Klebsiella pneumoniae was inoculated into a Brain Heart infusion broth contained in a properly labelled Bijou bottle.

Reagent preparation

1,040 µl of Proteinase K storage buffer was added to 20 mg of proteinase K tube prior to use. It was stored at -20 °C after mixing.

Sample processing

The Brain Heart Infusion (BHI) broth containing the sample was dispensed into Eppendorf tube. The sample was centrifuged at 500 xg for 2 min. The supernatant was decanted by sharp inversion. The bottom of the Eppendorf tube was tapped to re-suspend the sediment. 20 µl of DNA elusion buffer was added to the cell pellet (sediment). It was mixed using a vortex machine for 10 s. 200 µl of sample mixture was added to another eppendorf tube. 200 µl of Biofluid and cell buffer and 20 µl of Proteinase K was added to the Eppendorf tube. The content of the tube was mixed using the vortex machine for 10 s and incubated in a heat block at 55 °C for 10 min. 420 µl of Genomic Binding Buffer was added to the digested sample. It was mixed using a vortex for 10 s. The mixture was transferred to a Zymo-spin™ IIC-XLR Columnin a collection tube. It was centrifuged at 12,000 xg for 1 min and the flow through and collection tube was discarded. 400 µl DNA pre-wash buffer was added to the spin column in a new collection tube. It was centrifuged at 12,000 xg for 1 min and the collection tube was emptied. 700 µl of g-DNA wash buffer was added to the spin column. It was centrifuged at 12,000 xg for 1 min and the collection tube was emptied. 200 µl of g-DNA wash buffer was added to the spin column. It was centrifuged at 12,000 xg for 1 min and the collection tube and flow through were discarded. The spin column was transferred to a new Eppendorf tube. 50 µl of DNA elution buffer was added directly on the matrix. It was incubated for 5 min at room temperature. It was centrifuged at maximum speed (14,000 xg) for 1 min to elute the DNA which was used for molecular-based applications.

Primer design

The primer sequences and optimization protocols utilized in this study for the detection of OXA-48 and NDM-1 genes in Klebsiella pneumoniae isolates were adapted from a previously published work by Poirel et al. [43]. These primers have been validated for their efficacy in identifying these genes among clinical isolates of Klebsiella pneumoniae. The primer sequences can be found in Table 1.

PCR amplification with uniplex assays

Briefly, from the extracted genomic DNA of Klebsiella pneumoniae, OXA-48 and NDM-1 genes were amplified using primers listed in Table 1. The amplification reaction was carried out in a 0.5 ml microcentrifuge tubes loaded into a DNA thermocycler (Eppendorf Mastercycler AG 22331, Hamburg, Germany). Each tube contained 20 µl reaction mixture. A known positive sample was used as positive control while asterile distilled water was used as negative control. The samples were subjected to different cycling conditions (Table 2) using a PCR machine supplied by Hangzhou Bioer Technology Company Limited (Zhejiang, China). Afterwards, agarosegel electrophoresis was carried out. At the end of the run, the gel was viewed under UV blue light to determine the band sizes of the amplicons. Using the primers listed belowr, OXA-48 and NDM-1 genes were expected to have a band size of 438 bp and 621 bp, respectively.

Table 1 Primers sequences used for the molecular detection of Klebsiella pneumoniae carbapenemase genes [43]

Primer name	Sequence (5’ to 3’)	Product size (bp)	Annealing temperature (°C)	
OXA-48-F

OXA-48-R

	GCGTGGTTAAGGATGAACAC

CATCAAGTTCAACCCAACCG

	438	52	
NDM-1-F

NDM-1-R

	GGTTTGGCGATCTGGTTTTC

CGGAATGGCTCATCACGATC

	621	52	

Table 2 PCR thermal cycling conditions [43]

Gene	Initial denaturation	No of cycles	Denaturation	Annealing	Extension	Final extension	
OXA-48	94 °C for 10 min	36 cycles	94 °C for 30 s	52 °C for 40 s	72 °C for 50 s	72 °C for 5 min	
NDM-1	94 °C for 10 min	36 cycles	94 °C for 30 s	52 °C for 40 s	72 °C for 50 s	72 °C for 5 min	

Results

The data presented for this research are in two steps. The first step is the presentation of the primers’ operation with Klebsiella pneumoniae. Results show that the designed primers for the OXA-48 gene and NDM-1 gene operated well with the Klebsiella pneumoniae. The OXA-48 and NDM-1 genes were amplified from the genomic DNA of Klebsiella pneumoniae clinical isolates by uniplex PCR. The generated amplicons for OXA-48 gene and NDM-1 gene were 438 bp and 621 bp respectively (Figs. 1 and 2).

The second step involves the samples and the specimen types. The results of this phase are presented in a chart representing the frequency of the specimen types used. It was observed that Klebsiella pneumoniae was most frequently isolated from urine specimens, accounting for 24 (48%) of the cases, followed by blood, sputum, pus, tracheal aspirate, and ascitic fluid, which accounted for 8 (16%), 7 (14%), 7 (14%), 3 (6%), and 1 (2%) of the cases, respectively (Fig. 3). A total of 50 Klebsiella pneumoniae clinical isolates were sub-cultured and re-identified using biochemical tests. These isolates were obtained from different infection sites including 24 urine samples (48%), 8 blood samples (16%), 7 sputum samples (14%), 7 pus samples (14%), 3 tracheal aspirates (6%) and 1 Ascitic fluid sample (2%) (Table 3).

The results showed that the uniplex PCR assay for the detection of the OXA-48 gene was positive for 9 samples (18%) and 22 samples (44%) were positive for the NDM-1 gene (Fig. 4). OXA-48 gene was positive in 9 (18%) clinical isolates of Klebsiella pneumoniae in different specimen types. The urine specimen had the highest number of positive cases, with 5 (10%), followed by blood, sputum, and pus with 2 (4%), 1 (2%), and 1 (2%) positive cases, respectively. The OXA-48 gene was not detected in Klebsiella pneumoniae clinical isolates from tracheal aspirate and ascitic fluid specimens (Fig. 5).

Table 3 Distribution of clinical isolates of Klebsiella pneumoniae

Clinical specimen	Frequency (N)	Percentage (%)	
Urine	24	48	
Blood	8	16	
Sputum	7	14	
Pus	7	14	
Tracheal aspirate	3	6	
Ascitic fluid	1	2	

NDM-1 gene was positive in 22 (44%) clinical isolates of Klebsiella pneumoniae in different specimen types. The urine specimen had the highest number which was 11 (22%) followed by sputum, blood, pus and Ascitic fluid which was 5 (10%), 3 (6%), 2 (4%) and 1 (2%) respectively. The NDM-1 gene was not detected in Klebsiella pneumoniae clinical isolates from tracheal aspirate specimens (Fig. 6).

There was significant association between the carbapenemase genes among clinical isolates of Klebsiella pneumoniae and the sites of infection (Fig. 7). Both OXA-48 gene and NDM-1 gene were detected in 4 (8%) clinical isolates of Klebsiella pneumoniae in different specimen types. Blood specimen had the highest number of isolates with both genes, with 2 (4%), followed by sputum and pus with 1 (2%) each. Neither urine specimens, tracheal aspirates, nor ascitic fluid specimens contained both genes (Fig. 8).

Not all clinical isolates of Klebsiella pneumoniae possessed either the OXA-48 or NDM-1 genes. A total of 23 (46%) clinical isolates of Klebsiella pneumoniae from different specimen types possessed neither the OXA-48 gene nor the NDM-1 gene. The urine specimen had the highest number of such cases, with 8 (16%), followed by blood, sputum, pus, and tracheal aspirates, with 5 (10%), 2 (4%), 5 (10%), and 3 (6%) cases, respectively (Fig. 9).

The results of the Antibiotic Susceptibility Testing (AST) performed on the clinical isolates of Klebsiella pneumoniae showed that all the 50 (100%) clinical isolates of Klebsiella pneumoniae were resistant to meropenem. 9 (18%) clinical isolates of Klebsiella pneumoniae were resistant to azithromycin. 3 (6%) clinical isolates of Klebsiella pneumoniae were resistant to ciprofloxacin. 1 (2%) clinical isolate of Klebsiella pneumoniae was resistant to amoxicillin. 1 (2%) clinical isolate of Klebsiella pneumoniae was resistant to ceftriaxone. 1 (2%) clinical isolate of Klebsiella pneumoniae was resistant to levofloxacin. 1 (2%) clinical isolate of Klebsiella pneumoniae was resistant to cefepime. There was no resistance observed to ceftazidime, cefuroxime, gentamicin, piperacillin-tazobactam or amikacin (Table 4).

Table 4 Antibiotic susceptibility pattern of clinical isolates of Klebsiella pneumoniae

Antibiotics	Number of isolates tested N (%)	Sensitive N (%)	Intermediate N (%)	Resistant N (%)	
Ceftazidime	50 (100)	38 (76)	12 (24)	-	
Amoxicillin	50 (100)	37 (74)	12 (24)	1 (2)	
Ceftriaxone	50 (100)	38 (76)	11 (22)	1 (2)	
Cefuroxime	50 (100)	40 (80)	10 (20)	-	
Gentamicin	50 (100)	41 (82)	9 (18)	-	
Ciprofloxacin	50 (100)	32 (64)	15 (30)	3 (6)	
Piperacillin-Tazobactam	50 (100)	49 (98)	1 (2)	-	
Meropenem	50 (100)	-	-	50 (100)	
Amikacin	50 (100)	43 (86)	7 (14)	-	
Levofloxacin	50 (100)	35 (70)	14 (28)	1 (2)	
Cefepime	50 (100)	32 (64)	17 (34)	1 (2)	
Azithromycin	50 (100)	29 (58)	12 (24)	9 (18)	

Fig. 1 PCR amplification of Klebsiellapneumoniae for the detection of OXA-48 gene on gel electrophoresis with a generated amplicon of 438 bp.Uniplex. Lane M: DNA Ladder; (100 bp). Lane P: Positive control. Lane N: Negative control. Lanes 1, 2, 4 and 5 were positive for OXA-48 gene. Lanes 3, 6, 7, 8, 9, 10, 11 and 12 were negative for OXA-48 gene

Fig. 2 PCR amplification of Klebsiella pneumoniae for the detection of NDM-1 gene on gel electrophoresis with a generated amplicon of 621 bp.Uniplex. Lane M: DNA Ladder; (100 bp). Lane P: Positive control. Lane N: Negative control. Lanes 1, 2, 3, 9, 10, 11 and 12 were positive for NDM-1 gene. Lanes 4, 5, 6, 7 and 8 were negative for NDM-1 gene

Fig. 3 Bar chart showing the number of different specimen types in the clinical isolates of Klebsiella pneumoniae

Fig. 4 Bar chart showing the comparison of the number of the number of positive samples for each gene

Fig. 5 Bar chart showing the number of positive OXA-48 carbapenemase genes of Klebsiella pneumoniae present in each cultured specimen type

Fig. 6 Bar chart showing the number of positive NDM-1 carbapenemase genes of Klebsiella pneumoniae present in each cultured specimen type

Fig. 7 Bar chart showing the number of specimen types that were positive for each gene

Fig. 8 Bar chart showing the number of specimen types that were positive for both OXA-48 and NDM-1 genes

Fig. 9 Bar chart showing the number of specimen types that had neither OXA-48 gene nor NDM-1 gene

Discussion

Carbapenem-resistant Enterobacteriaceae (CRE) frequently cause infections in immunocompromised patients, leading to prolonged hospital stays and increased mortality [3, 15, 24]. Despite the introduction of new antibiotics for CRE infections, combating antibiotic resistance remains challenging due to the limited availability of effective treatments and the lack of comprehensive clinical data from large randomized controlled trials. Diagnosing, treating, and preventing CRE infections are significant challenges. Notably, carbapenem-resistant Klebsiella pneumoniae (CRKP) is identified as a critical-priority pathogen among CREs [39]. The principal resistance mechanism of CRKP involves the production of carbapenemases, such as Klebsiella pneumoniae carbapenemases (KPC), New Delhi metallo-β-lactamase (NDM), imipenemase metallo-β-lactamase (IMP), Verona integron-encoded metallo-β-lactamase (VIM), and oxacillinase-48-type carbapenemases (OXA-48) [15, 28, 30, 40, 41].

This study aimed to detect OXA-48 and NDM-1 carbapenemase genes in clinical isolates of Klebsiella pneumoniae from patients attending a private tertiary hospital in southwestern Nigeria. Our results show an OXA-48 positivity rate of 18% and an NDM-1 positivity rate of 44% among Klebsiella pneumoniae isolates. This contrasts with findings from Odewale et al. [44], who reported a higher prevalence of OXA-48 at 28.9%, suggesting regional variations in prevalence. Our detection rate for NDM-1 is consistent with Olalekan et al. [19], where 62.5% of isolates were positive for blaNDM, although the presence of NDM-1 in our study was lower. This discrepancy might be attributed to differences in local epidemiological factors and healthcare practices. We found that 8% of the isolates possessed both OXA-48 and NDM-1 genes, predominantly in blood, sputum, and pus samples. This contrasts with Olowo-okere et al. [45], who reported a rare co-existence of carbapenemase genes. This variation could indicate a potential for gene co-expression that might be specific to our study region.

Furthermore, our study identified the highest prevalence of both carbapenemase genes in urine specimens, which aligns with the findings of Nkup et al. [16], who also reported a high prevalence of Klebsiella pneumoniae in urine samples. This observation underscores the importance of urine as a significant source of resistant isolates in Nigeria. Our study observed that 46% of the isolates were negative for both genes, which is consistent with findings from Doko et al. [18] and Oduyebo et al. [46]. This suggests that while carbapenem resistance is prevalent, not all resistant strains carry the tested carbapenemase genes, highlighting the presence of other resistance mechanisms or undetected genes. The absence of OXA-48 and NDM-1 in some isolates, as seen in Doko et al. [18], indicates that resistance might be mediated by other mechanisms or genes not covered in our study. Additionally, the lower detection of OXA-48 in our study compared to others might reflect differences in molecular techniques or the specific strains circulating in our region.

Beyond the borders of Nigeria, the 44% prevalence of the NDM-1 gene observed in this study was higher than the 17.6% reported in South India by Remya et al. [47] but lower than the 66% reported in Iran by Ghanbarinasab et al. [48]. These discrepancies could stem from differences in sample size or methodology. Conversely, the 18% prevalence of the OXA-48 gene found in this study was lower than the 55% reported in Croatia by Šuto et al. [49], the 66.7% in South India by Remya et al. [47], and the 52% and 100% in Egypt and Iran, respectively, reported by El-Domany et al. [50] and Ghanbarinasab et al. [48]. These variations may be due to differences in sample size, study population, or geographical location. Furthermore, both genes co-occurred in 8% of the isolates, unlike the 41.3% reported by Al-Zahrani et al. [27], possibly due to sample size differences.

ElFeky et al. [51] found a high dissemination of both NDM-1 and OXA-48 co-producing Enterobacterales in Egypt, indicating similar resistance patterns. These findings are consistent with our study, underscoring the predominance of these resistance mechanisms in the region. Studies in Bosnia and Herzegovina and India also reported similar resistance trends, highlighting the need for global surveillance and control measures [52–54]. Our observation of 100% meropenem resistance among all isolates reflects the broader challenge of multidrug resistance observed in various regions. This resistance rate is slightly higher than the 93.2% reported by Wang et al. [6] in China and significantly higher than the 29% reported by Šuto et al. [49] in Croatia. The lower resistance rates in these studies may be due to differences in the presence of resistance genes.

In this study, Klebsiella pneumoniae demonstrated high susceptibility to third- and fourth-generation cephalosporins: 76% to ceftazidime, 76% to ceftriaxone, and 64% to cefepime. These susceptibility rates are higher than those reported by Šuto et al. [49] in Croatia and Wang et al. [6] in China, where susceptibility rates were significantly lower. The discrepancies might be due to the presence of additional resistance genes in the isolates studied.

Aminoglycoside antibiotics showed high efficacy, with 82% and 86% susceptibility to gentamicin and amikacin, respectively. These rates were higher than those reported by An et al. [55] in Eastern China and Ghanbarinasab et al. [48] in Iran. The higher susceptibility rates in our study could be attributed to the absence of other resistance genes. Piperacillin-tazobactam showed 98% susceptibility, higher than the 80.27% reported by Remya et al. [47] in South India and the 7.5% reported by Wang et al. [6] in China. The high resistance reported by Hosseinzadeh et al. [56] in Iran and Alhazmi et al. [2] in Jeddah contrasts sharply with our findings. These differences could be due to variations in the presence of other resistance genes.

Our study demonstrated a 74% susceptibility rate to amoxicillin, significantly higher than the rates reported by Wang et al. [6] in China and Argente et al. [57] in Catalonia, who found much lower susceptibility rates. While the high sensitivity rate to amoxicillin observed in this study is unconventional, it highlights the potential for unique resistance profiles in specific bacterial populations. It is possible that the Klebsiella pneumoniae isolates in our study harbor genetic mutations or variations that could impact their typical resistance profiles. Such variations might include the loss or alteration of the genes encoding penicillinases or other resistance mechanisms, leading to unexpected susceptibility to amoxicillin. While Klebsiella pneumoniae is known to possess chromosomal SHV-type beta-lactamases, it is possible that some of the isolates in our study acquired plasmid-borne beta-lactamase genes. These plasmid-encoded beta-lactamases may contribute to resistance against beta-lactam antibiotics. However, the observed susceptibility to amoxicillin in a minority of the isolates could be due to other factors, such as variations in gene expression or the presence of alternative resistance mechanisms that do not completely inhibit the effectiveness of the antibiotic.

Klebsiella pneumoniae is a highly adaptable organism with significant genetic diversity. Mutations or deletions in the genes encoding the SHV-type beta-lactamases could lead to variations in resistance patterns. Such genetic variability among clinical isolates could explain the unexpected susceptibility to amoxicillin observed in our study. Whole-genome sequencing of these isolates could further elucidate these genetic differences. The phenotypic expression of antibiotic resistance can vary among different isolates, even within the same species. Environmental factors, selective pressures, and genetic background can influence the expression of resistance genes. This phenotypic heterogeneity could account for the observed variation in amoxicillin susceptibility. The ecological niche and evolutionary pressures faced by the clinical isolates may have led to differential expression of resistance mechanisms. In a clinical setting, the selective pressure exerted by the use of various antibiotics can shape the resistance profile of bacterial populations. The isolates we tested might have been exposed to selective pressures that favored the retention or loss of certain resistance traits, including those against amoxicillin [58–60].

Our study was conducted in a specific geographical region (Southwestern Nigeria) where local epidemiological factors might influence the resistance profiles of bacterial populations. These factors could include differences in antibiotic usage patterns, infection control practices, or the presence of unique bacterial strains. We also observed susceptibility to quinolones: 64% to ciprofloxacin and 70% to levofloxacin, significantly higher than the rates reported by Wang et al. [6] in China and Argente et al. [57] in Catalonia. Again, these differences could be attributed to regional variations in the prevalence of resistance genes or local healthcare practices.

The susceptibility rate to carbapenems in our study was 20%, slightly higher than the rate reported by El-Domany et al. [50] in Egypt, who found a 13% susceptibility rate. These rates underscore the challenge of treating infections caused by carbapenem-resistant Klebsiella pneumoniae. Interestingly, our study showed that 42% of the isolates were susceptible to colistin, a stark contrast to the 0% reported by Olowo-okere et al. [45] in Nigeria. This difference might be due to variations in local colistin usage patterns or resistance mechanisms.

The high isolation rate of CRKP from urine samples in our study (46%) was similar to the 52% reported by Rojas et al. [61] in the United States and consistent with the findings of Satlin et al. [62] and El-Sayed et al. [63]. However, studies in Poland [6] and South Africa [64] reported higher isolation rates from sputum and bloodstream infections, respectively. This variation underscores the need for regional surveillance and tailored interventions. Overall, this study highlights the alarming prevalence of carbapenem-resistant Klebsiella pneumoniae due to OXA-48 and NDM-1 genes, reflecting global trends. Carbapenemase genes are often located on integrons with other cassette genes, contributing to multidrug resistance (MDR). The widespread nature of these resistance genes underscores the urgent need for comprehensive surveillance, robust infection control practices, and international cooperation to mitigate the spread of these formidable pathogens [65–68].

In the context of One Health, the global interconnectedness of ecosystems plays a crucial role in the dissemination of antibiotic-resistant bacteria and their genetic elements. Resistant strains and their genes can be transported across ecosystems through water, air, and soil. Contaminated water sources in one region can carry resistant strains to distant areas. Wildlife, livestock, and pets can also spread resistant bacteria and genes across borders. Animals traveling between regions or countries can introduce new resistant strains into different ecosystems. Human activities through global travel and trade facilitate the movement of resistant bacteria. Patients traveling for medical treatment, as well as international shipping and trade, can spread resistant strains across continents [65, 69].

Furthermore, antibiotic use in agriculture can select for resistant strains, which then spread through food, waste, and environmental contamination. Cross-border healthcare activities, including patient transfers and international medical collaborations, can contribute to the spread of resistant bacteria and genes. These interconnected pathways highlight the importance of global surveillance and cooperative strategies to address antimicrobial resistance [69, 70]. Understanding these dynamics is crucial for developing effective interventions and control measures to combat the spread of carbapenem-resistant strains like those detected in our study.

Limitations of this study

The limitations of this study include: (1) A small number of clinical isolates were used for the study due to the high cost associated with molecular detection of the resistance genes of interest in this research setting. (2) The study was conducted over just two months. This short duration may not fully capture the variability in antibiotic resistance patterns over time. (3) While the study detected the presence of carbapenemase genes, it did not investigate their actual expression levels. Gene expression profiles could provide insights into the functional relevance of these genes in the resistance of Klebsiella pneumoniae strains to carbapenems, and (4) The study focused on two specific carbapenemase genes (OXA-48 and NDM-1). Other resistance genes that contribute to Klebsiella pneumoniae resistance were not explored due to the high cost of investigation.

Recommendations

Based on the limitations identified in the study, the following recommendations are proposed to address these shortcomings and enhance the robustness and applicability of future research: (1) Increase the sample size to obtain a more representative sample of clinical isolates, enabling more accurate estimation of the prevalence and distribution of OXA-48 and NDM-1 genes among Klebsiella pneumoniae strains. Larger sample sizes can enhance the statistical power of analyses and facilitate subgroup analyses by patient demographics, infection sites and antimicrobial resistance profiles. (2) Future studies with longer durations are necessary to provide a more robust and comprehensive analysis of resistance trends. (3) Conduct longitudinal studies to elucidate temporal trends in the prevalence and genetic diversity of Klebsiella pneumoniae strains, allowing for the assessment of changes in resistance gene expression over time and their association with clinical outcomes. Longitudinal data can provide valuable insights into the dynamics of Klebsiella pneumoniae infections and inform targeted intervention strategies. (4) Expand the scope of molecular analysis to include other antimicrobial resistance determinants and genetic markers associated with Klebsiella pneumoniae resistance. Whole-genome sequencing and functional genomics approaches can provide a comprehensive understanding of the genetic basis of Klebsiella pneumoniae antimicrobial resistance, guiding the development of novel therapeutics and diagnostics. (5) Implement population-based surveillance programs to monitor the prevalence and epidemiology of Klebsiella pneumoniae infections at the community level, facilitating early detection of outbreaks and identification of emerging antimicrobial resistance patterns. (6) Collaboration between healthcare institutions, public health agencies, and academic research centers can enhance data sharing and facilitate collaborative research efforts to combat Klebsiella pneumoniae infections effectively. By implementing these recommendations, future research endeavors can address the limitations identified in this study and advance our understanding of Klebsiella pneumoniae antimicrobial resistance and clinical management strategies, ultimately improving patient outcomes and public health outcomes.

Conclusion

In conclusion, Carbapenemase genes (OXA-48 and NDM-1) were present in varying degree (18% and 44% respectively) in the clinical isolates of Klebsiella pneumoniae recovered from various sites of infections of patients attending a private tertiary hospital in southwestern Nigeria. The detection of different carbapenemase genes of Klebsiella pneumoniae isolates suggests that they are associated with resistance accompanied by serious implications for patients and healthcare workers. The outcome of this study underscores the results of previous studies and contributes significantly to the understanding of resistance of Klebsiella pneumoniae, offering insights into gene distribution and the potential for targeted interventions in the clinical setting. The combination of molecular methods and clinical data provides a holistic view of Klebsiella pneumoniae infections in the studied population. The findings offer valuable insights into the diversity of gene distribution among specimen types and the potential of molecular techniques in Medical Microbiology. This study serves as a foundation for future research and underscores the importance of continued vigilance and proactive measures in managing Klebsiella pneumoniae infections in healthcare settings.

Author contributions

Study concept and design: CBO & SSE; Literature search: CBO, SSE, OAK, ACI, AAA, MUI, GEI, AOO, POA & MFK; Acquisition of data: CBO, SSE, OAK, ACI & AAA; Analysis and interpretation of data: CBO, SSE, MUI & GEI; Statistical analysis: CBO, SSE & OAK; Study supervision: SSE & OAK; Drafting of the manuscript: CBO, SSE, OAK, ACI, & AAA; Critical revision of the manuscript for important intellectual content: CBO, SSE, OAK % ACI; Final approval of the manuscript: CBO, SSE, OAK, ACI, AAA, MUI, GEI, AOO, POA & MFK.

Funding

None.

Data availability

No new data were generated. The primer sequences and optimization protocols utilized in this study for the detection of OXA-48 and NDM-1 genes in Klebsiella pneumoniae isolates were adapted from a previously published work available online at: https://doi.org/10.1016/j.diagmicrobio.2010.12.002.

Declarations

Ethical approval

Ethical approval for this study was granted by the Babcock University Health Research Ethics Committee (BUHREC) with ethical approval registration number: BUHREC 914/23. BUHREC is the Institutional Review Board (IRB) of the university.

Informed consent

Informed consent was obtained from each participant. The purpose and nature of the study, as well as the method of sample collection was explained to them properly. Afterwards, participants was requested to voluntarily complete the consent form in their own handwriting and endorsed by their signatures as proof of willingness to provide samples for the test. They were assured of the confidentiality.

Competing interests

The authors declare no competing interests.

Abbreviations

AST Antibiotic Susceptibility Test

BLAST Basic Local Alignment Search Tool

BUHREC Babcock University Health Research Ethics Committee

BUTH Babcock University Teaching Hospital

CLSI Clinical and Laboratory Standard Institute

CRE Carbapenem-resistant Enterobacteriaceae

CRKP Carbapenem-resistant Klebsiella pneumoniae

CSF Cerebrospinal Fluid

DNA Deoxyribonucleic Acid

EDTA Ethylenediaminetetraacetic Acid

ESBL Extended-spectrum beta-lactamase

GES Guiana extended-spectrum

IMP Imipenemasemetallo-β-lactamase

KPC Klebsiella pneumoniaecarbapenemase

NCBI National Center for Biotechnology Information

NDM New Delhi metallo-β-lactamase

OXA 48-Oxacillinase-48-type carbapenemases

PCR Polymerase Chain Reaction

TBE Tris-Boric EDTA

UV Ultraviolet

VIM Verona integron-encoded metallo-β-lactamase

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Yu W Luo Q Shen P Chen Y Xu H Xiao Y &Qiu Y New options for bloodstream infections caused by colistin- or ceftazidime/avibactam-resistant Klebsiella pneumoniae Int J Antimicrob Agents 2021 58 6 106458 10.1016/j.ijantimicag.2021.106458 34706255
Yu W, Luo Q, Shen P, Chen Y, Xu H, Xiao Y, &Qiu Y. New options for bloodstream infections caused by colistin- or ceftazidime/avibactam-resistant Klebsiella pneumoniae. Int J Antimicrob Agents. 2021;58(6):106458. 10.1016/j.ijantimicag.2021.106458.34706255 10.1016/j.ijantimicag.2021.106458
2. Alhazmi W, Al-Jabri A, Al-Zahrani I. The Molecular Characterization of Nosocomial Carbapenem-Resistant Klebsiella pneumoniae Co-Harboring bla NDM and bla OXA-48 in Jeddah. Microbiology Research. 2022;13(4):753 – 64. 10.3390/microbiolres13040054
3. Tzouvelekis LS, Markogiannakis A, Psichogiou M, Tassios PT, Daikos GL. Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimensions. ClinMicrobiol Rev. 2012;25(4):682–707. 10.1128/CMR.05035-11
4. Nordmann P. Carbapenemase-producing Enterobacteriaceae: overview of a major public health challenge. Medicine and Infectious Diseases. 2014;44(2):51–6. 10.1016/j.medmal.2013.11.007
5. Sharma R Garcia E Diep JK Lee VH Minhaj F Jermain B Ellis-Grosse EJ Abboud CS Rao GG Pharmacodynamic and immunomodulatory effects of polymyxin B in combination with fosfomycin against KPC-2-producing Klebsiella pneumoniae Int J Antimicrob Agents 2022 59 4 106566 10.1016/j.ijantimicag.2022.106566 35288260
Sharma R, Garcia E, Diep JK, Lee VH, Minhaj F, Jermain B, Ellis-Grosse EJ, Abboud CS, Rao GG. Pharmacodynamic and immunomodulatory effects of polymyxin B in combination with fosfomycin against KPC-2-producing Klebsiella pneumoniae. Int J Antimicrob Agents. 2022;59(4):106566. 10.1016/j.ijantimicag.2022.106566.35288260 10.1016/j.ijantimicag.2022.106566
6. Wang N, Zhan M, Liu J, Wang Y, Hou Y, Li C et al. Prevalence of carbapenem-resistant Klebsiella pneumoniae infection in a Northern province in China: Clinical characteristics, drug resistance and geographical distribution. Infect Drug Resist. 2022;15:569–579. 10.2147/IDR.S347343
7. Hu Y, Liu C, Shen Z, Zhou H, Cao J, Chen S et al. Prevalence, risk factors and molecular epidemiology of carbapenem-resistant Klebsiella pneumoniae in patients from Zhejiang, China, 2008–2018. Emerging Microbes and Infections. 2020;9(1):1771–9. 10.1080/22221751.2020.1799721
8. Mouktaroudi M Kotsaki A Giamarellos-Bourboulis EJ Meropenem-vaborbactam: a critical positioning for the management of infections by Carbapenem-resistant Enterobacteriaceae Expert Rev Anti-Infective Therapy 2022 20 6 809 18 10.1080/14787210.2022.2030219 35034551
Mouktaroudi M, Kotsaki A, Giamarellos-Bourboulis EJ. Meropenem-vaborbactam: a critical positioning for the management of infections by Carbapenem-resistant Enterobacteriaceae. Expert Rev Anti-Infective Therapy. 2022;20(6):809–18. 10.1080/14787210.2022.2030219.35034551 10.1080/14787210.2022.2030219
9. Fuster B, Tormo N, Salvador C, Gimeno C. Detection of two simultaneous outbreaks of Klebsiella pneumoniae coproducing OXA-48 and NDM-1 carbapenemases in a tertiary-care hospital in Valencia, Spain. New Microbes and New Infections. 2020;34:100660. 10.1016/j.nmni.2020.100660
10. Paul M Carrara E Retamar P Tängdén T Bitterman R Bonomo RA de Waele J Daikos GL Akova M Harbarth S Pulcini C Garnacho-Montero J Seme K Tumbarello M Lindemann PC Gandra S Yu Y Bassetti M Moutin JW Tacconelli E Rodriguez-Bano J European Society of Clinical Microbiology and Infectious diseases (ESCMID) guidelines for the treatment of infections caused by multidrug-resistant Gram-negative bacilli Clin Microbiol Infect 2022 28 4 521 47 10.1016/j.cmi.2021.11.025 34923128
Paul M, Carrara E, Retamar P, Tängdén T, Bitterman R, Bonomo RA, de Waele J, Daikos GL, Akova M, Harbarth S, Pulcini C, Garnacho-Montero J, Seme K, Tumbarello M, Lindemann PC, Gandra S, Yu Y, Bassetti M, Moutin JW, Tacconelli E, Rodriguez-Bano J. European Society of Clinical Microbiology and Infectious diseases (ESCMID) guidelines for the treatment of infections caused by multidrug-resistant Gram-negative bacilli. Clin Microbiol Infect. 2022;28(4):521–47. 10.1016/j.cmi.2021.11.025.34923128 10.1016/j.cmi.2021.11.025
11. Karlowsky JA Lob SH Khan A Chen WT Woo PCY Seto WH Ip M Leung S Wong QWL Chau RWY DeRyke AC Young K Motyl MR Sahm DF Activity of ceftolozane/tazobactam against Gram-negative isolates among different infections in Hong Kong: SMART 2017–2019 J Med Microbiol 2022 71 4 1487 10.1099/jmm.0.001487
Karlowsky JA, Lob SH, Khan A, Chen WT, Woo PCY, Seto WH, Ip M, Leung S, Wong QWL, Chau RWY, DeRyke AC, Young K, Motyl MR, Sahm DF. Activity of ceftolozane/tazobactam against Gram-negative isolates among different infections in Hong Kong: SMART 2017–2019. J Med Microbiol. 2022;71(4):1487. Available from:.10.1099/jmm.0.001487
12. Gaibani P, Lombardo D, Bussini L, Bovo F, Munari B, Giannella M et al. Epidemiology of Meropenem/Vaborbactam Resistance in KPC-Producing Klebsiella pneumoniae Causing Bloodstream Infections in Northern Italy, 2018. Antibiotics, 2021; 10(5), 536. 10.3390/antibiotics10050536
13. Umair M Walsh TR Mohsin M A systematic review and meta-analysis of carbapenem resistance and its possible treatment options with focus on clinical Enterobacteriaceae: thirty years of development in Pakistan Heliyon 2024 10 7 e28052 10.1016/j.heliyon.2024.e28052 38596009
Umair M, Walsh TR, Mohsin M. A systematic review and meta-analysis of carbapenem resistance and its possible treatment options with focus on clinical Enterobacteriaceae: thirty years of development in Pakistan. Heliyon. 2024;10(7):e28052. 10.1016/j.heliyon.2024.e28052.38596009 10.1016/j.heliyon.2024.e28052
14. Queenan AM Bush K Carbapenemases: the versatile beta-lactamases Clin Microbiol Rev 2007 20 3 440 58 10.1128/CMR.00001-07 17630334
Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007;20(3):440–58. 10.1128/CMR.00001-07.17630334 10.1128/CMR.00001-07
15. Pitout JD, Nordmann P, Poirel L. Carbapenemase-producing Klebsiella pneumoniae, a key pathogen set for global nosocomial dominance. Antimicrob Agents Chemother. 2015;59(1):5873–5884. 10.1128/AAC.01019-15
16. Barguigua A, Zerouali K, Katfy K, El Otmani F, Timinouni M, Elmdaghri N. Occurrence of OXA-48 and DM-1 carbapenemase-producing Klebsiella pneumoniae in a Moroccan university hospital in Casablanca, Morocco. Infection, Genetics and Evolution. 2015;31:142-8. 10.1016/j.meegid.2015.01.010
17. Solgi H, Badmasti F, Giske CG, Aghamohammad S, Shahcheraghi F. Molecular epidemiology of NDM-1-and OXA-48-producing Klebsiella pneumoniae in an Iranian hospital: clonal dissemination of ST11 and ST893. Journal of Antimicrobial Chemotherapy. 2018;73(6):1517-24. 10.1093/jac/dky081
18. Bush K, Bradford PA. Interplay between β-lactamases and new β-lactamase inhibitors. Nature Reviews Microbiology, 2019; 17(5), 295–306. 10.1038/s41579-019-0159-8
19. Al-Zahrani IA, Aljabri A, Alhazmi WA, Yasir M, Abujamel T, Alghamdi AK, Azhar EI. Genomic analysis of extensively drug resistant (XDR) Klebsiella pneumoniae high-risk clone ST14 co-harboring blaNDM and blaOXA-48 recovered from Saudi Arabia. Journal of Infection and Public Health. 2024;17(4):669 – 75. 10.1016/j.jiph.2024.02.011
20. Bougouizi A, Chekroud Z, Rahab H, Boumegoura A, Touati A. Prevalence and characterization of Carbapenem-Resistant Enterobacterales among inpatients and outpatients in Skikda, Algeria. The Journal of Infection in Developing Countries. 2024;18(03):383–390. 10.3855/jidc.18263
21. Takei S, Tabe Y, Miida T, Hishinuma T, Khasawneh A, Kirikae T, Sherchand JB, Tada T. Multidrug-resistant Klebsiella pneumoniae clinical isolates producing NDM-and OXA-type carbapenemase in Nepal. Journal of Global Antimicrobial Resistance. 2024; 37, 233–243. 10.1016/j.jgar.2024.04.008
22. Moghadampour M, Rezaei A, Faghri J. The emergence of bla OXA-48 and bla NDM among ESBL-producing Klebsiella pneumoniae in clinical isolates of a tertiary hospital in Iran. ActaMicrobiologicaetImmunologicaHungarica. 2018;65(3):335 – 44. 10.1556/030.65.2018.034
23. Nagaraj G, Shamanna V, Govindan V, Rose S, Sravani D, Akshata KP et al. High-resolution genomic profiling of carbapenem-resistant Klebsiella pneumoniae isolates: a multicentric retrospective indian study. Clin Infect Dis. 2021;73(4):300–7. 10.1093/cid/ciab767
24. El Naggar NM, Shawky RM, Serry FM, Emara M. The Increased Prevalence of rmpA Gene in Klebsiella pneumoniae Isolates Coharboringbla NDM and bla OXA-48-like Genes. Microbial Drug Resistance. 2024 May 21. 10.1089/mdr.2023.0296
25. Abbasi E, Ghaznavi-Rad E. High frequency of NDM-1 and OXA-48 carbapenemase genes among Klebsiella pneumoniae isolates in central Iran. BMC microbiology. 2023;23(1):98. 10.1186/s12866-023-02840-x
26. Bošnjak Z, Hasman H, Hansen F, Hammerum AM, Roer L, Jurić I, Budimir A. Co-occurrence of triple carbapenemase genes, bla VIM-2, bla NDM-1, and bla OXA-48 in Enterobacter hormaechei clinical isolates–first report from Croatia. Journal of Chemotherapy. 2024 May 9:1–5. 10.1080/1120009X.2024.2354107
27. Veeraraghavan B, Shankar C, Karunasree S, Kumari S, Ravi R, Ralph R. Carbapenem-resistant Klebsiella pneumoniae isolated from bloodstream infection: Indian experience. Pathog Glob Health. 2017;111(5):240–246. 10.1080/20477724.2017.1340128
28. Doi Y, O’Hara JA, Lando JF, Querry AM, Townsend BM, Pasculle AW et al. Co-production of NDM-1 and OXA-232 by Klebsiella pneumoniae. Emerging Infectious Diseases. 2014;20(1):163–5. 10.3201/eid2001.130904
29. Kumarasamy K, Kalyanasundaram A. Emergence of Klebsiella pneumoniaeisolate co-producing NDM-1 with KPC-2 from India. Journal of Antimicrobial Chemotherapy. 2012;67(1):243–4. 10.1093/jac/dkr431
30. Pourakbari B, Mamishi S, Poormohammadi S et al. High prevalence of carbapenem resistance and clonal expansion of blaNDM gene in Klebsiella pneumoniae isolates in an Iranian referral pediatric hospital. Gut Pathog 16, 17 (2024). 10.1186/s13099-024-00611-1
31. Cuzon G, Ouanich J, Gondret R, Naas T, Nordmann P. Outbreak of OXA-48-positive carbapenem-resistant Klebsiella pneumoniae isolates in France. Antimicrobial Agents and Chemotherapy. 2011;55(5):2420–3. 10.1128/AAC.01452-10
32. Barwa R, Shaaban M. Molecular characterization of Klebsiella pneumoniae clinical isolates with elevated resistance to carbapenems. The open microbiology journal. 2017;11:152. 10.2174/1874285801711010152
33. Nkup J Joseph S Agabi Y David V Hashimu Z Madubulum CC David A Otobo U Goyil G Cirfat N Anejo-Okopi JA Molecular detection of carbapenem resistant Klebsiella pneumoniae isolated from clinical specimens in Jos, Nigeria Microbes Infect Dis 2023 4 2 555 62 10.21608/MID.2022.145897.1329
Nkup J, Joseph S, Agabi Y, David V, Hashimu Z, Madubulum CC, David A, Otobo U, Goyil G, Cirfat N, Anejo-Okopi JA. Molecular detection of carbapenem resistant Klebsiella pneumoniae isolated from clinical specimens in Jos, Nigeria. Microbes Infect Dis. 2023;4(2):555–62. 10.21608/MID.2022.145897.1329.10.21608/MID.2022.145897.1329
34. Maduakor UC Eleazar CI Mba CG Obodochukwu CC Eberechukwu CL Ogu CO Metallo-Beta-Lactamase Producing isolates of Escherichia coli and Klebsiella pneumoniae and their resistance profiles in Enugu, Nigeria: a threat to Public Health J Adv Microbiol 2024 24 2 11 9 10.9734/jamb/2024/v24i2791
Maduakor UC, Eleazar CI, Mba CG, Obodochukwu CC, Eberechukwu CL, Ogu CO. Metallo-Beta-Lactamase Producing isolates of Escherichia coli and Klebsiella pneumoniae and their resistance profiles in Enugu, Nigeria: a threat to Public Health. J Adv Microbiol. 2024;24(2):11–9. 10.9734/jamb/2024/v24i2791.10.9734/jamb/2024/v24i2791
35. Doko HI Enejiyon SO Wuna MM Adedeji SA Sa’adu M Fasasi RA Adabara NU Molecular characterization OfCarbapenem resistant Klebsiella Pneumoniae from Wound surfaces of patients attending General Hospital Minna, Nigeria Fudma J Sci 2024 8 3 233 41 10.33003/fjs-2024-0803-2494
Doko HI, Enejiyon SO, Wuna MM, Adedeji SA, Sa’adu M, Fasasi RA, Adabara NU. Molecular characterization OfCarbapenem resistant Klebsiella Pneumoniae from Wound surfaces of patients attending General Hospital Minna, Nigeria. Fudma J Sci. 2024;8(3):233–41. 10.33003/fjs-2024-0803-2494.10.33003/fjs-2024-0803-2494
36. Olalekan A Onwugamba F Iwalokun B Mellmann A Becker K Schaumburg F High proportion of carbapenemase-producing Escherichia coli and Klebsiella pneumoniae among extended-spectrum β-lactamase-producers in Nigerian hospitals J Global Antimicrob Resist 2020 21 8 12 10.1016/j.jgar.2019.09.007
Olalekan A, Onwugamba F, Iwalokun B, Mellmann A, Becker K, Schaumburg F. High proportion of carbapenemase-producing Escherichia coli and Klebsiella pneumoniae among extended-spectrum β-lactamase-producers in Nigerian hospitals. J Global Antimicrob Resist. 2020;21:8–12. 10.1016/j.jgar.2019.09.007.10.1016/j.jgar.2019.09.007
37. Akinyemi KO Abegunrin RO Iwalokun BA Fakorede CO Makarewicz O Neubauer H Pletz MW Wareth G The emergence of Klebsiella pneumoniae with reduced susceptibility against Third Generation cephalosporins and carbapenems in Lagos hospitals, Nigeria Antibiotics 2021 10 2 142 10.3390/antibiotics10020142 33535654
Akinyemi KO, Abegunrin RO, Iwalokun BA, Fakorede CO, Makarewicz O, Neubauer H, Pletz MW, Wareth G. The emergence of Klebsiella pneumoniae with reduced susceptibility against Third Generation cephalosporins and carbapenems in Lagos hospitals, Nigeria. Antibiotics. 2021;10(2):142. 10.3390/antibiotics10020142.33535654 10.3390/antibiotics10020142
38. Ekpunobi NF, Mgbedo UG, Okoye LC, Agu KC. Prevalence of Esbl Genes in Klebsiella pneumoniae from Individuals with Community Acquired Urinary Tract Infections in Lagos State, Nigeria. Preprints 2024, 10.20944/preprints202403.1702.v1
39. Akinola O, Dahunsi O. Whole Genome Sequencing Revealing Antibiotics Resistance Pattern and Virulence Factors in KlebsiellaQuasipneumoniae Subsp. Similipneumoniae From Hospital Wastewater in South-West Nigeria. SimilipneumoniaeFrom Hospital Wastewater in South-West Nigeria. 10.2139/ssrn.4760762
40. Ibrahim Y Sani Y Saleh Q Saleh A Hakeem G Phenotypic detection of extended spectrum beta lactamase and carbapenemase co-producing clinical isolates from two tertiary hospitals in Kano, North West Nigeria Ethiop J Health Sci 2017 27 1 3 10 10.4314/ejhs.v27i1.2 28458485
Ibrahim Y, Sani Y, Saleh Q, Saleh A, Hakeem G. Phenotypic detection of extended spectrum beta lactamase and carbapenemase co-producing clinical isolates from two tertiary hospitals in Kano, North West Nigeria. Ethiop J Health Sci. 2017;27(1):3–10. 10.4314/ejhs.v27i1.2.28458485 10.4314/ejhs.v27i1.2
41. Muhammad BA Survey for Carbapenem resistant Klebsiella Pneumoniae among patients attending Aminu Kano Teaching Hospital, Kano, Nigeria UMYU J Microbiol Res (UJMR) 2023 8 2 181 9 10.47430/ujmr.2382.021
Muhammad BA. Survey for Carbapenem resistant Klebsiella Pneumoniae among patients attending Aminu Kano Teaching Hospital, Kano, Nigeria. UMYU J Microbiol Res (UJMR). 2023;8(2):181–9. 10.47430/ujmr.2382.021.10.47430/ujmr.2382.021
42. Irekeola AA, Shueb RH, Abd Rahman EN, Afolabi HA, Wada Y, Elmi AH, Hakami MA, Alghzwani SM, Elnoubi OA, Alshehri AA. High prevalence of Carbapenem-resistant Enterobacterales (CRE) in human samples from Nigeria: a systematic review and Meta-analysis. Heliyon 2024 Jul 20. 10.1016/j.heliyon.2024.e34926
43. Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes.Diagnostic microbiology and infectious disease. 2011;70(1):119–23. Available online at: 10.1016/j.diagmicrobio.2010.12.002
44. Odewale G Jibola-Shittu MY Ojurongbe O Olowe RA Olowe OA Genotypic determination of Extended Spectrum β-Lactamases and carbapenemase production in clinical isolates of Klebsiella pneumoniae in Southwest Nigeria Infect Disease Rep 2023 15 3 339 53 10.3390/idr15030034 37367193
Odewale G, Jibola-Shittu MY, Ojurongbe O, Olowe RA, Olowe OA. Genotypic determination of Extended Spectrum β-Lactamases and carbapenemase production in clinical isolates of Klebsiella pneumoniae in Southwest Nigeria. Infect Disease Rep. 2023;15(3):339–53. 10.3390/idr15030034.37367193 10.3390/idr15030034
45. Olowo-okere A Ibrahim YK Olayinka BO Ehinmidu JO Mohammed Y Nabti LZ Rolain JM Diene SM Phenotypic and genotypic characterization of clinical carbapenem-resistant Enterobacteriaceae isolates from Sokoto, northwest Nigeria New Microbes New Infections 2020 37 100727 10.1016/j.nmni.2020.100727 32939286
Olowo-okere A, Ibrahim YK, Olayinka BO, Ehinmidu JO, Mohammed Y, Nabti LZ, Rolain JM, Diene SM. Phenotypic and genotypic characterization of clinical carbapenem-resistant Enterobacteriaceae isolates from Sokoto, northwest Nigeria. New Microbes New Infections. 2020;37:100727. 10.1016/j.nmni.2020.100727.32939286 10.1016/j.nmni.2020.100727
46. Oduyebo OO, Falayi OM. 1,; Oshun, P; Ettu, A O. 2015. 10.4103/1117-1936.173973
47. Remya P, Shanthi M, Sekar U. Prevalence and clonal relatedness of NDM and OXA-48-producing Klebsiella pneumoniae in a tertiary care hospital in South India. J Lab Physicians. 2019;11(4):312–316. 10.4103/JLP.JLP_111_19
48. Ghanbarinasab F, Haeili M, Ghanati SN, Moghimi M. High prevalence of OXA-48-like and NDM-1 carbapenemases among carbapenem-resistant Klebsiella pneumoniae of clinical origin from Iran. Iranian Journal of Microbiology. 2023;15(5):609–15. 10.18502/ijm.v15i5.13866
49. Šuto S, Bedenic B, Likic S. Diffusion of OXA-48 carbapenemase among urinary isolates of Klebsiella pneumoniae in non-hospitalized elderly patients. BMC Microbiol. 2022;22(30). 10.1186/s12866-022-02443-y
50. El-Domany RA, El-Banna T, Sonbol F, Abu-Sayedahmed SH. Co-existence of NDM-1 and OXA-48 genes in Carbapenem Resistant Klebsiella pneumoniae clinical isolates in Kafrelsheikh, Egypt. African health sciences. 2021;21(2):489 – 96. 10.4314/ahs.v21i2.2
51. ElFeky DS, Awad AR, Mowafy HL, Baddour MM, Hamed RM. Dissemination of NDM-1 and OXA-48 co-producing carbapenem-resistant Enterobacterales at two tertiary hospitals in Egypt. Egyptian Journal of Medical Microbiology. 2024;33(2):163 – 74. 10.21608/ejmm.2024.288181.1247
52. Ljubović AD, Granov Đ, Zahirović E, Čamdžić A, Muhić A, Bešić IS. Predominance of OXA-48 carbapenemase-producing Klebsiella pneumoniae strains in tertiary hospital in Sarajevo, Bosnia and Herzegovina. Biomolecules and Biomedicine. 2024 May 2. 10.17305/bb.2024.10406
53. Srivastava D, Bajpai S, Singh S, Singh MR. Molecular Characterization of Blaoxa-48 And Blandm-1 Resistant Genes In Carbapenem Resistance Klebsiella pneumoniae Clinical Isolates: A Cross Sectional Study. Biochemical & Cellular Archives. 2024;24(1). 10.51470/BCA.2024.24.1.107
54. TaşkınKafa AH, Aslan R, DurnaDaştan S, Çeli̇k C, Hasbek M, Emi̇noğlu A. Molecular diversity of Klebsiella pneumoniae clinical isolates: antimicrobial resistance, virulence, and biofilm formation. Nucleosides, Nucleotides & Nucleic Acids. 2024 Apr 19:1–7. 10.1080/15257770.2024.2344741
55. An X, Xie W, Zheng X, Zhao L, Wu Y, Qu Y. Detection and analysis of carbapenem-resistant Klebsiella pneumoniae resistance genes in five hospitals in Qingdao City. Chinese. 2020;32(2):145–9. 10.3760/cma.j.cn121430-20200110-00027
56. Hosseinzadeh Z, Ebrahim-Saraie HS, Sarvari J, Mardaneh J, Dehghani B, Rokni-Hosseini SM, Motamedifar M. Emerge of bla NDM-1 and bla OXA-48-like harboring carbapenem-resistant Klebsiella pneumoniae isolates from hospitalized patients in southwestern Iran. Journal of the Chinese Medical Association. 2018;81(6):536 – 40. 10.1016/j.jcma.2017.08.015
57. Argente M, Miró E, Martí C, Vilamala A, Alonso-Tarrés C, Ballester F et al. Molecular characterization of OXA-48 carbapenemase-producing Klebsiella pneumoniae strains after a carbapenem resistance increase in Catalonia. EnfermedadesInfecciosasMicrobiologíaClínica. 2019;37(2):82–8. 10.1016/j.eimc.2018.02.003
58. Nordmann P, Dortet L, Poirel L. Carbapenem resistance in Enterobacteriaceae: Here is the storm! Trends in Molecular Medicine. 2012;18(5):263–72. 10.1016/j.molmed.2012.03.003
59. Nordmann P, Poirel L, Dortet L. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2012;18(9):1503–7. 10.3201/eid1809.120355
60. Karaman E, Çiçek AÇ, Şemen V, ŞabanBeriş F. Characterization of resistance genes and replicon typing in Carbapenem-resistant Klebsiella pneumoniae strains. Annals of Clinical Microbiology and antimicrobials. 2024;23(1):19. 10.1186/s12941-024-00672-9
61. Rojas LJ, Salim M, Cober E, Richter SS, Perez F, Salata RA et al. Colistin resistance in carbapenem-resistant Klebsiella pneumoniae: laboratory detection and impact on mortality. Clin Infect Dis. 2017;64(6):711–8. 10.1093/cid/ciw805
62. Satlin MJ, Kubin CJ, Blumenthal JS, Cohen AB, Furuya EY, Wilson SJ et al. Comparative effectiveness of aminoglycosides, polymyxin B, and tigecycline for clearance of carbapenem-resistant Klebsiella pneumoniae from urine. Antimicrob Agents Chemother. 2011;55(12):5893–9. 10.1128/AAC.00387-11
63. El-Sayed AK, Abou-Dobara MI, Saleh HH, Ahmad YF. Detection of blaOXA-48 gene in carbapenem-resistant Klebsiella pneumoniae and Escherichia coli from urine samples. Scientific Journal for Damietta Faculty of Science. 2024;14(1):119 – 28. 10.21608/SJDFS.2024.270443.1160
64. Malinga NZZ, Shobo CO, Molechan C, Amoako DG, Zishiri OT, Bester LA. Molecular surveillance and dissemination of Klebsiella pneumoniae on frequently encountered surfaces in South African Public Hospitals. Microbial Drug Resistance. 2021;28(3). 10.1089/mdr.2020.0546
65. Durmuş MA, Aydin MD. Detection of Carbapenem Resistance Using the Genotypic and Phenotypic Methods in Klebsiella pneumoniae. Duzce Medical Journal. 2024;26(1):15–20. 10.18678/dtfd.1383748
66. Mawla NN, Nessa M, Nandi P, Rahman MM, Faruk BS. Molecular Detection of Carbapenemase Genes among Carbapenem Resistant Gram-Negative Bacilli in Tertiary Care Hospital, Bangladesh. 10.21275/SR24502173236
67. Addis E, Unali I, Bertoncelli A, Ventura A, Cecchetto R, Mazzariol A. Different OXA-Carbapenemases in Genetically Unrelated Klebsiella pneumoniae Strains Isolated in a North Italian Hospital During Multidrug Resistance Screening. Microbial Drug Resistance. 2024 Jan 2. 10.1089/mdr.2023.0134
68. El Naggar NM, Shawky RM, Serry FME et al. Investigating the relationship between carbapenemase production and biofilm formation in Klebsiella pneumoniae clinical isolates. BMC Res Notes 17, 49 (2024). 10.1186/s13104-024-06708-9
69. Diallo OO, Baron SA, Abat C, Colson P, Chaudet H, Rolain JM. Antibiotic resistance surveillance systems: a review. Journal of Global Antimicrobial Resistance. 2020;23:430–8. 10.1016/j.jgar.2020.10.009
70. Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis. 2018;18(3):318–27. 10.1016/S1473-3099(17)30753-3
