
==== Front
Clin Cancer Res
Clin Cancer Res
Clinical Cancer Research
1078-0432
1557-3265
American Association for Cancer Research

39163021
CCR-24-1023
10.1158/1078-0432.CCR-24-1023
Version of Record
Drug Resistance
Gastrointestinal Cancers
Colorectal Cancer
Gene Technologies
High-Throughput Sequencing
Precision Medicine
Translational Cancer Mechanisms and Therapy
Novel ERBB2 Variant Potentially Associated with Resistance against Anti-HER2 Monoclonal Antibody–Based Therapy in ERBB2-Amplified Metastatic Colorectal Cancer
A Novel ERBB2 Variant in ERBB2-Amplified mCRC
https://orcid.org/0000-0002-9790-2865
Iida Naoko 1
https://orcid.org/0000-0001-8736-0399
Imai Mitsuho 1
https://orcid.org/0000-0002-2602-7282
Okamoto Wataru 2
https://orcid.org/0000-0001-5347-550X
Kato Takeshi 3
https://orcid.org/0000-0002-9169-8453
Esaki Taito 4
https://orcid.org/0000-0002-1733-5072
Kato Ken 5
https://orcid.org/0000-0002-1570-6802
Komatsu Yoshito 6
https://orcid.org/0000-0002-2039-3062
Yuki Satoshi 7
https://orcid.org/0000-0002-7521-1596
Masuishi Toshiki 8
https://orcid.org/0000-0002-4073-3757
Nishina Tomohiro 9
https://orcid.org/0000-0003-3155-7576
Ebi Hiromichi 10
https://orcid.org/0000-0003-1407-6682
Taniguchi Hiroya 8
https://orcid.org/0000-0002-6522-6233
Nonomura Norio 11
https://orcid.org/0000-0002-0163-7543
Sunakawa Yu 12
https://orcid.org/0009-0006-1912-5948
Shiozawa Manabu 13
https://orcid.org/0000-0001-6269-9345
Yamazaki Kentaro 14
https://orcid.org/0000-0002-5015-0379
Boku Shogen 15
https://orcid.org/0000-0001-5041-2765
Bando Hideaki 16
https://orcid.org/0000-0001-6144-5845
Shiraishi Yuichi 17
https://orcid.org/0000-0001-5920-5906
Kobayashi Maki 18
https://orcid.org/0009-0007-7143-2811
Goto Hiroki 18
https://orcid.org/0000-0002-0049-6718
Sato Akihiro 19
https://orcid.org/0000-0002-1789-9871
Fujii Satoshi 2021
https://orcid.org/0000-0002-0489-4756
Yoshino Takayuki 16
https://orcid.org/0000-0002-5241-6855
Nakamura Yoshiaki 116*
1 Translational Research Support Office, National Cancer Center Hospital East, Kashiwa, Japan.
2 Department of Clinical Oncology, Hiroshima University Hospital, Hiroshima, Japan.
3 Department of Surgery, NHO Osaka National Hospital, Osaka, Japan.
4 Department of Gastrointestinal and Medical Oncology, NHO Kyushu Cancer Center, Fukuoka, Japan.
5 Department of Head and Neck, Esophageal Medical Oncology, National Cancer Center Hospital, Tokyo, Japan.
6 Department of Cancer Center, Hokkaido University Hospital, Sapporo, Japan.
7 Department of Gastroenterology and Hepatology, Hokkaido University Hospital, Sapporo, Japan.
8 Department of Clinical Oncology, Aichi Cancer Center Hospital, Nagoya, Japan.
9 Gastrointestinal Medical Oncology, NHO Shikoku Cancer Center, Matsuyama, Japan.
10 Division of Molecular Therapeutics, Aichi Cancer Center Research Institute, Nagoya, Japan.
11 Department of Urology, Graduate School of Medicine, Osaka University, Suita, Japan.
12 Department of Clinical Oncology, St. Marianna University School of Medicine, Kawasaki, Japan.
13 Department of Gastrointestinal Surgery, Kanagawa Cancer Center, Yokohama, Japan.
14 Division of Gastrointestinal Oncology, Shizuoka Cancer Center, Shunto-gun, Japan.
15 Cancer Treatment Center, Kansai Medical University Hospital, Hirakata, Japan.
16 Department of Gastroenterology and Gastrointestinal Oncology, National Cancer Center Hospital East, Kashiwa, Japan.
17 Division of Genome Analysis Platform Development, National Cancer Center Research Institute, Tokyo, Japan.
18 Translational Research Laboratories, Daiichi Sankyo Co., Ltd., Tokyo, Japan.
19 Clinical Research Support Office, National Cancer Center Hospital East, Kashiwa, Japan.
20 Division of Pathology, Exploratory Oncology Research & Clinical Trial Center, National Cancer Center, Tokyo, Japan.
21 Department of Molecular Pathology, Yokohama City University Graduate School of Medicine, Kanagawa, Japan.
* Corresponding Author: Yoshiaki Nakamura, International Research Promotion Office/Translational Research Support Office/Department of Gastrointestinal Oncology, National Cancer Center Hospital East, 6-5-1, Kashiwanoha, Kashiwa 277-8577, Japan. E-mail: yoshinak@east.ncc.go.jp
Clin Cancer Res 2024;30:4167–78

13 9 2024
17 7 2024
30 18 41674178
29 3 2024
26 5 2024
16 7 2024
©2024 The Authors; Published by the American Association for Cancer Research
2024
American Association for Cancer Research
https://creativecommons.org/licenses/by-nc-nd/4.0/ This open access article is distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0) license.

Abstract

Purpose:

HER2-targeted therapies in ERBB2-amplified metastatic colorectal cancer (mCRC) are effective; however, a notable portion of patients do not respond to treatment, and secondary resistance occurs in most patients receiving these treatments. The purpose of this study was to investigate determinants of treatment efficacy and resistance in patients with ERBB2-amplified mCRC who received HER2-targeted therapy by analyzing multiomics data.

Experimental Design:

We investigated genomic data from a nationwide large cancer genomic screening project, the SCRUM-Japan project. We analyzed paired genome and transcriptome data of tissue and genomic data of ctDNA collected pre- and postprogression in patients enrolled in the related trial, TRIUMPH, in ERBB2-amplified mCRC.

Results:

In 155 patients with ERBB2-amplified solid tumors who received HER2-targeted therapy based on the SCRUM-Japan project, the objective response rate was 50%, 51%, and 35% in ERBB2 wild-type, variant of unknown significance, and pathogenic variant groups, respectively. In the paired genome and transcriptome data analyses in TRIUMPH, we identified the novel splicing-associated variant c.644-66_-2del in one of the 11 patients with paired whole-exome sequencing and whole-transcriptome sequencing data sets, which lacks the binding domain of pertuzumab, in progressed metastatic tumor as a variant with potential pathogenicity. The time-course ctDNA analysis detected c.644-66_-2del as an acquired variant.

Conclusions:

This study highlighted the importance of ERBB2 genomic status when evaluating the efficacy of HER2-targeted therapies in ERBB2-amplified mCRC. The identification of a novel splicing-associated variant may provide insights into potential mechanisms of treatment resistance. Furthermore, we demonstrated the utility of ctDNA to follow the acquired genomic status of mCRC tumors.

Japan Agency for Medical Research and Development (AMED) http://dx.doi.org/10.13039/100009619 16lk0201054h0001 Yoshino T. Japan Agency for Medical Research and Development (AMED) http://dx.doi.org/10.13039/100009619 19ck0106445h0002 Nakamura Y. National Cancer Center Japan (NCC) http://dx.doi.org/10.13039/100015322 2021-A-06 Yoshino T. Daiichi Sankyo Company (Sankyo Company) http://dx.doi.org/10.13039/501100002336
==== Body
pmcTranslational Relevance

We demonstrated the association of ERBB2 variant pathogenicity with the efficacy of HER2 antibody–based therapy in ERBB2-amplified metastatic colon cancers. Our results identified a new variant, ERBB2 c.644-66_-2del, which resulted in deletion of the region bound by pertuzumab, providing a mechanistic link to resistance against the drug. Through ctDNA analysis, we indicated that monitoring variant dynamics and detecting emerged variants in addition to tissue analysis is feasible. These findings underscore the importance of detecting ERBB2 variants in ERBB2-amplified metastatic colorectal cancer.

Introduction

Amplification of ERBB2 gene, which encodes the HER2 protein, occurs in 2% to 4% of patients with metastatic colorectal cancer (mCRC), contributing to the disease’s aggressive nature (1–4). Various HER2-targeted strategies have been developed for ERBB2-amplified mCRC, including dual HER2 blockade using HER2 monoclonal antibodies (mAbs) with or without tyrosine kinase inhibitors (TKI), HER2 antibody drug conjugates (ADC), and biparatopic antibodies (3, 5–10). We previously conducted a phase II trial, the TRIUMPH study, that evaluated the efficacy of combination therapy with HER2-targeted mAbs, pertuzumab and trastuzumab, in ERBB2-amplified mCRC (8). The objective response rate (ORR) was 30% in tissue-positive patients and 27% in ctDNA-positive patients, and these results led to the approval for pertuzumab plus trastuzumab in ERBB2-amplified mCRC. Despite these advancements, a certain number of mCRC do not respond to HER2 blockade or develop resistance after initial effectiveness, highlighting the need for further research into the mechanisms of resistance to improve treatment outcomes in ERBB2-amplified mCRC.

ERBB2 variants have emerged as a potential resistance mechanism against HER2-targeted therapy in ERBB2-amplified solid tumors (11). In colorectal cancer, ERBB2 variants are present in 1% to 3% of patients (12). The most prevalent pathogenic variants include R678Q, V842I, S310F V777L, L755S, and T862A, as reported in The Cancer Genome Atlas (TCGA) colorectal cancer project and other recent studies (2, 13). Targeting pathogenic ERBB2 variants in colorectal cancer is less well defined clinically. The pathogenic role of the co-occurrence of ERBB2 variants and amplification is not fully understood. Better understanding of the molecular features and mechanisms underlying ERBB2 variants and amplification is crucial to developing more effective treatment strategies for ERBB2-amplified mCRC.

In this study, we examined the relationship between the efficacy of HER2-targeted therapy and ERBB2 variants in ERBB2-amplified solid tumors using a large-scale cancer screening database, SCRUM-Japan. We then performed comprehensive genomic and transcriptome analysis of tumor tissue samples collected from 14 patients with ERBB2-amplified mCRC in the TRIUMPH study prior to treatment initiation and after disease progression. Our analysis identified a novel ERBB2 variant associated with resistance to pertuzumab and trastuzumab in ERBB2-amplified mCRC. Furthermore, we demonstrate the utility of ctDNA to follow the genomic status of tumors by time-course ctDNA analysis.

Materials and Methods

Study design and participants of SCRUM-Japan

SCRUM-Japan is a nationwide cancer genome screening project to profile cancer-related genomic alterations in advanced solid tumors for the purpose of developing biomarker-guided therapies since 2015 (14). SCRUM-Japan includes the GOZILA, MONSTAR-SCREEN, and MONSTAR-SCREEN2 studies. The GOZILA study is a plasma genomic profiling study using Guardant360 (Guardant Health, Redwood City, CA), a 74-gene comprehensive ctDNA sequencing assay (UMIN000029315). MONSTAR-SCREEN comprehensively characterized DNA genomic profiles using FoundationOne CDx (Foundation Medicine, MA) for tissue from previously untreated patients and FoundationOne Liquid CDx (Foundation Medicine, MA) for ctDNA throughout treatment. MONSTAR-SCREEN2 performed whole-exome sequencing (WES) and whole-transcriptome sequencing (WTS) of tumor tissue and plasma samples and comprehensive molecular multiomics profiling using assays developed by Caris Life Sciences (Irving, TX). A total of 28,158 therapies for 9,445 patients were recorded. A total of 155 patients with ERBB2 amplification were treated with HER2-targeted therapy. Variants were annotated on the basis of the OncoKB (RRID: SCR_014782) annotation of concurrent ERBB2 mutation: pathogenic, variant of unknown significance (VUS), and wild type. Wild-type variants included synonymous variants and variants annotated as benign. The VUS included nonsynonymous variants not annotated as benign and pathogenic.

Study design and participants of TRIUMPH

TRIUMPH is a multicenter, open-label, single-arm, phase II study in Japan. Eligible patients were 20 years or older; had histologically confirmed mCRC; had an Eastern Cooperative Oncology Group performance status of 0 or 1; had RAS wild-type and HER2-positive (HER2+) tumors, defined as immunohistochemistry (IHC) 3+ >10% of tumor cells or fluorescence in situ hybridization (FISH)–positive (ERBB2/CEP17 ratio ≥2.0) by tissue testing, or ERBB2-amplified and RAS wild type by ctDNA analysis. ERBB2 amplification was determined using the Guardant360 CDx assay. Patients were categorized as ERBB2-amplified if their ERBB2 copy number (CN) was equal to or greater than 2.12 and were refractory or intolerant to fluoropyrimidine, irinotecan, oxaliplatin, and an anti-EGFR antibody. The study protocol was approved by the institutional review board at each institution. The study was performed in accordance with the study protocol, the Ministerial Ordinance on Good Clinical Practice for Drugs, and the Declaration of Helsinki. All patients provided written informed consent before enrollment.

Patients received intravenous pertuzumab (840 mg loading dose, followed by 420 mg) and trastuzumab (8 mg/kg loading dose, followed by 6 mg/kg) every 3 weeks until disease progression, death, unacceptable toxicity, or discontinuation for any other reasons. Radiographic imaging by CT or MRI scans was done every 6 weeks during the first 24 weeks of treatment and then every 9 weeks thereafter. Response was assessed by RECIST v1.1 by local site investigators. All tumor responses were confirmed at least 4 weeks after the initial response. Clinical data were collected using Medidata Rave version 2015.1.1 and Medidata Classic Rave version 2018.2.0.

Tissue HER2 and HER3 IHC testing

IHC was performed on 4-µm-thick formalin-fixed paraffin-embedded sections using the PATHWAY HER2/neu (4B5) Rabbit Monoclonal Primary Antibody (not diluted) and BenchMark ULTRA autostainer (Ventana Medical Systems). The IHC score of each sample (0, 1+, 2+, or 3+) was assessed by a certified pathologist (SF) using diagnostic criteria following international consensus diagnostic criteria (15). IHC scores 0 and 1+ were considered HER2-negative. The proportions of HER2+ cells were calculated by microscopy, similar to the method by which pathologists perform routine diagnostics for HER2 in breast and gastric cancers.

WES and WTS

We conducted WES and WTS using genomic DNA and RNA extracted from the tumor tissues. Exome capture libraries were generated using the Agilent SureSelectXT Human All Exon V6 Kit (Agilent). The prepared libraries were sequenced on an Illumina NovaSeq6000 system (Illumina) with paired-end (2 × 150 bp) reads. We obtained average reads of 149 million and exome read depths of 151×. Total mRNA was used to generate libraries using the following kits: QIAseq FastSelect rRNA removal kit (QIAGEN N.V.), NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Inc.), and NEBNext Multiplex Oligos for Illumina (New England Biolabs, Inc.). The libraries were sequenced on the Illumina NovaSeq 6000 system (Illumina). We obtained average reads of 157 million and unique mapped ratio of 78%.

Variant calls

WES reads were aligned to the reference human genome GRCh38 using Burrows–Wheeler aligner-MEM (arXiv:1303.3997v2, RRID:SCR_022192). The Genome Analysis Toolkit (version 4.3.0.0; ref. 16) was used for the duplicate marking and the pileup. We performed the variant calls using Mutect (RRID: SCR_000559) and filtering variants by orientation bias and using a threshold of allele frequency greater than 0.02. We annotated them using the Ensembl Variant Effect Predictor (release version 108; RRID: SCR_001876; ref. 17) and filtered out variants with an allele frequency greater than 0.01 in gnomAD v3.1.2 (https://gnomad.broadinstitute.org/downloads). Copy number variation (CNV) was estimated using the CNVkit (version 0.9.10; ref. 18) in default quantification mode using the tumor data without normal samples. We filtered the resultant CNVs on the basis of an estimated log2 copy ratio with a threshold greater than 0.5. The log2 of the integer CN value was in the resultant cnr files.

Mutation signature analysis

Mutation signature analysis was performed using the Catalogue of Somatic Mutations in Cancer mutational signatures tool v3.3 (RRID: SCR_002260) available at https://cancer.sanger.ac.uk/signatures/sbs/ (19). Only single-nucleotide variants with read depth greater than 3 reads were used in this analysis.

Processing of WTS

We aligned WTS fastq files to the human reference genome (GRCh38) using STAR (version 2.7.10b; RRID: SCR_004463; ref. 20) and annotated them with gencode.v43.annotation.gtf (https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_43/). Read counts for genes were determined using featureCount (21), and transcripts per million (TPM) values were calculated. The splicing patterns were visualized using ggsashimi (v1.1.5; ref. 22).

Splicing-associated variant analysis

Detection of splicing-associated variants was performed using SAVNet (v0.4.0) using WES and WTS. We used the control panel of splicing junctions, which were consistently observed across multiple samples within the Genotype-Tissue Expression project. This panel consists of splicing junctions present with two or more supporting reads in at least eight individuals (bioRxiv 2024.02.21.581470).

Protein structure modeling

The protein sequence for wild-type HER2 (P04626) was obtained from the UniPort database, and the protein sequence of exon skipping was generated by replacing L215 with H and deleting the amino sequences from the 216th to 301st position. Wild-type protein structures for HER2 were downloaded from the AlphaFold Protein Structure Database (ID is AF-P04626-F1). The exon-skipping structure was generated using the Alpha Fold2 MMseqs2 (version ColabFold v1.5.5; ref. 23). The resultant rank 1 model is used in Fig. 4C.

ctDNA genotyping

Next-generation sequencing analysis of ctDNA was performed using Guardant360, which is approved by the US FDA and Japan PMDA, at a Clinical Laboratory Improvement Amendments–certified, College of American Pathologists–accredited laboratory approved by the New York State Department of Health. Guardant360 interrogates 74 genes and detects single-nucleotide variants, indels, fusions, CN alterations, and microsatellite instability. Whole blood (two samples, 10 mL each) was collected from patients in a Cell-Free DNA BCT (Streck, Inc., La Vista, NE) and sent to Guardant Health. Next, 5 to 30 ng of cell-free DNA isolated from plasma was labeled with nonredundant oligonucleotides (“molecular barcoding”), enriched using targeted hybridization capture, and sequenced on the NextSeq 550 platform (Illumina, San Diego, CA). Base call files generated using the RTA software version 2.12 (Illumina) were demultiplexed using bcl2fastq (version 2.19, RRID: SCR_015058) and processed using a custom pipeline for molecular barcode detection, sequencing adapter trimming, and base quality trimming. Processed reads were aligned to hg19 using the Burrows–Wheeler aligner-MEM algorithm (H. Li; submitted for publication). Somatic ctDNA alterations were identified using a proprietary bioinformatics pipeline. Relative variant allele frequency (VAF) was calculated by dividing the VAF by the maximally detected variant in the same sample and expressed as percentages. ERBB2 amplification was determined using the Guardant360 CDx assay. Patients were categorized as ERBB2-amplified if their ERBB2 CN was equal to or greater than 2.12.

Statistical analysis

Tumor response to systemic therapy was assessed according to the RECIST v1.1 by local site investigators. Clinical benefit was defined as tumor response or stable disease (SD) for four or more months. Progression-free survival (PFS) was estimated as the time from the date of treatment initiation to the date of disease progression according to the investigator’s assessment or the date of death from any cause. The Kaplan–Meier method was used to estimate survival rates. All statistical analyses were performed using R version 4.2.2. P values of <0.05 were considered statistically significant.

Data availability

The authors declare that all variant data used in the conduct of the analyses are available within the article and its Supplementary Material. To protect the privacy and confidentiality of patients in this study, clinical data are not made publicly available in a repository or the Supplementary Material of the article but will be available upon reasonable request to the corresponding author.

Results

Response of ERBB2-amplified colorectal cancer to HER2-targeted drugs in the SCRUM-Japan project

SCRUM-Japan, a nationwide cancer genomic screening project, aims to develop precision treatment for solid tumors (14). Three projects included in the SCRUM-Japan, GOZILA, MONSTAR-SCREEN, and MONSTAR-SCREEN-2, were conducted for molecular profiling using tissue and plasma multiomics assays. We used these data sets to investigate the efficacy of HER2-targeted agents in patients with ERBB2-amplified solid tumors. A total of 155 patients with ERBB2-amplified solid tumors were treated with HER2-targeted therapy, including mAbs, ADCs, and TKIs. We categorized patients on the basis of the OncoKB annotation of the ERBB2 variant status: pathogenic, VUS, and wild type (Supplementary Table S1). The ORR was 50% (58/114), 51% (14/27), and 35% (5/14) in the ERBB2 wild-type, VUS, and pathogenic variant groups, respectively, suggesting that the pathogenic variants attenuated the efficacy of HER2-targeted agents, although the difference between wild-type and pathogenic variants was not statistically significant (χ2 test; P = 0.69; Fig. 1A). We then investigated the impact of the different classes of drugs on ORR. The group treated with ADCs (49/77) showed a higher ORR than those treated with mAbs (28/75; P = 0.085). In patients with pathogenic variants, ADCs achieved 50% of ORR (5/10), whereas no response was observed with treatment with mAbs (0/4; P = 0.22). The difference in the efficacy by variant pathogenicity and drug class was also observed in the subset of 40 patients with ERBB2-amplified mCRC with seven pathogenic variants. For patients with pathogenic mutations, three of four patients treated with ADCs achieved a complete response or partial response, whereas none of the three patients treated with mAbs achieved a response (Supplementary Fig. S1B). The difference in ORR was not statistically significant (P = 0.14).

Figure 1. Therapy efficacy and gene alterations in 155 patients with ERBB2-amplified cancer treated with HER2-targeted therapy in SCRUM-Japan GOZILA/MONSTAR-SCREEN. A, Overall response of HER2-targeted therapy. Patients were grouped by drug class and ERBB2 genomic status. B, Kaplan–Meier plots of PFS for patients with tumors harboring ERBB2 wild-type, VUS, and pathogenic variants. The log-rank test P-value was 0.098. C, PFS, best overall response, and HER2 genomic status of 93 patients with ERBB2 amplification treated with HER2-targeted therapy in the SCRUM-Japan project. BoR, best overall response; CR, complete response; PD, progressive disease; PR, partial response.

The median PFS was 4.63 months [95% confidence interval (CI), 2.69–NA], 11.43 months (95% CI, 6.90–15.64), and 6.67 months (95% CI, 5.59–7.85) in the ERBB2 pathogenic variant, VUS, and wild-type groups, respectively (Fig. 1B). The pathogenic variants in the ERBB2 gene are typically the oncogenic activating type, which has similar consequences as gene amplification, and are associated with decreased effectiveness of drugs. In contrast, patients with VUS showed favorable PFS. Some VUS may be linked to the increased effectiveness of drugs, such as variants that suppress HER2 activation in ERBB2 amplification.

We further investigated the ERBB2 variants acquired after treatment initiation (Supplementary Fig. S1A). Ninety-three patients underwent genomic testing before and after HER2-targeted therapies. At the time of treatment initiation, 24 (25%) patients had ERBB2 variants, and 9 variants were pathogenic. In 13 patients (14%), 11 VUS and 2 pathogenic variants were identified as acquired alterations after treatment (Fig. 1C). These results indicated that ERBB2 variant status, in addition to the cancer type and disease context, may result in a different magnitude of benefit to the use of HER2-targeted agents.

Study design and participants in TRIUMPH

The TRIUMPH study is a SCRUM-Japan GI-SCREEN/GOZILA–related phase II clinical trial evaluating the efficacy of pertuzumab plus trastuzumab in patients with mCRC with ERBB2 amplification confirmed via tumor tissue or ctDNA analysis (Fig. 2A). In this study, HER2 positivity was defined as IHC 3+ in >10% of tumor cells or FISH-positive (ERBB2/CEP17 ratio ≥2.0) by tissue testing or as ERBB2-amplified by ctDNA analysis. The study met its primary endpoint, with a confirmed ORR of 30% in 27 tissue HER2+ and 28% in 25 ctDNA HER2+ patients (8). To evaluate the molecular profiles and efficacy of HER2-targeted combination treatment, we performed comprehensive WES and WTS using pretreatment and postprogression tumor tissue samples of 14 patients enrolled in the TRIUMPH project (Supplementary Table S2). WES data of pre- and post-treatment were available for 12 and 4 patients, respectively. WTS data of pre- and post-treatment are available for 13 and 6 patients, respectively. Therefore, paired pre- and post-treatment data sets of WES and WTS are available for four and six patients, respectively. Among the 14 patients, 3 showed partial response (PR), 6 had stable disease (SD), and 5 had progressive disease (PD) (Fig. 2B). The number of patients achieving tumor size reduction was seven (Fig. 2B). Four patients experienced clinical benefit, defined as radiographic response or SD at 4 or more months.

Figure 2. Study overview. A, Experimental design. Fourteen patients enrolled in the TRIUMPH project had ERBB2-amplified metastatic colon cancer. The patients were treated by pertuzumab and trastuzumab. We obtained fresh tumor tissues pretreatment and postprogression and ctDNA pretreatment, 3 weeks after the start of treatment, and postprogression. B, Best overall response (BoR) and change in tumor size in response to treatment. Waterfall plot showing the change in the sum of the longest diameters of lesions from the baseline to the best postbaseline investigator assessment. The x-axis indicates the TRIUMPH IDs; green font indicates the presence of clinical benefit. C, Overview of the results of HER2 IHC, ERBB2 copy number (CNV), and transcription (TPM) for tissue samples. Tiles marked with slashes indicate the absence of data. WES data of pre- and post-treatment are available for 12 and 4 patients, respectively. WTS data of pre- and post-treatment are available for 13 and 5 patients, respectively. Therefore, paired pre- and post-treatment data sets of WES and WTS are available for four and six patients, respectively. D, Relationship between TPM and IHC score (left) and TPM and CN (right). The symbols represent the presence (triangle) and absence (circle) of clinical benefit.

Consistency of IHC, genomic amplification of ERBB2, and transcription of ERBB2

IHC testing showed that most samples were HER2 3+ in >10% of tumor cells (Fig. 2C). HER3, a member of the HER family, forms dimers with HER2, and plays a crucial role in HER2 oncogenic activity (2). Most patients also showed HER3 overexpression (>+2) by IHC assay, although the increased level of IHC scores for HER2 and HER3 did not always correlate in the samples (Fig. 2C). We examined the genomic CN and transcription (TPM) of ERBB2 using WES and WTS data, respectively. All analyzed patients showed amplification of ERBB2 ranging from 3 to 79 CNs (Fig. 2C). TPM of ERBB2 was strongly correlated with the HER2 IHC score and ERBB2 CN (Spearman correlation coefficient = 0.7008; Fig. 2D), indicating the overall consistency of the HER2 IHC score, ERBB2 genomic amplification, and ERBB2 transcription level. We examined the differences on the basis of sampling, and the IHC scores, CNs, and TPMs remained unchanged throughout treatments in most patients. Furthermore, we examined the correlation of HER2/ERBB2 status with clinical benefit. The group that exhibited clinical benefit seemed to have a high prevalence of patients with elevated IHC scores, CNs, and TPMs. However, no statistically significant differences were observed (Supplementary Fig. S2).

Genomic variants in ERBB2-amplified mCRC

Using WES data, we investigated genome-wide genomic alterations. To characterize the mutational processes throughout treatment, we analyzed the mutational signatures on the Catalogue of Somatic Mutations in Cancer using detected variants (19). Most single base substitutions were C:G>T:A transition, and the main mutational signature was the signature of clock-like mutational processes correlated with age in a wide range of normal human cell types. Some signatures such as signature 87, associated with thiopurine chemotherapy treatment, appeared after treatment, indicating treatment caused a distinct pattern of single base substitutions (Supplementary Fig. S3). The mutational signatures were not associated with clinical benefit.

To identify variants linked to cancer, we annotated variants with ClinVar and OncoKB databases. The most frequent genes were tumor suppressor genes APC and TP53, regardless of the treatment efficacy, and were shared between pretreatment and postprogression samples (Fig. 3A). Pathogenic variants in ERBB2 (V777L, D769Y, G778-P780insLeuProSer, and L841V) were detected only in patients who did not achieve clinical benefit (Fig. 3A; Table 1). These variants are all located in the tyrosine kinase domain of HER2. Our result suggested that tumors with ERBB2 pathogenic tyrosine kinase variants may not benefit from HER2-targeted combination treatment by pertuzumab plus trastuzumab. We also detected four unknown variants (D1144H, c.644-66_-2del, c.902-1277G>C, and S1050L) of ERBB2 in patients who did not achieve clinical benefit. D1144H was detected in two patients, with and without clinical benefit, and may be benign, as this variant was present with a high frequency (0.0098) in East Asian people (gnomAD v4.0.0). c.644-66_-2del, c.902-1277G>C, S1050L, located in the extracellular domain and C-terminal domain, were detected in patients who did not achieve clinical benefit (Fig. 3B). By conducting WES, we were able to identify even more variants and observe the presence of the variants in patients with no clinical benefit.

Figure 3. Genomic variants identified in ERBB2. A, Heatmap of variants. Short nucleotide variants were analyzed in tissue samples pretreatment (left) and postprogression (right). We extracted variants in genes associated with cancer (listed in the Cancer Gene Census). Pathogenic variants reported in Clinvar and OncoKB are indicated in red. On the x-axis, green font indicates clinical benefit. B, Variants detected in ERBB2. The illustration was downloaded from the PDB database (https://pdb101.rcsb.org/motm/268). Labels denoting protein or cDNA changes based on transcriptional consequences of NM_004448 transcript. Variants in exons are described as labels of a reference amino acid, a position in a protein sequence, and alternative amino acid. For a variant in intron c.644-66_-2del, the label indicates the deletion from -66th to -2nd base position against the 644th base position in the cDNA. For a variant in deep intron c.902-1277G>C, the label indicates the base substitution of G to C at -1277 base position against the 902nd base position in the cDNA. Red font indicates pathogenic variants reported in OncoKB. CT, C-terminal; ECD, extracellular domain; KD, kinase domain.

Table 1. ERBB2 variants identified by WES.

ID	BoR	PFS (m)	Clinical benefit	Timeline	Mutation	VAF (%)	Type	Domain	Amino acid	Clinical significance	
t0001	SD	3.975	No	Post	chr17_39710019_GGTGATGCTGATGAGGGTCTGGTGCCCAGGGCGCCACTCAGCCCTCATCCTGCCCTTTGCCCAACA_G	19.2	Splice acceptor disruption	Extracellular domain	Skipping exons 6-7, in-frame (c.644-66_-2del)	Unknown	
t0008	PD	1.38	No	Pre	chr17_39724008_G_T	72.7	Missense	Kinase domain	D769Y	Oncogenic (OncoKB)	
chr17_39724747_G_C	74.1	Missense	Kinase domain	V777L	Likely pathogenic (ClinVar376406) Oncogenic (OncoKB)	
chr17_39726993_C_T	19.1	Missense	C-terminal region	S1050L	Unknown	
t0011	PD	1.412	No	Pre	chr_39710651_G_C	2.3	Intron variant	Extracellular domain	c.902-1277G>C	Unknown	
t0022	SD	2.595	No	Pre	chr17_39724749_G_GGGCTCCCCA	81.9	In-frame insertion	Kinase domain	G778-P780GSP	Pathogenic (ClinVar375993) oncogenic (OncoKB)	
t0023	PD	1.183	No	Pre	chr17_39727706_G_C	2.5	Missense	C-terminal region	D1144H	Unknown	
t0024	SD	2.825	No	Pre	chr17_39725076_C_G	88.4	Missense	Kinase domain	L841V	Oncogenic (OncoKB)	
t0027	PR	7.885	Yes	Pre	chr17_39727706_G_C	99.1	Missense	C-terminal region	D1144H	Unknown	

The novel exon skipping splice variant of ERBB2

We identified a novel variant, c.644-66_-2del, in patient t0001 in the postprogression pelvic mass. The variant c.644-66_-2del disrupts the acceptor splice site at the sixth intron (Fig. 4A), and it is thus likely to affect splicing. The splicing-associated variants of ERBB2 and their impact on drug efficacy have been largely unexplored, as comprehensive analyses involving genome and transcriptome are required. We obtained paired WES and WTS data, analyzed splicing-associated variants using SAVNet software (24), and detected c.644-66_-2del as a splicing-associated variant, which causes in-frame exon skipping of exons 6 and 7, including the extracellular domain II that is bound by pertuzumab (Fig. 4B). The c.644-66_-2del variant was not detected in pretreatment and postprogression liver, whereas it was detected in the postprogression pelvic mass. When we examined the ERBB2 transcripts, skipping of exons 6 and 7 was observed at a very low frequency of 0.25% (26/10552 reads) in the pretreatment metastatic liver and at a high frequency of 52.5% (5154/9812 reads) in the postprogression pelvic mass. The high penetrance of exon skipping in the pelvic mass strongly suggested that c.644-66_-2del is a splicing-associated variant in accordance with the result of SAVNet. The exon skipping was detected in the pretreatment liver at the very low frequency (Fig. 2B). c.644-66_-2del might exist at undetectable low frequency in the pretreatment liver, but tumor cells harboring this variant may have evolved during tumor progression in the pelvic mass. SAVNet analysis detected another splicing-associated variant, TP53 c.375+4A>G (NM_000546.6) in patient t0001. TP53 c.375+4A>G disrupted the splice donor motif and led to an alternative splice site in the exon, resulting in the out-of-frame deletion of 67 amino acids. TP53 c.375+4A>G was registered in ClinVar (Accession: VCV000406570.9) as VUS in hereditary cancer–predisposing syndrome and Li–Fraumeni syndrome. As TP53 c.375+4A>G is located in an intron, it may be considered a silent variant. However, this variant, as a splicing-associated variant, seems to have a strong impact on TP53 protein. Understanding variants in intron such as splicing-associated variants is crucial for therapy according to specific variant status.

Figure 4. Novel splicing-associated variants. A, Alignment status of around c.644-66_-2del in ERBB2 shown by Integrative Genomics Viewer for ERBB2 for WES of patient t0001. B, Sashimi plot for patient t0001 pretreatment liver (without c.644-66_-2del, top) and postprogression pelvic mass (with c.644-66_-2del, bottom) using WTS. c.644-66_-2del resulted in in-frame skipping of exons 6 and 7. The red circle presents the position of the variant. C, Three-dimensional structure of HER2. Protein structures were predicted using the amino acid sequences of the wild-type sequence (left) and the variant with exons 6 and 7 skipping with leucine at 215 replaced with histidine and deletion of the amino sequences from the 216th to 301st position (right) by AlphaFold2. The pink region is around the extracellular domain II (190th to 343rd position in the amino acid sequence). The color coding is based on the Local Distance Difference Test scores, which assess the accuracy of predictions. A higher score with cooler colors indicates greater accuracy.

To investigate the effect of the exon skipping on HER2 protein structure, we predicted the 3D protein structure of the exon skipping variant using the AlphaFold2 protein prediction artificial intelligence system (23). Exon 6 and 7 skipping led to a structure in which a large part of extracellular domain II was missing (Fig. 4C). However, this did not lead to dramatic changes in whole protein assembly. It is likely that the exon skipping resulted in the translation of HER2 that retained the transmembrane (TM) domain and kinase activity, while interfering with the binding of pertuzumab. These results indicated that c.644-66_-2del may be associated with drug efficacy and oncogenic function.

To investigate the extent to which exon skipping of exons 6 and 7 in ERBB2 is observed in cancer, we searched the transcriptome data in TCGA, a large cancer database (https://portal.gdc.cancer.gov). We searched 10,549 TCGA splice junction data and found 5 samples (TCGA-CU-A0YR of bladder urothelial carcinoma, TCGA-EE-A2GO of skin cutaneous melanoma, TCGA-77–7463 of lung squamous cell carcinoma, TCGA-AK-3434 of kidney renal clear cell carcinoma, and TCGA-N7-A59B of uterine carcinosarcoma) with this novel exon skipping with a frequency of >0.05% in 3 or higher of supporting reads, although the associated variants at the corresponding splice sites were not detected. This result indicated that the exon skipping of exons 6 and 7 occurs in cancers at low frequency. However, further clinical studies will be needed to correlate the pathogenicity with therapeutic efficacy. Variants associated with exon-skipping alterations have not yet been comprehensively investigated because of the complexity that multiple distinct variants may cause a single exon-skipping alteration. We successfully identified the novel splicing alteration and the associated variants by SAVNet using WES and WTS analysis.

The dynamics of the variants of ERBB2

The novel variant of ERBB2, with a deletion in the sixth intron (c.644-66_-2del), was found in the pelvic mass postprogression in patient t0001. This patient was a 53-year-old female with liver and peritoneal metastases who had undergone surgery for sigmoid colon cancer. After four cycles of pertuzumab and trastuzumab, although the size of the liver metastases was reduced, the pelvic mass was enlarged and treatment was discontinued because of disease progression (Fig. 5A). We also analyzed WES of the postprogression liver in addition to the pretreatment liver and postprogression pelvic mass. The c.644-66_-2del variant was detected only in the pelvic mass during postprogression (Fig. 5B). Furthermore, we collected ctDNA at pretreatment, 3 weeks after the start of treatment, and postprogression, and analyzed the somatic variants. The variant c.644-66_-2del emerged at the 3-week point and increased in VAF during progression (Fig. 5C). Additionally, the variant c.1899-20_1901del, which was not detected in tissue, was identified in ctDNA during postprogression. The c.1899-20_1901del variant seems to be a splicing-associated variant that disrupts the splice acceptor site in intron 15. Disruption of an acceptor splice site in intron 15 causes the skipping of exon 16, including the TM domain, forming a constitutively active isoform and is a likely pathogenic mutation (25). The c.1899-20_1901del may be a variant impacting exon 16 skipping. In addition to variants, we compared other ERBB2 genomic alterations, CN, and the amplified regions, including the ERBB2 locus predicted using CNVkit software. This patient exhibited distinct CNVs (CN = 35, 12, 52) and amplified regions (215, 76, 253 kb) of ERBB2 in the metastatic pretreatment liver, postprogression liver, and postprogression pelvic mass, respectively (Fig. 5D and E). We observed the distinct CNs and the amplified regions among metastatic tissues in this patient. Furthermore, CNs varied in ctDNA analysis throughout treatment. These results suggested the presence of tumor populations with different CN alterations and variants and demonstrated the utility of ctDNA to analyze the dynamics of the genomic status of tumors.

Figure 5. Dynamics of ERBB2 status throughout treatment. A, CT images reveal the change in tumor size in patient t0001 in the liver (top) and pelvic mass (bottom) before (left) and after (right) treatment. The orange circles indicate tumors. B, Detection of variants in tissue and ctDNA. The red color indicates the detection of variants in tissue and at sampling timing. Pre, pretreatment; 3W, 3rd week after starting treatment; and Post, after disease progression. C, ctDNA analysis. Relative variant frequency (VAF) and copy number (CN) of ERBB2 in ctDNA. D and E, CN (D) and the length (E) of amplified region containing ERBB2 locus in the pretreatment liver, postprogression liver, and postprogression pelvic mass of patient t0001.

Discussion

We reasoned that multiomics information derived from tissue and liquid biopsy could improve outcome assessment in a precision medicine trial such as TRIUMPH. Indeed, in the last decade, the molecular profiles of solid cancer have been screened, and their influence on the outcome of targeted therapies has become increasingly apparent. In this study, we demonstrated that pathogenic variants of ERBB2 were related to the efficacy of HER2-targeted therapy and identified novel splice variants associated with drug resistance. Acquired variants were tracked using ctDNA during the treatment process. These results may help in the development of additional lines of treatment in patients with ERBB2-amplified mCRC.

Multiple mechanistic strategies for inhibiting HER2 pathways in colorectal cancer have been identified. mAbs directly block HER2-mediated signaling by binding to its extracellular domain (trastuzumab) or by inhibiting its dimerization (pertuzumab). TKIs such as tucatinib, neratinib, and lapatinib block phosphorylation of the intracellular tyrosine kinase domain, thereby reducing pathway signaling. The efficacy of these signal blocking agents may be attenuated by the activation of HER2 signal through pathogenic mutation of ERBB2. ADCs function by binding to the target antigen on the surface of the cancer cell followed by internalizing and releasing the cytotoxic drug. Therefore, this class of drug potentially has potency irrespective of specific mutational status. Furthermore, oncogenic ERBB2 mutations have been reported to enhance the HER2 internalization rate of ADCs. Taken together, ERBB2 mutations are crucial resistance mechanisms in mAb-based treatment, and strategies to overcome these mutations may be important approaches for therapeutic development. In our study, the frequency of new pathogenic ERBB2 variants detected during HER2-targeted therapy was approximately 2% (2 out of 93 patients), which is lower than the reported frequency of EGFR mutations emerging during anti-EGFR therapy (around 10%; refs. 26, 27). This difference could be attributed to several factors. First, the mode of action of HER2-targeted antibodies may differ from that of anti-EGFR antibodies, potentially leading to different mutation rates. Second, anti-EGFR antibodies have been shown to downregulate mismatch repair and activate mutagenesis, which may contribute to the higher frequency of EGFR mutations observed during anti-EGFR therapy (28). Further studies are needed to elucidate the mechanisms underlying the emergence of ERBB2 mutations during HER2-targeted therapy and to compare the mutation rates between different targeted therapies.

Splicing alteration is a hallmark in cancer development and progression. Splicing-associated variants in ERBB2 such as HER2-∆16, herstatin, HER2-PI9, and HER2-I12 were reported in cancer, especially breast and gastric cancers (29–31). We discovered the novel splice-associated variant, c.644-66_-2del, which is associated with exon skipping of exons 6 and 7, resulting in the in-frame deletion of the extracellular domain II bound by pertuzumab. Intriguingly, prior to treatment, the splice variant was identified at a very low allelic fraction only by WTS and was not detectable by WES; it then increased up to approximately 50% in the progressed lesion, suggesting a resistance mechanism through the clonal expansion. Analysis of the predicted protein structure strongly suggested compromised drug binding and an association with drug efficacy. ctDNA analysis also detected c.1899-20_1901del as a HER2-∆16–related variant. HER2-∆16 variants result in exon 16 skipping, which causes a constitutively active isoform with in-frame loss of 16 amino acids in the juxta-TM region. c.1899-1G>A, one of the HER2-∆16 variants, was identified in the acquired resistance to trastuzumab in HER2+ breast cancer (31). These results highlight the importance of ERBB2 splicing variants in ERBB2-amplified mCRC. Our study suggests a potential association between the novel ERBB2 variant and resistance to anti-HER2 mAb-based therapy based on the kinetics during therapy and 3D protein modeling. However, we acknowledge that further in vitro and in vivo validation using model systems is necessary to confirm its role in resistance. Future studies using cell lines and model organisms should be conducted to elucidate the functional impact of this novel splicing alteration on anti-HER2 therapy resistance and to provide more conclusive evidence of its causative role. We showed the novel ERBB2 splicing alterations were present in cancers by using a large database of TCGA. However, existing databases, including TCGA, have limited data on treatment efficacy, which could not provide in-depth analysis of treatment resistance. Further validation of the correlation with treatment efficacy requires the accumulation of cases.

This study has several limitations. Namely, the patient population is heterogeneous in terms of etiology and severity of disease, presence of comorbidities, treatment history, and genetic mutations. The SCRUM-Japan GOZILA/MONSTAR-SCREEN project also includes a variety of therapies targeting HER2; the TRIUMPH project collects omics data uniformly in a single clinical trial, but the patient sample size is limited. We analyzed ERBB2 variants in tissue and ctDNA in this study. Some limitations exist in accurately analyzing variants and interpreting results. The detection of plasma genomic variant is challenging given the typically low amounts of ctDNA shed into the bloodstream. However, we detected the ERBB2 variants, indicating the presence of tumor populations in distinct tissues and sampling timing. Our results indicated the utility of ERBB2 variants as genotyping for determining treatments. Analyzing variants within amplifications using short reads is also challenging because it cannot distinguish between intra- and intercellular heterogeneity. The amount of variation in a genomic ERBB2 region with increased CNs is not known. Elucidating these details may be crucial in therapies in which targeting variants are used for treatment decisions. Technologies such as long-read sequencing could reveal such details.

Conclusion

Our multiomics analysis demonstrated the association of ERBB2 variants in ERBB2 amplification in HER2-targeted mAb therapy. We identified the c.644-66_-2del variant and showed it caused in-frame skipping of exon 6 using WES and WTS data. Using only WES to identify splice-associated variants is common, but interpreting the impact of splicing is difficult. Comprehensive WES and WTS enabled us to effectively understand the impact of variants on transcripts, including the identification of splicing-associated variants. We also demonstrated the importance of ctDNA genotyping to the assessment of treatment efficacy. Our study will be helpful in furthering the understanding of the mechanism underlying drug efficacy and resistance in ERBB2-amplified mCRC.

Supplementary Material

Figure S1 Figure S1

Figure S2 Figure S2

Figure S3 Figure S3

Supplementary Data 1 Supplementary Data

Source data 1 Source data

Acknowledgments

The authors would like to thank all patients and their families who participated in this study; the investigators, research nurses, study coordinators, and research staff at the study sites; the National Cancer Center Exploratory Oncology Research & Clinical Trial Center members; and the National Cancer Center Hospital East Translational Research Support Section members. This study was supported by grants from the Japan Agency for Medical Research and Development (16lk0201054h0001 to T. Yoshino, 19ck0106445h0002 to Y. Nakamura), National Cancer Center Research and Development Fund (2021-A-06 to T. Yoshino), Daiichi Sankyo, and SCRUM-Japan Funds (http://www.scrum-japan.ncc.go.jp/index.html). Computations were partially performed on the NIG supercomputer at ROIS National Institute of Genetics.

Authors’ Disclosures

M. Imai reports other support from Sumitomo Corp., Exact Sciences Corporation, Chugai Pharmaceutical Co., Ltd., and Merck Sharp and Dohme, Inc., outside the submitted work. W. Okamoto reports grants from AMED and nonfinancial support from Chugai Pharmaceutical Co., Ltd., and Abbott Japan LLC during the conduct of the study, as well as grants and personal fees from Daiichi Sankyo Co., Ltd., grants from Janssen Pharmaceutical K.K. and Agios Pharmaceuticals, Inc., and personal fees from Chugai Pharmaceutical Co., Ltd., Bristol Myers Squibb Company, Ono Pharmaceutical Co., Ltd., AstraZeneca K.K., Taiho Pharmaceutical Co., Ltd., Eisai Co., Ltd., Bayer Holding Ltd., Novartis Pharma K.K., Eli Lilly Japan K.K., MSD K.K., Takeda Pharmaceutical Co., Ltd., Zeria Pharmaceutical Co., Ltd., Guardant Health Japan Corp., and Thermo Fisher Scientific K.K. outside the submitted work. T. Kato reports personal fees from Chugai and Takeda outside the submitted work. T. Esaki reports grants from MSD, Ono, Chugai, Amgen, ALX Oncology, Seagen, Taiho, Daiichi Sankyo, Pfizer, Jazz Pharmaceuticals, Asahi Kasei Pharma, Quintiles, Astellas Amgen BioPharma, Novartis, and Syneos Health Clinical outside the submitted work. Y. Komatsu reports grants and personal fees from Daiichi Sankyo during the conduct of the study, as well as grants and personal fees from Daiichi Sankyo, Chugai, Ono, Bristol Myers Squibb, Bayer, Takeda, Merck, MSD, Astellas, Servier, Sanofi, Taiho, Eli Lilly and Company, Nihon Kayaku, Nipro, and Shionogi outside the submitted work. S. Yuki reports personal fees from Eli Lilly Japan K.K., Chugai Pharmaceutical Co., Ltd., Taiho Pharmaceutical Co., Ltd., Merck Biopharma Co., Ltd., Bristol Myers Squibb K.K., Bayer Yakuhin, Ltd., Takeda Pharmaceutical Co., Ltd., MSD K.K., Ono Pharmaceutical Co., Ltd., Miyarisan Pharmaceutical Co., Ltd., Nippon Boehringer Ingelheim Co., Ltd., and Daiichi Sankyo Co., Ltd., outside the submitted work. T. Masuishi reports grants and personal fees from MSD, Daiichi Sankyo, Ono, and Eli Lilly and Company, grants from Novartis, Amgen, Syneos Health Clinical, Boehringer Ingelheim, Pfizer, and CIMIC Shift Zero, and personal fees from Takeda, Chugai, Merck Biopharma, Taiho, Bayer, Yakult Honsha, Sanofi, Bristol Myers Squibb, and Nippon Kayaku outside the submitted work. T. Nishina reports grants and personal fees from Bristol Myers Squibb, Daiichi Sankyo, Ono Pharmaceutical, Taiho Pharmaceutical, Astellas, and MSD outside the submitted work. H. Ebi reports personal fees from Amgen, Bristol Myers Squibb, Chugai Pharmaceutical, Incyte, Guardant, Merck Serono, and Ono Pharmaceutical outside the submitted work. H. Taniguchi reports personal fees from Chugai, Ono, Eli Lilly and Company, and Merck Biopharma and grants from Takeda and Daiichi Sankyo outside the submitted work. Y. Sunakawa reports grants and personal fees from Chugai Pharmaceutical Co., Ltd., and Taiho Pharmaceutical Co., Ltd., and personal fees from Eli Lilly Japan K.K., Bristol Myers Squibb K.K., Takeda Pharmaceutical Co., Ono Pharmaceutical Co., Ltd., Merck Biopharma Co., Ltd., Bayer Yakuhin, Ltd., Daiichi Sankyo Co., Ltd., MSD K.K., Novartis Pharmaceuticals, and Astellas Pharma, Inc., outside the submitted work. K. Yamazaki reports personal fees from Chugai, Takeda, Yakult, Taiho, Daiichi Sankyo, Merck Biopharma, Eli Lily and Company, Ono, MSD, and Bristol Myers and Squibb outside the submitted work. S. Boku reports grants from Daiichi Sankyo Co., Ltd., and personal fees from Chugai Pharmaceutical and Daiichi Sankyo Co., Ltd., during the conduct of the study, as well as personal fees from Taiho Pharmaceutical and Yakult Honsha outside the submitted work. H. Bando reports personal fees from Eli Lilly Japan, Taiho Pharmaceutical, and Ono Pharmaceutical outside the submitted work. M. Kobayashi reports other support from Daiichi Sankyo during the conduct of the study. A. Sato reports grants from Taiho Pharmaceutical, Boehringer Ingelheim, Bayer, Chugai Pharmaceutical, Eisai, MSD, Ono Pharmaceutical, Takeda, Dainippon Sumitomo Pharma, Oncolys BioPharma, Rakuten Medical, Pentax Medical Devices, and Daiichi Sankyo/UCB Japan and personal fees from Astellas Pharma Inc. outside the submitted work. T. Yoshino reports grants and personal fees from Chugai Pharmaceutical, Takeda Pharmaceutical, Ono Pharmaceutical, and MSD K.K., personal fees from Merck Biopharma, Bayer Yakuhin, and Sumitomo Corp., and grants from Amgen, Bristol Myers Squibb, Daiichi Sankyo, Eisai, FALCO Biosystems, Genomedia, MEDICAL & BIOLOGICAL LABORATORIES, Merus N.V., Molecular Health GmbH, Nippon Boehringer Ingelheim, Pfizer, Roche Diagnostics, Sanofi, Sysmex, and Taiho Pharmaceutical outside the submitted work. Y. Nakamura reports grants from Daiichi Sankyo Co., Ltd., during the conduct of the study and grants from Genomedia, Guardant Health AMEA, Guardant Health, Tempus, and Roche Diagnostics K.K. outside the submitted work, as well as personal fees from Daiichi Sankyo Co., Ltd., Natera, Inc., Roche, Ltd., Premo Partners, Inc., Takeda, Exact Sciences, Gilead Sciences, Guardant Health Pte. Ltd., MSD K.K., Eisai, Zeria Pharmaceutical, Miyarisan Pharmaceutical, Merck, CareNet, Inc., Hisamitsu Pharmaceutical, Taiho Pharmaceutical, Becton Dickinson, and Guardant Health Japan Corp., and grants and personal fees from Seagen, Inc., and Chugai Pharmaceutical. No disclosures were reported by the other authors.

Authors’ Contributions

N. Iida: Data curation, formal analysis, investigation, visualization, writing–original draft. M. Imai: Resources, writing–review and editing. W. Okamoto: Resources, writing–review and editing. T. Kato: Resources, writing–review and editing. T. Esaki: Resources, writing–review and editing. K. Kato: Resources, writing–review and editing. Y. Komatsu: Resources, writing–review and editing. S. Yuki: Resources, writing–review and editing. T. Masuishi: Resources, writing–review and editing. T. Nishina: Resources, writing–review and editing. H. Ebi: Resources, writing–review and editing. H. Taniguchi: Resources, writing–review and editing. N. Nonomura: Resources, writing–review and editing. Y. Sunakawa: Resources, writing–review and editing. M. Shiozawa: Resources, writing–review and editing. K. Yamazaki: Resources, writing–review and editing. S. Boku: Resources, writing–review and editing. H. Bando: Resources, writing–review and editing. Y. Shiraishi: Resources, writing–review and editing. M. Kobayashi: Resources, writing–review and editing. H. Goto: Resources, writing–review and editing. A. Sato: Resources, writing–review and editing. S. Fujii: Resources, writing–review and editing. T. Yoshino: Conceptualization, supervision, funding acquisition, project administration, writing–review and editing. Y. Nakamura: Conceptualization, resources, formal analysis, visualization, writing–original draft, project administration.

Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).
==== Refs
References

1. Sawada K , NakamuraY, YamanakaT, KubokiY, YamaguchiD, YukiS, . Prognostic and predictive value of HER2 amplification in patients with metastatic colorectal cancer. Clin Colorectal Cancer 2018;17 :198–205.29866615
2. Ross JS , FakihM, AliSM, ElvinJA, SchrockAB, SuhJ, . Targeting HER2 in colorectal cancer: the landscape of amplification and short variant mutations in ERBB2 and ERBB3. Cancer 2018;124 :1358–73.29338072
3. Strickler JH , CercekA, SienaS, AndréT, NgK, Van CutsemE, . Tucatinib plus trastuzumab for chemotherapy-refractory, HER2-positive, RAS wild-type unresectable or metastatic colorectal cancer (MOUNTAINEER): a multicentre, open-label, phase 2 study. Lancet Oncol 2023;24 :496–508.37142372
4. Strickler JH , YoshinoT, GrahamRP, SienaS, Bekaii-SaabT. Diagnosis and treatment of ERBB2-positive metastatic colorectal cancer: a review. JAMA Oncol 2022;8 :760–9.35238866
5. Siena S , Di BartolomeoM, RaghavK, MasuishiT, LoupakisF, KawakamiH, . Trastuzumab deruxtecan (DS-8201) in patients with HER2-expressing metastatic colorectal cancer (DESTINY-CRC01): a multicentre, open-label, phase 2 trial. Lancet Oncol 2021;22 :779–89.33961795
6. Meric-Bernstam F , HurwitzH, RaghavKPS, McWilliamsRR, FakihM, VanderWaldeA, . Pertuzumab plus trastuzumab for HER2-amplified metastatic colorectal cancer (MyPathway): an updated report from a multicentre, open-label, phase 2a, multiple basket study. Lancet Oncol 2019;20 :518–30.30857956
7. Sartore-Bianchi A , TrusolinoL, MartinoC, BencardinoK, LonardiS, BergamoF, . Dual-targeted therapy with trastuzumab and lapatinib in treatment-refractory, KRAS codon 12/13 wild-type, HER2-positive metastatic colorectal cancer (HERACLES): a proof-of-concept, multicentre, open-label, phase 2 trial. Lancet Oncol 2016;17 :738–46.27108243
8. Nakamura Y , OkamotoW, KatoT, EsakiT, KatoK, KomatsuY, . Circulating tumor DNA-guided treatment with pertuzumab plus trastuzumab for HER2-amplified metastatic colorectal cancer: a phase 2 trial. Nat Med 2021;27 :1899–903.34764486
9. Meric-Bernstam F , BeeramM, HamiltonE, OhD-Y, HannaDL, KangY-K, . Zanidatamab, a novel bispecific antibody, for the treatment of locally advanced or metastatic HER2-expressing or HER2-amplified cancers: a phase 1, dose-escalation and expansion study. Lancet Oncol 2022;23 :1558–70.36400106
10. Connolly RM , WangV, HymanDM, GrivasP, MitchellEP, WrightJJ, . Trastuzumab and pertuzumab in patients with non-breast/gastroesophageal HER2-amplified tumors: results from the NCI–MATCH ECOG–ACRIN trial (EAY131) subprotocol J. Clin Cancer Res 2024;30 :1273–80.38433347
11. Vaghi C , MauriG, AgostaraAG, PatelliG, PizzutiloEG, NakamuraY, . The predictive role of ERBB2 point mutations in metastatic colorectal cancer: a systematic review. Cancer Treat Rev 2023;112 :102488.36410093
12. Yaeger R , ChatilaWK, LipsycMD, HechtmanJF, CercekA, Sanchez-VegaF, . Clinical sequencing defines the genomic landscape of metastatic colorectal cancer. Cancer Cell 2018;33 :125–36.e3.29316426
13. Cancer Genome Atlas Network . Comprehensive molecular characterization of human colon and rectal cancer. Nat [Internet] 2012;487 :330–7.
14. Nakamura Y , FujisawaT, TaniguchiH, BandoH, OkamotoW, TsuchiharaK, . SCRUM-Japan GI-SCREEN and MONSTAR-SCREEN: path to the realization of biomarker-guided precision oncology in advanced solid tumors. Cancer Sci 2021;112 :4425–32.34510657
15. Fujii S , MaglioccoAM, KimJ, OkamotoW, KimJE, SawadaK, . International harmonization of provisional diagnostic criteria for ERBB2-amplified metastatic colorectal cancer allowing for screening by next-generation sequencing panel. JCO Precis Oncol 2020;4 :6–19.35050726
16. McKenna A , HannaM, BanksE, SivachenkoA, CibulskisK, KernytskyA, . The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 2010;20 :1297–303.20644199
17. McLaren W , GilL, HuntSE, RiatHS, RitchieGRS, ThormannA, . The ensembl variant effect predictor. Genome Biol 2016;17 :122.27268795
18. Talevich E , ShainAH, BottonT, BastianBC. CNVkit: genome-wide copy number detection and visualization from targeted DNA sequencing. PLoS Comput Biol 2016;12 :e1004873.27100738
19. Tate JG , BamfordS, JubbHC, SondkaZ, BeareDM, BindalN, . COSMIC: the catalogue of somatic mutations in cancer. Nucleic Acids Res 2019;47 :D941-7.30371878
20. Dobin A , DavisCA, SchlesingerF, DrenkowJ, ZaleskiC, JhaS, . STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013;29 :15–21.23104886
21. Liao Y , SmythGK, ShiW. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014;30 :923–30.24227677
22. Garrido-Martín D , PalumboE, GuigóR, BreschiA. ggsashimi: Sashimi plot revised for browser- and annotation-independent splicing visualization. PLoS Comput Biol 2018;14 :e1006360.30118475
23. Jumper J , EvansR, PritzelA, GreenT, FigurnovM, RonnebergerO, . Highly accurate protein structure prediction with AlphaFold. Nature 2021;596 :583–9.34265844
24. Shiraishi Y , KataokaK, ChibaK, OkadaA, KogureY, TanakaH, . A comprehensive characterization of cis-acting splicing-associated variants in human cancer. Genome Res 2018;28 :1111–25.30012835
25. Smith HW , YangL, LingC, WalshA, MartinezVD, BoucherJ, . An ErbB2 splice variant lacking exon 16 drives lung carcinoma. Proc Natl Acad Sci U S A 2020;117 :20139–48.32727899
26. Siena S , RaghavK, MasuishiT, YamaguchiK, NishinaT, ElezE, . 386O Exploratory biomarker analysis of DESTINY-CRC01, a phase II, multicenter, open-label study of trastuzumab deruxtecan (T-DXd, DS-8201) in patients (pts) with HER2-expressing metastatic colorectal cancer (mCRC). Ann Oncol 2021;32 :S532.
27. Siravegna G , LazzariL, CrisafulliG, Sartore-BianchiA, MussolinB, CassingenaA, . Radiologic and genomic evolution of individual metastases during HER2 blockade in colorectal cancer. Cancer Cell 2018;34 :148–62.e7.29990497
28. Russo M , CrisafulliG, SogariA, ReillyNM, ArenaS, LambaS, . Adaptive mutability of colorectal cancers in response to targeted therapies. Science 2019;366 :1473–80.31699882
29. Hart V , SilipoM, SatamS, GautreyH, KirbyJ, Tyson-CapperA. HER2-PI9 and HER2-I12: two novel and functionally active splice variants of the oncogene HER2 in breast cancer. J Cancer Res Clin Oncol 2021;147 :2893–912.34136934
30. Silipo M , GautreyH, SatamS, LennardT, Tyson-CapperA. How is Herstatin, a tumor suppressor splice variant of the oncogene HER2, regulated? RNA Biol 2017;14 :536–43.27935425
31. Jiao X-D , LiuK, WuY, ZhouX-C, QinB-D, LingY, . HER2 splice site mutation c.1899-1G>A as the potential acquired resistance to trastuzumab in a patient with HER2-positive gastric adenocarcinoma. Oncologist 2021;26 :717–21.33896090
