
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00768-5
10.1016/j.psj.2024.104189
104189
IMMUNOLOGY, HEALTH AND DISEASE
Effects of Hypericum attenuatum Choisy extract on the immunologic function and intestinal microflora of broilers under oxidative stress
Song Rui *†‡
Jiang Yanzhen *†
Zhang Bo *†
Jiao Zimeng *†
Yang Xing *†
Zhang Nanyi zhangny282@nenu.edu.cn
*†1
⁎ College of Forestry and Grassland Science, Jilin Agricultural University, Changchun 130118, China
† Jilin Provincial Key Laboratory of Tree and Grass Genetics and Breeding, Jilin Agricultural University, Changchun 130118, China
‡ Agricultural Technology Extension Center, Shuyang County Agriculture and Rural Affairs Bureau, Shuyang 223600, China
1 Corresponding author zhangny282@nenu.edu.cn
08 8 2024
11 2024
08 8 2024
103 11 10418914 5 2024
3 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
This study investigated the impact of Hypericum attenuatum Choisy extract (HYG) on immunological function and the cecum microflora in broilers. A total of 240 one-day-old AA broilers were randomly divided into 5 groups with 6 replicates of 8 broilers each: 1) the CN group, in which broilers were injected with saline and fed a basal diet; 2) the PC group, in which broilers were injected with lipolyaccharide (LPS) and fed a basal diet; 3) the HYG1 group, in which broilers were injected with LPS and fed a 400 mg/kg HYG-supplemented diet; 4) the HYG2 group, in which broilers were injected with LPS and fed a 800 mg/kg HYG-supplemented diet; 5) the HYG3 group, in which broilers were injected with LPS and fed a 1,200 mg/kg HYG-supplemented diet. Broilers were injected with 1 mg/kg LPS or the same amount saline 12 hours before sampling on d 21 and 42. The results revealed that dietary 400 mg/kg HYG supplementation alleviated spleen index and thymus index abnormalities, balanced the disturbance of serum immunoglobulin (Ig)M and IgA levels, and regulated the cytokine balance in the serum, liver, spleen and jejunum tissues included induced by LPS. Dietary supplementation with 400 mg/kg HYG also downregulated the relative expression of the inhibitor of kappa B kinase alpha (IKKα) and interleukin (IL)-6 mRNAs in the liver and upregulated the relative expression of the inhibitor kappa B alpha (IκBα) and IL-10 mRNAs in the spleen. Dietary HYG improved the cecal microflora balance at 42 d by increasing the relative abundance of beneficial bacteria, such as Alistipes and Phascolarctobacterium, while reducing the relative abundance of harmful bacteria, such as Helicobacter and Colidextribacter. Spearman correlation analysis revealed a negative correlation between activation of the NF-κB inhibitory pathway in the liver and the presence of Phascolarctobacterium, Erysipelatoclostridium, Subdoligranulum and Parabacteroides. Conclusions: The incorporation of 400 mg/kg HYG into the diet was optimal in improving broiler immunological function.

Key words

Hypericum attenuatum Choisy
extract
immunologic function
intestinal microflora
broiler
==== Body
pmcINTRODUCTION

Excellent immune performance is fundamental for achieving optimal production performance in broilers. The current large-scale and intensive development of the broiler industry, along with the transformation and upgrading of industrial intelligence, has yielded substantial economic benefits while also generating new challenges to the immune performance of chickens. Antibiotic abuse has led to the generation of antibiotic resistance genes (Mehdi et al., 2018; El-Saadony et al., 2023); this resistance, along with the oxidative stress and immunosuppression in broilers caused by unsanitary feeding conditions, have become new threats to the immune performance of chickens (Antonissen et al., 2017; Jahromi et al., 2017; Liao et al., 2019; Xie et al., 2022). In addition to providing a hygienic breeding environment, a scientific breeding management system and safe feed, attention should also be given to "dietary therapy" methods that enhance immune function. Subtherapeutic doses of antibiotics added to feed can promote the growth of broilers in dense conditions, protect poultry health and prevent diseases by improving the immune status of broilers and controlling the modification of the intestinal microflora (Mehdi et al., 2018). However, antibiotics also lead to the emergence of bacterial resistance, environmental pollution, and antibiotic residues in animal products that are harmful to human health. Currently, China, the European Union, the United States, South Korea and other countries have banned the use of antibiotic growth promoters in animal production (Wang et al., 2024a). For the safest and high-quality poultry products, it is necessary to develop efficient and sustainable feed additives. Plant extracts have the advantages of natural reliability, low toxicity, diverse benefits, easy degradation and abundant sources. Numerous studies have demonstrated their role within the poultry industry, including promoting animal growth and development, regulating nutrient metabolism, participating in immune regulation, enhancing anti-inflammatory and antioxidant capacity, regulating the intestinal microflora and other biological functions (Shams Shargh et al., 2012; Islam et al., 2023; Kumari et al., 2023; Qin et al., 2023a; Xing et al., 2023). The use of plant extracts has gradually emerged as a prominent area in the field of alternative antibiotic research.

Plant extracts, which are naturally derived and contain diverse chemical compounds, often exert various effects on poultry. Research has demonstrated that the injection of hatching eggs with a grape pomace extract rich in total phenols, flavonoids, and anthocyanins can enhance the growth performance of hatched chicks, increase their total antioxidant capacity, and increase their levels of IgM and IgG, which improve their immune function and antioxidant state (Madkour et al., 2024). The addition of 450 mg/kg willow leaf extract rich in total phenols to the diet not only significantly improved the body weight gain, feed conversion ratio and carcass characteristics of broiler chickens but also enhanced their antioxidant performance while inhibiting infection by Staphylococcus aureus and other bacteria in the blind intestinal tract (Farag et al., 2024). Furthermore, the inclusion of 400 mg/kg Neolamarckia cadamba leaf extract (with total flavonoids, total phenols, water-soluble tannins, and condensed tannins at 585.0 g/kg, 73.0 g/kg, 70.8 g/kg, and 61.8 g/kg, respectively) in the diet not only upregulated gene expression in the p38 MAPK/Nrf2/ARE signaling pathway and increased antioxidant enzyme activity but also modulated amino acid metabolism leading to improved meat quality (Wang et al., 2024b). Hypericum attenuatum Choisy, a perennial herb in the genus Hypericum L, is utilized as a traditional Chinese herbal medicine. With advancements in pharmacology and clinical medicine, various compounds such as flavonoids, phloroglucinols, volatile oils, and phenolic compounds have been isolated and identified from Hypericum attenuatum Choisy; these compounds exhibit a wide range of biological activities (Jin et al., 2023). Current studies have demonstrated that Hypericum attenuatum Choisy extract has potential therapeutic effects on diabetes by improving glycolipid metabolism, regulating the intestinal microflora, and modulating biological pathways (Jin et al., 2019a; Lv et al., 2019). Moreover, a study revealed that Hypericum attenuatum Choisy extract can inhibit the MAPK/NF-κB pathway and exhibit anti-inflammatory effects in mice, suggesting its potential application in the treatment of ulcerative colitis (Jin et al., 2019b). Additionally, the flavonoids in Hypericum attenuatum Choisy play crucial roles in alleviating cardiac arrhythmias, inhibiting apoptosis, modulating macrophage phagocytic activity, and protecting immune organs (Lin et al., 2009; Ma et al., 2014; Yang et al., 2020; Tan et al., 2023). However, the impact of Hypericum attenuatum Choisy extract (HYG) on broiler immune function remains unexplored. Therefore, the purpose of this study was to investigate the effects of HYG on the immune performance of the liver, spleen, jejunum, and intestinal microfloras under lipolyaccharide (LPS)-induced oxidative stress in broilers. Furthermore, this study provides a theoretical basis for the exploitation and utilization of Hypericum attenuatum Choisy resources in poultry production.

MATERIALS AND METHODS

Plant Material

The plant material used was triennial Hypericum attenuatum Choisy cultivated in the pratacultural science experimental plot of Jilin Agricultural University (N 43° 810433′, E 125° 410385′). A voucher specimen (IBSC 0231261) was saved at the South China Botanical Garden Herbarium. Verification of Hypericum attenuatum Choisy was conducted by consulting the data on the website http://www.worldfloraonline.org.

Extract Preparation and Chemical Component Analysis

HYG was prepared according to the method described by Jin et al. (2019a). The extract was subsequently freeze-dried to obtain a powdered form, and the extraction rate of HYG was 12.71%. Chemical component analysis revealed that HYG primarily consisted of 23.45% total phenols, 6.74% total flavonoids, 19.90% total sugars, 13.31% water and 0.43% total protein. Flavonoid-targeted metabolomics analysis of HYG revealed a total of 95 types of flavonoids present in HYG, including but not limited to 29 types of flavones; 19 types of flavonols; 10 types each of flavanones and chalcones; 8 types of flavanonols; 6 types of isoflavanones; 3 types of flavanols; 2 types each of xanthones, flavone glycosides and phenonic acids; and 1 type each of flavonols, biflavonoids and flavanones, (Table S1). Among these compounds, the seven flavonoids with the highest concentrations of HYG were hyperoside (8805.50 nmol/g), quercetin (4494.17 nmol/g), (-)-epicatechin (2235.45 nmol/g), mangiferin (1845.57 nmol/g), quercitrin (1824.72) nmol/g), isomangiferin (1185.06 nmol/g), and farrerol (1086.20 nmol/g). High-performance liquid chromatography (HPLC) analysis confirmed these findings (Figure 1). The chromatographic conditions were as follows: mobile phase A was acetonitrile, and mobile phase B was a 0.2% phosphoric acid solution. The detection wavelength was 270 nm, the column temperature was 35°C, the flow rate was 0.8mL /min, and the sample size was 20 μL. In gradient elution, phase A (15%) and phase B (85%) were obtained from 0 to 10 min; phase A (20%) and phase B (80%) were obtained from 10 to 30 min; phase A (25%) and phase B (75%) were obtained from 30 to 45 min; phase A (27%) and phase B (73%) were obtained from 45 to 60 min; phase A (15%) and phase B (85%) were obtained from 60 to 80 min.Figure 1 HLPC peak pattern of HYG.

Figure 1

Animals and Management

The study strictly adhered to the Guide for the Care and Use of Laboratory Animals (United States Department of Human Health and Services, National Institutes of Health, Publication Number ISBN 0-309-05377-3, 1996). All experimental procedures were approved by the Animal Ethics Committee of Jilin Agricultural University. A total of 240 one-day-old AA white broilers with an average body weight of 45.44 g (purchased from Jilin Deda Co., Ltd.) were randomly divided into 5 groups with 6 replicates of 8 broilers each. The control group (CN) and LPS stress model group (PC) were fed a basal diet, whereas experimental group 1 (HYG1) was fed a basal diet supplemented with 400 mg/kg HYG, experimental group 2 (HYG2) was fed a basal diet supplemented with 800 mg/kg HYG, and experimental group 3 (HYG3) was fed a basal diet supplemented with 1,200 mg/kg HYG. Samples were collected at 21 d and 42 d. Twelve hours before sampling, the HYG1 group, the HYG2 group, the HYG3 group and the PC group were injected intraperitoneally with 5 mL/kg LPS (LPS solution was prepared with normal saline at a concentration of 200 μg/mL), and the CN group was injected with an equal amount of normal saline. The basal diet used in this experiment was purchased from Jilin Xinfangyuan Animal Husbandry Technology Co., Ltd., and was formulated according to the NRC standard and the "Chicken Feeding Standard: NY/T33-2004″ issued by the Ministry of Agriculture of China. The dietary formulations and nutrient levels are shown in Table 1.Table 1 Dietary Composition and nutrient level (air-dried basis).

Table 1Items	1–21 d	22–42 d	
Ingredients(%)			
Corn	61.00%	64.00%	
Wheat bran	2.50%	3.00%	
Soybean meal	28.50%	25.00%	
Soybean oil	2.00%	3.00%	
Fish meal	2.50%	1.60%	
Salt	0.30%	0.30%	
Stone powder	1.30%	1.20%	
Calcium hydrogen phosphate	1.28%	1.28%	
DL-methionine	0.12%	0.12%	
Vitamin - trace element premix1	0.50%	0.50%	
Total	100.00%	100.00%	
Nutrient level2 Metabolizable energy /(MJ/kg)	12.33%	12.67%	
Crude protein	20.38%	18.63%	
Calcium	1.05%	0.92%	
Available phosphorus	0.49%	0.43%	
Lysine	1.11%	0.97%	
Methionine	0.45%	0.42%	
1Shows premix for each kilogram of grain extract: VA, 3,250 IU; VD, 31,010 IU; VE, 75,000 mg; VK, 3,000 mg; VB1, 1,000 mg; VB2, 2,500 mg; VB6, 1,200 mg; VB12, 0.009 mg; niacin, 10,000 mg; D-calcium pantothenate, 5,000 mg; biotin, 0.040 mg; folate, 0.500 mg; Choline, 550 mg; Cu, 7,500 mg; Zn, 60,000 mg; Mn, 60,000 mg; Fe, 80,000 mg; Se, 0.150 mg; I, 0.350 mg.

2Indicates nutrient level as calculated value.

The experiment was conducted via 3-layer cage feeding, with each cage measuring 52.7 cm in length, 60 cm in width, and 46.6 cm in height. Eight broilers were raised per cage, providing an average area of 0.04 m2 per chicken. Before the test began, the chicken house was cleaned, fumigated and disinfected, and the test equipment and feed were checked. The temperature inside the chicken house was gradually increased to 30 °C before chick feeding activities were initiated. Throughout the first week of the experiment, a constant temperature of 33 °C was maintained within the housing environment; the temperature subsequently decreased by 3°C every week until reaching a target temperature range of 22 ± 1°C, which remained consistent throughout the study period. The relative humidity of the chicken house was controlled at 60 to 70%. Broilers had ad libitum access to both feed and water throughout all stages of testing with specific feeding times scheduled at regular intervals (8:30 am, 12:00 pm, and 17:30 pm). The light conditions during the different phases included the following: 1 to 3 d, 24 h; 4 to 10 d, 20 h; 11 to 25 d, 18 h; 26 to 35 d, 16 h; 36 to 42 d, 22 h. The feed intake, water intake, number of deaths and mental state of the broilers were observed every day during the experiment. The house was kept clean and hygienic, and good ventilation was maintained. The feeding management system and biosecurity procedures for broilers at the experimental site were strictly followed.

Growth Performance Measurement

The samples were tested once every 7 d during the trial. The body weight and feed intake of the broilers in each replicate group were recorded after they had fasted for 12 h (with no restriction on water intake). The average daily feed intake (ADFI), average daily gain (ADG) and ratio of feed to gain (FCR) of the experimental groups at 1 to 21 d, 22 to 42 d and 1 to 42 d were calculated according to the experimental data obtained. The mortality rate of the broilers was recorded daily, and then the mortality correction was made for the performance parameters.

Sample Collection and Immune Organ Index Determination

On d 21 and 42, 4 broilers with similar body weights and health statuses were selected from each replicate for euthanasia by bleeding through their necks. The blood was collected and allowed to stand at room temperature for 30 min, followed by centrifugation at 6,000 rpm for 15 min to isolate the serum samples which were stored in a -20°C freezer. Complete and clean bursa, thymus, liver and spleen samples were dissected, weighed, and used to calculate the organ indices via formula (2.1). Tissue samples weighing 5 g from the corresponding parts of the liver, spleen and jejunum; mucosa samples weighing 2 g from the jejunum; and cecum content samples weighing 5 g were collected under sterile conditions. These samples were frozen in liquid nitrogen and stored at -80 °C for subsequent index determination.(2.1) Immuneorganindex=ImmuneorganfreshweightBroilerliveweight×100%

Determination of Immunoglobulin, Cytokine, Diamine Oxidase and D-Lactic Acid Levels

An enzyme-linked immunosorbent assay (ELISA) was used to determine the levels of immunoglobulin (Ig)A, IgG, IgM, diamine oxidase (DAO), D-lactic acid (DL), tripartite motif-containing 25 (TRIM25), transforming growth factor (TGF)-β, β-defensin (β-DF) and interferon (IFN)-β in the serum, interleukin (IL)-lβ, IL-4, IL-6, IL-10, IFN-γ and tumor necrosis factor (TNF)-α levels in the serum, liver, spleen and jejunum tissue, β-DF levels in jejunum tissue, and mucoprotein 2 (MUC2) and secretory immunoglobulin A (SIgA) levels in jejunum mucosa at 21 d and 42 d. The content of lysozyme (LZM) in the serum of broilers at 21 d and 42 d was determined by turbidimetry. All commercial ELISA kits used for testing were purchased from Sinobestbio in Shanghai while the LZM test box was purchased from Nanjing Jiancheng Bioengineering Institute. The procedures followed the provided instructions.

Real-Time Fluorescence Quantification

The relative expression levels of the Toll-like receptor 4 (TLR4), myeloid differentiation primary response gene 88 (MyD88), nuclear factor kappa B (NF-κB), inhibitor kappa B alpha (IκBα), inhibitor of kappa B kinase alpha (IKKα), TNF receptor superfamily member 1B (TNFRSF1B), TNF-α, IL-6 IL-10 and IL-4 genes in the liver and spleen were determined via real-time fluorescence quantitative techniques at 21 d and 42 d, with β-action as the reference gene. Additionally, the relative expression of the zonula occludens (ZO)-1, ZO-2, claudin 2 and occludin genes in the jejunum was assessed. The real-time fluorescence quantitative method employed in this study followed Xing et al.'s protocol (Xing et al., 2023). The primer sequences of the target genes are provided in Table 2, Table 3. These primers were synthesized by Sangon Biotech (Shanghai, China). The RrimeScript RT reagent Kit with gDNA Eraser, the TB Green Premix Ex Taq II (Tli RNaseH Plus) kit and RNAiso Plus were purchased from Takara (Beijing, China).Table 2 Primers sequence information.

Table 2Gene	Primer sequence (5′-3′)	Gene Bank number	Length (bp)	
β-action	F: CCCAGCCATGTATGTAGCCATCC	NM_205518	91	
R: AACACCATCACCAGA GTCCATCAC	
TLR4	F: CCATCCCAACCCAAC CACAGTAG	NM_001030693.2	122	
R: ACCCACTGAGCAGC ACCAATG	
MyD88	F: CCGTGGGTCAACT GCTGGAG	NM_001030962.5	115	
R: TCCTGCTGCTTCC TTCGTAAGTAC	
NF-κB	F: CACCACCACCACAA CACAATGC	NM_001396038.1	118	
R: CTCAGCGGCGTC GATGGTATC	
IκBα	F: CCGTAGACCTTCAGAAC TCAGACC	NM_001001472.3	130	
R: TCCTGTATGCTGG CGTTGTCTC	
IKKα	F: TGCTGAGTCTCCTTCG GTATAATGC	NM_001012904	142	
R: GCCATCTGGTCACT GTATCTCTCC	
TNFRSF1B	F: ACGCAGGTGAATGTGA CTTGTATTG	NM_204439.4	87	
R: TGTGCTAGTTGGACC AGTCTGTTC	
TNF-α	F: GGACAGCCTATGCCA ACAAGTAC	NM_204267.2	125	
R: GTCACGATCATCTGG TTACAGGAAG	
IL-4	F: AGAGCCAGCACT GCCACAAG	NM_001007079.2	142	
R: AGGTCTGCTAGGAACT TCTCCATTG	
IL-6	F: AAATCCCTCCTCGCCAATCTGAAG	NM_204628.2	106	
R: CCCTCACGGTCTTCTCCATAAACG	
IL-10	F: CAGCACCAGCCATCAGCAGAG	NM_001004414.4	148	
R: ATCCATCTTCTCGAACGTCTCCTTG	
Abbreviations: IL-4, Interleukin- 4; IL-6, Interleukin- 6; IL-10, Interleukin- l0; TNF-α, Tumor necrosis factor-α; TLR4, Toll-like receptor 4; MyD88, Myeloid differentiation primary response gene 88; NF-κB, Nuclear factor kappa-B; IκBα, Inhibitor kappa B alpha; IKKα, Inhibitor of kappa B kinase alpha; TNFRSF1B, TNF receptor superfamily member 1B.

Table 3 Sequence information of jejunum tight junction protein primers.

Table 3Gene	Primer sequence (5′-3′)	Gene bank number	Length (bp)	
β-Action	F: CCCAGCCATGTATGTAGCCATCC	NM_205518	91	
R: AACACCATCACCAGAGTCCATCAC	
ZO-1	F: GCACTAGAGGATGAGGAGGAAGAAG	XM_040706827	82	
R: ATACGCCACCATTGCTGTTGAATAC	
ZO-2	F: GTGGCTATGGACAGGACTACAGAAG	NM_001396726	134	
R: AGGTGAAGGACTACGAGAATGAAGC	
Claudin 2	F: CGGCGTCATCTTCCTGCTCTC	NM_001013611	95	
R: TCACCAGCGGGTTGTAGAAATCC	
Occludin	F: CTACGGCAGCACCTACCTCAAC	NM_205128	107	
R: GGCAGAGCAGGATGACGATGAG	
Abbreviation: ZO, Zonula Occludens.

Intestinal Microflora Analysis

16S rDNA sequencing was conducted by Novogene, Beijing, China. Genomic DNA was extracted from the cecal contents of broilers in each treatment group on the 42nd day via a soil and fecal genomic DNA extraction kit (TianGen), followed by amplification of the 16S V4 region. The library was constructed via the NEB Next Ultra II FS DNA PCR-free Library Prep Kit (New England Biolabs) and sequenced on the NovaSeq 6000 platform. The reads were spliced and filtered, and Amplicon Sequence Variants (ASV) were denoised. The available data were annotated for species identification, abundance estimation and diversity analysis.

Statistical Analysis

The data analysis for one-way ANOVA was conducted via SPSS 22.0 software, and multiple comparisons were performed via Duncan's test. Statistical significance was accepted at P < 0.05. All results are reported as the means ± standard deviations. Additionally, graphical representations were generated in Origin 2021.

RESULTS

Effects of HYG on the Growth Performance of Broilers

As shown in Table 4, the ANOVA results revealed that dietary HYG had no significant effects on the ADFI, ADG or FCR of broilers at 1 to 21 d, 22 to 42 d or 1 to 42 d (P > 0.05).Table 4 Effect of HYG on growth performance of broilers.

Table 4Times	Items	Treatments	
CN	PC	HYG1	HYG2	HYG3	
1-21 d	ADFI/g	49.40 ± 0.54	49.19 ± 0.83	47.51 ± 0.56	49.11 ± 1.18	47.74 ± 1.61	
ADG/g	40.00 ± 1.02	40.24 ± 0.90	39.01 ± 1.13	39.71 ± 1.3	39.30 ± 1.12	
FCR	1.26 ± 0.03	1.23 ± 0.03	1.22 ± 0.01	1.25 ± 0.05	1.20 ± 0.03	
22-42 d	ADFI/g	169.00 ± 1.75	166.50 ± 0.59	161.84 ± 1.75	166.76 ± 1.63	167.55 ± 1.18	
ADG/g	70.42 ± 2.74	73.45 ± 3.77	69.05 ± 4.69	71.82 ± 1.61	69.12 ± 2.57	
FCR	2.46 ± 0.10	2.29 ± 0.11	2.46 ± 0.11	2.21 ± 0.12	2.40 ± 0.07	
1-42 d	ADFI/g	92.36 ± 1.28	90.88 ± 1.00	87.49 ± 1.60	90.73 ± 1.36	92.36 ± 1.28	
ADG/g	56.52 ± 1.72	58.35 ± 1.88	55.57 ± 3.00	57.72 ± 0.88	55.78 ± 1.38	
FCR	1.68± 0.05	1.58 ± 0.05	1.67 ± 0.05	1.53 ± 0.07	1.63 ± 0.04	
The means within a row with different letters (a-d) are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; ADG, the average daily gain; ADFI, average daily feed intake; FCR, feed conversion rate.

Effects of HYG on the Immune Organ Indices of Broilers

In trial 21 d, compared with the CN group, the PC group had a significantly greater spleen index (P < 0.05) and tended to have an increased thymus index. Dietary HYG partially mitigated the increase in the spleen index and thymus index induced by LPS stress (Figure 2). Compared with those in the PC group, dietary supplementation with 800 mg/kg HYG significantly inhibited the increase in the spleen index caused by LPS stress to reach the level of the CN group and inhibited the in creasein the thymus index, making it significantly lower than that in the CN group (P < 0.05).Figure 2 Effect of HYG on immune organ index of broilers. Different lowercase letters (a, b, c) indicate a significant difference in the mean value of 21 d, and different uppercase letters (A, B, C) indicate a significant difference in the mean value of 42 d (P < 0.05).

Figure 2

In trial 42d, the thymus indices of broilers in the PC group were significantly lower than those in the CN group (P < 0.05). Dietary HYG alleviated the decline in the thymus index caused by LPS stress to a certain extent; notably, supplementation with 800 mg/kg HYG significantly increased the thymus index of broilers under LPS stress and restored it to that of the CN group (P < 0.05) (Figure 2).

Effect of HYG on the Immunoglobulin Levels in the Serum

At 21 d, the ANOVA results revealed that, compared with the CN group, the PC group presented significantly increased IgM and IgA levels (P < 0.05). Supplementation with 400 mg/kg or 800 mg/kg HYG significantly reduced the IgA level under LPS stress (P < 0.01), but the difference was not significant. The addition of 800 mg/kg HYG also reversed the abnormal increase in the IgM level induced by LPS stress (Figure 3).Figure 3 Effect of HYG on serum immunoglobulin levels. Different lowercase letters (a, b, c) indicate a significant difference in the mean value of 21 d, and different uppercase letters (A, B, C) indicate a significant difference in the mean value of 42 d (P < 0.05).

Figure 3

At 42 d, while there was a significant decrease in the IgM levels in the PC group compared with those in the CN group (P < 0.05), no significant effects were observed on the IgG and IgA levels (P > 0.05) (Figure 3). In addition, dietary supplementation with 400 mg/kg HYG significantly increased the IgM level under LPS stress, increasing the level to a level closer to that of the CN group (P < 0.05). Additionally, compared with those in the CN group, the addition of 400mg/kg HYG significantly increased the IgG level; however, the addition of 800 mg/kg HYG significantly decreased the IgG and IgA levels (P < 0.05).

Effects of HYG on Cytokine Levels in the Serum

On d 21, the ANOVA results revealed that, compared with the CN group, the PC group significantly increased IL-1β, IL-4 and IL-10 levels (P < 0.05) and showed an elevated trend in TNF-α and IFN-γ levels (Table 5). Compared with the PC group, dietary HYG significantly reduced the IFN-γ level (P < 0.05), with the most pronounced reduction achieved at doses of 400 mg/kg and 800 mg/kg HYG, resulting in reductions of approximately 31.08% and 22.38%, respectively. Furthermore, dietary supplementation with 400 mg/kg HYG also alleviated the abnormal increase in the IL-10 level induced by LPS stress and restored it to a level close to that of the CN group.Table 5 Effect of HYG on serum cytokine and TRIM25 levels.

Table 5Items	Times	Treatments	
CN	PC	HYG1	HYG2	HYG3	
TRIM25 (pg/mL)	21 d	1173.91 ± 44.01	1258.10 ± 18.54	1193.25 ± 31.44	1193.10 ± 3.27	1255.55 ± 79.18	
42 d	1194.61 ± 27.95a	1171.87 ± 21.11a	1240.08 ± 57.40a	1028.71 ± 17.97b	1152.97 ± 37.18a	
IFN-β (pg/mL)	21 d	57.81 ± 1.99	61.76 ± 1.58	63.00 ± 2.53	60.33 ± 0.71	62.41 ± 2.71	
42 d	58.05 ± 0.79	57.05 ± 0.58	60.18 ± 1.81	54.78 ± 1.42	55.98 ± 1.05	
TGF-β (pg/mL)	21 d	2670.02 ± 211.62	3283.66 ± 85.32	2810.45 ± 219.09	2603.09 ± 195.95	3491.20 ± 462.81	
42 d	2584.60 ± 144.48	2362.40 ± 126.95	3027.93 ± 216.38	2507.19 ± 32.09	2787.67 ± 223.67	
β-DF (pg/mL)	21 d	123.46 ± 4.50	138.56 ± 9.41	126.45 ± 8.46	116.58 ± 2.24	137.98 ± 6.54	
42 d	102.71 ± 3.71	112.29 ± 4.44	97.83 ± 10.78	97.07 ± 3.32	112.23 ± 4.47	
LZM (μg/mL)	21 d	6.734 ± 0.49	5.24 ± 0.30	4.35 ± 0.30	4.86 ± 0.24	2.96 ± 0.18	
42 d	4.010 ± 0.23	2.33 ± 0.11	3.20 ± 0.13	4.31 ± 0.14	5.74 ± 0.30	
IL-1β (pg/mL)	21 d	58.86 ± 0.30c	68.44 ± 3.42b	71.95 ± 1.51b	74.61 ± 3.05ab	80.72 ± 1.97a	
42 d	51.08 ± 0.80d	61.56 ± 2.45bc	57.01 ± 1.93cd	67.67 ± 2.50ab	72.17 ± 1.61a	
IL-4 (pg/mL)	21 d	225.77 ± 20.08b	261.96 ± 1.52a	279.63 ± 4.58a	268.85 ± 1.58a	270.22 ± 0.03a	
42 d	230.29 ± 16.65b	256.48 ± 0.96ab	274.34 ± 11.10a	272.99 ± 3.45a	287.00 ± 8.19a	
IL-6 (pg/mL)	21 d	24.20 ± 0.18	26.10 ± 0.19	23.92 ± 0.47	27.68 ± 2.89	29.50 ± 1.51	
42 d	21.30 ± 0.31d	24.66 ± 0.34b	23.50 ± 0.49c	25.370 ± 0.10b	27.70 ± 0.14a	
IL-10 (pg/mL)	21 d	67.53 ± 1.07d	83.18 ± 3.45b	76.41 ± 0.66c	85.27 ± 1.00b	90.79 ± 0.73a	
42 d	68.03 ± 2.83	66.40 ± 2.86	66.51 ± 1.77	71.05 ± 1.32	77.48 ± 4.49	
TNF-α (pg/mL)	21 d	42.27 ± 3.40b	48.03 ± 0.15ab	48.62 ± 0.98ab	50.24 ± 2.80a	53.69 ± 1.81a	
42 d	44.54 ± 4.75	45.48 ± 0.76	46.97 ± 0.80	45.55 ± 3.24	50.57 ± 3.70	
IFN-γ (pg/mL)	21 d	66.71 ± 0.40ab	68.49 ± 2.75a	47.20 ± 2.38c	53.16 ± 2.59c	61.40 ± 1.58b	
42 d	73.48 ± 3.70a	49.26 ± 1.23c	52.51 ± 1.27c	55.56 ± 2.45c	64.57 ± 3.940b	
a-d The means within a row with different letters are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; TRIM25, Tripartite motif-containing 25; IFN-β, Interferon-β; TGF-β, Transforming growth factor-β; β-DF, β-defansin; LZM, lysozyme; IL-lβ, Interleukin- lβ; IL-4, Interleukin- 4; IL-6, Interleukin- 6; IL-10, Interleukin- l0; TNF-α, Tumor necrosis factor-α; IFN-γ, Interferon-γ.

On d 42, the ANOVA results demonstrated that, compared with the CN group, the PC group presented significantly increased IL-1β and IL-6 levels but significantly decreased IFN-γ levels (P < 0.05). Compared with the PC group, dietary supplementation with 400 mg/kg HYG alleviated the abnormal increase in the IL-1β level induced by LPS stress and restored it to the level in the CN group; additionally, it significantly reduced the IL-6 level toward values similar to those observed in the CN group (P < 0.01). Conversely, adding 1200 mg/kg HYG to the diet significantly increased the IFN-γ level (P < 0.05) and further increased the levels of IL-1β and IL-6 under LPS stress (P < 0.01). Compared with the CN group, supplementation with HYG significantly increased the IL-4 level (P < 0.05), with no significant difference between the treatments; however, supplementation with 800 mg/kg HYG significantly decreased the TRIM25 level (P < 0.05) (Table 5).

Effects of HYG on the Anti-Inflammatory Function of Liver in the Broilers Under Oxidative Stress

Effect of HYG on cytokine levels in the liver. On d 21, the ANOVA results revealed that, compared with the CN group, the PC group presented significantly increased IL-4 and TNF-α levels (P < 0.05) and showed upward trends for IL-6 and IL-10 levels. Compared with the PC group, supplementation with HYG increased the levels of IL-4 and IL-10, with a further significant increase observed in liver IL-4 levels under LPS stress upon the addition of 400 mg/kg and 1,200 mg/kg of HYG (P < 0.01). No significant difference was found between these 2 treatments. The addition of HYG to the diet increased the level of IL-10 in the liver under LPS stress, which gradually reached significance as the dietary concentration increased (P < 0.05). Furthermore, dietary supplementation with 1200 mg/kg HYG also significantly increased the IL-6 and IL-1β levels under LPS stress (P < 0.05) (Table 6).Table 6 Effect of HYG on cytokine levels in the liver of broilers.

Table 6			Treatments	
Items	Times	CN	PC	HYG1	HYG2	HYG3	
IL-1β (pg/mL)	21 d	49.80 ± 2.47b	48.66 ± 1.88b	52.41 ± 1.73b	49.73 ± 2.81b	66.03 ± 1.30a	
42 d	49.75 ± 1.34b	47.57 ± 0.50b	48.70 ± 3.28b	57.84 ± 2.97a	59.21 ± 1.27a	
IL-4 (pg/mL)	21 d	177.41 ± 1.53d	214.42 ± 3.03c	233.54 ± 3.47ab	225.81 ± 4.28bc	246.12 ± 9.38a	
42 d	183.50 ± 5.15c	202.27 ± 7.17bc	216.16 ± 0.90ab	224.91 ± 2.52ab	236.75 ± 13.85a	
IL-6 (pg/mL)	21 d	20.34 ± 0.44c	20.88 ± 0.12bc	22.19 ± 0.07abc	22.41 ± 1.11ab	23.43 ± 0.49a	
42 d	19.79 ± 0.66c	21.48 ± 0.71bc	21.59 ± 0.53bc	22.80 ± 0.81ab	23.94 ± 0.42a	
IL-10 (pg/mL)	21 d	54.91 ± 1.91c	59.30 ± 0.38bc	62.37 ± 1.29b	63.56 ± 1.66b	68.64 ± 1.35a	
42 d	51.43 ± 1.11b	52.10 ± 0.25b	55.50 ± 2.31ab	57.65 ± 1.11a	60.03 ± 2.39a	
TNF-α (pg/mL)	21 d	36.32 ± 1.32b	41.63 ± 0.50a	41.68 ± 0.03a	41.35 ± 0.73a	43.00 ± 0.10a	
42 d	34.42 ± 0.83	36.83 ± 1.26	36.27 ± 0.92	38.02 ± 0.61	37.76 ± 0.59	
IFN-γ (pg/mL)	21 d	47.16 ± 2.82	46.98 ± 0.77	54.24 ± 2.60	54.19 ± 3.20	47.29 ± 2.97	
42 d	45.92 ± 0.94b	52.41 ± 0.50a	54.15 ± 1.03a	45.30 ± 1.52b	45.57 ± 1.47b	
a-d The means within a row with different letters are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; IL-lβ, Interleukin- lβ; IL-4, Interleukin- 4; IL-6, Interleukin- 6; IL-10, Interleukin- l0; TNF-α, Tumor necrosis factor-α; IFN-γ, Interferon-γ.

On d 42, the results of ANOVA revealed that, compared with the CN group, the PC group presented significantly increased IFN-γ levels (P < 0.01) and tended to have elevated IL-4 and IL-6 levels (Table 6). Compared with the PC group, the HYG supplementation group presented increased IL-4 and IL-10 levels, and which gradually increased with increasing HYG concentration and finally reached a significant level. However, adding either 800 mg/kg or 1,200 mg/kg HYG significantly decreased the IFN-γ level under LPS stress (P < 0.05), restoring it to the level in the CN group. In contrast, compared with the PC group, the 800 mg/kg and 1,200 mg/kg HYG group presented increased IL-1β and IL-6 levels, but the differences were not significant.

Effect of HYG on the expression of genes related to the TLR4/NF-κB signaling pathway in the liver. As shown in Table 7, at 21 d, the ANOVA results revealed that, compared with that in the CN group, the expression of IL-10 mRNA continued to increase with increasing HYG concentration. The expression reached a significant level when the plants were supplemented with 1200 mg/kg HYG (P < 0.05).Table 7 Effects of HYG on relative gene expression in liver.

Table 7		Treatments	
Items	Times	CN	PC	HYG1	HYG2	HYG3	
TLR4	21 d	1.21 ± 0.12	0.75 ± 0.03	0.77 ± 0.47	0.51 ± 0.04	1.71 ± 0.45	
42 d	1.14 ± 0.20b	2.87 ± 0.08b	4.36 ± 0.53b	19.35 ± 2.09a	4.11 ± 0.47b	
MyD88	21 d	1.33 ± 0.10	0.58 ± 0.05	0.30 ± 0.01	0.44 ± 0.04	0.76 ± 0.07	
42 d	1.03 ± 0.17c	1.14 ± 0.10c	1.72 ± 0.18c	15.99 ± 1.54a	6.28 ± 0.72b	
NF-κB	21 d	1.54 ± 0.11	0.74 ± 0.06	0.41 ± 0.03	1.01 ± 0.01	0.73 ± 0.05	
42 d	1.09 ± 0.14b	1.02 ± 0.15b	2.31 ± 0.29b	6.43 ± 0.63a	4.68 ± 0.39ab	
IκBα	21 d	1.29 ± 0.10	0.33 ± 0.02	0.46 ± 0.05	0.43 ± 0.04	1.65 ± 0.12	
42 d	1.48 ± 0.08a	0.61 ± 0.08b	0.62 ± 0.00b	0.72 ± 0.05b	0.51 ± 0.05b	
IKKα	21 d	1.48 ± 0.13	0.47 ± 0.03	0.47 ± 0.03	0.53 ± 0.04	1.00 ± 0.10	
42 d	1.01 ± 0.11b	3.47 ± 0.34a	0.55 ± 0.04b	0.71 ± 0.07b	0.52 ± 0.08b	
TNFRSF1B	21 d	1.59 ± 0.01	0.50 ± 0.06	0.44 ± 0.04	0.63 ± 0.04	0.92 ± 0.07	
42 d	1.04 ± 0.11	0.74 ± 0.01	0.41 ± 0.04	0.76 ± 0.04	0.75 ± 0.07	
TNF-α	21 d	1.23 ± 0.12	0.81 ± 0.04	1.38 ± 0.13	1.85 ± 0.14	5.15 ± 0.59	
42 d	2.67 ± 0.23	4.24 ± 0.23	2.44 ± 0.24	3.70 ± 0.17	6.28 ± 0.78	
IL-6	21 d	1.02 ± 0.14	0.90 ± 0.06	2.62 ± 0.62	0.64 ± 0.10	2.47 ± 0.24	
42 d	0.71 ± 0.05c	3.37 ± 0.22a	0.68 ± 0.08c	2.06 ± 0.18b	1.89 ± 0.04b	
IL-10	21 d	1.25 ± 0.04b	0.92 ± 0.05b	1.51 ± 0.07b	1.79 ± 0.18b	6.47 ± 0.11a	
42 d	1.01 ± 0.11b	0.95 ± 0.08b	1.00 ± 0.013b	1.36 ± 0.09b	4.96 ± 0.47a	
a-d The means within a row with different letters are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; IL-6, Interleukin- 6; IL-10, Interleukin- l0; TNF-α, Tumor necrosis factor-α; TLR4, Toll-like receptor 4; MyD88, Myeloid differentiation primary response gene 88; NF-κB, Nuclear factor kappa-B; IκBα, Inhibitor kappa B alpha; IKKα, Inhibitor of kappa B kinase alpha; TNFRSF1B, TNF receptor superfamily member 1B.

At 42 d, compared with the CN group, the PC group presented significantly upregulated relative mRNA expression of IKKα and IL-6 but downregulated relative mRNA expression of IκBα (P < 0.05). Compared with the PC group, adding HYG to the diet significantly downregulated the relative expression of IKKα and IL-6 mRNAs under LPS stress (P < 0.05), without any notable effect on IκBα (P > 0.05). Specifically, adding 400 mg/kg HYG to the diet inhibited the abnormal up-regulation of liver IL-6 expression induced by LPS stress and restored it to the level found in the CN group. Furthermore, increasing HYG supplementation resulted in increased expression of IL-10 mRNA, which reached significance at the highest levels. Additionally, medium or high concentrations of HYG led to elevated relative expressions of TLR4, NF-κB, and MyD88 (Table 7).

Effects of HYG on the Anti-Inflammatory Function of the Spleen in Broilers Under Oxidative Stress

Effects of HYG on cytokine levels in spleen. At 21 d, the ANOVA results revealed that, compared with those in the CN group, the IL-4, IL-6 and TNF-α levels in the PC group significantly increased, and the levels of IL-1β, IL-10 and IFN-γ in the spleens of the broilers tended to increase (Table 8). Compared with those in the PC group, dietary HYG significantly increased the IL-1β and IL-10 levels in a dose-dependent manner (P < 0.05). Furthermore, HYG at a concentration of 1,200 mg/kg in the diet further significantly increased the IL-4 level in the spleen under LPS stress (P < 0.05). Supplementation with 800 mg/kg or 1,200 mg/kg HYG significantly increased the TNF-α level under LPS stress (P < 0.05), but the difference between the 2 groups was not significant. Moreover, dietary supplementation with 400 mg/kg and 800 mg/kg HYG resulted in a significant decrease in IFN-γ levels within the spleen (P < 0.05), with no notable difference between these treatments, with an average reduction of approximately 7.51%.Table 8 Effect of HYG on cytokine levels in spleen of broilers.

Table 8Items	Times	Treatments	
CN	PC	HYG1	HYG2	HYG3	
IL-1β (pg/mL)	21 d	48.03 ± 0.63c	50.69 ± 2.76bc	53.35 ± 0.50ab	54.25 ± 0.95ab	57.83 ± 0.25a	
42 d	40.30 ± 1.97d	45.78 ± 0.37cd	48.27 ± 1.38c	57.96 ± 1.56b	64.42 ± 2.70a	
IL-4 (pg/mL)	21 d	157.62 ± 0.91c	182.65 ± 8.36b	178.56 ± 3.39b	191.79 ± 5.27ab	204.34 ± 2.84a	
42 d	166.12 ± 0.70d	181.10 ± 9.03cd	201.55 ± 6.86ab	190.30 ± 4.00bc	214.32 ± 2.58a	
IL-6 (pg/mL)	21 d	16.51 ± 0.05b	20.33 ± 0.26a	19.26 ± 1.22a	20.14 ± 0.81a	21.24 ± 0.14a	
42 d	17.80 ± 0.06c	20.78 ± 0.74ab	19.44 ± 0.64bc	20.61 ± 0.27ab	22.67 ± 1.49a	
IL-10 (pg/mL)	21 d	45.42 ± 1.48d	49.82 ± 0.33cd	53.42 ± 0.12bc	58.64 ± 2.24ab	62.10 ± 2.90a	
42 d	43.70 ± 0.64b	45.19 ± 0.30b	51.96 ± 1.09a	50.41 ± 0.47a	53.51 ± 2.87a	
TNF-α (pg/mL)	21 d	27.13 ± 1.82c	30.62 ± 0.70b	31.51 ± 0.35b	36.27 ± 0.53a	35.52 ± 1.07a	
42 d	27.76 ± 1.50c	32.56 ± 1.75b	33.80 ± 0.07ab	35.17 ± 0.49ab	38.22 ± 1.88a	
IFN-γ (pg/mL)	21 d	48.27 ± 2.25ab	55.77 ± 3.25a	46.59 ± 2.84b	42.70 ± 1.77b	50.65 ± 1.38ab	
42 d	53.40 ± 3.06ab	48.33 ± 1.13b	47.58 ± 0.83b	51.44 ± 1.15ab	56.94 ± 2.38a	
a-d The means within a row with different letters are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; IL-lβ, Interleukin- lβ; IL-4, Interleukin- 4; IL-6, Interleukin- 6; IL-10, Interleukin- l0; TNF-α, Tumor necrosis factor-α; IFN-γ, Interferon-γ.

At 42 d, compared with the CN group, the PC group presented significantly increased IL-6 and TNF-α levels. Compared with the PC group, the 400 mg/kg HYG-treated group presented increased IL-6 levels caused by LPS stress, which were restored to the levels found in the CN group. Conversely, the addition of 1,200 mg/kg HYG further increased the TNF-α level under LPS stress (P < 0.05). Compared with those in the PC group, dietary HYG significantly increased the IL-1β and IL-4 levels, but did not significantly affect the IFN-γ level in the spleen (P > 0.05). Notably, among these treatments, HYG1 resulted in the least pronounced increase in the IL-1β level but resulted in a greater increase in the IL-4 level within the spleen. However, dietary HYG significantly increased the IL-10 level in the spleen (P < 0.05), without any significant difference among the different concentrations (Table 8).

Effects of HYG on the expression of genes related to the TLR4/NF-κB signaling pathway in the spleen. As shown in Table 9, at 21 d, the relative mRNA expression levels of TLR4 and IL-10 increased with increasing concentrations of HYG and reached significantly higher level in the 1,200 mg/kg HYG group compared with those in the PC group (P < 0.05). Furthermore, both 800 mg/kg and 1,200 mg/kg HYG significantly upregulated the relative mRNA expression of NF-κB (P < 0.05). Additionally, the relative expression of IL-4 mRNA was significantly increased by the addition of 1,200 mg/kg HYG (P < 0.05). Moreover, adding HYG significantly increased the relative mRNA expression of IL-6 (P < 0.05), without any significant difference among the different concentrations.Table 9 Effect of HYG on relative gene expression in spleen.

Table 9		Treatments	
Items	Times	CN	PC	HYG1	HYG2	HYG3	
TLR4	21 d	1.55 ± 0.01bc	0.52 ± 0.07c	2.03 ± 0.15abc	3.52 ± 0.22ab	4.45 ± 0.29a	
42 d	1.55 ± 0.08b	1.45 ± 0.07b	3.10 ± 0.33ab	3.01 ± 0.08ab	4.93 ± 0.23a	
MyD88	21 d	1.24 ± 0.10	0.56 ± 0.02	0.31 ± 0.02	0.26 ± 0.02	0.18 ± 0.01	
42 d	0.73 ± 0.03	2.09 ± 0.21	4.55 ± 0.37	6.81 ± 0.45	2.78 ± 0.20	
NF-κB	21 d	1.22 ± 0.12c	0.86 ± 0.07c	0.49 ± 0.01c	5.04 ± 0.76a	2.83 ± 0.02b	
42 d	1.03 ± 0.18	0.58 ± 0.03	4.24 ± 0.38	3.20 ± 0.35	2.02 ± 0.18	
IκBα	21 d	1.61 ± 0.11	0.87 ± 0.04	2.82 ± 0.36	2.67 ± 0.15	3.77 ± 0.09	
42 d	1.13 ± 0.08b	1.54 ± 0.05b	3.25 ± 0.23ab	3.36 ± 0.13ab	6.12 ± 0.41a	
IKKα	21 d	1.20 ± 0.10	1.38 ± 0.09	3.27 ± 0.29	4.03 ± 0.37	1.58 ± 0.06	
42 d	1.26 ± 0.12	0.54 ± 0.02	3.62 ± 0.27	1.66 ± 0.09	1.61 ± 0.05	
TNFRSF1B	21 d	1.21 ± 0.17	1.07 ± 0.04	1.48 ± 0.12	1.63 ± 0.09	2.01 ± 0.09	
42 d	1.45 ± 0.17b	1.48 ± 0.46b	1.88 ± 0.26ab	2.48 ± 0.18a	2.75 ± 0.25a	
TNF-α	21 d	1.64 ± 0.11	0.73 ± 0.09	1.00 ± 0.07	0.53 ± 0.05	0.61 ± 0.02	
42 d	1.01 ± 0.11b	2.61 ± 0.11b	7.19 ± 0.61a	2.24 ± 0.17b	1.05 ± 0.09b	
IL-4	21 d	1.35 ± 0.11b	0.73 ± 0.07b	0.31 ± 0.04b	0.74 ± 0.06b	2.69 ± 0.29a	
42 d	1.25 ± 0.09b	1.22 ± 0.14b	4.69 ± 0.44a	3.21 ± 0.37ab	2.60 ± 0.36b	
IL-6	21 d	1.02 ± 0.11c	1.37 ± 0.12c	4.41 ± 0.22ab	2.58 ± 0.19bc	5.18 ± 0.50a	
42 d	1.05 ± 0.03c	2.27 ± 0.25bc	1.85 ± 0.29bc	4.23 ± 0.27ab	6.21 ± 056a	
IL-10	21 d	1.32 ± 0.11c	1.28 ± 0.07c	2.65 ± 0.05bc	4.86 ± 0.78ab	5.85 ± 0.19a	
42 d	1.09 ± 0.03d	3.66 ± 0.17c	8.26 ± 0.08a	5.68 ± 0.23b	5.87 ± 0.78b	
a-d The means within a row with different letters are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; IL-lβ, Interleukin- lβ; IL-4, Interleukin- 4; IL-6, Interleukin- 6; IL-10, Interleukin- l0; TNF-α, Tumor necrosis factor-α; TLR4, Toll-like receptor 4; MyD88, Myeloid differentiation primary response gene 88; NF-κB, Nuclear factor kappa-B; IκBα, Inhibitor kappa B alpha; IKKα, Inhibitor of kappa B kinase alpha; TNFRSF1B, TNF receptor superfamily member 1B.

At 42 d, compared with the PC group, the relative mRNA expressions levels of IκBα and TNFRSF1B increased with increasing HYG concentration, reaching a significant level at the highest concentration (P < 0.05). Conversely, dietary supplementation with HYG increased the relative expressions of IL-10 and IL-4 mRNAs compared with those in the PC group. Additionally, the addition of 400 mg/kg HYG significantly increased the relative expression of TNF-α mRNA (P < 0.05). Furthermore, supplementation with 1,200 mg/kg HYG led to a significant increase in TLR4 and IL-6 mRNA expression (P < 0.05).

Effects of HYG on Jejunal Barrier Function in Broilers Under Oxidative Stress

Effects of HYG on the serum levels of DAO and DL. As shown in Figure 4, at 21 d, compared with the CN group, the PC group presented significantly increased serum DAO levels (P < 0.05), whereas dietary supplementation with HYG did not ameliorate the increase in DAO levels caused by LPS stress. At 42 d, dietary supplementation with HYG led to a decreasing DL level, but this difference was not significant (P > 0.05) (Figure 4).Figure 4 Effect of HYG on serum DAO and DL levels. Different lowercase letters (a, b, c) indicate a significant difference in the mean value of 21 d, and different uppercase letters (A, B, C) indicate a significant difference in the mean value of 42 d (P < 0.05).

Figure 4

Effects of HYG on the levels of SIgA and MUC2 in the jejunum mucosa. As shown in Figure. 5, at 21 d, compared with the CN group, the PC group tended to have increased levels of SIgA. Compared with the PC group, the addition of 400 mg/kg HYG to the diet inhibited the increasing trend of SIgA induced by LPS stress and restored it to the level of the CN group. Conversely, the addition of 400 mg/kg HYG significantly reduced the MUC2 level compared with that in the PC group (P < 0.05).Figure 5 Effect of HYG on SlgA and MUC2 levels in jejunum mucosa. Different lowercase letters (a, b, c) indicate a significant difference in the mean value of 21 d, and different uppercase letters (A, B, C) indicate a significant difference in the mean value of 42 d (P < 0.05).

Figure 5

At 42 d, compared with the PC group, dietary supplementation with 400 mg/kg HYG tended to increase the SIgA level. Nevertheless, as the HYG concentration in the diet increased, the SIgA level within the jejunum mucosa gradually decreased compared with that in the PC group; however, this difference did not reach statistical significance.

Effects of HYG on cytokine levels in jejunum tissues. At 21 d, compared with the CN group, the PC group presented significantly increased IL-6, IL-10 and β-DF levels (P < 0.01) (Table 10). Supplementation with 400 mg/kg HYG alleviated the increase in the level of IL-6 induced by LPS stress and restore it to the level in the CN group. Furthermore, supplementation with 800 mg/kg HYG inhibited the abnormal increase in β-DF levels in the jejunum of broilers under LPS stress (P < 0.05), restoring it to the level found in the CN group level. Dietary inclusion of HYG significantly increased the IL-10 level under LPS stress (P < 0.05), with HYG3 demonstrating greater enhancing effects than HYG1 and HYG2. Additionally, the dietary addition of HYG significantly increased the IL-1β and IL-4 levels compared with those in the CN group (P < 0.05), and the effect on elevating IL-4 levels did not differ among concentrations of HYG.Table 10 Effects of HYG on cytokine levels in jejunum tissue.

Table 10Items	Times	Treatments	
CN	PC	HYG1	HYG2	HYG3	
IL-1β (pg/mL)	21 d	44.71 ± 0.49c	42.27 ± 2.75c	51.70 ± 1.17b	54.72 ± 0.57b	70.80 ± 2.17a	
42 d	51.61 ± 0.31d	55.41 ± 1.44c	61.13 ± 0.38b	61.66 ± 1.96b	80.51 ± 0.01a	
IL-4 (pg/mL)	21 d	203.23 ± 2.20c	197.434 ± 4.88c	224.76 ± 0.11b	219.38 ± 1.30b	245.03 ± 3.74a	
42 d	206.36 ± 1.00b	222.52 ± 3.28b	227.41 ± 2.21b	252.26 ± 24.26ab	294.26 ± 26.94a	
IL-6 (pg/mL)	21 d	19.60 ± 0.52d	22.10 ± 0.25c	21.01 ± 0.42cd	24.00 ± 0.63b	26.55 ± 0.31a	
42 d	23.37 ± 1.33bc	23.31 ± 0.16bc	22.33 ± 0.20c	25.10 ± 0.08ab	26.57 ± 0.52a	
IL-10 (pg/mL)	21 d	51.63 ± 0.31d	55.42 ± 1.43c	61.17 ± 0.40b	61.68 ± 1.97b	80.62 ± 0.01a	
42 d	55.40 ± 2.17c	62.11 ± 0.92bc	56.95 ± 0.80c	73.65 ± 2.53ab	76.79 ± 7.59a	
TNF-α (pg/mL)	21 d	35.42 ± 2.73	33.61 ± 1.37	40.00 ± 2.21	37.39 ± 0.57	41.21 ± 0.43	
42 d	34.04 ± 2.31	36.77 ± 2.03	38.90 ± 0.45	40.35 ± 0.31	40.41 ± 1.11	
β-DF
(pg/mL)	21 d	87.99 ± 4.34b	104.88 ± 4.78a	105.16 ± 5.19a	89.79 ± 3.79b	105.25 ± 2.12a	
42 d	101.32 ± 3.02	107.22 ± 2.40	117.91 ± 3.50	104.40 ± 6.35	109.73 ± 3.49	
a-d The means within a row with different letters are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; IL-lβ, Interleukin- lβ; IL-4, Interleukin- 4; IL-6, Interleukin- 6; IL-10, Interleukin- l0; TNF-α, Tumor necrosis factor-α; β-DF, β-defansin.

At 42 d, compared with the CN group, the PC group presented significantly increased IL-1β level (P < 0.01). The addition of HYG significantly increased the IL-1β level under LPS stress (P < 0.05), with a greater increase observed in the HYG3 group than in both HYG1 and HY2 groups. Moreover, compared with the PC group, the dietary addition of 400 mg/kg HYG tended to decrease the IL-6 level under LPS stress, whereas the addition of 800 mg/kg or 1200 mg/kg HYG promoted the levels of IL-4 and IL-10 (Table 10).

Effects of HYG on the expression levels of tight junction protein-related genes in the jejunum. As shown in Table 11, at 21 d, dietary HYG had no significant effect on the mRNA expression of Claudin 2, ZO-1, ZO-2, or Occludin in the jejunum.Table 11 Effects of HYG on relative gene expression in jejunum.

Table 11Items	Times	Treatments	
CN	PC	HYG1	HYG2	HYG3	
Claudin 2	21 d	1.01 ±0.06	1.02 ± 0.09	1.02 ± 0.11	0.89 ± 0.00	0.93 ± 0.04	
42 d	0.70 ± 0.07	0.47 ± 0.05	0.56 ± 0.00	3.70 ± 0.31	0.62 ± 0.02	
ZO-1	21 d	0.84 ± 0.10	1.34 ± 0.12	1.62 ± 0.09	1.02 ± 0.08	2.56 ± 3.69	
42 d	1.54 ± 0.07a	0.05 ± 0.00b	0.01 ± 0.00b	0.05 ± 0.04b	0.04 ± 0.00b	
ZO-2	21 d	1.07 ± 0.22	1.09 ± 0.03	1.13 ± 0.18	1.38 ± 0.30	0.91 ± 0.13	
42 d	1.05 ± 0.01a	1.35 ± 0.20a	0.36 ± 0.02b	0.95 ± 0.03a	1.19 ± 0.04a	
Occludin	21 d	1.24 ± 0.42	1.00 ± 0.17	1.43 ± 0.14	1.30 ± 0.48	1.44 ± 0.22	
42 d	0.95 ± 0.01b	0.74 ± 0.01b	0.38± 0.04b	0.67 ± 0.04b	4.19 ± 0.19a	
a-d The means within a row with different letters are significantly different (P < 0.05).

Abbreviations: HYG, Hypericum attenuatum choisy extract; ZO, Zonula Occludens.

At 42 d, compared with the CN group, the PC group presented significantly downregulated relative ZO-1 mRNA expression (P < 0.05). Compared with the PC group, dietary supplementation with HYG had no significant effect on the relative expression of ZO-1 mRNA (P > 0.05). However, adding 1200 mg/kg HYG to the diet significantly increased the relative expression of Occludin mRNA, and adding 400 mg/kg HYG significantly decreased the relative expression of ZO-2 mRNA.

Effect of HYG on the Cecal Microflora in Broilers Under Oxidative Stress

ASVs and diversity index. As shown in Figure. 6, the CN group, PC group, HYG1 group, HYG2 group and HYG3 group shared a total of 466 ASVs. Compared with the CN group (521), the PC group presented a lower number of unique ASVs (182), wheares the HYG1 group presented a greater number of unique ASVs (205) than did the PC group. Furthermore, the unique ASVs of the HYG2 group (146) and HYG3 group (179) were somewhat lower than those of the PC group. These findings indicate that HYG can regulate the cecal microflora of broilers under LPS stress.Figure 6 Venn diagram of ASVs microflora in cecum of broilers.

Figure 6

As presented in Table 12, HYG supplementation did not significantly affect the Chao1 index, Shannon index or Simpson index of the cecal microbial (P > 0.05). The PCoA results depicted in Figure 7 demonstrate that the distance between each group was relatively small, indicating that the community composition among the groups was similar (Figure 7). These findings suggest that dietary supplementation with HYG did not change the diversity of cecal microflora in broilers under LPS stress.Table 12 Diversity of cecal microflora Alpha in broilers.

Table 12	CN	PC	HYG1	HYG2	HYG3	
Chao1	491.24 ± 13.56	491.14 ± 12.35	494.66 ± 10.86	472.04 ± 14.10	421.75 ± 18.03	
Shannon	6.30 ± 0.19	6.08 ± 0.12	6.04 ± 0.09	6.05 ± 0.85	5.45 ± 0.26	
Simpson	0.95 ± 0.01	0.93 ± 0.01	0.95 ± 0.01	0.92 ± 0.05	0.91 ± 0.02	
The means within a row with different letters (a-d) are significantly different (P < 0.05).

Figure 7 Unweighted unifrac distance PCoA analysis.

Figure 7

Composition of the phylum-level microflora. As shown in Figure 8, the cecal microflora of broilers at the phylum level consists primarily Bacteroidota, Firmicutes, Protebacteria, Desulfobacterota, and Campylobacterota. Compared with the CN group, the PC group presented a significantly greater relative abundance of Campylobacter (P < 0.05) and a decreasing trend in the relative abundance of Proteobacteria. Compared with those in the PC group, dietary supplementation with HYG significantly mitigated or prevented the abnormal increase in the relative abundance of Campylobacter induced by LPS stress and restored it to levels similar to that observed in the CN group (P < 0.05). In contrast, dietary supplementation with 800 mg/kg HYG significantly increased the relative abundance of Proteobacteria in the cecum (P < 0.05), and supplementation with 1,200 mg/kg HYG further decreased its relative abundance.Figure 8 Relative abundance of cecal microflora in broilers at phylum level.

Figure 8

Composition of genus-level microflora. As shown in Figure 9 and Table S2, compared with the CN group, the PC group presented significantly lower relative abundances of Alistipes, CHKCI001 and Phascolarctobacterium but higher relative abundances of UCG-005, Helicobacter and Colidextribacter (P < 0.05). Dietary HYG effectively prevented the abnormal decrease in the relative abundance of Alistipes alleviated the decline in Phascolarctobacterium relative abundance caused by LPS stress (P < 0.05), with no significant differences among the concentrations. Furthermore, compared with those in the PC group, the relative abundances of UCG-005, Helicobacter and Colidextribacter were significantly lower in the HYG-supplemented group (P < 0.05). Notably, compared with HYG1, HYG2 and HYG3 more effectively inhibited the relative abundance of Helicobacter. The relative abundance of Colidextribacter in the cecum of broilers fed HYG was significantly lower than that in the CN group (P < 0.05). Additionally, compared with those in the CN group, dietary supplementation with 800 mg/kg HYG significantly increased the relative abundances of Parabacteroides, Rikenella and Subdoligranulum (P < 0.05), whereas supplementation with 400 mg/kg HYG significantly increased the relative abundance of Erysipelatoclostridium in the cecum (P < 0.05).Figure 9 Relative abundance of cecal microflora in broilers at genus level.

Figure 9

Linear discriminant analysis. To elucidate the distinctive microflora of the different responses in the cecum of broilers fed HYG, linear discriminant analysis (LDA) was performed, and the LDA scores that exceeded 2.5 are presented in Figure 10. The distinctive microflora of the control group were Victivallis, Parasutterella and Oscillibacter; the distinctive microflora of the PC group was Merdibacter; the distinctive microflora of the HYG1 group were Sellimonas and Papillibacter; and the distinctive microflora of the HYG2 group were Parabacteroides and Megamonas (Figure 10).Figure 10 LEfSe of microflora in the cecum of broilers. (A) LDA value distribution; (B) LEfSe generates a branch graph.

Figure 10

Spearman correlation analysis. The Spearman correlation analysis results depicted in Figure 11 demonstrate that Alistipes relative abundance exhibited a significant positive correlation with serum IgM levels. Phascolarctobacterium displayed a significantly positive correlation with serum IFN-β levels. Helicobacter, Colidextribacter and UCG-005 were significantly positively correlated with the relative expression of IKKα mRNA in the liver. Moreover, Helicobacter was also significantly negatively correlated with the relative expressions of IL-10 and IL-1β mRNA in the liver, while Colidextribacter also demonstrated a significantly negative correlation with MyD88 and NF-κB mRNA relative expression in the liver. Phascolarctobacterium, Subdoligranulum and Parabacteroides were significantly negatively correlated with the relative expression of IKKα mRNA in the liver. The relative expression of TNFRSF1B mRNA in the liver was negatively correlated with the relative abundance of Erysipelatoclostridium. Rikenella displayed a significant negative correlation with the expression of IκBα mRNA and a notable positive correlation with the relative expression of IL-6 mRNA. The levels of IL-4 and relative mRNA expressions of MyD88, NF-κB and TLR4 in the liver were positively correlated with Parabacteroides and Megamonas. Furthermore, Helicobacter exhibited a significantly positive correlation with the relative expressions of IL-4 and TNF-α mRNA in the spleen. Colidextribacter and UCG-005 were negatively correlated with the relative expressions of IκBα and TLR4 mRNA in the spleen. The relative expressions of IL-10, IL-6, MyD88 and NF-κB mRNA in the spleen were positively correlated with Parabacteroides and Megamonas.Figure 11 Spearman correlation analysis heat map.

Figure 11

DISCUSSION

Effects of HYG on the Serum Immunologic Function of Broilers Under Oxidative Stress

Immunoglobulin are crucial components of the humoral immune system of poultry. Previous studies have reported that plant extracts, such as red osier dogwood extract and Acanthopanax senticosus extract, have beneficial effects on improving the humoral immunity of broilers by increasing the serum levels of IgA and IgM (Long et al., 2021; Erinle et al., 2022). In this study, LPS-induced stress disruptd the redox balance and triggered excessive production of reactive oxygen species (ROS) within the body. ROS can mediate B lymphocyte activation, proliferation and differentiation (Fedyk and Phipps, 1994), leading to overproduction of IgA. The main flavonoids present in HYG, such as quercetin, hyperoside and mangiferin, can enhance antioxidant enzyme activity while increasing overall antioxidant capacity. The addition of 400 mg/kg HYG to the diet helps the host eliminate the excess ROS and inhibits excessive B lymphocyte proliferation and activation. Consequently, HYG supplementation reduced the excessive secretion of IgA in the serum at 21 d. Furthermore, quercetin can also impede Wnt/β-catein signal transduction in lymphocytes to reduce B1 lymphocyte proliferation and differentiation (Novo et al., 2015). This effect may explain why adding 800 mg/kg HYG to the diet suppressed IgM overproduction at 21 d. Excessive ROS not only caused the breakdown of the mitochondrial membrane potential of B lymphocytes, leading to cell death. But also oxidized cellular proteins and DNA, which may subsequently decrease IgM secretion (Liu et al., 2023a; Li et al., 2024). Mangiferin, quercetin and rutin can inhibit oxidative stress in lymphocytes (Muruganandan et al., 2005; Kurzawa-Zegota et al., 2012), whereas hyperoside also has anti-genotoxic and antioxidative damage effects (Yuzbasioglu et al., 2023). Collectively, these mechanisms ensure the optimal functioning of lymphocytes, including their proliferation, differentiation, and synthesis. This process contributed to the synthesis and secretion of IgM and IgG in the serum at 42 d.

Cytokines function as chemical messengers within the immune system, and their levels in serum can reflect the body's immune status and inflammatory response. Studies have demonstrated that LPS invasion in broilers leads to elevated levels of proinflammatory cytokines such as IL-6, TNF-α and IFN-γ (Wang et al., 2023a; Xing et al., 2023), resulting in inflammation and oxidative stress. The inflammatory response mediated by proinflammatory cytokines plays a protective role by eliminating harmful stimuli and facilitating tissue repair. However, excessive proinflammatory cytokines can cause damage to self-tissues, trigger autoimmune diseases, and even lead to death. Research has shown that dietary ginsenoside Rg1 or Re can reduce IL-1β, IL-6 and TNF-α levels in the serum of broilers under LPS stress while improving host inflammation (Hu et al., 2023a). In this study, dietary supplementation with 400 mg/kg HYG alleviated or inhibited the abnormal increase in proinflammatory cytokine levels induced by LPS, and increased level of the anti-inflammatory cytokine IL-4. Upon invasion by LPS, TLR4 signaling is activated, which subsequently triggers downstream signaling pathways including the MAPK, NF-κB and JAK-STAT pathways, that regulate the expression of various inflammatory genes involved in the onset of host inflammation. Quercetin, mangiferin and hyperoside have been reported to downregulate host TLR4 gene expression and inhibit TLR4 signaling (Li et al., 2016; Sun et al., 2020; Yu et al., 2024), thereby suppressing inflammatory gene expression and reducing proinflammatory cytokine content in the serum. IL-4 plays a crucial role in protection and in upregulating MHC II generation (Butovsky et al., 2005; Whitley et al., 1993), enhancing antigen presentation and T-cell recognition of antigens, which helps the host to liminate pathogens. In addition, IL-4 promotes the differentiation of naive T cells into Th2 cells (Zhu, 2015; Cai et al., 2021), induces the expression of other anti-inflammatory cytokines, and reduces the levels of IL-1β and IL-6 in the serum, thus regulating the serum cytokine balance and alleviating host inflammatory responses.

Effects of HYG on the Anti-Inflammatory Functions of the Liver and Spleen in Broilers Under Oxidative Stress

The liver, an immune digestive organ in poultry, participates in various biological activities including substance metabolism, immune regulation and detoxification. The NF-κB signaling pathway is a complex biological signaling network in animal cells that actively participates in the inflammatory response, contributes to the immune response, and serves as a key regulator of the immune system (Wang et al., 2024c). Previous studies have reported that LPS invasion of broiler livers significantly upregulates the mRNA expression of TLR4, NF-κB, MyD88 and other factors within liver cells while inhibiting IκBα mRNA expression (Yang et al., 2019; Xing et al., 2021; Tong et al., 2022). It has been reported that hyperoside can increase the production of IκBα protein under stress conditions, inhibit NF-κB p65 protein production and phosphorylation, and prevent the nuclear translocation of NF-κB p65 (Ye et al., 2017; Yang et al., 2022). Additionally, hyperoside blocks TLR4 signal transduction (Sun et al., 2020). Quercetin has been shown to alleviate the phosphorylation of IκBα and NF-κB and inhibit the translocation of NF-κB p65 from the cytoplasm, thereby preventing inflammatory cytokine synthesis (Luo et al., 2022; Li et al., 2023). In this study, LPS-induced stress reduced synthesis of the IκB protein and induced the degradation and separation of the IκB protein in the NF-κB·IκB complex by downregulating IκBα mRNA expression coupled with upregulating IKKα mRNA expression. Consequently, this excitates the NF-κB dimer form and activates the NF-κB signaling pathway. Furthermore, it upregulates the transcription of proinflammatory cytokines, such as IL-6, and increases the levels of IL-6 and other proinflammatory cytokines in liver cells. Dietary HYG was found to inhibit IκB kinase complex synthesis by downregulating IKKα mRNA expression in the livers of broilers under oxidative stress, thereby maintaining stable binding of the NF-κB and IκB proteins. This effect inhibits the activation of the NF-κB signaling pathway and downregulates the expression proinflammatory cytokines such as IL-6. Additionally, the addition of HYG led to increased IL-10 mRNA expression, leading to increased levels of IL-10, which negatively regulated the NF-κB signaling pathway. Furthermore, HYG metabolites may prevent ubiquitination and degradation by binding to IκBα, thus preserving the stability of NF-κB binding to the IκB protein. Interestingly, our study revealed that adding a medium or high concentration of HYG to the diet could upregulate TLR4, MyD88 and NF-κB gene expression in liver cells, suggesting that this concentration of HYG could potentially activate Toll-like receptor signaling and NF-κB signaling pathways within the liver. However, these concentrations did not increase the expression of downstream proinflammatory cytokine genes, such as IL-6. This phenomenon might be attributed to the ability of HYG at these concentrations to inhibit the phosphorylation and nuclear translocation of NF-κB p65, resulting in suppressed transcriptional activity of the IL-6 gene. Nevertheless, these concentrations of HYG may have positive effects on the translation and modification of the IL-6 protein, thereby increasing the level of IL-6 within the liver.

MAPK signals play crucial roles in cell growth and development, the inflammatory response and tumor generation. Previous studies have demonstrated the inhibitory effects of quercetin, mangiferin and hyperoside on the expression of ERK1/2, JNK, and p38MAPK, therey hindering MAPK signal transduction and further inhibiting the downstream inflammatory response (Ma et al., 2015; Fan et al., 2017; Wang et al., 2021). Moreover, hyperoside, quercetin and mangiferin can also activate the Nrf2 signaling pathway to increase the cytoprotectivet capacity by promoting the expression of antioxidant enzymes (Xing et al., 2011; Rasooli et al., 2021; Jayasuriya and Ramkumar, 2022). In this study, the addition of HYG to the diet increased the IL-4 and IL-10 levels in the liver under LPS stress during various periods. This effect may occur because HYG has antioxidant properties, which increase the levels of antioxidant enzymes in the body while mitigating the oxidative damage caused by excessive free radicals. This process creates favorable conditions for the proliferation and differentiation of lymphocytes as well as the secretion of anti-inflammatory cytokines such as IL-4. Furthermore, the high concentration of HYG added to the diet may inhibit the production of IFN-γ in the liver through its ability to block MAPK signaling pathway activation, which contributes to reducing the hepatic inflammatory response and enhancing the anti-inflammatory capability ability to block.

The spleen serves as a crucial peripheral immune organ in poultry, contributing to both humoral and cellular immunity, and serves as an important site for antigen presentation, lymphocyte differentiation and proliferation, antibody production, and cytokine secretion. Studies have shown that LPS stress can activate the immune system of the spleen and induce the expression of inflammatory cytokines such as IL-6, TNF-α, IFN-γ and iNOS by spleen lymphocytes (Dai et al., 2008; Xue et al., 2022). In this study, LPS stress stimulated the secretion of proinflammatory cytokines, including IL-6 and TNF-α, in spleen cells while increasing the spleen index. These findings are consistent with several reports (Xue et al., 2022; Zhang et al., 2023a). Different concentrations of HYG had different effects on the expression of IL-4, IL-6 and other cytokines, but consistently promoted IL-10 mRNA expression and levels in the spleen at different times. Supplementation with HYG also increased the expression of IκBα and TNFRSF1B mRNAs in the spleens of 42-day-old broilers. HYG may enhance TNF- α signaling to provide accurate feedback on the immune status of spleen cells while also reshaping the homeostasis of the NF-κB·IκB complex by increasing IκBα and IL-10 expression to inhibit the activation of the NF-κB signaling pathway. This process contributes to regulating the balance of proinflammatory and anti-inflammatory cytokines in spleen cells, alleviating the inflammatory response within the spleen, and ultimately leading to a reduction in the spleen index. Pyroptosis is a novel form of programmed cell death characterized by destruction of the cell membrane and the release of inflammatory cytokines such as IL-1β and IL-18, which activate robust inflammatory responses (Hao and Feng, 2023). Recent studies have also demonstrated that LPS can participate in disease development through the induction of pyroptosis (Liu et al., 2022a; Wang et al., 2023b). A previous study reported that quercetin possesses anti-inflammatory activity but is protective against pyroptosis (Luo et al., 2022). The present study also revealed that adding medium or high concentrations of HYG to the diet increased TLR4 and NF-κB mRNA expression in broiler spleens under oxidative stress. Therefore, the addition of medium or high concentrations of HYG to the diet may also have a protective effect on the scorch death of splenic macrophages, which may be a potential cause of the increase in IL-1β and TNF-α levels in the spleen under LPS stress.

Effects of HYG on Jejunal Barrier Function in Broilers Under Oxidative Stress

The gut is not only the primary site for nutrient metabolism, but also regulates the immune system of broilers through the gut‒liver axis and the gut‒brain axis (Khongthong et al., 2023; Mo et al., 2023). The jejunum is the longest segment of the small intestine in broilers, and improving or maintaining its immune function is very important for enhancing broiler production performance. In this study, there were no significant differences in D-lactic acid levels in the serum between the treatment groups, indicating that HYG had no significant effect on intestinal permeability. MUC2, which is the main mucin within the intestinal mucosa, acts as a key component of the intestinal chemical barrier. The synthesis and secretion of the MUC2 protein are regulated by various factors including cytokines and signaling pathways such as the Notch, Wnt and ERK pathways (Liu et al., 2020; Yaxin Liu et al., 2023b). Cytokines such as IL-4, IL-13 and TNF-α have been shown to mediate MUC2 synthesis via the MAPK pathway (Iwashita et al., 2003), with p38 MAPK expression positively correlated with MUC2 transcription in cells (Li et al., 2013). Additionally, IL-10, an important anti-inflammatory cytokine, has been reported to negatively regulate intestinal goblet cell differentiation via feedback and reduce MUC2 transcription in goblet cells (Morales et al., 2022). In this study, dietary supplementation with 400mg/kg HYG resulted in a decrease in the MUC2 level in the jejunal mucosa at 21 d. This dose of HYG possibly alleviated the inflammatory response in the jejunum by increasing the IL-10 content in the jejunum tissue. However, excessive IL-10 content also inhibited goblet cell differentiation to a certain extent at 21 d. Although the addition of HYG at this concentration can increase the content of IL-4 and other anti-inflammatory cytokines in the jejunum, major flavonoids in HYG, such as hypericin and quercetin, can partially inhibit p38 MAPK expression, thereby blocking the MAPK signaling pathway and subsequently inhibiting MUC2 transcription. Consequently, the content of MUC2 in the jejunum mucosa decreased at 21 d. As the jejunum of broilers matured, the effect of HYG on the jejunum gradually weakened, whereas low-dose HYG had almost no effect on the IL-10 level, and only the medium or high dose promoted IL-10 expression in the jejunum tissue. This difference may explain why the MUC2 content in the jejunal mucosa of broilers at 42 d tended to decrease compared with that in thePC group but did not reach a significant level.

SIgA plays a crucial role in preventing pathogen attachment and interfering with viral replication. In this study, the addition of 1,200 mg/kg HYG promoted the synthesis and secretion of SIgA in the short term; however, prolonged exposure to HYG inhibited SIgA production. Research has demonstrated that a Hypericum plant extract, especially its flavonoid components, has significant cytotoxic and anti-inflammatory effects (Chen et al., 2020). Hyperoside can induce the apoptosis of cancer cells and inhibit their proliferation (Liu et al., 2016; Li et al., 2018). Quercetin is able to induce genetic instability and reduce cell activity and proliferation, exhibiting cytotoxicity and genotoxicity (Araújo et al., 2013; Engen et al., 2015). The decrease in SIgA secretion observed in this study may be attributed to long-term high-concentration HYG intake resulting in the accumulation of cytotoxic and genotoxic compounds associated with certain flavonoids present in HYG. This excessive accumulation exceeds the normal tolerance range of the body, thereby disturbing the normal proliferation of B lymphocytes and reducing the activity of B cells and plasma cells resulting in diminished synthetic secretion of SIgA.

Diamine oxidase is a highly active intracellular enzyme located in the villi of the small intestinal mucosa. When intestinal mucosal cells are damaged, DAO is released into the blood, leading to increased DAO level in the serum. Tight junctions, which are composed of multiple protein family members, are part of the intestinal physical barrier of the gut. The functionality of tight junction transport channels regulates ion movement between epithelial cells. Both the expression pattern and single amino acid substitution in tight junction proteins influence channel selectivity (Hartsock and Nelson, 2008). However, our study demonstrated that HYG failed to effectively ameliorate LPS-induced abnormalities in DAO and ZO-1, indicating that HYG may not be involved in the repair of mechanical barriers (Kuo et al., 2021). Furthermore, although a low concentration of HYG resulted in decreased jejunal ZO-2 mRNA expression, it did not significantly alter the serum DAO and DL contents compared with those in the CN and PC groups. This observation may indicate that HYG regulates the selective permeability of intestinal transport channels by regulating the expression of ZO family genes and other genes to improve the absorption and utilization of HYG or its digestive metabolites within the jejunum. These substances can subsequently rapidly reach the liver and spleen through the portal vein system and the blood circulation system, leading to a reduction in or inhibition of inflammation in the liver or spleen while enhancing their anti-inflammatory capacity. In addition, abnormal expression of jejunum ZO-2 might also be associated with gut‒liver axis signal transduction.

Effect of HYG on Cecal Microflora in Broilers Under Oxidative Stress

The intestinal microflora is a vital component of the digestive system and is also a constituent of the intestinal microbial barrier. It also plays a key role in maintaining the stability of the host intestinal environment. The diversity of the intestinal microflora forms the foundation for host nutrient digestion and absorption, immune regulation and metabolism. The results of this study revealed that HYG did not affect the diversity of the microflora, but rather influenced the relative abundance of some bacterial genera in the microflora.

The genetic factors, nutritional environment and physiological state of the host closely influence the composition of the intestinal microflora. The functionality of the host's intestinal microflora primarily relies on the dominant species in the gut as well as the abundant or absent species in the intestinal microflora. In this study, dietary HYG protected against or alleviated the LPS-induced decline in the relative abundances of Alistipes and Phascolarctobacterium. Furthermore, supplying low to medium concentrations of HYG also increased the relative abundances of Erysipelatoclostridium, Rikenella, Parabacteroides and Subdoligranulum. Spearman correlation analysis revealed a negative association between Phascolarctobacterium, Erysipelatoclostridium, Subdoligranulum and Parabacteroides and the activation of the NF-κB signaling pathway in the liver. Alistipes, a relatively new genus of Bacteroides, has been shown to metabolize glucose to produce beneficial short-chain fatty acids (SCFA), such as succinic acid, acetic acid, and propionic acid (Guo et al., 2021). Additionally, Alistipes produces sulfonolipids (Radka et al., 2022). Crataegus pinnatifida polysaccharide, Arctium lappa L polysaccharide and Iljinskaja polysaccharide have been reported to alleviate or inhibit the host inflammatory response by increasing the relative abundance of Alistipes in the intestine (Zhang et al., 2020; Guo et al., 2021; Lu et al., 2023). Phascolarctobacterium utilizes succinate as a growth substrate and inhibits colonization by harmful bacteria such as Clostridium difficile in the gut (Nagao-Kitamoto et al., 2020; Watanabe et al., 2012). Moreover, Phascolarctobacterium promotes the production of short-chain fatty acids, such as acetate and propionate (Wu et al., 2017), which are known to participate in the activation of the GPRs signaling pathway to regulate the inflammatory response and attenuate intestinal inflammation (Lin et al., 2023). Previous studies have reported that an increase in the relative abundance of Phascolarctobacterium positively influences remission from type 2 diabetes or intestinal inflammation and improves liver fibrosis (Feng et al., 2023a; He et al., 2023; Sun et al., 2023). Erysipelatoclostridium has been found to be closely associated with obesity (Ma et al., 2022; Chen et al., 2023). It heavily colonizes the intestine of fast-fertilizing chickens and is positively correlated with palmitoylethanolamine metabolism (Liu et al., 2022b). An increased relative abundance of Rikenella has been reported to contribute to the restoration of intestinal barrier function in hosts with colitis (Zhang et al., 2023b). Furthermore, numerous studies have reported that Rikenella is associated with host anti-inflammatory functions (Li et al., 2020; Yu et al., 2022; Ren et al., 2024). Additionally, Rikenella is coated with IgA in the intestine, which may explain why adding 800 mg/kg or 1200 mg/kg HYG at 42 d led to a certain decrease in the SIgA level in the jejunum mucosa. Study has reported that increasing the relative abundance of Parabacteroides in chick intestines can improve the resistance of chicks to interference by Salmonella enteritidis (Wang et al., 2022a). In broilers supplemented with Astragalus and licorice polysaccharides, the presence of Parabacteroides in the gut contributes to the expression of serum IgG and intestinal claudin-1, which improves the intestinal barrier (Qiao et al., 2022). Moreover, Parabacteroides has been implicated in pyroptosis and negatively affects SIgA expression in the chicken jejunum (Feng et al., 2023b; Liu et al., 2023c). This may be a potential reason for the decreased SIgA levels in the jejunal mucosa and the increased IL-1β levels in the jejunal tissue due to medium or high dose HYG addition at 42 d. The relative abundance of Subdoligranulum in the gut of chickens infected with Salmonella typhimurium was significantly diminished (Jan et al., 2023). The increased relative abundance of Subdoligranulum contributed to increased intestinal calcium retention in laying hens with osteoporosis (Jiang et al., 2023). Furthermore, several studies have reported that Subdoligranulum is also involved in the regulation of the inflammatory response (Huang et al., 2020; Wang et al., 2022b; Qin et al., 2023b). In this study, Spearman correlation analysis revealed that Helicobacter, Colidextribacter and UCG-005 were involved in the inflammatory response of the liver and spleen. Notably, dietary supplementation with HYG effectively reduced the relative abundances of UCG-005, Helicobacter and Colidextribacter in the cecum under LPS -induced stress. According to previous reports, Helicobacter is a pathogenic bacterial genus closely related to hepatitis and enteritis in poultry (Ceelen et al., 2006). The increased relative abundance of Colidextribacter was positively correlated with proinflammatory activity and inversely correlated with antioxidant enzyme activity and immunosuppressive remission (Sun et al., 2022; Yang et al., 2023). Moreover, the increased relative abundance of Colidextribacter was strongly associated with impaired intestinal barrier function (Leibovitzh et al., 2022). UCG-005 represents the predominant bacterial species in the gut of hosts with recurrent ulcerative colitis (Liu et al., 2023d). Selimonas, a characteristic genus of the HYG1 group, plays a regulatory role in amino acid and carbohydrate metabolism as well as energy production and transformation in broilers, as revealed through high-frequency gene coding (Liu et al., 2021). An increase in the relative abundance of Selimonas in the cecum of broilers is negatively correlated with glutamic oxalocetic transaminase levels and contributes to alleviating fatty liver disease induced by a high-fat diet (Hu et al., 2023b). Papillibacter is another characteristic guns of the HYG1 group. Research has reported that Papillibacter cinnamivorans attenuated the proinflammatory response and improved intestinal barrier function through the modulation of the YAK-STAT signaling pathway, thereby regulating lipid metabolism and hepatic thermogenesis. (Zong et al., 2023).

CONCLUSIONS

Dietary supplementation with 400 mg/kg HYG can regulate the balance of cytokines in the serum, liver and spleen by inhibiting the activation of the NF-κB signaling pathway in the liver and spleen of broilers, which contributes to ameliorating thymus and spleen abnormalities and restoring the disturbed serum immunoglobulin levels induced by LPS. The addition of HYG should regulate the cecal microflora composition to improve body metabolism and alleviate the systemic inflammatory response by increasing the relative abundance of beneficial bacteria such as Alistipes and Phascolarctobacterium. In the future, the internal mechanism by which HYG improves the immune performance of broilers needs to be further studied.

DISCLOSURES

The authors declare no conflict of interest.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

The study was financially supported by the 10.13039/501100001809 National Natural Science Foundation of China (No. 31600258 ) and the Science and Technology Research Project of the Education Department of Jilin Province (No. JJKH20220372KJ ).

Ethics Approval: All experimental procedures were approved by the Animal Ethics Committee of Jilin Agricultural University (Changchun, China).

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2024.104189.
==== Refs
REFERENCES

Antonissen G. De Baere S. Devreese M. Van Immerseel F. Martel A. Croubels S. Feed contamination with Fusarium mycotoxins induces a corticosterone stress response in broiler chickens Poult. Sci. 96 2017 14 17 27591283
Araújo K.C.F. de M.B. Costa E.M. Pazini F. Valadares M.C. de Oliveira V. Bioconversion of quercetin and rutin and the cytotoxicity activities of the transformed products Food Chem. Toxicol. 51 2013 93 96 23000251
Butovsky O. Talpalar A.E. Ben-Yaakov K. Schwartz M. Activation of microglia by aggregated β-amyloid or lipopolysaccharide impairs MHC-II expression and renders them cytotoxic whereas IFN-γ and IL-4 render them protective Mol. Cell. Neurosci. 29 2005 381 393 15890528
Cai G. Liu S. Zhong F. Gu J. Yuan Y. Zhu J. Zhu G. Liu Z. Zou H. Bian J. Zearalenone and deoxynivalenol inhibited IL-4 receptor-mediated Th2 cell differentiation and aggravated bacterial infection in mice Toxicol. Appl. Pharmacol. 415 2021 115441
Ceelen L.M. Haesebrouck F. Favoreel H. Ducatelle R. Decostere A. The cytolethal distending toxin among Helicobacter pullorum strains from human and poultry origin Vet. Microbiol. 113 2006 45 53 16310982
Chen G. Peng Y. Huang Y. Xie M. Dai Z. Cai H. Dong W. Xu W. Xie Z. Chen D. Fan X. Zhou W. Kan X. Yang T. Chen C. Sun Y. Zeng X. Liu Z. Fluoride induced leaky gut and bloom of Erysipelatoclostridium ramosum mediate the exacerbation of obesity in high-fat-diet fed mice J. Adv. Res. 50 2023 35 54 36341987
Chen Q. Di L. Zhang Y. Li N. Chemical constituents with cytotoxic and anti-inflammatory activity in Hypericum sampsonii and the antitumor potential under the view of cancer-related inflammation J. Ethnopharmacol. 259 2020 112948
Dai R. Phillips R.A. Zhang Y. Khan D. Crasta O. Ahmed S.A. Suppression of LPS-induced Interferon-γ and nitric oxide in splenic lymphocytes by select estrogen-regulated microRNAs: a novel mechanism of immune modulation Blood 112 2008 4591 4597 18791161
El-Saadony M.T. Saad A.M. Yang T. Salem H.M. Korma S.A. Ahmed A.E. Mosa W.F.A. Abd El-Mageed T.A. Selim S. Al Jaouni S.K. Zaghloul R.A. Abd El-Hack M.E. El-Tarabily K.A. Ibrahim S.A. Avian campylobacteriosis, prevalence, sources, hazards, antibiotic resistance, poultry meat contamination, and control measures: a comprehensive review Poult. Sci. 102 2023 102786
Engen A. Maeda J. Wozniak D.E. Brents C.A. Bell J.J. Uesaka M. Aizawa Y. Kato T.A. Induction of cytotoxic and genotoxic responses by natural and novel quercetin glycosides Mutat. Res. Toxicol. Environ. Mutagen. 784–785 2015 15 22
Erinle T.J. MacIsaac J. Yang C. Adewole D.I. Effect of red osier dogwood extract on growth performance, blood biochemical parameters, and gut functionality of broiler chickens challenged or unchallenged intraperitoneally with Salmonella Enteritidis lipopolysaccharide Poult. Sci. 101 2022 101861
Fan H.H. Zhu L.B. Li T. Zhu H. Wang Y.-N. Ren X.L. Hu B.L. Huang C.-P. Zhu J.-H. Zhang X. Hyperoside inhibits lipopolysaccharide-induced inflammatory responses in microglial cells via p38 and NFκB pathways Int. Immunopharmacol. 50 2017 14 21 28622577
Farag S.A. El-Keredy A. Abd El Gawad S.A. Swelum A.A. Tellez-Isaias G. Abouzeid A.E. Impacts of willow (Salix babylonica L.) leaf extract on growth, cecal microbial population, and blood biochemical parameters of broilers Poult. Sci. 103 2024 103386
Fedyk E.R. Phipps R.P. Reactive oxygen species and not lipoxygenase products are required for mouse B-lymphocyte activation and differentiation Int. J. Immunopharmacol. 16 1994 533 546 7928003
Feng H.Y. Xiong J.Y. Liang S.S. Wang Y.L. Zhu Y.F. Hou Q.H. Yang X.J. Yang X. Fecal virus transplantation has more moderate effect than fecal microbiota transplantation on changing gut microbial structure in broiler chickens: FMT or FVT and broiler jejunum Poult. Sci. 103 2023 103282
Feng J. Li Z. Ma H. Yue Y. Hao K. Li J. Xiang Y. Min Y. Quercetin alleviates intestinal inflammation and improves intestinal functions via modulating gut microbiota composition in LPS-challenged laying hens Poult. Sci. 102 2023 102433
Guo C. Wang Y. Zhang S. Zhang X. Du Z. Li M. Ding K. Crataegus pinnatifida polysaccharide alleviates colitis via modulation of gut microbiota and SCFAs metabolism Int. J. Biol. Macromol. 181 2021 357 368 33774071
Hao W. Feng C. Research progress on pyroptosis and its effect on the central nervous system Neurobiol. Dis. 188 2023 106333
Hartsock A. Nelson W.J. Adherens and tight junctions: structure, function and connections to the actin cytoskeleton Biochim. Biophys. Acta BBA - Biomembr., Apical Junctional Complexes Part I 1778 2008 660 669
He X. Liang J. Li X. Wang Y. Zhang X. Chen D. Wu L. Wang S. Dahuang zhechong pill ameliorates hepatic fibrosis by regulating gut microbiota and metabolites J. Ethnopharmacol. 321 2023 117402 37967779
Hu D. Hou M. Song P. Chen Q. Feng Y. Wu X. Ni Y. Dietary bile acids supplementation improves the growth performance and alleviates fatty liver in broilers fed a high-fat diet via improving the gut microbiota Poult. Sci. 103 2023 103270
Hu W. Bi S. Shao J. Qu Y. Zhang L. Li J. Chen S. Ma Y. Cao L. Ginsenoside Rg1 and Re alleviates inflammatory responses and oxidative stress of broiler chicks challenged by lipopolysaccharide Poult. Sci. 102 2023 102536
Huang S.M. Wu Z.H. Li T.T. Liu C. Han D.D. Tao S.Y. Pi Y. Li N. Wang J.J. Perturbation of the lipid metabolism and intestinal inflammation in growing pigs with low birth weight is associated with the alterations of gut microbiota Sci. Total Environ. 719 2020 137382
Islam R. Sultana N. Bhakta S. Haque Z. Hasan A. Siddique M.P. Islam M.R. Modulation of growth performance, gut morphometry, and cecal microbiota in broilers by clove (Syzygium aromaticum) and tulsi (Ocimum sanctum) supplementation Poult. Sci. 102 2023 102266
Iwashita J. Sato Y. Sugaya H. Takahashi N. Sasaki H. Abe T. mRNA of MUC2 is stimulated by IL-4, IL-13 or TNF-α through a mitogen-activated protein kinase pathway in human colon cancer cells Immunol. Cell Biol. 81 2003 275 282 12848848
Jahromi M.F. Liang J.B. Ebrahimi R. Soleimani A.F. Rezaeizadeh A. Abdullah N. Shokryazdan P. Protective potential of Lactobacillus species in lead toxicity model in broiler chickens Animal 11 2017 755 761 27804905
Jan T.R. Lin C.S. Yang W.Y. Differential cytokine profiling and microbial species involved in cecal microbiota modulations in SPF chicks immunized with a dual vaccine against Salmonella Typhimurium infection Poult. Sci. 103 2023 103334 38104411
Jayasuriya R. Ramkumar K.M. Mangiferin alleviates hyperglycemia-induced endothelial impairment via Nrf2 signaling pathway Eur. J. Pharmacol. 936 2022 175359
Jiang S. Zou X.Y. Mao M. Zhang M. Tu W.J. Jin M.L. Low Ca diet leads to increased Ca retention by changing the gut flora and ileal pH value in laying hens Anim. Nutr. 13 2023 270 281 37168452
Jin D.X. He J.F. Luo X.G. Zhang T.C. Hypoglycemic effect of Hypericum attenuatum Choisy extracts on type 2 diabetes by regulating glucolipid metabolism and modulating gut microbiota J. Funct. Foods 52 2019 479 491
Jin D.X. He J.F. Zhang K.Q. Luo X.G. Zhang T.C. EtOAc extract of H. attenuatum Choisy inhibits inflammation by suppressing the NF-κB and MAPK pathways and modulating the gut microbiota Phytomedicine 57 2019 292 304 30802715
Jin D.X. He J.F. Zhang K.Q. Zhang N.Y. Phenolic composition, antioxidant, cytotoxic activities and cardioprotective effect of hydroalcoholic extract from aerial-parts of Hypericum attenuatum Fisch. ex Choisy Nat. Prod. Res. 38 2023 781 788 37029624
Khongthong S. Faroongsarng D. Roekngam N. Nopparat J. Kraitavin W. Pastor A. Steiner T. Theapparat Y. Sanguinarine-based isoquinoline alkaloids modulated the gut-brain axis and enhanced growth performance and gut integrity in natural heat stress broiler chickens Livest. Sci. 275 2023 105297
Kumari M. Gupta R.P. Bagri P. Singh R. Immunopathological studies on Escherichia coli infected broiler chickens fed on Aloe vera leaf extract Vet. Immunol. Immunopathol. 258 2023 110562
Kuo W.T. Zuo L. Odenwald M.A. Madha S. Singh G. Gurniak C.B. Abraham C. Turner J.R. The tight junction protein ZO-1 is dispensable for barrier function but critical for effective mucosal repair Gastroenterology 161 2021 1924 1939 34478742
Kurzawa-Zegota M. Najafzadeh M. Baumgartner A. Anderson D. The protective effect of the flavonoids on food-mutagen-induced DNA damage in peripheral blood lymphocytes from colon cancer patients Food Chem. Toxicol. 50 2012 124 129 21907754
Leibovitzh H. Lee S.-H. Xue M. Raygoza Garay J.A. Hernandez-Rocha C. Madsen K.L. Meddings J.B. Guttman D.S. Espin-Garcia O. Smith M.I. Goethel A. Griffiths A.M. Moayyedi P. Steinhart A.H. Panaccione R. Huynh H.Q. Jacobson K. Aumais G. Mack D.R. Abreu M.T. Bernstein C.N. Marshall J.K. Turner D. Xu W. Turpin W. Croitoru K. Altered gut microbiome composition and function are associated with gut barrier dysfunction in healthy relatives of patients with Crohn's disease Gastroenterology 163 2022 1364 1376.e10 35850197
Li H. Wang Q. Chen X. Ding Y. Li W. Mangiferin inhibits lipopolysaccharide-induced production of interleukin-6 in human oral epithelial cells by suppressing toll-like receptor signaling Arch. Oral Biol. 71 2016 155 161 27517515
Li J. Pang B. Shao D. Jiang C. Hu X. Shi J. Artemisia sphaerocephal Krasch polysaccharide mediates lipid metabolism and metabolic endotoxaemia in associated with the modulation of gut microbiota in diet-induced obese mice Int. J. Biol. Macromol. 147 2020 1008 1017 31726144
Li J. Wang Z. Xiao N. Guo S. Ai M. Endogenous reactive oxygen species (ROS)-driven protein oxidation regulates emulsifying and foaming properties of liquid egg white Int. J. Biol. Macromol. 268 2024 131843
Li J.P. Liao X.H. Xiang Y. Yao A. Song R.H. Zhang Z.J. Huang F. Dai Z.T. Zhang T.C. Hyperoside and let-7a-5p synergistically inhibits lung cancer cell proliferation via inducing G1/S phase arrest Gene 679 2018 232 240 30201337
Li L. Jiang W. Yu B. Liang H. Mao S. Hu X. Feng Y. Xu J. Chu L. Quercetin improves cerebral ischemia/reperfusion injury by promoting microglia/macrophages M2 polarization via regulating PI3K/Akt/NF-κB signaling pathway Biomed. Pharmacother. 168 2023 115653
Li Y. Song J. Yu H. Wu S. PGE2 induces MUC2 and MUC5AC expression in human intrahepatic biliary epithelial cells via EP4/p38MAPK activation Ann. Hepatol. 12 2013 479 486 23619266
Liao J. Yang F. Chen H. Yu W. Han Q. Li Y. Hu L. Guo J. Pan J. Liang Z. Tang Z. Effects of copper on oxidative stress and autophagy in hypothalamus of broilers Ecotoxicol. Environ. Saf. 185 2019 109710
Lin J.P. Yang J.S. Lu C.C. Chiang J.H. Wu C.L. Lin J.J. Lin H.L. Yang M.D. Liu K.C. Chiu T.H. Chung J.G. Rutin inhibits the proliferation of murine leukemia WEHI-3 cells in vivo and promotes immune response in vivo Leuk. Res. 33 2009 823 828 19010542
Lin Y. Lv Y. Mao Z. Chen X. Chen Y. Zhu B. Yu Y. Ding Z. Zhou F. Polysaccharides from Tetrastigma Hemsleyanum Diels et Gilg ameliorated inflammatory bowel disease by rebuilding the intestinal mucosal barrier and inhibiting inflammation through the SCFA-GPR41/43 signaling pathway Int. J. Biol. Macromol. 250 2023 126167
Liu H. Feng X. Wang D. Liu L. Liu Y. Liu B. Zhu L. Zhang C. Yang W. Altered metabolome and microbiome features provide clues in predicting recurrence of ulcerative colitis J. Pharm. Biomed. Anal. 239 2023 115864
Liu J. Wang J. Zhou Y. Han H. Liu W. Li D. Li F. Cao D. Lei Q. Integrated omics analysis reveals differences in gut microbiota and gut-host metabolite profiles between obese and lean chickens Poult. Sci. 101 2022 102165
Liu M. Lu J. Yang S. Chen Y. Yu J. Guan S. Alliin alleviates LPS-induced pyroptosis via promoting mitophagy in THP-1 macrophages and mice Food Chem. Toxicol. 160 2022 112811
Liu S. Huang B. Cao J. Wang Y. Xiao H. Zhu Y. Zhang H. ROS fine-tunes the function and fate of immune cells Int. Immunopharmacol. 119 2023 110069
Liu Y. Liu G. Mei J. Wang J. The preventive effects of hyperoside on lung cancer in vitro by inducing apoptosis and inhibiting proliferation through Caspase-3 and P53 signaling pathway Biomed. Pharmacother. 83 2016 381 391 27419887
Liu Y. Yu X. Zhao J. Zhang H. Zhai Q. Chen W. The role of MUC2 mucin in intestinal homeostasis and the impact of dietary components on MUC2 expression Int. J. Biol. Macromol. 164 2020 884 891 32707285
Liu Y.L. Ye L. Chen H. Tsim K.W.K. Shen X. Li X.M. Li X.L. Lei H. Herbicide propisochlor exposure induces intestinal barrier impairment, microbiota dysbiosis and gut pyroptosis Ecotoxicol. Environ. Saf. 262 2023 115154
Liu Y.S. Li S. Wang X.F. Xing T. Li J.L. Zhu X.D. Zhang L. Gao F. Microbiota populations and short-chain fatty acids production in cecum of immunosuppressed broilers consuming diets containing γ-irradiated Astragalus polysaccharides Poult. Sci. 100 2021 273 282 33357691
Liu Y.X. Yu Z.H. Zhu L.P. Ma S. Luo Y. Liang H.X. Liu Q.L.F. Chen J.H. Guli S. Chen X. Orchestration of MUC2 — The key regulatory target of gut barrier and homeostasis: a review Int. J. Biol. Macromol. 236 2023 123862
Long L.N. Zhang H.H. Wang F. Yin Y.X. Yang L.Y. Chen J.S. Research note: effects of polysaccharide-enriched Acanthopanax senticosus extract on growth performance, immune function, antioxidation, and ileal microbial populations in broiler chickens Poult. Sci. 100 2021 101028
Lu H. Shen M. Chen Y. Yu Q. Chen T. Xie J. Alleviative effects of natural plant polysaccharides against DSS-induced ulcerative colitis via inhibiting inflammation and modulating gut microbiota Food Res. Int. 167 2023 112630
Luo X. Bao X. Weng X. Bai X. Feng Y. Huang J. Liu S. Jia H. Yu B. The protective effect of quercetin on macrophage pyroptosis via TLR2/Myd88/NF-κB and ROS/AMPK pathway Life Sci 291 2022 120064
Lv Y. Hao J. Liu C. Huang H. Ma Y. Yang X. Tang L. Anti-diabetic effects of a phenolic-rich extract from Hypericum attenuatum Choisy in KK-Ay mice mediated through AMPK /PI3K/Akt/GSK3β signaling and GLUT4, PPARγ, and PPARα expression J. Funct. Foods 61 2019 103506
Ma J.Q. Li Z. Xie W.R. Liu C.M. Liu S.S. Quercetin protects mouse liver against CCl4-induced inflammation by the TLR2/4 and MAPK/NF-κB pathway Int. Immunopharmacol. 28 2015 531 539 26218279
Ma Y. Wang Y. Gao Y. Fu Y. Li J. Total flavonoids from Ganshanbian (Herba Hyperici Attenuati) effect the expression of CaL-α1C and KATP-Kir6.1 mRNA of the myocardial cell membrane in myocardial ischemia-reperfusion arrhythmia rats J. Tradit. Chin. Med. 34 2014 357 361 24992765
Ma Y. Zhu L. Ke H. Jiang S. Zeng M. Oyster (Crassostrea gigas) polysaccharide ameliorates obesity in association with modulation of lipid metabolism and gut microbiota in high-fat diet fed mice Int. J. Biol. Macromol. 216 2022 916 926 35868410
Madkour M. Abdel-Fattah S.A. Ali S.I. Ali N.G.M. Shourrap M. Hosny M. Elolimy A.A. Impact of in ovo feeding of grape pomace extract on the growth performance, antioxidant status, and immune response of hatched broilers Poult. Sci. 103 2024 103914
Mehdi Y. Létourneau-Montminy M.-P. Gaucher M.-L. Chorfi Y. Suresh G. Rouissi T. Brar S.K. Côté C. Ramirez A.A. Godbout S. Use of antibiotics in broiler production: global impacts and alternatives Anim. Nutr. 4 2018 170 178 30140756
Mo Q. Kulyar M.F.-A. Quan C. Ding Y. Zhang Y. Zhang L. Pan H. Li J. Thiram-induced hyperglycemia causes tibial dyschondroplasia by triggering aberrant ECM remodeling via the gut-pancreas axis in broiler chickens J. Hazard. Mater. 444 2023 130368
Morales R.A. Rabahi S. Diaz O.E. Salloum Y. Kern B.C. Westling M. Luo X. Parigi S.M. Monasterio G. Das S. Hernández P.P. Villablanca E.J. Interleukin-10 regulates goblet cell numbers through Notch signaling in the developing zebrafish intestine Mucosal Immunol 15 2022 940 951 35840681
Muruganandan S. Lal J. Gupta P.K. Immunotherapeutic effects of mangiferin mediated by the inhibition of oxidative stress to activated lymphocytes, neutrophils and macrophages Toxicology 215 2005 57 68 16076520
Nagao-Kitamoto H. Leslie J.L. Kitamoto S. Jin C. Thomsson K.A. Gillilland M.G. Kuffa P. Goto Y. Jenq R.R. Ishii C. Hirayama A. Seekatz A.M. Martens E.C. Eaton K.A. Kao J.Y. Fukuda S. Higgins P.D.R. Karlsson N.G. Young V.B. Kamada N. Interleukin-22-mediated host glycosylation prevents Clostridioides difficile infection by modulating the metabolic activity of the gut microbiota Nat. Med. 26 2020 608 617 32066975
Novo M.C.T. Osugui L. dos Reis V.O. Longo-Maugéri I.M. Mariano M. Popi A.F. Blockage of Wnt/β-catenin signaling by quercetin reduces survival and proliferation of B-1 cells in vitro Immunobiology 220 2015 60 67 25245014
Qiao Y. Liu C. Guo Y. Zhang W. Guo W. Oleksandr K. Wang Z. Polysaccharides derived from Astragalus membranaceus and Glycyrrhiza uralensis improve growth performance of broilers by enhancing intestinal health and modulating gut microbiota Poult. Sci. 101 2022 101905
Qin H. Fu Y. Zhou K. Song H. Fang G. Chen Q. Pang Y. Toddalia asiatica extract attenuates adjuvant-induced arthritis by modulating colon Th17/Treg balance and colony homeostasis J. Ethnopharmacol. 313 2023 116542
Qin L. Huang T. Jing R. Wen J. Cao M. Mulberry leaf extract reduces abdominal fat deposition via adenosine-activated protein kinase/sterol regulatory element binding protein-1c/acetyl-CoA carboxylase signaling pathway in female Arbor Acre broilers Poult. Sci. 102 2023 102638
Radka C.D. Miller D.J. Frank M.W. Rock C.O. Biochemical characterization of the first step in sulfonolipid biosynthesis in Alistipes finegoldii J. Biol. Chem. 298 2022 102195
Rasooli Z. Hemmati M. Khodabandehloo H. Esmaeilzadeh A. Mohammadi D. Impact of adiponectin and quercetin on alleviating palmitic acid-induced kidney cell damage through Keap1/Nrf2 pathway Gene Rep 25 2021 101362
Ren D. Ding M. Su J. Ye J. He X. Zhang Y. Shang X. Stachyose in combination with L. rhamnosus GG ameliorates acute hypobaric hypoxia-induced intestinal barrier dysfunction through alleviating inflammatory response and oxidative stress. Free Radic Biol. Med. 212 2024 505 519
Shams Shargh M. Dastar B. Zerehdaran S. Khomeiri M. Moradi A. Effects of using plant extracts and a probiotic on performance, intestinal morphology, and microflora population in broilers J. Appl. Poult. Res. 21 2012 201 208
Sun M. Li D. Hua M. Miao X. Su Y. Chi Y. Li Y. Sun R. Niu H. Wang J. Analysis of the alleviating effect of black bean peel anthocyanins on type 2 diabetes based on gut microbiota and serum metabolome J. Funct. Foods 102 2023 105456
Sun T. Liu Y. Li M. Yu H. Piao H. Administration with hyperoside sensitizes breast cancer cells to paclitaxel by blocking the TLR4 signaling Mol. Cell. Probes 53 2020 101602
Sun Y. Wang F. Liu Y. Liu S. An Y. Xue H. Wang J. Xia F. Chen X. Cao Y. Microbiome-metabolome responses of Fuzhuan brick tea crude polysaccharides with immune-protective benefit in cyclophosphamide-induced immunosuppressive mice Food Res. Int. Ott. Ont 157 2022 111370
Tan H. Zhen W. Bai D. Liu K. He X. Ito K. Liu Y. Li Y. Zhang Y. Zhang B. Ma Y. Effects of dietary chlorogenic acid on intestinal barrier function and the inflammatory response in broilers during lipopolysaccharide-induced immune stress Poult. Sci. 102 2023 102623
Tong Y. Yu C. Xie Z. Zhang X. Yang Z. Wang T. Trans-anethole ameliorates lipopolysaccharide-induced acute liver inflammation in broilers via inhibiting NF-κB signaling pathway Poult. Sci. 101 2022 101962
Wang C. Chen D. Wu S. Zhou W. Chen X. Zhang Q. Wang L. Dietary supplementation with Neolamarckia cadamba leaf extract improves broiler meat quality by enhancing antioxidant capacity and regulating metabolites Anim. Nutr. 17 2024 358 372 38800732
Wang H. Chai Y. Xu Y. Wang Y. Li J. Zhang R. Bao J. Long-term music stimulating alleviated the inflammatory responses caused by acute noise stress on the immune organs of broilers by NF-κB signaling pathway Ecotoxicol. Environ. Saf. 273 2024 116131
Wang H. Zheng X. Lin Y. Zheng X. Yan M. Li Y. Shi D. Guo S. Liu C. The mixture of Radix isatidis, Forsythiae, and Gypsum alleviates lipopolysaccharide-induced fever in broilers by inhibition of TLR4/NF-κB signaling pathway Poult. Sci. 102 2023 103032
Wang J. Deng L. Chen M. Che Y. Li L. Zhu L. Chen G. Feng T. Phytogenic feed additives as natural antibiotic alternatives in animal health and production: A review of the literature of the last decade Anim. Nutr. 17 2024 244 264 38800730
Wang R. Liu J. Wang Z. Wu X. Guo H. Jiao X. Zhang H. Qi C. Li X. Mangiferin exert protective effects on joints of adjuvant-induced arthritis rats by regulating the MAPKs/NF-κB pathway of fibroblast-like synoviocytes Int. Immunopharmacol. 101 2021 108352
Wang X. Wu X. Cong X. Ren J. Li J. Zhu J. Dai M. Hrabchenko N. Du Y. Qi J. The functional role of fecal microbiota transplantation on Salmonella Enteritidis infection in chicks Vet. Microbiol. 269 2022 109449
Wang X.H. Yang Y.N. Liang Y. Lang R. Zeng Q. Yan L. Yu R.H. Wu C.M. Structural modulation of gut microbiota during alleviation of experimental passive Heymann nephritis in rats by a traditional Chinese herbal formula Biomed. Pharmacother. Biomedecine Pharmacother. 145 2022 112475
Wang Z. Huang S. Xue Z. Gao K. Sun M. Wang A. Lin P. Jin Y. UFM1 inhibits the activation of the pyroptosis in LPS-induced goat endometritis Theriogenology 196 2023 50 58 36395577
Watanabe Y. Nagai F. Morotomi M. Characterization of Phascolarctobacterium succinatutens sp. nov., an asaccharolytic, succinate-utilizing bacterium isolated from human feces Appl. Environ. Microbiol. 78 2012 511 518 22081579
Whitley M.Z. Cheng H.-L. Tomasi T.B. Boothby M. Distinct IL-4 response mechanisms of the MHC GENE Aα IN different mouse b cell lines Mol. Immunol. 30 1993 821 832 8321247
Wu F. Guo X. Zhang J. Zhang M. Ou Z. Peng Y. Phascolarctobacterium faecium abundant colonization in human gastrointestinal tract Exp. Ther. Med. 14 2017 3122 3126 28912861
Xie K. He X. Hu G. Zhang H. Chen Y. Hou D.X. Song Z. The preventive effect and mechanisms of adsorbent supplementation in low concentration aflatoxin B1 contaminated diet on subclinical symptom and histological lesions of broilers Poult. Sci. 101 2022 101634
Xing H.Y. Liu Y. Chen J.H. Sun F.J. Shi H.Q. Xia P.Y. Hyperoside attenuates hydrogen peroxide-induced L02 cell damage via MAPK-dependent Keap1–Nrf2–ARE signaling pathway Biochem. Biophys. Res. Commun. 410 2011 759 765 21689633
Xing Y. Zheng Y. Yang S. Zhang L. Guo S. Shi L. Xu Y. Jin X. Yan S. Shi B. Artemisia ordosica polysaccharide ameliorated LPS-induced growth inhibition and intestinal injury in broilers through enhancing immune-regulation and antioxidant capacity J. Nutr. Biochem. 115 2023 109284
Xing Y.Y. Zheng Y.K. Yang S. Zhang L.H. Guo S.W. Shi L.L. Xu Y.Q. Jin X. Yan S.M. Shi B.L. Artemisia ordosica Polysaccharide Alleviated Lipopolysaccharide-induced Oxidative Stress of Broilers via Nrf2/Keap1 and TLR4/NF-κB Pathway Ecotoxicol. Environ. Saf. 223 2021 112566
Xue D. Wei J. Lu W. Xia B. Li S. Liu D. Liu N. Wang X. Lin G. BDE-47 disturbs the immune response of lymphocytes to LPS by downregulating NF-κB pathway Chemosphere 308 2022 136562
Yang J.X. Maria T.C. Zhou B. Xiao F.L. Wang M. Mao Y.J. Li Y. Quercetin improves immune function in Arbor Acre broilers through activation of NF-κB signaling pathway Poult. Sci. 99 2020 906 913 32029167
Yang L. Liu G. Zhu X. Luo Y. Shang Y. Gu X.-L. The anti-inflammatory and antioxidant effects of leonurine hydrochloride after lipopolysaccharide challenge in broiler chicks Poult. Sci. 98 2019 1648 1657 30476291
Yang L. Wang Y. Zheng G. Li Z. Mei J. Resveratrol-loaded selenium/chitosan nano-flowers alleviate glucolipid metabolism disorder-associated cognitive impairment in Alzheimer's disease Int. J. Biol. Macromol. 239 2023 124316
Yang Y. Huang J.-J. Zhu G.-S. Hu W. Hyperoside attenuates osteoarthritis progression by targeting PI3K/Akt/NF-κB signaling pathway: In vitro and in vivo studies J. Funct. Foods 95 2022 105169
Ye P. Yang X. Chen X. Shi C. Hyperoside attenuates OVA-induced allergic airway inflammation by activating Nrf2 Int. Immunopharmacol. 44 2017 168 173 28107754
Yu J. Fu R. Buhe A. Xu B. Quercetin attenuates lipopolysaccharide-induced hepatic inflammation by modulating autophagy and necroptosis Poult. Sci. 103 2024 103719
Yu J. Zhao J. Xie H. Cai M. Yao L. Li J. Han L. Chen W. Yu N. Peng D. Dendrobium huoshanense polysaccharides ameliorate ulcerative colitis by improving intestinal mucosal barrier and regulating gut microbiota J. Funct. Foods 96 2022 105231
Yuzbasioglu D. Dilek U.K. Erikel E. Unal F. Antigenotoxic effect of hyperoside against Mitomycin C and hydrogen peroxide-induced genotoxic damage on human lymphocytes Toxicol. In Vitro 90 2023 105604
Zhang L.Z. Gong J.G. Li J.H. Hao Y.S. Xu H.J. Liu Y.C. Feng Z.H. Dietary resveratrol supplementation on growth performance, immune function and intestinal barrier function in broilers challenged with lipopolysaccharide Poult. Sci. 102 2023 102968
Zhang X. Zhang N. Kan J. Sun R. Tang S. Wang Z. Chen M. Liu J. Jin C. Anti-inflammatory activity of alkali-soluble polysaccharides from Arctium lappa L. and its effect on gut microbiota of mice with inflammation Int. J. Biol. Macromol. 154 2020 773 787 32199919
Zhang Y. Li Y. Bian T. Sun Y. Zhang Z. Liu T. Gao F. Wang Y. Cao R. Xin E. Yan X. Hedysari Radix Praeparata Cum Melle repairs impaired intestinal barrier function and alleviates colitis-associated colorectal cancer via remodeling gut microbiota and metabolism J. Funct. Foods 108 2023 105748
Zhu J. T helper 2 (Th2) cell differentiation, type 2 innate lymphoid cell (ILC2) development and regulation of interleukin-4 (IL-4) and IL-13 production Cytokine 2015 14 24 IL 4/IL 13 family 75
Zong X. Zhang H. Zhu L. Deehan E.C. Fu J. Wang Y. Jin M. Auricularia auricula polysaccharides attenuate obesity in mice through gut commensal Papillibacter cinnamivorans J. Adv. Res. 52 2023 203 218 Food and Drug Interaction with Gut Microbiota 37549868
