
==== Front
ACS Nano
ACS Nano
nn
ancac3
ACS Nano
1936-0851
1936-086X
American Chemical Society

39197041
10.1021/acsnano.4c05249
Article
Long Noncoding RNA NR_030777 Alleviates Cobalt Nanoparticles-Induced Neurodegenerative Damage by Promoting Autophagosome–Lysosome Fusion
Lin Xinpei †‡¶
Chen Cheng †‡¶
Chen Jinxiang †¶
Zhu Canlin †
Zhang Jiajun †
Su Ruiqi †
Chen Shujia †
Weng Shucan †
Chang Xiangyu †‡
Lin Shengsong †‡
Chen Yilong †‡
Li Jiamei †‡
Lin Ling §
Zhou Jinfu †∥
Guo Zhenkun †‡
Yu Guangxia †‡
Shao Wenya †‡
Hu Hong †‡
Wu Siying ‡⊥
Zhang Qunwei #
Li Huangyuan *†‡
https://orcid.org/0000-0003-3349-0862
Zheng Fuli *†‡
† Department of Preventive Medicine, School of Public Health, Fujian Medical University, Fuzhou, Fujian Province 350122, China
‡ The Key Laboratory of Environment and Health, School of Public Health, Fujian Medical University, Fuzhou, Fujian Province 350122, China
§ Public Technology Service Center, Fujian Medical University, Fuzhou, Fujian Province 350122, China
∥ Medical Genetic Diagnosis and Therapy Center, Fujian Maternity and Child Health Hospital College of Clinical Medicine for Obstetrics & Gynecology and Pediatrics, Fujian Medical University, Fuzhou, Fujian Province 350001, China
⊥ Department of Epidemiology and Health Statistics, School of Public Health, Fujian Medical University, Fuzhou, Fujian Province 350122, China
# Department of Epidemiology and Population Health, School of Public Health and Information Sciences, University of Louisville, 485 E. Gray Street, Louisville, Kentucky 40292, United States
* Email: lhy@fjmu.edu.cn.
* Email: f.zheng@fjmu.edu.cn.
28 08 2024
10 09 2024
18 36 2487224897
21 04 2024
22 08 2024
21 08 2024
© 2024 The Authors. Published by American Chemical Society
2024
The Authors
https://creativecommons.org/licenses/by-nc-nd/4.0/ Permits non-commercial access and re-use, provided that author attribution and integrity are maintained; but does not permit creation of adaptations or other derivative works (https://creativecommons.org/licenses/by-nc-nd/4.0/).

Potential exposure to cobalt nanoparticles (CoNPs) occurs in various fields, including hard alloy industrial production, the increasing use of new energy lithium-ion batteries, and millions of patients with metal-on-metal joint prostheses. Evidence from human, animal, and in vitro experiments suggests a close relationship between CoNPs and neurotoxicity. However, a systematic assessment of central nervous system (CNS) impairment due to CoNPs exposure and the underlying molecular mechanisms is lacking. In this study, we found that CoNPs induced neurodegenerative damage both in vivo and in vitro, including cognitive impairment, β-amyloid deposition and Tau hyperphosphorylation. CoNPs promoted the formation of autophagosomes and impeding autophagosomal–lysosomal fusion in vivo and in vitro, leading to toxic protein accumulation. Moreover, CoNPs exposure reduced the level of transcription factor EB (TFEB) and the abundance of lysosome, causing a blockage in autophagosomal–lysosomal fusion. Interestingly, overexpression of long noncoding RNA NR_030777 mitigated CoNPs-induced neurodegenerative damage in both in vivo and in vitro models. Fluorescence in situ hybridization assay revealed that NR_030777 directly binds and stabilizes TFEB mRNA, alleviating the blockage of autophagosomal–lysosomal fusion and ultimately restoring neurodegeneration induced by CoNPs in vivo and in vitro. In summary, our study demonstrates that autophagic dysfunction is the main toxic mechanism of neurodegeneration upon CoNPs exposure and NR_030777 plays a crucial role in CoNPs-induced autophagic dysfunction. Additionally, the proposed adverse outcome pathway contributes to a better understanding of CNS toxicity assessment of CoNPs.

cobalt nanoparticles
neurodegenerative damage
long noncoding RNA NR_030777
autophagy
TFEB
autophagosome–lysosome
National Natural Science Foundation of China 10.13039/501100001809 81903352 Innovation and Entrepreneurship Training Program for College Students of Fujian Medical University NA xy202210026 Innovation and Entrepreneurship Training Program for College Students of Fujian Medical University NA NA Innovation and Entrepreneurship Training Program for College Students of Fujian Medical University NA C23013 Fujian Provincial Key Laboratory of Molecular Neurology NA 2022-SJKF-001 Natural Science Foundation of Fujian Province 10.13039/501100003392 2023J01627 National Natural Science Foundation of China 10.13039/501100001809 82473660 National Natural Science Foundation of China 10.13039/501100001809 82311530107 document-id-old-9nn4c05249
document-id-new-14nn4c05249
ccc-price
==== Body
pmcCobalt nanoparticles (CoNPs) have been widely used in batteries, recording media, catalysts, magnetic applications, and the medical industry since the Industrial Revolution.1−3 The rapid growth of electric vehicles has led to an increased demand for cobalt.4,5 Workers exposed to cobalt during the manufacturing, grinding, and polishing of hard metal may suffer from attention and memory impairments due to inhaling fine cobalt-containing dust.6 Patients with metal-on-metal (MOM) hip replacements may be exposed to CoNPs through long-term wear of the prosthesis.7 More than one million individuals have undergone hip replacement surgery, raising concerns about the systemic effects of CoNPs released in MOM hip replacements. These patients may experience visual impairment, hearing loss, and numbness in hands and feet, suggesting that CoNPs can penetrate the blood–brain barrier and cause neurotoxic effects.8 Therefore, it is crucial to investigate the neurotoxicity of CoNPs to address the potential exposure in large populations.

Several in vitro studies have shown that CoNPs induce cell toxicity in various cell types. Co3O4 nanoparticles induced neurotoxicity in PC12 cells.9 Additionally, CoNPs induce cell apoptosis in PC12 cells and trigger inflammatory responses in microglia cells.10 Our previous research demonstrated that CoNPs exposure leads to mitochondrial damage and β-amyloid (Aβ) toxicity in Caenorhabditis elegans,11 as well as inflammatory responses and tau phosphorylation in both rats12 and mice,10 indicating a link between CoNPs and Alzheimer’s disease (AD). However, the sophisticated mechanism of CoNPs-induced AD remains incompletely understood.

AD is an age-related neurodegenerative disorder that is pathologically associated with increased production of Aβ and phosphorylated tau in the brain,13 causing neuronal loss and cognitive decline.14 Over 50 million people are suffering from AD worldwide as estimated in the year 2019, and the number is expected to grow by 10 million annually.15,16 The increasing prevalence of AD has imposed a significant social and economic burden globally.17 Autophagy typically facilitates the degradation of Aβ precursor protein (APP) and hyperphosphorylated tau.17,18 However, autophagy dysfunction is frequently linked to the pathological processes of neurodegenerative disorders.18,19 Post-mortem studies and animal models have provided evidence of impaired autophagy in the pathogenesis of AD, encompassing autophagy initiation, autophagosome formation, and clearance.13,20 Furthermore, autophagy is vulnerable to environmental stress, including metal nanoparticles, heavy metals, and pesticides.21,22 Autophagy is regulated by both external stressors, such as hypoxia and glucose depletion, and internal regulators, including signaling pathways, genetics, and epigenetics.23−25 Recently, we have observed that CoNPs promote the formation of autophagosomes in SH-SY5Y cells in our systems.26 Nevertheless, whether and how autophagy is involved in the neurotoxicity of CoNPs remains to be further elucidated.

Long noncoding RNA (LncRNA), defined as noncoding RNA exceeding 200 nucleotides, plays a crucial role in cellular processes.27 Accumulating evidence suggests that LncRNA regulates various physiological processes in cells, encompassing cell proliferation, invasion, metastasis, apoptosis, and autophagy.28,29 Additionally, studies spanning epidemiologic, physiologic, cellular, and molecular levels indicate that an increasing number of LncRNAs are associated with AD. Specifically, these LncRNAs contribute to AD development by facilitating the formation of Aβ plaques, tau phosphorylation, and inflammation.30 Our previous research revealed that LncRNA NR_030777 mitigates neurotoxicity triggered by the pesticide paraquat, an environmental stressor.31,32 Importantly, NR_030777 not only was affected by paraquat but also regulated by reactive oxygen species (ROS), indicating that the alteration of NR_030777 is not limited to paraquat treatment. Our previous demonstrated that CoNPs could promote the generation of ROS.33 Nevertheless, the underlying functions and mechanisms of NR_030777 in autophagy and its response to CoNPs exposure remain to be elucidated.

This study aimed to investigate whether CoNPs could induce neurodegenerative damage and the underlining role and mechanisms of NR_030777 in regulating autophagy. We hypothesized that CoNPs could alter the expression of NR_030777, leading to autophagic dysfunction and ultimately resulting in neurodegenerative damage. Following a comprehensive characterization of the CoNPs used in this study, neurobehavioral tests and the detection of AD and autophagy hallmark proteins confirmed CoNPs-induced neurodegenerative damage and autophagy dysfunction in C57BL/6 mice. Subsequently, to examine the causal relationship and underlying mechanism, CoNPs-induced autophagy was evaluated both in vivo and in vitro by analyzing autophagy-related proteins and autophagy flux. Genetic modifications (overexpression (OE) or knockdown (KD)) of NR_030777 were then employed to elucidate the role of NR_030777 in CoNPs-induced autophagy and AD-like neurodegenerative damage. Finally, the protective role of NR_030777 was further demonstrated in brain-specific NR_030777 OE mice.

Results

Characterization of CoNPs Used in This Study

First, the physical properties of CoNPs were thoroughly characterized. According to transmission electron microscope (TEM) and scanning electron microscope (SEM) analysis, CoNPs were predominantly spherical with a diameter of 34.89 nm (13.34–85.79 nm) in medium (Figure 1A,B). Subsequently, the properties of CoNPs at various concentrations in deionized (DI) water and culture medium were assessed to match the experimental conditions. The hydrodynamic diameters of CoNPs at different concentrations in both DI water and culture medium were similar but larger than the TEM size (Figure 1A,C). The Zeta potential of CoNPs at different concentrations in two diluting solutions was negative, while the Zeta potential in the culture medium was lower than in DI water at the same concentration (Figure 1D). The ultraviolet–visible (UV–vis) absorption peaks of CoNPs remained consistent across different concentrations in the two diluting solutions (Figure S1A,B). Simultaneously, the UV–vis absorption peaks of CoNPs in two diluting solutions were below 280 nm wavelength, but the emission shifted to 500–600 nm wavelength when transitioning from DI water to culture medium (Figure 1E). Evaluation of the photoluminescence (PL) of CoNPs at different concentrations in the two diluting solutions showed no impact on the fluorescence spectra (Figure S1C–F). Furthermore, the emission and excitation peaks in both diluting solutions were similar, although the fluorescence intensity in DI water was slightly higher than that in the culture medium (Figure 1F,G).

Figure 1 Characteristics of CoNPs. (A) TEM image shows the size of 500 μg/mL CoNPs in DMEM. (B) SEM image shows the morphology of 500 μg/mL CoNPs in DMEM. (C) The dynamic light scatter of CoNPs in DMEM and DI water. (D)The Zeta potential in DMEM and DI water. (E) UV–vis absorption spectra of CoNPs (30 μg/mL) in DMEM and DI water. (F) Excitation spectra of CoNPs (30 μg/mL) in DMEM and DI water at. λem = 420 and 480 nm, respectively. (G) Emission spectra of CoNPs (30 μg/mL) in DMEM and DI water. λex = 350 and 380 nm, respectively.

Cognitive Function in Mice was Impaired by CoNPs

Patients with AD-like neurodegenerative diseases exhibit a progressive decline in cognition and memory, similar to what is observed in mice20 Therefore, behavioral tests, such as the open field test, novel object recognition (NOR), and Morris water maze, were performed to assess cognitive decline in mice (Figure 2A). First, we assessed the spontaneous locomotor and exploratory activity of the mice in an open field test. CoNPs-exposed mice showed reduced time spent in the center zone compared to the control group, indicating decreased exploratory activity (Figure 2B,C).

Figure 2 CoNPs impair cognitive function in C57BL/6 mice. (A) Diagram of animal experiment design. (B,C) Spontaneous locomotor and exploratory activity were assessed using the open field test. (D,E) Short-term memory was examined using NOR trail. (F) The latency to escape to the island zone during the training period of Morris water maze. (G) Locus diagram of Morris water maze during the exploring period. (H) Time spent in the island zone during the exploration period. (I) Time spent in the third zone during the exploring period. Data were presented as mean ± SEM *, **P < 0.05, 0.01 compared with the control group. n = 12.

Cognitive deficits are crucial pathological features of neurodegenerative diseases, manifesting as reduced short-term memory and spatial learning and memory (Figure 2A).34 We evaluated the short-term memory impairment induced by CoNPs using a NOR test. All CoNPs exposure concentrations impaired mice’s preference for new objects (Figure 2D,E), clearly indicating short-term memory impairment. Subsequently, we utilized the Morris water maze to examine the spatial reference learning and memory of mice. During the training stage, all mice could reach the island location; however, CoNPs-exposed mice took longer to arrive at the island than the control group (Figure 2F). In the exploration stage, CoNPs-treated mice crossed the island significantly fewer times and spent less time in the third quadrant (Figure 2G–I). These findings indicate that CoNPs-exposed mice exhibited reduced exploration activity and impaired cognitive function.

CoNPs Increased the Expression of Hallmark Neurodegenerative Proteins in Mice

In addition to the cognitive impairment identified in behavioral trials, the proteins also displayed abnormal hyperphosphorylation and accumulation in the brain. Consequently, we assessed the levels of Aβ and p-tau proteins in the cortex and hippocampus of mice. As anticipated, the Aβ protein level markedly rose in both the cortex and hippocampus following CoNPs exposure, concomitant with elevated levels of APP protein in the brain (Figure 3A,E,F,H,L,M). Furthermore, multiple tau phosphorylation sites associated with neurodegeneration, particularly at Thr217 and Thr231, exhibited elevated levels in the cortex compared to the control group, whereas Thr181 remained unchanged (Figure 3A–D). Interestingly, in contrast to the cortex, all phosphorylation sites exhibited an increase in the hippocampus following CoNPs exposure (Figure 3H–K). Additionally, synaptic plasticity, governed by postsynaptic neurotransmitter receptors, is crucial for memory function. A reduction in postsynaptic density protein 95 (PSD95) levels was noted in both the cortex and hippocampus following exposure to 4 mg/kg CoNPs (Figure 3A,G,H,N). To visualize the distribution of this pathological protein in the brain, immunohistochemistry was employed. Our findings revealed the presence of phosphorylated tau and Aβ in both the hippocampus and cortex, coinciding with an escalation in CoNPs exposure dosage (Figure 4A–D). In conclusion, CoNPs could induce AD-like neurodegenerative damage in mice, as evidenced by behavioral tests and the presence of AD-hallmark proteins.

Figure 3 CoNPs increase the expression of neurodegenerative-related proteins in mice. (A–G) Western blot analyzed the neurodegenerative-related protein in the cortex. (H–N) Western blot analyzed the neurodegenerative-related protein in the hippocampus. Data were presented as mean ± SEM *, **P < 0.05, 0.01 compared with control group. n = 6.

Figure 4 Immunohistochemistry showed the expression of phosphorylated tau and Aβ in the brain. (A) The expression of p-tau (217). The white arrow indicates p-tau (217). (B) The expression of p-tau (231). The white arrow indicates p-tau (231). (C) The expression of p-tau (181). The white arrow indicates p-tau (181). (D) The expression of Aβ. The white arrow indicates Aβ. Scale bar = 200 μm. n = 3.

CoNPs Induced Autophagic Dysfunction in Mice

Extensive evidence has demonstrated the association between autophagic dysfunction and neurodegenerative diseases.35,36 Consequently, we assessed the levels of autophagy-related proteins in the cortex and hippocampus of mice exposed to CoNPs. As anticipated, the levels of Beclin1 and Microtubule-associated protein 1 light chain 3B (LC3B) proteins increased following exposure to CoNPs in both the cortex and hippocampus, suggesting enhanced autophagosome formation (Figure 5A,E,G,H,L,N). Subsequently, the upstream regulators of autophagy were investigated to confirm the autophagic dysfunction. In the cortex, the levels of phosphorylated mammalian target of rapamycin (p-mTOR) protein increased in the 4 and 8 mg/kg groups but decreased in the 12 mg/kg group. Consistent with mammalian target of rapamycin (mTOR), phosphorylated UNC-51-like kinase 1 (p-ULK1) (s757), a downstream target of mTOR, exhibited a similar expression pattern (Figure 5A–C). Conversely, the levels of p-ULK1 (s555) protein decreased in the 8 and 12 mg/kg groups (Figure 5A,D). P-ULK1 (s555) is activated by AMP-activated protein kinase (AMPK), which signifies an alternative autophagy-inducing pathway distinct from the mTOR pathway. These findings indicate that CoNPs can stimulate autophagic initiation in the cortex, albeit with variations in the activation pathway depending on the CoNPs concentrations. Conversely, in the hippocampus, the levels of p-mTOR protein and p-ULK1 (s757) also increased in all CoNPs groups. These results revealed that the activation of autophagy in the hippocampus relies on both mTOR/p-ULK1 (s757) and p-ULK1 (s555). Nevertheless, sequestosome 1 (P62), a specific substrate degraded by the autophagy–lysosome pathway and an indicator of autophagosome turnover, increased in both the cortex and hippocampus, indicating compromised autophagic flux in vivo (Figure 5). In conclusion, exposure to CoNPs can induce autophagic dysfunction in vivo, despite the unclear underlying mechanism.

Figure 5 CoNPs triggered autophagic dysfunction in mice. (A–G) Western blot analyzed autophagy related-protein in cortex. (H–N) Western blot analyzed autophagy related-protein in hippocampus. Data were presented as mean ± SEM *, **P < 0.05, 0.01 compared with control group. n = 6.

CoNPs Induced Autophagosome Accumulation in HT22 Cells

Here, to investigate the underlying mechanism of CoNPs-induced autophagy in detail, the mouse hippocampal neuron cell line HT22, a commonly used in vitro model for neurotoxicity assessment, was selected. First, we established a neurodegenerative damage model in vitro using the HT22 cell line. As shown in the result, CoNPs promoted the expression of phosphorylated tau protein and Aβ protein (Figure 6A, quantifications in Figure S3A–E). These results demonstrated that the neurodegenerative damage model in vitro was successfully established. Next, autophagic-related proteins were examined in HT22 cells. p-mTOR protein levels decreased after CoNPs treatment, suggesting the activation of autophagy. Simultaneously, Beclin1 and LC3B protein levels increased with CoNPs treatment, indicating the accumulation of autophagosomes (Figure 6B, quantifications in Figure S4A–E). Furthermore, mCherry-GFP-LC3B plasmid was transfected to HT22 cells to detect the turnover of autophagosomes. Compared to the control group, the accumulation of autophagosome (more yellow puncta) can be observed in CoNPs treatment group. This result was also corroborated by the upregulation of P62 protein upon CoNPs treatment, indicating potential blockage of autophagy (Figure 6D). Most importantly, the combination of chloroquine (CQ) and CoNPs treatment led to the same degree of P62 upregulation as CQ alone, assuring that CoNPs-induced P62 accumulation was due to the impaired autophagosome turnover, rather than the regulation of P62 gene transcription or translation (Figure 6D, quantifications in Figure S5A). Additionally, the blockage of autophagy flux by CQ further exacerbated the tau protein phosphorylation (Figure 6E, quantifications in Figure S5B,C), indicating that the blockage of autophagosome–lysosome is a mechanism of neurodegenerative damage induced by CoNPs. Collectively, the above results suggest that CoNPs can promote the dysfunction of autophagic flux by inducing autophagosome accumulation, thereby inducing neurodegenerative-like damage in vitro (Figure 6F).

Figure 6 CoNPs triggered autophagic dysfunction in HT22 cells. (A) The levels AD related proteins after CoNPs treatment. (B) The levels of autophagy-related proteins after CoNPs treatment. (C) Confocal images show autophagosome accumulation induced by CoNPs. (D) LC3B protein levels upon 50 nM CQ pretreatment. (E) The levels AD related proteins after CQ pretreatment. (F) Schematic diagram of CoNPs-induced autophagic dysfunction. Data were presented as mean ± SEM n = 3.

NR_030777 Alleviated Autophagic Dysfunction In Vitro

LncRNAs have been identified as crucial regulators in autophagy and neurological diseases.37 In this study, we observed a decrease in the level of NR_030777 following treatment with CoNPs in HT22 cells (Figure 7A). To elucidate the function of NR_030777, we performed the tagged RNA affinity purification (TRAP) experiment in N2a cells, followed by Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis. Interestingly, the KEGG analysis revealed the involvement of the autophagy pathway, suggesting a potential regulation of autophagy by NR_030777 (Figure 7B). Subsequently, the expression of autophagy-related proteins was assessed in NR_030777 OE-HT22 cells (Figure S6A). Consistent with expectations, the OE of NR_030777 decreased the levels of Beclin1 and LC3B in HT22 cells, suggesting that the excessive formation of autophagosomes was alleviated by NR_030777 OE. Concurrently, the levels of p-mTOR were restored upon OE of NR_030777. Additionally, the levels of P62 protein were reduced in the OE NR_030777 + CoNPs groups compared to the CoNPs groups alone (Figure 7C, quantifications in Figure S7A–E).

Figure 7 NR_030777 relieves abnormal accumulation of autophagosomes in CoNPs-treated HT22 cells. (A) The level of NR_030777 upon CoNPs treatment. (B) KEGG pathway analysis on NR_030777-enriched gene. (C) The level of autophagy-related proteins upon CoNPs treatment in OE NR_030777 HT22 cells. (D) The level of autophagy-related proteins after treated with CoNPs in KD NR_030777 HT22 cells. (E) Confocal images showed the alteration of LC3B in OE and KD NR_030777 HT22 cells. Scale bar = 10 μm. (F) The level AD related proteins in OE NR_030777 HT22 cells. (G) The level AD related proteins in KD NR_030777 HT22 cells. Data were presented as mean ± SEM n = 3.

To further validate the role of NR_030777 in autophagy, we generated a KD NR_030777 cell line using small interfering RNA in HT22 cells (Figure S6B). In contrast to OE NR_030777, the KD of NR_030777 led to a further reduction in p-mTOR protein levels compared to the CoNPs groups, as observed in KD NR_030777 + CoNPs groups. Moreover, the levels of Beclin1 and LC3B proteins were elevated in HT22 cells in the KD NR_030777 + CoNPs groups compared to the CoNPs groups, suggesting that KD of NR_030777 exacerbated the accumulation of autophagosomes. Furthermore, the levels of P62 protein were further elevated in KD NR_030777 + CoNPs HT22 cells compared to the CoNPs groups (Figure 7D, quantifications in Figure S8A–E). Additionally, the mCherry-GFP-LC3B plasmid showed consistent results for the level of LC3B protein. CoNPs treatment led to increase formation of autophagosomes (yellow puncta) compared to the negative control (NC) group. In contrast, the OE NR_030777 + CoNPs groups exhibited fewer yellow puncta and increased red puncta, suggesting that overexpressing NR_030777 could mitigate autophagosome accumulation. Conversely, the KD of NR_030777 exacerbated autophagosomes accumulation (Figure 7E). Subsequently, we explored the potential of NR_030777 in alleviating CoNPs-induced neurodegenerative damage. As anticipated, the upregulation of NR_030777 decreased tau protein phosphorylation and Aβ protein levels (Figure 7F, quantifications in Figure S9A–E), while the downregulation of NR_030777 intensified tau protein phosphorylation and reduced Aβ protein (Figure 7G, quantification in Figure S10A–E). In summary, NR_030777 seems to positively modulate autophagic dysfunction, thereby shielding cells from neurodegenerative harm caused by CoNPs.

Impaired Autophagosomal–Lysosomal Fusion upon CoNPs Treatment Was Linked to TFEB-Involved Blockade of Autophagic Flux

The aforementioned observation has clarified the mechanism behind CoNPs-induced autophagy dysfunction. Nonetheless, it is possible that CoNPs could target various stages of the autophagy pathway separately, potentially leading to a comprehensive disruption of the autophagic process. Consequently, we further investigated the mechanism responsible for the CoNPs-induced disruption of autophagic flux. Decreased lysosomal function and abnormalities in autophagosomal–lysosomal fusion serve as initial factors in impeding autophagic flux.38 To investigate these hypotheses, we initially evaluated the potential interference of CoNPs with lysosomal function by assessing lysosomal acidification, as the degradative capability of lysosomes is known to rely on their acidic milieu.39 Nevertheless, confocal microscopy indicated that CoNPs treatment does not induce lysosomal alkalization in HT22 cells (Figure S11A). Hence, the hindrance of autophagic flux seems unrelated to compromised lysosomal function. Another potential scenario involves the disruption of autophagosome fusion with lysosomes, a process facilitated by lysosome-associated membrane protein (LAMP) proteins.40 Initially, we examined the quantity and dimensions of lysosomes in CoNPs-treated HT22 cells. Confocal microscopy demonstrated a notable reduction in lysosome count following CoNPs treatment (Figure 8A). Additionally, flow cytometry confirmed the decrease in lysosomes in CoNPs-treated HT22 cells (Figure 8B,C). Furthermore, Western blot analysis revealed a substantial decrease in the levels of lysosomal marker proteins lysosome-associated membrane protein 1 (LAMP1) and lysosome-associated membrane protein 2 (LAMP2) following CoNPs treatment (Figure 8D–F). Overall, CoNPs hindered the fusion of autophagosomes with lysosomes by diminishing the quantity of lysosomes rather than their functionality.

Figure 8 CoNPs impaired the function of lysosomes both in vitro and in vivo. (A) Representative image of lysosomes in HT22 cells. Scale bar = 10 μm. (B,C) Flow cytometer shows the number of lysosomes in HT22 cells. (D–G) The expression of LAMP and TFEB in HT22 cells. (H–I) The distribution of TFEB at cytosol and nucleus in HT22 cells. (J) Confocal images revealed the levels of TFEB in cytosol and nucleus in HT22 cells. Scale bar = 10 μm. (K–N) The level of LAMP and TFEB in cortex. (O–R) The level of LAMP and TFEB in hippocampus. Data were presented as mean ± SEM *, ** and *** indicate P < 0.05, 0.01, and 0.001 compared with the control group. n = 3.

Transcription factor EB (TFEB) serves as a crucial transcription factor in the control of lysosomal biogenesis.41 Western blot analysis demonstrated a decrease in TFEB expression following CoNPs exposure in HT22 cells (Figure 8D,G). Functionally, TFEB translocates from the cytoplasm to the nucleus to activate lysosome-related genes such as LAMP1 and LAMP2. The level of TFEB in the nucleus was assessed using Western blot and immunofluorescence. The results indicated a decrease in nucleus TFEB with increasing CoNPs treatment, suggesting reduced lysosome-related gene transcription (Figure 8H–J). Additionally, the expression of these lysosome-related proteins was evaluated in vivo. Consistent with the in vitro findings, exposure to CoNPs led to decreased levels of LAMP1 and LAMP2 in the cortex and hippocampus. TFEB levels were also reduced in both the cortex and hippocampus upon CoNPs exposure (Figure 8K–R). In conclusion, CoNPs not only reduced the abundance of lysosomal, but also the inhibition of autophagosomal–lysosomal fusion via TFEB may hinder autophagy clearance and disrupt autophagic flux both in vitro and in vivo.

NR_030777 Alleviated the Dysfunction of Autophagosomal–Lysosomal fusion by Promoting TFEB Stability in CoNPs-Treated HT22 Cells

To further investigate the involvement of TFEB in CoNPs-induced blockage of autophagosomal–lysosomal fusion, TFEB was knocked down using a specific inhibitor, eltrombopag (Eltro). qRT-PCR and Western blot analysis demonstrated that Eltro reduced TFEB mRNA and protein levels, confirming the effectiveness of TFEB inhibition (Figure S12A,B). Interestingly, Eltro exacerbated tau protein phosphorylation in HT22 cells treated with CoNPs (Figure 9A–C), suggesting that the inhibition of autophagosomal–lysosomal fusion through TFEB reduction is crucial in CoNPs-induced neurodegenerative damage. However, the mechanism by which CoNPs induced TFEB reduction requires further investigation.

Figure 9 NR_030777 positively regulates TFEB protein in CoNPs-treated HT22 cells. (A–C) The level of tau phosphorylation after pretreated with 20 μM Eltro. (D–G) The expression of LAMP and TFEB in OE NR_030777 HT22 cells. (H–K) The level of TFEB in cytosol and nucleus in KD NR_030777 HT22 cells. (L,M) The number of lysosomes in OE or KD NR_030777 HT22 cells upon CoNPs treatments. (N–P) The level of tau phosphorylation. Data were presented as mean ± SEM *, ** and *** indicate P < 0.05, 0.01, and 0.001 compared with the control group. n = 3.

The TRAP experiment showed that NR_030777 may binds to TFEB mRNA, suggesting that NR_030777 may interact with TFEB mRNA to protect against CoNPs-induced neurodegenerative damage. Therefore, we examined the changes in TFEB protein levels following KD and OE of NR_030777. Western blot analysis revealed that overexpressed NR_030777 restored TFEB levels after CoNPs treatment (Figure 9D,G), whereas knockdowned NR_030777 exacerbated the decrease in TFEB levels following CoNPs treatment in HT22 cells (Figure 9H,K). Importantly, the downstream targets of TFEB, LAMP1 and LAMP2, were restored by overexpressing NR_030777 (Figure 9D–F) and aggravated by knockdowning NR_030777 (Figure 9H–J). Subsequently, we assessed the impact of NR_030777 on lysosome numbers. Flow cytometry showed that overexpressing NR_030777 increased lysosome numbers following CoNPs treatment, whereas knockdowning NR_030777 decreased lysosome abundance under CoNPs treatment. It is important to note that only OE or KD of NR_030777 did not affect lysosome abundance (Figure 9L,M). To provide additional evidence of NR_030777’s neuroprotective role through TFEB targeting, a rescue experiment was conducted. Our results showed that OE of NR_030777 could mitigate CoNPs-induced neurodegenerative damage, but this beneficial effect was abolished by inhibiting TFEB (Figure 9N–P).

The translocation of TFEB from the cytoplasm to the nucleus was investigated under conditions of NR_030777 KD and OE. Western blot analysis revealed that NR_030777 OE enhanced the nuclear TFEB level, whereas NR_030777 KD reduced it (Figure S13). Additionally, confocal microscopy analysis indicated that NR_030777 KD reduced TFEB nuclear translocation, whereas NR_030777 OE enhanced it (Figure 10A).

Figure 10 NR_030777 stabilized TFEB mRNA to play protective role in response to CoNPs treatment. (A) Confocal images revealed the level of TFEB in cytosol and nucleus in KD or OE NR_030777 HT22 cells. Scale bar = 10 μm. (B) TFEB mRNA stability in OE NR_030777 HT22 cells upon CoNPs treatment. (C) TFEB mRNA stability in KD NR_030777 HT22 cells upon CoNPs treatment. (D) The stability of TFEB mRNA was detected using Roadblock-qPCR methods. (E) FISH revealed the bind of NR_030777 and TFEB mRNA. Scale bar = 10 μm. Data were presented as mean ± SEM *, ** and *** indicate P < 0.05, 0.01, and 0.001 compared with the control group. n = 3.

To elucidate the mechanism underlying NR_030777 targeting of TFEB, we performed an mRNA stability assay through inhibiting global mRNA transcription synthesis. The results demonstrated that NR_030777 OE stabilized TFEB mRNA, whereas NR_030777 KD reduced its stability following CoNPs treatment (Figure 10B,C). Furthermore, the other method named Roadblock-qPCR, which exhausts the nascent transcripts, was used to confirm that NR_030777 stabilized TFEB mRNA. Consistent with previous result, NR_030777 OE promoted the stability of TFEB mRNA (Figure 10D). To determine whether NR_030777 directly binds to TFEB mRNA, fluorescence in situ hybridization (FISH) was performed in OE NR_030777 HT22 cells following CoNPs treatment. The FISH assay result revealed that NR_030777 was colocalized with TFEB mRNA. Furthermore, CoNPs reduced the colocalization level between NR_030777 and TFEB mRNA, whereas OE NR_030777 enhanced it (Figure 10E). In summary, NR_030777 directly binds to TFEB mRNA, promoting its stability and thereby exerting a protective role against CoNPs-induced neurodegenerative damage.

NR_030777 Restored Cognitive Function Impaired by CoNPs in Mice

To demonstrate the in vivo function of NR_030777, we established a brain-specific conditional OE mice model for NR_030777. qRT-PCR analysis confirmed the successful establishment of the NR_030777 overexpressing mice model. However, CoNPs exposure further decreased NR_030777 levels in the OE NR_030777 background (Figure S14A,B). To conclusively determine the neuroprotective effect of OE NR_030777 against CoNPs-induced neurodegenerative damage, behavioral experiments were conducted in mice (Figure 11A). Initially, an open field test was conducted to assess the spontaneous locomotor and exploratory activities of the mice. CoNPs exposure decreased the time spent in the center zone by mice, whereas NR_030777 OE increased this time, suggesting the restoration of exploratory activity in mice (Figure 11B,C). Following, NOR test was used to measure the equal preference for both old and new objects in mice exposed to CoNPs, whereas mice-overexpressing NR_030777 exposed to CoNPs spontaneously preferred new objects, indicating alleviation of short-term memory impairment by NR_030777 OE (Figure 11D,E). Finally, the Morris water maze was utilized to investigate the spatial reference learning and memory of mice. In the training stage, although all mice reached the island location, the NR_030777 + CoNPs groups spent less time arriving at the island compared with the CoNPs group. During the exploring stage, interestingly, the NR_030777 + CoNPs groups crossed the island much more often than CoNPs-exposed mice and spent more time on the third quadrant. It is noteworthy that there are no changes in any of the behavioral experiments in the saline group compared with the OE NR_030777 group (Figure 11F,G). These results demonstrated that mice overexpressing NR_030777 can restore the impairment of exploratory and cognitive ability induced by CoNPs.

Figure 11 NR_030777 mitigates the impairment of cognitive function induced by CoNPs. (A) Schematic representation of animal experiments. (B,C) Spontaneous locomotor and exploratory activity were assessed using open field test. (D,E) Short-term memory was assessed via NOR test. (F) The latency of escape to island zone in the training period of Morris water maze. (G) Locus plot of Morris water maze in the exploring period. Data were presented as mean ± SEM * and ** indicate P < 0.05 and 0.01 compared with the NC group. ##P < 0.01 compared to the CoNPs group. n = 12.

Since the recovery of exploratory activity and cognitive function was demonstrated in behavioral trials, we then assessed the proteins exhibiting abnormal hyperphosphorylation and accumulation in the brain. As anticipated, the elevation of Aβ and APP proteins following CoNPs exposure was mitigated by the OE of NR_030777 in both the cortex and hippocampus. Crucially, the tau phosphorylation induced by CoNPs was also alleviated by NR_030777 OE in both the cortex and hippocampus (Figure 12A–H). Immunohistochemistry was further employed to examine the distribution of phosphorylated tau and Aβ, revealing that OE of NR_030777 significantly reduced phosphorylated tau and Aβ levels in the hippocampus and cortex (Figure 12I,J). In conclusion, the OE of NR_030777 can mitigate CoNPs-induced neurodegenerative damage in vivo.

Figure 12 NR_030777 relieves the level of neurodegenerative-related protein induced by CoNPs in mice. (A–D) Western blot analyzed the neurodegenerative-related protein in cortex. (E–H) Western blot analyzed the neurodegenerative-related protein in hippocampus. (I) Immunohistochemistry showed the expression of p-tau in brain. The white arrow indicates p-tau. (J) Immunohistochemistry showed the expression of Aβ in brain. The white arrow indicates Aβ. Scale bar = 200 μm. n = 3. Data were presented as mean ± SEM * and ** indicate P < 0.05 and 0.01 compared with the saline NC group.

NR_030777 Alleviated Autophagosome Accumulation Induced by CoNPs In Vivo

To investigate whether OE of NR_030777 in mice reduces autophagosome accumulation, we analyzed autophagy-related proteins in the cortex and hippocampus. Notably, OE of NR_030777 reduced the elevated levels of LC3B and Beclin1 proteins in both the cortex and hippocampus under CoNPs exposure, suggesting a mitigation of autophagosome accumulation. Crucially, the upregulation of P62 protein induced by CoNPs exposure was reversed by NR_030777 OE in the cortex and hippocampus (Figure 13A–H). Subsequently, we analyzed the TFEB levels in the cortex and hippocampus. Notably, NR_030777 OE reversed the decrease in TFEB protein levels caused by CoNPs. Subsequently, the downstream of TFEB, LAMP1 and LAMP2, were also restored by OE NR_030777 in both the cortex and hippocampus (Figure 13I–P). To determine the effect of CoNPs on TFEB translocation in the brain, immunofluorescence analysis was conducted. Results indicate that CoNPs significantly reduced the nuclear distribution of TFEB in the hippocampus and cortex. However, OE of NR_030777 led to an increase in the nuclear localization of TFEB in these regions (Figure 13Q). In summary, NR_030777 OE mitigates the CoNPs-induced blockade of autophagosome–lysosome fusion in vivo.

Figure 13 NR_030777 relieves the autophagic dysfunction in brain conditional OE NR_030777 mice. (A–D) The level of autophagy-related proteins upon CoNPs exposure in cortex. (E–H) The level of autophagy-related proteins upon CoNPs exposure in hippocampus. (I–L) The level of lysosome-related proteins upon CoNPs exposure in cortex. (M–P) The level of lysosome-related proteins upon CoNPs exposure in hippocampus. (Q) The distribution of TFEB in brain. Data were presented as mean ± SEM * and ** indicate P < 0.05 and 0.01 compared with the saline NC group.

Discussion

CoNPs are widely used in various fields from lithium batteries, pigments and heterogeneous catalysis.42,43 Increasing evidence suggest that CoNPs poses a nonnegligible threat to human health. The size of cobalt particle dust encountered in occupation environments is from several microns to nanosize.44 More importantly, in patients who suffered MOM implants, the size of the cobalt particles isolated from the implant is in the range of 6–834 nm.45 In addition, the deposition of the metal wear debris found in distant organs has also been reported.46 Occupational exposure mainly causes respiratory ailments47 and MOM implant patients suffered wear particles induced macrophage-mediated inflammatory reactions.48 However, previous studies have rarely systematically assessed the relationship between CoNPs and neurodegenerative damage. Here, we demonstrate that CoNPs triggered AD-like neurodegenerative damage both in vivo and in vitro. We further revealed that CoNPs impaired the fusion of autophagosome–lysosome by the decrease in lysosome numbers via the suppression of the TFEB-LAMP pathway, thus causing neurodegenerative damage. More importantly, NR_030777 can bind and promote the stability of TFEB mRNA to alleviate the blockage of autophagosome–lysosome fusion induced by CoNPs, thus mitigating neurodegenerative damage both in vivo and in vitro.

CoNPs induce neurodegenerative damage in vivo and in vitro. Previous studies have demonstrated that nanomaterials can induce neurotoxicity,49 with some leading to neurodegeneration.50 Aluminum nanoparticles,51 manganese nanoparticles52 and nickel nanoparticles53 can modify tau structure and increase the cytotoxicity of neuron cells. Although CoNPs can induce neurotoxicity both in vivo and in vitro, key evidence of cognitive behavioral tests of CoNPs exposure is still lacking. The major clinical phenotype of AD patients is the progressive decline in cognition. In a genetic AD animal model, mice show cognitive impairment in the NOR test and Morris water maze.54 In accordance with previous studies, we observed impairment of short-term memory in the NOR test and defect in reference spatial memory using Morris water maze in CoNPs-exposed mice. Besides cognitive behavioral changes, behavioral and psychological symptoms including agitation, aberrant motor behavior, anxiety, depression and hallucinations also exist in AD animal models. Abnormalities in noncognitive behaviors have been implicated in various AD transgenic mice including the 3xTg-AD mice.55 Here, we found that mice exposed to CoNPs exhibited a decrease in exploratory activity. Moreover, we found that CoNPs reduced PSD95 protein in a dosage-dependent manner in the cortex, while 4 mg/kg CoNPs decreased the PSD95 protein in the hippocampus. In line with our findings, synaptic impairment and attrition are among the early manifestations of AD, exhibiting a stronger correlation with cognitive impairments than the presence of Aβ plaques and tau tangles, and are posited to constitute the fundamental structural underpinning of cognitive deterioration.56 Among them, PSD95 is the most abundant scaffolding protein in the excitatory postsynaptic density.57 PSD95 level was found to be reduced in APP/PS1 transgenic mice.58 Such evidence from behavioral trail strongly supports that CoNPs exposure impairs exploration and cognition in mice.

Hyperphosphorylated tau protein is one of the key mechanisms leading to synaptic and neuronal dysfunction in the pathological development of AD.59 p-tau (Thr181), p-tau (Thr231) and p-tau (Thr217) are highly correlated with tau protein phosphorylation in AD.60−62 In mice exposed to CoNPs, increased tau phosphorylation at Thr217 and Thr231 was observed in the cortex, while Thr181 phosphorylation remained unchanged. In contrast, all tau phosphorylation sites in the hippocampus showed an increase under CoNPs exposure. These results suggest that CoNPs-induced tau phosphorylation may be site-specific in different tissues. Collectively, CoNPs cause neurodegenerative damage by inducing excessive tau protein phosphorylation.

The dysfunction of autophagy induced by CoNPs is a primary mechanism in the development of neurodegenerative damage. The entire autophagy process, including initiation, autophagosome formation, and autophagosome–lysosome fusion and degradation, is impaired in AD.35 Hyperactivation of mTOR signaling in AD may prevent autophagy initiation and autophagosome formation.63 Yet, here we found that CoNPs promoted the formation of autophagosomes both in vivo and in vitro. Our result demonstrated that autophagy was mainly activated by mTOR/pULK1 (757) in the cortex, while activated by AMPK/pULK1 (555) in the hippocampus. A study showed that AMPK and mTOR affect the different phosphorylation sites of ULK1 under nutrient conditions.64 Yet the sophisticated mechanism should be studied in the future. In vitro, CoNPs reduced the activation of mTOR significantly, ultimately activating autophagy. In the autophagosome formation stage, we found that CoNPs increased the expression of Beclin1, P62 and LC3B in mice and HT22 cells, which indicates the accumulation of autophagosome. In the autophagosome–lysosome fusion stage, LC3B-GFP-mcherry fluorescence demonstrated that autophagosomes did not fuse with lysosomes, which was primarily due to a decrease in the number of lysosomes. CQ pretreatment (to block the acidification of lysosomes) further deteriorates tau phosphorylation, indicating that CoNPs impair the fusion of autophagosome–lysosome to induce neurodegenerative damage. In neurodegenerative disease, neuronal maturation of autophagolysosomes and their retrograde transport is impeded, which makes lysosomal deficiency a prominent feature in normal aging as well as in neurodegenerative brains.65

We further demonstrated that CoNPs impaired autophagosomal–lysosomal fusion via the TFEB/LAMP pathway, inducing the phenotype of neurodegenerative damage. We found that CoNPs can reduce the number of lysosomes in HT22 cells. In additional, the LAMP protein level was decreased upon CoNPs exposure both in cells and mice, indicating the reduction of lysosome number and the impairment of autophagosomal–lysosomal fusion.40 CoNPs appears to selectively influence the LAMP protein, without affecting lysosomal acidification. Lysosomal genes predominantly exhibit coordinated transcriptional patterns, regulated by the TFEB.66 TFEB translocates from the cytoplasm to the nucleus, activating its target genes, such as LAMP.41 As anticipated, CoNPs was found to decrease TFEB levels both in vivo and in vitro, as well as hinder its translocation from the cytoplasm to the nucleus. OE and activation of TFEB have been shown to potentially reverse neurodegenerative pathology, promoting Aβ clearance via regulation of the autophagy–lysosome pathway, thereby reducing Aβ-induced ROS production and cell apoptosis.67,68 TFEB can rescue tau aggregation through the TFEB-PTEN-PI3K-Akt-mTOR pathway, resulting in increased tau degradation by cathepsin D.69,70 Our results indicate that KD of TFEB aggravated the neurodegenerative-like phenotype induced by CoNPs in HT22 cells. Similarly, another study has shown that the loss of TFEB leads to increased tau accumulation.71 In summary, CoNPs exposure leads to the formation of autophagosomes, reduction of lysosomes and disruption of autophagosomal–lysosomal fusion, mediated by reduced TFEB levels.

NR_030777 regulates the TFEB/LAMP pathway to alleviate CoNPs-induced neurodegenerative damage. LncRNA is involved in regulating biological functions, such as cell proliferation, metastasis, apoptosis and autophagy.27,28 Recently studies show that the increase of TFEB-mediated autophagy could alleviate Aβ pathology in the AD model,15 which means that targets TFEB may release AD-like phenotype. Titanium dioxide nanoparticles altered the LncRNA expression profile in Human lung cells. Here, we demonstrated that CoNPs can decrease NR_030777 level in HT22 cell and mouse models. It has been demonstrated that LncRNA can subject autophagy-relevant regulators and machineries are subjected to epigenetic and post-translational modulation, resulting in alterations in autophagy levels, which can subsequently induce diseases.72 KEGG analysis indicates that NR_030777 is involved in the autophagy and AD pathway. OE of NR_030777 reduced the accumulation of autophagosome induced by CoNPs in mice and HT22 cells, while KD of NR_030777 further accumulated autophagosome in HT22 cells. Increasing studies demonstrate that the improvement of lysosomes could recover the clearance of pathologic proteins in neurodegenerative diseases.73 Overexpressing NR_030777 increased the abundance of lysosomes, while KD NR_030777 further decreased the number of lysosomes.

Due to bioinformatics analysis showing that NR_030777 may bind the TFEB mRNA, we further explored the relationship between NR_030777 and TFEB mRNA. OE of NR_030777 can directly bind to TFEB mRNA, followed by stabilized TFEB mRNA and protein upon CoNPs exposure, while KD of NR_030777 exacerbated the decrease of TFEB mRNA and protein. As a downstream target of TFEB, LAMP protein was also restored by OE of NR_030777 and further decreased by KD of NR_030777. Moreover, we carried out a rescue experiment to further confirm that NR_030777 protected neurons from CoNPs-induced neurodegenerative damage via TFEB. We found that the protective effect of OE NR_030777 could be abolished by KD TFEB. Importantly, we constructed brain conditional NR_030777 OE mice, which demonstrated that OE NR_030777 rescued the decrease in explore activity and impairment of cognitive ability impaired by CoNPs. Most importantly, tau phosphorylation induced by CoNPs is also alleviated by OE NR_030777 both in the cortex and hippocampus. Upon overall consideration, OE NR_030777 can protect against CoNPs-induced neurodegenerative damage in vivo. Combined with these results, we confirm that the NR_030777-TFEB-LAMP pathway is the main mechanism behind the neurodegenerative-like phenotype induced by CoNPs.

The adverse outcome pathway (AOP) concept provides a mechanism-based framework for interpreting what is known from existing toxicological studies of chemical substances, which covers the sequential progression of events from molecular initiation events (MIE) to adverse effects.74 The main blocks of an AOP consist of the MIE, key events (KEs) as the mediators, and ultimately the results, termed AO. The definition of MIE is the first point of chemical–biological interaction within an organism that starts the AOP.75 KEs are measurable events described at increasing levels of biological complexity.76 Here, we have summarized the AOP based on our findings to facilitate a more accurate assessment of CoNPs-induced neurodegenerative damage (Figure 14). CoNPs, as the stressor, can decrease the phosphorylation of mTOR (the molecular initiating event 1, MIE1) and reduce the expression of NR_030777 (the molecular initiating event 2, MIE2). At the cell level, MIE1 activates autophagy (KE1). MIE2 then decreases the expression of TFEB (KE2), followed by a reduction in the LAMP protein level and lysosome number (KE3). These three KEs then impair the fusion of autophagosome–lysosome (KE4). The disruption of autophagic flux ultimately induces the accumulation of toxic protein (Aβ, p-tau) (KE5). The AO resulting from the combination of KEs is the onset of neurodegenerative damage characterized by impairment of both short-term and long-term memory. For a better understanding of wider audience rather than the toxicologists, we’ve provided a schematic route of CoNPs inducing neurodegenerative damage by the activation of autophagy and the impairment of autophagosomal–lysosomal function via the regulation of NR_030777 and the downstream TFEB (abstract graphic).

Figure 14 A proposed AOP for assessing CoNPs neurotoxicity. This pathway depicts CoNPs, as the stressor, reducing mTOR phosphorylation (MIE1) and NR_030777 expression (MIE2). At the cellular level, MIE1 triggers autophagy (KE1), while MIE2 reduces TFEB expression (KE2), subsequently diminishing LAMP protein levels and the abundance of lysosome (KE3). These three KEs then hinder autophagosome–lysosome fusion (KE4), ultimately leading to the dysregulation of toxic proteins such as Aβ and p-tau (KE5).

Conclusion

In summary, this study demonstrates that CoNPs induce a neurodegenerative damage phenotype both in vivo and in vitro. Mechanistically, CoNPs disrupt autophagic flux by decreasing autophagosomal–lysosomal fusion, primarily suppressing TFEB levels both in vivo and in vitro, and reducing lysosome abundance. Additionally, we discovered the role of NR_030777 in alleviating CoNPs-induced autophagic dysfunction by binding and stabilizing TFEB mRNA. This ultimately increases lysosome numbers and restores autophagosomal–lysosomal fusion, mitigating neurodegenerative damage both in vivo and in vitro. This study provides insights into the mechanisms and potential applications of epigenetic regulation in understanding CoNPs-induced neurodegenerative damage. Furthermore, the proposed AOP enhances the understanding of CoNPs neurotoxicity assessment.

Methods

Preparation of CoNPs

CoNPs (cobalt–carbon-coated magnetic, nanopowder, purity ≥99%, product number 697745, Batch number MKCL5254). CoNPs were diluted in DI water to a final concentration of 1 mg/mL in a 1.5 mL Eppendorf (EP) tube.

Prior to treatment with cells, the solution was sonicated in a bath-type sonicator (KQ-500E, Kunshan, China) for 10 min and shake every three min.

Characterization of CoNPs

To determine the zeta potential, dynamic scattered light and polydispersion, CoNPs were diluted to various concentrations (10, 20, 30, 50, 100, 200, 300, and 500 μg/mL) in DI water or Dulbecco’s modified Eagle medium (DMEM). After sonication, Zetasizer Nano ZS90 was used for detecting the zeta potential, dynamic scattered light and polydispersion.

For UV–vis and spectrum, different concentrations of CoNPs were sonicated and then INFINITE 200 PRO was used for detecting UV–vis and excitation spectrum and emission spectrum.

Animals and Exposure

The experimental protocols for mice adhered to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the approval of the Animal Use Committee, Fujian Medical University (no. FJMU IACUC 2021-0480). Measures were implemented to minimize animal distress and suffering. The experimental mice were housed in a controlled barrier facility. The indoor temperature and humidity were maintained at 22 ± 2 °C and 50 ± 10%, respectively, through central air conditioning. A 12 h light/dark cycle was maintained, and the noise level was kept below 60 dB.

The exposure dosage for C57BL/6 mice was converted from the blood concentrations of cobalt in patients undergone MOM hip joint replacement, which is clinically relevant to endogenous cobalt exposure.77 For the experiment, 60 adult male mice aged 8–10 weeks were randomly and evenly assigned to four groups (saline group, 4 mg/kg CoNPs group, 8 mg/kg CoNPs group, 12 mg/kg CoNPs group). Each group consisted of 15 mice. All mice received daily intraperitoneal injections (ip) for 28 days. At the end of the exposure period, mice have conducted behavior trials. Following the behavioral tests, the mice were euthanized via carbon dioxide inhalation, and the hippocampus and cortex were isolated in the ice. The tissue samples were frozen in liquid nitrogen and stored at −80 °C. For the tissue section, mice were perfused with 0.9% saline to remove blood from the body, followed by injection of 50 mL of 4% paraformaldehyde. Subsequently, then the brain tissue was isolated and fixed in paraformaldehyde. Finally, the brain was gradient dehydrated for the tissue section.

The CRISPR/Cas9 technology was utilized to generate C57BL/6 mice with brain-specific conditional OE of NR_030777 in the central nervous system (CNS). Briefly, the Rosa26 gene was inserted into an inverted-NR_030777-Polya expression cassette, resulting in the generation of Rosa26LSL/+ mice. Rosa26LSL/+ mice can be mated with tissue-specific Cre tool mice to obtain mouse models with NR_030777 OE in specific cell types or tissues. In this study, Rosa26LSL/+ mice cross with Nestin-Cre transgenic mice to generate CNS-specific OE mice (namely OE NR_030777 mice). 60 adult male mice aged 8–10 weeks were randomly divided into four groups, including, Rosa26LSL/+ mice treated with saline, Rosa26LSL/+ mice treated with CoNPs (12 mg/kg), OE NR_030777 mice treated with saline, OE NR_030777 mice treated with CoNPs (12 mg/kg). Each group contains 15 mice. All mice were administered by ip once a day for 28 days. At the end of the exposure, mice have conducted behavior trials. Subsequently, after completing all the behavior trials, mice were sacrificed by inhaling carbon dioxide for further analysis.

The reason for choosing the ip injection is below. First, intraperitoneal injection delivers more accurate dosage to the target organs than other exposure routes such as ingestion, drinking, or inhalation.78,79 Second, we have previously used nasal aspiration for CoNPs, but the results were highly unstable (data not shown). Third, the dosage and exposure route of CoNPs are derived from the concentration of Co2+ (1.701–6.831 μg/L) in the serum of hip replacement patients, who have demonstrated endogenous CoNPs release. The intraperitoneal injection can effectively simulate this scenario.12,77 Furthermore, we have detected the blood concentration of Co2+ in 12 mg/kg CoNPs-exposed mice using ICP–MS, revealing a concentration range of 4.511 to 6.373 μg/L (Figure S2). Our results revealed that indeed intraperitoneal injection of CoNPs can mimic the endogenous exposure of CoNPs in hip replacement patients. Therefore, for the mechanism study, intraperitoneal injection would reflect the toxic effects of CoNPs more accurately.

All treatments were conducted meticulously to minimize mouse suffering. Throughout the experiment, none of the mice exhibited the humane end points, including labored breathing, inability to stand, or lack of response to external stimuli. Death was confirmed by the absence of breathing and heartbeat, as well as pupil dilation. No animals expired prematurely before the conclusion of the experiment.

Open Field Test

Exploratory behavior was assessed by allowing mice to freely explore an open-field arena for 5 min. The testing apparatus comprised a classic open field arena (a PVC square arena, 40 cm × 40 cm × 40 cm), equipped with a video camera connected to a computer. Each mouse was individually placed in the arena and their performance was monitored. The time spent in the center and peripheral area, as well as the distance traveled, were automatically recorded using a video tracking system (ANY-Maze software, USA). As mentioned previously, urine, scent cues, and feces were cleared from the maze.

NOR Test

The test consisted of two distinct phases: a sample phase, and a test phase. In the sample phase, two identical objects were symmetrically placed in the test apparatus, consistent with the open-field setup. Subsequently, each mouse was positioned in the same location within the device to commence the experiment and allowed 5 min of free exploration. During the test phase, one of the objects was substituted with a distinct shape. After a 1 h interval, the same mouse was positioned in the device, and data was recorded using a video tracking system. Object discrimination was evaluated using the index: [(time spent exploring the new object)/(time spent exploring both old and new objects)] during the test phase.

Morris Water Maze Test

The Morris water maze test was utilized to assess spatial reference learning and memory, adapted from the original protocol described by Morris and colleagues.80 The experiment was performed in a 150 cm-diameter white pool filled with nontoxic white paint and maintained at room temperature (RT) (21 ± 2 °C). During training, a 14 cm-diameter platform was submerged 1 cm below the water surface. All mice underwent four trials per day for five-six consecutive days. The starting position for each trial was randomly assigned to one of the four quadrants of the pool. Each animal had 120 s locate the hidden platform during each trial. If a mouse did not find the platform within 120 s, it was gently guided to the platform. Following each trial, the mouse remained on the platform for 30 s, was dried, and then returned to its home cage until the next trial. The exploring trial was conducted 24 h after the final day of training. During the exploring trial, mice swam in the pool without the escape platform for 120 s. The data were recorded using an automated tracking system.

Protein Extraction and Western Blot Analysis

For animal protein extraction, 20 mg cortex or hippocampus was added with 300 μL radio immunoprecipitation assay lysis (RIPA) buffer and homogenized using a homogenizer. Samples were centrifuged at 13,000g for 30 min and the supernatant was transferred to new EP tube. The supernatants were denatured by 5 × loading buffer at 95 °C for 10 min. For cell protein extraction, cells were lysed using RIPA buffer and denatured by 5 × loading buffer at 95 °C for 10 min.

Twenty μg of protein samples were separated by SDS-PAGE gel electrophoresis and subsequently transferred to polyvinylidene fluoride (PVDF) members with 0.2 μm pore size. The members were soaked in 5% nonfat milk for 2 h to block nonspecific binding sites and incubated with primary antibody at 4 °C overnight. After washing with TBST, the members were incubated with the secondary antibody for 1 h at RT. Protein images were captured using the Tanon 5200 Automatic Chemiluminescence Image Analysis System (Shanghai, China), and the gray values of the proteins were analyzed using performing ImageJ software.

Cell Culture and Treatment

HT22 cells were purchased from the State Key Laboratory of Genetic Resources and Evolution (Yunnan, China). Cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 100 units/mL of penicillin–streptomycin. Cells were cultured as monolayers at 37 °C in a humidified atmosphere containing 5% CO2.

When the density of cells reached 70–80% confluence, the medium was changed to DMEM without FBS. Subsequently, the cells were treated with various concentrations of CoNPs for 24 h to wait for the next measurement.

Confocal Microscope

To detect the turnover of fluorescent LC3B, the LC3B-GFP-mcherry plasmid has two excitation wavelengths, which LC3B-GFP indicates the LC3B puncta and LC3B-mcherry indicates LC3B engulfing by the lysosome. Briefly, cells were seeded at the density 3 × 104 per confocal dish. The LC3B-GFP-mcherry was packaged into DNA-lipofectamine complex using lipo8000 which was then added to cells. After a 24 h incubation, cells were treated with CoNPs for 24 h and observed using a confocal microscope (Leica SP5, Germany) with an excitation wavelength of 488 nm for LC3B-GFP and 543 nm for LC3B-mcherry.

To measure the PH of the lysosome, the LysoSensor Yellow/Blue DND-160 probe was used in this study. This probe emitted blue fluorescence in a neutral environment (Ex/Em = 329 nm/440 nm) and yellow fluorescence in an acidic environment (Ex/Em = 384 nm/540 nm). Cells were stained by 50 nM LysoSensor for 5 min in the dark room. After rinsing three times with phosphate buffer saline (PBS), images were captured by a confocal microscope (Leica SP5, Germany).

Pretreatment of Inhibitors

To block autophagy, HT22 cells were pretreated with 50 nM CQ (HY-17589A, MedChemExpress, USA). To inhibit TFEB, HT22 cells were pretreated with 20 μM Eltrombopag (HY-15306, MedChemExpress, USA). To block mRNA transcription, HT22 cells were pretreated with 5 μM actinomycin D (HY-17559, MedChemExpress, USA) for 1, 2, and 4 h.

Cell Transfection

To generate a NR_030777-overexpressing HT22 cell line, an OE NR_030777 lentivirus was constructed from GenePharma (Shanghai, China). The lentivirus was transfected into HT22 cells in the presence of 1 μg/mL polybrene and selected with 1 mg/mL puromycin for 5 days.

To KD NR_030777, siRNA-NR_030777 (and the corresponding NC) was constructed from GenePharma (Shanghai, China) (Table 1). When the density of cell reached 30–40%, siRNA transfected into HT22 cells with lipofectamine 8000 for 24 h and waited for the next experiment.

Table 1 Primer of siRNA

genes	sequences (5′–3′)	
SiRNA NR_030777	GGUCUGGCAUUCAAGGAUATTA	
 	UAUCCUUGAAUGCCAGACCTTCA	
NC	UUCUCCGAACGUGUCACGUTT	
 	ACGUGACACGUUCGGAGAATT	

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

The total RNA from HT22 cells was extracted using TRIZOL reagent (Accurate Biology, Hunan, China). RNA samples were reverse-transcribed into cDNA with Evo M-MLV RT Kit with gDNA Clean for qPCR II (AG11711, Accurate Biology, China). The qRT-PCR was conducted using SYBR Green Pro Taq HS (AG11746, Accurate Biology, China) on Roche LC480 Real-Time PCR instrument (Roche, Switzerland). The primer sequences used are listed in Table 2. The relative amplification of the mRNAs was determined using the quantitation-comparative CT (ΔΔCT) method, with actin beta (ACTB) as the RNA endogenous control.

Table 2 Primer Sequences

genes	primer sequences (5′–3′)	
NR_030777	forward: TCTTACGGAGGTCTGGCATTC	
 	reverse: CTCTTGCAGTAGCAATCGTCA	
TFEB	forward: CACAGGTTACCCCGATACC	
 	reverse: AGGGAGTCATCTAGGAGCATTA	
ACTB	forward: GTGACGTTGACATCCGTAAAGA	
 	reverse: GCCGGACTCATCGTACTCC	

Immunofluorescence Staining

For cell immunofluorescence, HT22 cells were seeded in the confocal dish at the density of 3 × 104, and treated with CoNPs for 24 h. The cells were fixed with 4% paraformaldehyde for 15 min and then permeabilized with 0.1% Triton X-100 for 10 min, and then blocked by 5% bovine serum albumin (BSA) at RT for 1 h. Subsequently, the cells were incubated with the primary antibody overnight at 4 °C, followed by staining with the corresponding Alexa Fluor-conjugated secondary antibody. Finally, images were captured by confocal microscope (Leica SP5, Germany).

For the frozen section, 10 μm samples were air-dried overnight at RT. The following day, after washed with PBS, the samples were incubated in 95 °C the Antigen Retrieval Solution (P0088, Beyotime, China) for 20 min to facilitate antigen repair. Subsequently, the samples were permeated with 0.5% Triton X-100 at 37 °C for 60 min. Following PBS washing, the samples were blocked by the blocking solution (9% goat serum and 1% BSA) at RT for 60 min, followed by overnight incubation with primary antibody at 4 °C. Following PBS washing, the samples were incubated with Goat anti-Rab Alexa Fluor-647 (ab150083, Abcam, USA) secondary antibody at RT for 60 min. Finally, the samples were mounted with an antiquencher containing DAPI (P0131, Beyotime, China).

Immunohistochemistry

For the paraffin section, the samples underwent dewaxing according to the following protocol: two washes in xylene for 15 min each, followed by washes in 100% ethanol, 95% ethanol, 80% ethanol, and 70% ethanol for 5 min each, and finally two washes in DI water for 5 min each.

For the frozen section, following PBS washing, the samples were put into 3% H2O2 solution to quench endogenous peroxidase activity at RT for 30 min. Next, samples were permeated with 0.5% Triton X-100 at 37 °C for 60 min. After washed with PBS, samples were blocked by the blockage solution (9% goat serum and 1% BSA) at RT for 60 min and then incubated overnight with the primary antibody at 4 °C. Samples were added to the secondary antibody (G1302, Servivebio, China) for 20 min at RT and then added 3,3N-diaminobenzidine tertrahydrochloride (DAB) (P0202, Beyotime, China) for 15 min. After washed with DI water, samples were added to Hematoxylin (C0105S, Beyotime, China) at RT for 5 min to stain the nucleus.

Isolation of Cytosol and Nucleus

HT22 cells were seeded in the 10 cm dish at a density of 3 × 106 and then treated with CoNPs for 24 h. After washing with PBS three times, 200 μL RIPA buffer (R0050, Solarbio, China) containing PMSF and protease inhibitor was added to dishes and then collected cell to 1.5 mL EP tube. Supernatants were centrifuged at 14,000g for 25 min and collected supernatant to new EP tube (this is cytosol protein). The remaining samples were added extracted reagents and vortexed for 15 s three times, followed by centrifuging at 14,000g for 10 min. The supernatants moved to new EP tube (this is the nucleus protein).

FISH Assay

FISH was used to assess the colocalization of NR_030777 and TFEB mRNA levels with a FISH kit (GenePharma, China). HT22 cells overexpressing NR_030777 were seeded in an 8-chambered plate and treated with CoNPs for 24 h. After washing with PBS three times, 4% paraformaldehyde was added to fix the cells at RT for 15 min, followed by 0.1% Triton X-100. Subsequently, the cells were washed with PBS and then blocked using a blocking solution for 30 min at 37 °C. The cells were incubated with 2 × buffer C at 37 °C for 30 min. A 2 μM probe mixed with buffer E was added to each well and incubated overnight at 37 °C. After the incubation, buffer F was used to wash the cells at 37 °C for 10 min, followed by 2 × buffer C at 60 °C for 10 min three times, and then washed with 2 × buffer C at 37 °C for 10 min. Finally, the chamber was added to an antifade mounting medium containing DAPI for observation under a confocal microscope.

mRNA Stability Assay

Cells were seeded in a 12-well plate at a density of 70–80%. Subsequently, 5 μg/mL of actinomycin D was used to inhibit global mRNA transcription synthesis in the cells. After incubation with actinomycin D for specified time points (0, 1, 2, 4 h), the cells were harvested, and total RNA was extracted for mRNA stability analysis using qRT-PCR.

Roadblock-qPCR was employed to detect mRNA decay as described in the literature.81 HT22 cells were seeded in 6-well plates with 4 time points (0, 2, 4, and 6 h) per group, each with 3 replicates. Following a 24 h treatment with CoNPs, cells were treated with 100 μM 4sU for 0 (no 4sU), 2, 4, and 6 h. After RNA isolation and normalization, 1 μg of RNA was diluted in 11 μL of RNase-free water in a PCR tube and incubated at 65 °C for 5 min. Subsequently, NEM buffer, NEM, and RNase-free water were added, and the mixture was incubated at 42 °C for 1.5 h. The NEM-treated RNA was then subjected to reverse transcription. Finally, qRT-PCR was conducted, and the ΔΔCT value for all targeted RNAs was calculated.

Statistical Analysis

Data are shown in the mean ± SEM where possible. Data were analyzed using SPSS software, version 19.0 (IBM Corporation, Armonk, NY, USA). One-way analysis of variance (ANOVA) was used for multiple comparisons followed by Tukey posthoc tests. All data satisfied the normality test, and subsequently, the LSD method was utilized for the post hoc test. Linear trends were analyzed using GraphPad Prism 9. In mice overexpressing NR_030777, two-way ANOVA was used for statistical comparison. P value <0.05 indicates statistical significance. All experiments were carried out in independent triplicates and three individual experiments were performed unless otherwise specified.

Supporting Information Available

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsnano.4c05249.Figure: S1 Characterization physicochemical property of CoNPs. Figure: S2 The concentration of Co2+ in blood serum of CoNPs-treated mice. Figure: S3 Quantification of AD-related proteins in HT22 cells. Figure: S4 Quantification of autophagic-related proteins in HT22 cells. Figure: S5 Quantification of AD-related proteins upon CQ pretreatment in HT22 cells. Figure: S6 Construction and validation of OE and knockdown of NR_030777 HT22 cells. Figure: S7 Quantification of autophagic related proteins upon CoNPs exposure in OE NR_030777 HT22 cells. Figure: S8 Quantification of autophagic related proteins upon CoNPs exposure in KD NR_030777 HT22 cells. Figure: S9 Quantification of AD-related proteins upon CoNPs exposure in OE NR_030777 HT22 cells. Figure: S10 Quantification of AD-related proteins upon CoNPs exposure in KD NR_030777 HT22 cells. Figure: S11 Quantification of lysosome function detected by confocal microscope. Figure: S12 Eltrombopag inhibits TFEB expression in HT22 cells. Figure: S13 NR_030777 affects the distribution of TFEB in HT22 cells. Figure: S14 NR_030777 expression level in mice overexpressing NR_030777 (PDF)

Supplementary Material

nn4c05249_si_001.pdf

Author Contributions

¶ X.L., C.C., and J.C. authors contributed equally to this work. F.Z. and H.L. designed research; X.L., X.C., and C.C. performed research; J.C., C.Z., J.Z., R.S., and S.C. conducted behavioral test in mice; J.Z. and S.W. performed Western blot in mice; S.L., Y.C. and J.L. carried out the qRT-PCR and mRNA stability experiment; L.L. performed the confocal microscope; X.L. analyzed data and organized figures and tables; X.L. drafted the manuscript; F.Z., H.L., Z.G., G.Y. and W.S. revised the manuscript; S.W. inspected the statistics. F.Z. is responsible for the funding acquisition. All the authors have read and approved the final manuscript.

This study was supported by the National Natural Science Foundation of China (82473660, 82311530107, 81903352), the Provincial Natural Science Foundation of Fujian Province (2023J01627), the Open Fund of Fujian Provincial Key Laboratory of Molecular Neurology (2022-SJKF-001), and the Innovation and Entrepreneurship Training Program for College Students of Fujian Medical University (C23013, xy202210026).

The authors declare no competing financial interest.

Notes

All animal procedures were approved by the Institutional Animal Care and Use Committee of the Fujian Medical University (no. FJMU IACUC 2021-0480).

Acknowledgments

We appreciate J Lin, S Zheng and Z Huang from the Public Technology Service Center, Fujian Medical University (Fuzhou, China) for their invaluable technical support.

Abbreviations

ACTB actin beta

AD Alzheimer’s disease

AMPK AMP-activated protein kinase

ANOVA one-way analysis of variance

AO adverse outcome

AOP adverse outcome pathway

APP Aβ precursor protein

Aβ β-amyloid

BSA bovine serum albumin

CNS central nervous system

CoNPs cobalt nanoparticles

CQ chloroquine

DAB 3,3N-diaminobenzidine tertrahydrochloride

DI deionized water

DMEM Dulbecco’s modified Eagle medium

Eltro eltrombopag

EP Eppendorf tube

FBS fetal bovine serum

FISH fluorescence in situ hybridization

ip intraperitoneal injection

KD knockdown

KE key event

KEGG Kyoto encyclopedia of genes and genomes

LAMP lysosome-associated membrane protein

LAMP1 lysosome-associated membrane protein 1

LAMP2 lysosome-associated membrane protein 2

LC3B microtubule-associated protein 1 light chain 3B

LncRNA long noncoding RNA

MIE molecular initiating event

MOM metal-on-metal

mTOR mammalian target of rapamycin

NC negative control

NOR novel object recognition test

OE overexpression

P62 sequestosome 1

PBS phosphate buffer saline

PL photoluminescence

p-mTOR phosphorylated mammalian target of rapamycin

PSD95 postsynaptic density protein 95

p-ULK1 phosphorylated UNC-51-like kinase 1

PVDF polyvinylidene fluoride

qRT-PCR quantitative real-time polymerase chain reaction

RIPA radio immunoprecipitation assay lysis

ROS reactive oxygen species

RT room temperature

SEM scanning electron microscope

TEM transmission electron microscope

TFEB transcription factor EB

TRAP tagged RNA affinity purification

UV–vis ultraviolet–visible absorption
==== Refs
References

Pankhurst Q. A. ; Thanh N. T. K. ; Jones S. K. ; Dobson J. Progress in Applications of Magnetic Nanoparticles in Biomedicine. J. Phys. D: Appl. Phys. 2009, 42 (22 ), 224001 10.1088/0022-3727/42/22/224001.
Srinivasan S. Y. ; Paknikar K. M. ; Bodas D. ; Gajbhiye V. Applications of Cobalt Ferrite Nanoparticles in Biomedical Nanotechnology. Nanomedicine 2018, 13 (10 ), 1221–1238. 10.2217/nnm-2017-0379.29882719
Cruz J. C. ; Nascimento M. A. ; Amaral H. A. V. ; Lima D. S. D. ; Teixeira A. P. C. ; Lopes R. P. Synthesis and Characterization of Cobalt Nanoparticles for Application in the Removal of Textile Dye. J. Environ. Manage. 2019, 242 , 220–228. 10.1016/j.jenvman.2019.04.059.31048227
Yang H. ; Song X. ; Zhang X. ; Lu B. ; Yang D. ; Li B. Uncovering the In-Use Metal Stocks and Implied Recycling Potential in Electric Vehicle Batteries Considering Cascaded Use: A Case Study of China. Environ. Sci. Pollut. Res. Int. 2021, 28 (33 ), 45867–45878. 10.1007/s11356-021-13430-7.33884548
Li Y. ; Sun L. ; Liu Y. ; Ye Z. Recycling Potential of Cobalt Metal from End-of-Life New Energy Passenger Vehicles in China, Waste Management & Research: The Journal of the International Solid Wastes and Public Cleansing Association; ISWA, 2024.
Jordan C. M. ; Whitman R. D. ; Harbut M. Memory Deficits and Industrial Toxicant Exposure: A Comparative Study of Hard Metal, Solvent and Asbestos Workers. Int. J. Neurosci. 1997, 90 (1–2 ), 113–128. 10.3109/00207459709000631.9285293
Keegan G. M. ; Learmonth I. D. ; Case C. P. Orthopaedic Metals and Their Potential Toxicity in the Arthroplasty Patient: A Review of Current Knowledge and Future Strategies. J. Bone Joint Surg. 2007, 89-B (5 ), 567–573. 10.1302/0301-620x.89b5.18903.
Mancuso T. F. Chromium as an Industrial Carcinogen: Part II. Chromium in Human Tissues. Am. J. Ind. Med. 1997, 31 (2 ), 140–147. 10.1002/(sici)1097-0274(19970204)31:2<140::aid-ajim2>3.0.co;2-3.9028429
Nouri M. ; Esfahanizadeh N. ; Shahpar M. G. ; Attar F. ; Sartipnia N. ; Akhtari K. ; Saboury A. A. ; Falahati M. Cobalt Oxide Nanoparticles Mediate Tau Denaturation and Cytotoxicity against PC-12 Cell Line. Int. J. Biol. Macromol. 2018, 118 (Pt B ), 1763–1772. 10.1016/j.ijbiomac.2018.07.024.30017981
Li J. ; Wang J. ; Wang Y.-L. ; Luo Z. ; Zheng C. ; Yu G. ; Wu S. ; Zheng F. ; Li H. NOX2 Activation Contributes to Cobalt Nanoparticles-Induced Inflammatory Responses and Tau Phosphorylation in Mice and Microglia. Ecotoxicol. Environ. Saf. 2021, 225 , 112725 10.1016/j.ecoenv.2021.112725.34492628
Chen J. ; Chen C. ; Wang N. ; Wang C. ; Gong Z. ; Du J. ; Lai H. ; Lin X. ; Wang W. ; Chang X. ; Aschner M. ; Guo Z. ; Wu S. ; Li H. ; Zheng F. Cobalt nanoparticles induce mitochondrial damage and β-amyloid toxicity via the generation of reactive oxygen species. Neurotoxicology 2023, 95 , 155–163. 10.1016/j.neuro.2023.01.010.36716931
Zheng F. ; Luo Z. ; Zheng C. ; Li J. ; Zeng J. ; Yang H. ; Chen J. ; Jin Y. ; Aschner M. ; Wu S. ; Zhang Q. ; Li H. Comparison of the Neurotoxicity Associated with Cobalt Nanoparticles and Cobalt Chloride in Wistar Rats. Toxicol. Appl. Pharmacol. 2019, 369 , 90–99. 10.1016/j.taap.2019.03.003.30849457
Scheltens P. ; Blennow K. ; Breteler M. M. B. ; de Strooper B. ; Frisoni G. B. ; Salloway S. ; Van der Flier W. M. Alzheimer’s Disease. Lancet 2016, 388 (10043 ), 505–517. 10.1016/S0140-6736(15)01124-1.26921134
Krishnamoorthi S. ; Iyaswamy A. ; Sreenivasmurthy S. G. ; Thakur A. ; Vasudevan K. ; Kumar G. ; Guan X.-J. ; Lu K. ; Gaurav I. ; Su C.-F. ; Zhu Z. ; Liu J. ; Kan Y. ; Jayaraman S. ; Deng Z. ; Chua K. K. ; Cheung K.-H. ; Yang Z. ; Song J.-X. ; Li M. PPARα Ligand Caudatin Improves Cognitive Functions and Mitigates Alzheimer’s Disease Defects By Inducing Autophagy in Mice Models. J. Neuroimmune Pharmacol 2023, 18 (3 ), 509–528. 10.1007/s11481-023-10083-w.37682502
Guan X. ; Deng Z. ; Liu J. ; Su C. ; Tong B. ; Zhu Z. ; Sreenivasmurthy S. G. ; Kan Y. ; Lu K. ; Chu C. P. ; Pi R. ; Cheung K.-H. ; Iyaswamy A. ; Song J.-X. ; Li M. Corynoxine promotes TFEB/TFE3-mediated autophagy and alleviates Aβ pathology in Alzheimer’s disease models. Acta Pharmacol. Sin. 2024, 45 (5 ), 900–913. 10.1038/s41401-023-01197-1.38225393
Iyaswamy A. ; Thakur A. ; Guan X.-J. ; Krishnamoorthi S. ; Fung T. Y. ; Lu K. ; Gaurav I. ; Yang Z. ; Su C.-F. ; Lau K.-F. ; Zhang K. ; Ng R. C.-L. ; Lian Q. ; Cheung K.-H. ; Ye K. ; Chen H. J. ; Li M. Fe65-Engineered Neuronal Exosomes Encapsulating Corynoxine-B Ameliorate Cognition and Pathology of Alzheimer’s Disease. Signal Transduct. Targeted Ther. 2023, 8 (1 ), 404 10.1038/s41392-023-01657-4.
Zhang Z. ; Yang X. ; Song Y.-Q. ; Tu J. Autophagy in Alzheimer’s Disease Pathogenesis: Therapeutic Potential and Future Perspectives. Ageing Res. Rev. 2021, 72 , 101464 10.1016/j.arr.2021.101464.34551326
Swaminathan G. ; Zhu W. ; Plowey E. D. BECN1/Beclin 1 sorts cell-surface APP/amyloid β precursor protein for lysosomal degradation. Autophagy 2016, 12 (12 ), 2404–2419. 10.1080/15548627.2016.1234561.27715386
Lee J.-H. ; Yu W. H. ; Kumar A. ; Lee S. ; Mohan P. S. ; Peterhoff C. M. ; Wolfe D. M. ; Martinez-Vicente M. ; Massey A. C. ; Sovak G. ; Uchiyama Y. ; Westaway D. ; Cuervo A. M. ; Nixon R. A. ; Nixon R. A. Lysosomal Proteolysis and Autophagy Require Presenilin 1 and Are Disrupted by Alzheimer-Related PS1Mutations. Cell 2010, 141 (7 ), 1146–1158. 10.1016/j.cell.2010.05.008.20541250
Drummond E. ; Wisniewski T. Alzheimer’s Disease: Experimental Models and Reality. Acta Neuropathol. 2017, 133 (2 ), 155–175. 10.1007/s00401-016-1662-x.28025715
Liu Z. ; Lv X. ; Xu L. ; Liu X. ; Zhu X. ; Song E. ; Song Y. Zinc Oxide Nanoparticles Effectively Regulate Autophagic Cell Death by Activating Autophagosome Formation and Interfering with Their Maturation. Part. Fibre Toxicol. 2020, 17 (1 ), 46 10.1186/s12989-020-00379-7.32948194
Pesonen M. ; Vähäkangas K. Autophagy in Exposure to Environmental Chemicals. Toxicol. Lett. 2019, 305 , 1–9. 10.1016/j.toxlet.2019.01.007.30664929
Parzych K. R. ; Klionsky D. J. An Overview of Autophagy: Morphology, Mechanism, and Regulation. Antioxid. Redox Signaling 2014, 20 (3 ), 460–473. 10.1089/ars.2013.5371.
Zhou J. ; Li Y. ; Liu X. ; Long Y. ; Chen J. LncRNA-Regulated Autophagy and Its Potential Role in Drug-Induced Liver Injury. Ann. Hepatol. 2018, 17 (3 ), 355–363. 10.5604/01.3001.0011.7381.29735795
Luo Y. ; Fu Y. ; Huang Z. ; Li M. Transition Metals and Metal Complexes in Autophagy and Diseases. J. Cell. Physiol. 2021, 236 (10 ), 7144–7158. 10.1002/jcp.30359.33694161
Zheng F. ; Luo Z. ; Lin X. ; Wang W. ; Aschner M. ; Cai P. ; Wang Y.-L. ; Shao W. ; Yu G. ; Guo Z. ; Wu S. ; Li H. Intercellular Transfer of Mitochondria via Tunneling Nanotubes Protects against Cobalt Nanoparticle-Induced Neurotoxicity and Mitochondrial Damage. Nanotoxicology 2022, 15 , 1358–1379. 10.1080/17435390.2022.2026515.
Marques-Rocha J. L. ; Samblas M. ; Milagro F. I. ; Bressan J. ; Martínez J. A. ; Marti A. Noncoding RNAs, Cytokines, and Inflammation-Related Diseases. FASEB J. 2015, 29 (9 ), 3595–3611. 10.1096/fj.14-260323.26065857
Ding J. ; Yeh C.-R. ; Sun Y. ; Lin C. ; Chou J. ; Ou Z. ; Chang C. ; Qi J. ; Yeh S. Estrogen receptor β promotes renal cell carcinoma progression via regulating LncRNA HOTAIR-miR-138/200c/204/217 associated CeRNA network. Oncogene 2018, 37 (37 ), 5037–5053. 10.1038/s41388-018-0175-6.29789714
Xu T.-X. ; Zhao S.-Z. ; Dong M. ; Yu X.-R. Hypoxia Responsive miR-210 Promotes Cell Survival and Autophagy of Endometriotic Cells in Hypoxia. Eur. Rev. Med. Pharmacol. Sci. 2016, 20 (3 ), 399–406.26914112
Idda M. L. ; Munk R. ; Abdelmohsen K. ; Gorospe M. Noncoding RNAs in Alzheimer’s Disease. Wiley Interdiscip. Rev.: RNA 2018, 9 (2 ), e1463 10.1002/wrna.1463.
Yang H. ; Lin Q. ; Chen N. ; Luo Z. ; Zheng C. ; Li J. ; Zheng F. ; Guo Z. ; Cai P. ; Wu S. ; Wang Y.-L. ; Li H. LncRNA NR_030777 Alleviates Paraquat-Induced Neurotoxicity by Regulating Zfp326 and Cpne5. Toxicol. Sci. 2020, 178 (1 ), 173–188. 10.1093/toxsci/kfaa121.32735315
Chen N. ; Hu H. ; Tang J. ; Zheng F. ; Guo Z. ; Lin X. ; Aschner M. ; Shao W. ; Yu G. ; Cai P. ; Chou W.-C. ; Wu S. ; Li H. LncRNA NR_030777 Promotes Mitophagy by Targeting CDK1-Related Mitochondrial Fission and ATG12 to Attenuate Paraquat-Induced Parkinson’s Disease. Environ. Pollut. 2024, 349 , e123875 10.1016/j.envpol.2024.123875.
Lin X. ; Wang W. ; Chang X. ; Chen C. ; Guo Z. ; Yu G. ; Shao W. ; Wu S. ; Zhang Q. ; Zheng F. ; Li H. ROS/mtROS Promotes TNTs Formation via the PI3K/AKT/mTOR Pathway to Protect against Mitochondrial Damages in Glial Cells Induced by Engineered Nanomaterials. Part. Fibre Toxicol. 2024, 21 (1 ), 1–20. 10.1186/s12989-024-00562-0.38225661
Jo K. W. ; Lee D. ; Cha D. G. ; Oh E. ; Choi Y. H. ; Kim S. ; Park E. S. ; Kim J. K. ; Kim K.-T. Gossypetin ameliorates 5xFAD spatial learning and memory through enhanced phagocytosis against Aβ. Alzheimer’s Res. Ther. 2022, 14 (1 ), 158 10.1186/s13195-022-01096-3.36271414
Zhang W. ; Xu C. ; Sun J. ; Shen H.-M. ; Wang J. ; Yang C. Impairment of the Autophagy–Lysosomal Pathway in Alzheimer’s Diseases: Pathogenic Mechanisms and Therapeutic Potential. Acta Pharm. Sin. B 2022, 12 (3 ), 1019–1040. 10.1016/j.apsb.2022.01.008.35530153
Caponio D. ; Veverová K. ; Zhang S.-Q. ; Shi L. ; Wong G. ; Vyhnalek M. ; Fang E. F. Compromised Autophagy and Mitophagy in Brain Ageing and Alzheimer’s Diseases. Aging Brain 2022, 2 , 100056 10.1016/j.nbas.2022.100056.36908880
Lee D. Y. ; Moon J. ; Lee S. T. ; Jung K. H. ; Park D. K. ; Yoo J. S. ; Sunwoo J. S. ; Byun J. I. ; Shin J. W. ; Jeon D. ; Jung K. Y. ; Kim M. ; Lee S. K. ; Chu K. Distinct Expression of Long Non-Coding RNAs in an Alzheimer’s Disease Model. J. Alzheimer’s Dis. 2015, 45 (3 ), 837–849. 10.3233/jad-142919.25624420
Li R. ; Ji Z. ; Qin H. ; Kang X. ; Sun B. ; Wang M. ; Chang C. H. ; Wang X. ; Zhang H. ; Zou H. ; Nel A. E. ; Xia T. Interference in Autophagosome Fusion by Rare Earth Nanoparticles Disrupts Autophagic Flux and Regulation of an Interleukin-1β Producing Inflammasome. ACS Nano 2014, 8 (10 ), 10280–10292. 10.1021/nn505002w.25251502
Kawai A. ; Uchiyama H. ; Takano S. ; Nakamura N. ; Ohkuma S. Autophagosome-Lysosome Fusion Depends on the pH in Acidic Compartments in CHO Cells. Autophagy 2007, 3 (2 ), 154–157. 10.4161/auto.3634.17204842
Corona A. K. ; Jackson W. T. Finding the Middle Ground for Autophagic Fusion Requirements. Trends Cell Biol. 2018, 28 (11 ), 869–881. 10.1016/j.tcb.2018.07.001.30115558
Sardiello M. ; Palmieri M. ; di Ronza A. ; Medina D. L. ; Valenza M. ; Gennarino V. A. ; Di Malta C. ; Donaudy F. ; Embrione V. ; Polishchuk R. S. ; Banfi S. ; Parenti G. ; Cattaneo E. ; Ballabio A. A Gene Network Regulating Lysosomal Biogenesis and Function. Science 2009, 325 (5939 ), 473–477. 10.1126/science.1174447.19556463
Liu J. ; Wang Z. ; Yan X. ; Jian P. Metallic Cobalt Nanoparticles Imbedded into Ordered Mesoporous Carbon: A Non-Precious Metal Catalyst with Excellent Hydrogenation Performance. J. Colloid Interface Sci. 2017, 505 , 789–795. 10.1016/j.jcis.2017.06.081.28672258
Azharuddin M. ; Zhu G. H. ; Das D. ; Ozgur E. ; Uzun L. ; Turner A. P. F. ; Patra H. K. A Repertoire of Biomedical Applications of Noble Metal Nanoparticles. Chem. Commun. 2019, 55 (49 ), 6964–6996. 10.1039/C9CC01741K.
Stefaniak A. B. ; Virji M. A. ; Day G. A. Characterization of Exposures among Cemented Tungsten Carbide Workers. Part I: Size-Fractionated Exposures to Airborne Cobalt and Tungsten Particles. J. Expo. Sci. Environ. Epidemiol. 2009, 19 (5 ), 475–491. 10.1038/jes.2008.37.18628793
Doorn P. F. ; Campbell P. A. ; Worrall J. ; Benya P. D. ; McKellop H. A. ; Amstutz H. C. Metal Wear Particle Characterization from Metal on Metal Total Hip Replacements: Transmission Electron Microscopy Study of Periprosthetic Tissues and Isolated Particles. J. Biomed. Mater. Res. 1998, 42 (1 ), 103–111. 10.1002/(SICI)1097-4636(199810)42:1<103::AID-JBM13>3.0.CO;2-M.9740012
Zywiel M. G. ; Cherian J. J. ; Banerjee S. ; Cheung A. C. ; Wong F. ; Butany J. ; Gilbert C. ; Overgaard C. ; Syed K. ; Jacobs J. J. ; Mont M. A. Systemic Cobalt Toxicity from Total Hip Arthroplasties: Review of a Rare Condition Part 2. Measurement, Risk Factors, and Step-Wise Approach to Treatment. Bone Joint J. 2016, 98-B (1 ), 14–20. 10.1302/0301-620x.98b1.36712.
Kinoshita M. ; Sueyasu Y. ; Watanabe H. ; Tanoue S. ; Okubo Y. ; Koga T. ; Kawahara M. ; Nagata E. ; Oizumi K. Giant Cell Interstitial Pneumonia in Two Hard Metal Workers: The Role of Bronchoalveolar Lavage in Diagnosis. Respirology 1999, 4 (3 ), 263–266. 10.1046/j.1440-1843.1999.00186.x.10489670
Bijukumar D. R. ; Segu A. ; Souza J. C. ; Li X. ; Barba M. ; Mercuri L. G. ; J Jacobs J. ; Mathew M. T. Systemic and Local Toxicity of Metal Debris Released from Hip Prostheses: A Review of Experimental Approaches. Nanomed. Nanotechnol. Biol. Med. 2018, 14 (3 ), 951–963. 10.1016/j.nano.2018.01.001.
Boyes W. K. ; van Thriel C. Neurotoxicology of Nanomaterials. Chem. Res. Toxicol. 2020, 33 (5 ), 1121–1144. 10.1021/acs.chemrestox.0c00050.32233399
Migliore L. ; Uboldi C. ; Di Bucchianico S. ; Coppedè F. Nanomaterials and Neurodegeneration. Environ. Mol. Mutagen. 2015, 56 (2 ), 149–170. 10.1002/em.21931.25627719
Kermani Z. R. ; Haghighi S. S. ; Hajihosseinali S. ; Fashami A. Z. ; Akbaritouch T. ; Akhtari K. ; Shahpasand K. ; Falahati M. Aluminium Oxide Nanoparticles Induce Structural Changes in Tau and Cytotoxicity of the Neuroblastoma Cell Line. Int. J. Biol. Macromol. 2018, 120 (Pt A ), 1140–1148. 10.1016/j.ijbiomac.2018.08.182.30179693
Mehdizadeh P. ; Fesharaki S. S. H. ; Nouri M. ; Ale-Ebrahim M. ; Akhtari K. ; Shahpasand K. ; Saboury A. A. ; Falahati M. Tau Folding and Cytotoxicity of Neuroblastoma Cells in the Presence of Manganese Oxide Nanoparticles: Biophysical, Molecular Dynamics, Cellular, and Molecular Studies. Int. J. Biol. Macromol. 2019, 125 , 674–682. 10.1016/j.ijbiomac.2018.11.191.30468808
Hajimohammadjafartehrani M. ; Hosseinali S. H. ; Dehkohneh A. ; Ghoraeian P. ; Ale-Ebrahim M. ; Akhtari K. ; Shahpasand K. ; Saboury A. A. ; Attar F. ; Falahati M. The Effects of Nickel Oxide Nanoparticles on Tau Protein and Neuron-like Cells: Biothermodynamics and Molecular Studies. Int. J. Biol. Macromol. 2019, 127 , 330–339. 10.1016/j.ijbiomac.2019.01.050.30654034
Chen Y. ; Liang Z. ; Blanchard J. ; Dai C.-L. ; Sun S. ; Lee M. H. ; Grundke-Iqbal I. ; Iqbal K. ; Liu F. ; Gong C.-X. A Non-Transgenic Mouse Model (Icv-STZ. Mouse) of Alzheimer’s Disease: Similarities to and Differences from the Transgenic Model (3xTg-AD Mouse). Mol. Neurobiol. 2013, 47 (2 ), 711–725. 10.1007/s12035-012-8375-5.23150171
Javonillo D. I. ; Tran K. M. ; Phan J. ; Hingco E. ; Kramár E. A. ; da Cunha C. ; Forner S. ; Kawauchi S. ; Milinkeviciute G. ; Gomez-Arboledas A. ; Neumann J. ; Banh C. E. ; Huynh M. ; Matheos D. P. ; Rezaie N. ; Alcantara J. A. ; Mortazavi A. ; Wood M. A. ; Tenner A. J. ; MacGregor G. R. ; Green K. N. ; LaFerla F. M. Systematic Phenotyping and Characterization of the 3xTg-AD Mouse Model of Alzheimer’s Disease. Front. Neurosci. 2022, 15 , 785276 10.3389/fnins.2021.785276.35140584
Tzioras M. ; McGeachan R. I. ; Durrant C. S. ; Spires-Jones T. L. Synaptic Degeneration in Alzheimer Disease. Nat. Rev. Neurol. 2023, 19 (1 ), 19–38. 10.1038/s41582-022-00749-z.36513730
Elias G. M. ; Nicoll R. A. Synaptic Trafficking of Glutamate Receptors by MAGUK Scaffolding Proteins. Trends Cell Biol. 2007, 17 (7 ), 343–352. 10.1016/j.tcb.2007.07.005.17644382
Wang Y.-Y. ; Zhou Y.-N. ; Jiang L. ; Wang S. ; Zhu L. ; Zhang S.-S. ; Yang H. ; He Q. ; Liu L. ; Xie Y.-H. ; Liang X. ; Tang J. ; Chao F.-L. ; Tang Y. Long-Term Voluntary Exercise Inhibited AGE/RAGE and Microglial Activation and Reduced the Loss of Dendritic Spines in the Hippocampi of APP/PS1 Transgenic Mice. Exp. Neurol. 2023, 363 , 114371 10.1016/j.expneurol.2023.114371.36871860
Dolan P. J. ; Johnson G. V. W. A Caspase Cleaved Form of Tau Is Preferentially Degraded through the Autophagy Pathway. J. Biol. Chem. 2010, 285 (29 ), 21978–21987. 10.1074/jbc.M110.110940.20466727
Ferreira P. C. L. ; et al. Plasma P-Tau231 and p-Tau217 Inform on Tau Tangles Aggregation in Cognitively Impaired Individuals. Alzheimer’s Dementia 2023, 19 (10 ), 4463–4474. 10.1002/alz.13393.
Ossenkoppele R. ; van der Kant R. ; Hansson O. Tau Biomarkers in Alzheimer’s Disease: Towards Implementation in Clinical Practice and Trials. Lancet Neurol. 2022, 21 (8 ), 726–734. 10.1016/S1474-4422(22)00168-5.35643092
Lantero Rodriguez J. ; Karikari T. K. ; Suárez-Calvet M. ; Troakes C. ; King A. ; Emersic A. ; Aarsland D. ; Hye A. ; Zetterberg H. ; Blennow K. ; Ashton N. J. Plasma P-Tau181 Accurately Predicts Alzheimer’s Disease Pathology at Least 8 Years Prior to Post-Mortem and Improves the Clinical Characterisation of Cognitive Decline. Acta Neuropathol. 2020, 140 (3 ), 267–278. 10.1007/s00401-020-02195-x.32720099
Cai C.-Z. ; Yang C. ; Zhuang X.-X. ; Yuan N.-N. ; Wu M.-Y. ; Tan J.-Q. ; Song J.-X. ; Cheung K.-H. ; Su H. ; Wang Y.-T. ; Tang B.-S. ; Behrends C. ; Durairajan S. S. K. ; Yue Z. ; Li M. ; Lu J.-H. NRBF2 Is a RAB7 Effector Required for Autophagosome Maturation and Mediates the Association of APP-CTFs with Active Form of RAB7 for Degradation. Autophagy 2021, 17 (5 ), 1112–1130. 10.1080/15548627.2020.1760623.32543313
Kim J. ; Kundu M. ; Viollet B. ; Guan K.-L. AMPK and mTOR Regulate Autophagy through Direct Phosphorylation of Ulk1. Nat. Cell Biol. 2011, 13 (2 ), 132–141. 10.1038/ncb2152.21258367
Nixon R. A. Autophagy, Amyloidogenesis and Alzheimer Disease. J. Cell Sci. 2007, 120 (23 ), 4081–4091. 10.1242/jcs.019265.18032783
Curnock R. ; Yalci K. ; Palmfeldt J. ; Jäättelä M. ; Liu B. ; Carroll B. TFEB-Dependent Lysosome Biogenesis Is Required for Senescence. EMBO J. 2023, 42 (9 ), e111241 10.15252/embj.2022111241.36970883
Zhang Y. ; Zhao J. TFEB Participates in the Aβ-Induced Pathogenesis of Alzheimer’s Disease by Regulating the Autophagy-Lysosome Pathway. DNA Cell Biol. 2015, 34 (11 ), 661–668. 10.1089/dna.2014.2738.26368054
Xiao Q. ; Yan P. ; Ma X. ; Liu H. ; Perez R. ; Zhu A. ; Gonzales E. ; Tripoli D. L. ; Czerniewski L. ; Ballabio A. ; Cirrito J. R. ; Diwan A. ; Lee J.-M. Neuronal-Targeted TFEB Accelerates Lysosomal Degradation of APP, Reducing Aβ Generation and Amyloid Plaque Pathogenesis. J. Neurosci. 2015, 35 (35 ), 12137–12151. 10.1523/JNEUROSCI.0705-15.2015.26338325
Polito V. A. ; Li H. ; Martini-Stoica H. ; Wang B. ; Yang L. ; Xu Y. ; Swartzlander D. B. ; Palmieri M. ; di Ronza A. ; Lee V. M.-Y. ; Sardiello M. ; Ballabio A. ; Zheng H. Selective Clearance of Aberrant Tau Proteins and Rescue of Neurotoxicity by Transcription Factor EB. EMBO Mol. Med. 2014, 6 (9 ), 1142–1160. 10.15252/emmm.201303671.25069841
Wang H. ; Wang R. ; Carrera I. ; Xu S. ; Lakshmana M. K. TFEB Overexpression in the P301S Model of Tauopathy Mitigates Increased PHF1 Levels and Lipofuscin Puncta and Rescues Memory Deficits. eNeuro 2016, 3 (3 ), ENEURO.0042-16.2016 10.1523/eneuro.0042-16.2016.
Xu Y. ; Du S. ; Marsh J. A. ; Horie K. ; Sato C. ; Ballabio A. ; Karch C. M. ; Holtzman D. M. ; Zheng H. TFEB Regulates Lysosomal Exocytosis of Tau and Its Loss of Function Exacerbates Tau Pathology and Spreading. Mol. Psychiatr. 2021, 26 (10 ), 5925–5939. 10.1038/s41380-020-0738-0.
Shu F. ; Xiao H. ; Li Q.-N. ; Ren X.-S. ; Liu Z.-G. ; Hu B.-W. ; Wang H.-S. ; Wang H. ; Jiang G.-M. Epigenetic and Post-Translational Modifications in Autophagy: Biological Functions and Therapeutic Targets. Signal Transduct. Targeted Ther. 2023, 8 (1 ), 32 10.1038/s41392-022-01300-8.
Martini-Stoica H. ; Xu Y. ; Ballabio A. ; Zheng H. The Autophagy-Lysosomal Pathway in Neurodegeneration: A TFEB Perspective. Trends Neurosci. 2016, 39 (4 ), 221–234. 10.1016/j.tins.2016.02.002.26968346
Sachana M. ; Rolaki A. ; Bal-Price A. Development of the Adverse Outcome Pathway (AOP): Chronic Binding of Antagonist to N-Methyl-d-Aspartate Receptors (NMDARs) during Brain Development Induces Impairment of Learning and Memory Abilities of Children. Toxicol. Appl. Pharmacol. 2018, 354 , 153–175. 10.1016/j.taap.2018.02.024.29524501
Allen T. E. H. ; Goodman J. M. ; Gutsell S. ; Russell P. J. Defining Molecular Initiating Events in the Adverse Outcome Pathway Framework for Risk Assessment. Chem. Res. Toxicol. 2014, 27 (12 ), 2100–2112. 10.1021/tx500345j.25354311
Saarimäki L. A. ; Fratello M. ; Pavel A. ; Korpilähde S. ; Leppänen J. ; Serra A. ; Greco D. A Curated Gene and Biological System Annotation of Adverse Outcome Pathways Related to Human Health. Sci. Data 2023, 10 (1 ), 409 10.1038/s41597-023-02321-w.37355733
Zheng F. ; Li Y. ; Zhang F. ; Sun Y. ; Zheng C. ; Luo Z. ; Wang Y.-L. ; Aschner M. ; Zheng H. ; Lin L. ; Cai P. ; Shao W. ; Guo Z. ; Zheng M. ; Zhou X. Z. ; Lu K. P. ; Wu S. ; Li H. Cobalt Induces Neurodegenerative Damages through Pin1 Inactivation in Mice and Human Neuroglioma Cells. J. Hazard. Mater. 2021, 419 , 126378 10.1016/j.jhazmat.2021.126378.34175703
Ning Z. H. ; Long S. ; Zhou Y. Y. ; Peng Z. Y. ; Sun Y. N. ; Chen S. W. ; Su L. M. ; Zhao Y. H. Effect of Exposure Routes on the Relationships of Lethal Toxicity to Rats from Oral, Intravenous, Intraperitoneal and Intramuscular Routes. Regul. Toxicol. Pharmacol. 2015, 73 (2 ), 613–619. 10.1016/j.yrtph.2015.09.008.26361856
Al Shoyaib A. ; Archie S. R. ; Karamyan V. T. Intraperitoneal Route of Drug Administration: Should It Be Used in Experimental Animal Studies?. Pharm. Res. 2019, 37 (1 ), 12 10.1007/s11095-019-2745-x.31873819
Sargolini F. ; Roullet P. ; Oliverio A. ; Mele A. Effects of Intra-Accumbens Focal Administrations of Glutamate Antagonists on Object Recognition Memory in Mice. Behav. Brain Res. 2003, 138 (2 ), 153–163. 10.1016/S0166-4328(02)00238-3.12527446
Watson M. J. ; Thoreen C. C. Measuring mRNA Decay with Roadblock-qPCR. Curr. Protoc. 2022, 2 (1 ), e344 10.1002/cpz1.344.35041257
