
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39266597
71486
10.1038/s41598-024-71486-0
Article
PEG-SeNPs as therapeutic agents inhibiting apoptosis and inflammation of cells infected with H1N1 influenza A virus
Guo Min 1
Ye Yu-Dan 1
Cai Jian-Piao 2
Xu Hai-Tong 1
Wei Wei 1
Sun Jia-Yu 1
Wang Chen-Yang 1
Wang Chang-Bing 1
Li Ying-Hua liyinghua@gzhmu.edu.cn

1
Zhu Bing zhubing0327@hotmail.com

1
1 grid.410737.6 0000 0000 8653 1072 Central Laboratory, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, 318 Renmin Middle Road, Guangzhou, China
2 https://ror.org/02zhqgq86 grid.194645.b 0000 0001 2174 2757 State Key Laboratory for Emerging Infectious Diseases, Carol Yu Centre for Infection, Department of Microbiology, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Pokfulam, Hong Kong China
12 9 2024
12 9 2024
2024
14 2131812 6 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
The rapid variation of influenza challenges vaccines and treatments, which makes an urgent task to develop the high-efficiency and low-toxicity new anti-influenza virus drugs. Selenium is one of the essential trace elements for the human body that possesses a good antiviral activity. In this study, we assessed anti-influenza A virus (H1N1) activity of polyethylene glycol (PEG)-modified gray selenium nanoparticles (PEG-SeNPs) on Madin-Darby Canine Kidney (MDCK) cells in vitro. CCK-8 assay showed that PEG-SeNPs had a protective effect on H1N1-infected MDCK cells. Moreover, PEG-SeNPs significantly reduced the mRNA level of H1N1. TUNEL-DAPI test showed that DNA damage reached a high level but effectively prevented after PEG-SeNPs treatment. Meanwhile, JC-1, Annexin V-FITC and cell cycle assay demonstrated the apoptosis induced by H1N1 was reduced greatly when treated with PEG-SeNPs. Furthermore, the downregulation of p-ATM, p-ATR and P53 protein, along with the upregualation of AKT protein indicated that PEG-SeNPs could inhibit H1N1-induced cell apoptosis through reactive oxygen species (ROS)-mediated related signaling pathways. Finally, Cytokine detection demonstrated PEG-SeNPs inhibited the production of pro-inflammatory factors after infection, including IL-1β, IL-5, IL-6, and TNF-α. To sum up, PEG-SeNPs might become a new potential anti-H1N1 influenza virus drug due to its antiviral and anti-inflammatory activity.

Keywords

PEG-SeNPs
Influenza virus
Apoptosis
Signaling pathways
Cytokine
Subject terms

Cell biology
Drug discovery
Medical research
Guangzhou Medical University Students’ Scientific Research In-novation Ability Improvement Project02-408-2203-2080, 02-408-2304-19080XM and 02-408-240603131099 Guangdong Natural Science Foundation2020A1515110648 tech-nology planning projects of Guangzhou202201020628 issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Approximately 5–10% of adults and 20–30% of children are infected with influenza each year, resulting in significant social and economic loss worldwide1–3. Acute respiratory diseases caused by influenza viruses are highly contagious, but often self-limiting diseases4,5. However, in severe cases, the clinical manifestation may include respiratory, circulatory, and central system problems and even death6,7. Influenza virus is an RNA virus that belongs to the Orthomyxoviridae family and has an envelope structure with radially arranged glycoproteins, including hemagglutinin (HA), neuraminidase (NA), and matrix protein M28,9. Neuraminidase inhibitors, such as oseltamivir, zanamivir, and peramivir, and ion channels M2 blockers, like amantadine and rimantadine are the most common anti-influenza virus drugs used in clinical practice10. However, the latest studies have shown that these drugs may lead to certain adverse side effects, including damage to the gastrointestinal system, central nervous system, and peripheral nervous system11. In addition, a rapid mutation of the influenza virus and related site mutations may lead to drug resistance12,13 and difficult of vaccine development14. Therefore, there is an urgent need to develop new anti-influenza drugs with high efficiency and low toxicity.

Over recent years, the combination of biotechnology and nanotechnology has promoted the widespread application of nanomedicine15,16. Selenium is an essential trace element necessary for humans and animals, and exhibits various biological functions in the body in the form of selenoprotein10,16–18. Moreover, selenium deficiency can induce cardiovascular19 and cerebrovascular diseases20, cancer21, nervous system diseases22, autoimmune diseases23 and is usually related to the incidence and mortality of viral infectious diseases24. So far, at least 30 viral infections have been linked to the host’s selenium nutritional status25. Previous studies have shown that selenium supplementation can balance the body’s redox and immune imbalance, inhibit virus replication, and alleviate viral diseases25,26. During the virus infection, excess reactive oxygen species (ROS) lead to DNA and/or protein damage, extensive mitochondrial oxidative damage, signal transduction, and cell apoptosis25,27,28. During past decades, selenium nanoparticles (SeNPs) have attracted much attention because of their antioxidant activity, unique biological activity, low toxicity, and nanomedicine applications29. Selenium, essential for a balanced diet, is absorbed in the intestines, metabolized into selenocysteine in the liver, and incorporated into selenoproteins such as SELENOP. SELENOP, released into the bloodstream, serves as a selenium source for tissues throughout the body30. Notably, SeNPs stand out among frequently studied nanoparticles like gold or silver nanoparticles due to the in vivo degradability of selenium31. Some studies have shown that SeNPs and selenocompounds have the ability to inhibit virus replication. It is reported that SeNPs are promising inhibitors for controlling influenza H1N1 virus infections as indicated by Su et al.32. Shao et al. founded that chitosan-coated selenium nanoparticles (CS-SeNPs) attenuate PRRSV replication and ROS/JNK-mediated apoptosis in vitro, suggesting the potential antiviral activity of CS-SeNPs33. Li et al. reported that Selenium–ruthenium complex blocks H1N1 influenza virus-induced cell damage by activating GPx1/TrxR134.

Polyethylene glycol (PEG) is the most popular and widely-used biocompatible proetein-coupled polymer used for functionalized protein and peptide drug delivery35,36. PEG is also wildly applied in protein modification37,38. PEGylating conquers the problems of protein application, for example, rapid elimination in vivo, enzymatic degradation and immunogenicity39. PEG is safe to ingest through both oral and non-oral routes according to animal experiments and clinical trials35. However, there are only a few studies on the modification of PEG as a biologically active molecule, especially the direct nanometerization of PEG-modified selenium. Most research is focused on the oncological efficacy of PEG-SeNPs through its toxicity on cancer cells. For instance, it has been reported that the PEG-SeNPs had very low cytotoxicity in human kidney HK-2 cells while exhibiting a dose-dependent cytotoxic effect on drug-resistant hepatocellular carcinoma cells (R-HepG2) to exert the anticancer effect31. Moreover, PEG-SeNPs modified with crocin demonstrated a great capability to reduce tumor growth in mice model40. Yet, the antiviral function of PEG-SeNPs still remains unexplored.

In this study, we assessed the anti-H1N1 activity of PEG-modified gray Se nanoparticles (PEG-SeNPs) on MDCK cells in vitro. Our results indicated that PEG-SeNPs could be a potential new treatment strategy against the H1N1 influenza virus.

Results

Evaluation of the antiviral activity of PEG-SeNPs

CCK-8 assay was used to evaluate the effect of different concentrations of PEG-SeNPs on the proliferation of MDCK cells infected with or without H1N1 virus. As shown in Fig. 1A, concentrations of 32 μM and above were toxic to the cells, and the 50% cytotoxic concentration (CC50) value was 53.58 μM. As shown in Fig. 1B, when the concentration is 4–16 μM, PEG-SeNPs inhibited viral activity, and the cell survival rate increased in a dose-dependent manner. The 50% maximal effective concentration (EC50) value was 4.30 μM and the selectivity index (SI) was CC50/EC50 = 53.58/4.30 = 12.46. Demonstrated in Fig. 1C and D, a significant reduction in virus titer was observed following PEG-SeNPs treatment, suggesting a good anti-H1N1 virus effect. Moreover, as shown in Fig. 1E, the virus group showed cytopathic changes compared to the treatment group; the number of cells in the virus group was reduced, and the intercellular space was enlarged. To sum up, these results showed that PEG-SeNPs improve the survival rate of MDCK cells after H1N1 infection.Fig. 1 The effects of different concentrations of PEG-SeNPs on MDCK cells with or without virus infection. (A) The cytotoxicity of PEG-SeNPs. (B) The antiviral activity of PEG-SeNPs was determined by CCK8 assay. (C, D) The antiviral activity of PEG-SeNPs was determined by TCID 50 assay. The concentration of PEG-SeNPs was 16 μM in C. (E) The morphological changes of cells infected with H1N1 virus and treated with different concentrations of PEG-SeNPs observed with phase-contrast microscope. Experiments were repeated three times. P < 0.05 was considered to be statistically significant. # represents comparison with the control group, while * represents comparison with the virus group.

PEG-SeNPs inhibited H1N1 replication

MDCK cells were first infected by H1N1 for 2 h and were then treated with 16 μM PEG-SeNPs. The expression of H1N1 mRNA was then detected using qPCR. Compare to the H1N1 group (100%), the expression of H1N1 mRNA was declined and the rate was decreased to 11.9% after treatment with PEG-SeNPs (Fig. 2). The result indicated that PEG-SeNPs inhibit virus replication, thereby improving cell proliferation and survival rates.Fig. 2 The effects of SeNPs on virus proliferation. Compare to the H1N1 virus group, the mRNA level of control group, PEG-SeNPs, and PEG-SeNPs + H1N1 group. The concentration of PEG-SeNPs was 16 μM. The level of viral RNA was detected in the cell culture supernatant using the Real-Time PCR method. Experiments were repeated three times. P < 0.05 was considered to be statistically significant. # represents comparison with the control group, while * represents comparison with the virus group.

PEG-SeNPs inhibit mitochondrial apoptosis pathway

The JC-1 is commonly used as a marker to analyze changes in mitochondrial membrane potential. Depolarization of mitochondrial membrane potential is one of the early signs of cell apoptosis. This study used flow cytometry and fluorescence microscope to detect the mitochondrial membrane potential in different groups. In contrast to the control group, the mitochondrial membrane potential was reduced significantly to 35.5%, and 13.1% for the H1N1, and PEG-SeNPs + H1N1 group, respectively (Fig. 3A, B). Compared with other groups, the green fluorescence of the JC-1 monomer in the virus group increased, accompanied by the decreased red fluorescence of JC-1 aggregates (Fig. 3C). These results revealed that PEG-SeNPs could inhibit the membrane potential depolarization of H1N1 infected MDCK cells.Fig. 3 PEG-SeNPs inhibited the reduction of mitochondrial membrane potential caused by virus infection. (A) Detection of mitochondrial membrane potential by flow cytometry. (B)The change of mitochondrial membrane potential compared with the H1N1 group. (C) The green fluorescence of the JC-1 monomer and red fluorescence of JC-1 aggregates were observed by fluorescence microscope. The concentration of PEG-SeNPs was 16 μM. Experiments were repeated three times. P < 0.05 was considered to be statistically significant. # represents comparison with the control group, while * represents comparison with the virus group.

PEG-SeNPs inhibited phosphatidylserine eversion in H1N1 infected MDCK cells

Annexin V-FITC and PI double staining experiments are used to detect the stage of cell apoptosis. Compared with the virus group, the early and late apoptosis rates of the drug treatment group were both obviously decreased (Fig. 4A). In accordance with Fig. 4B, the total apoptosis rates of the control group, H1N1 virus group, PEG-SeNPs group, and H1N1 + PEG-SeNPs are 7.79%, 48.79%, 13.04%, 16%, respectively. As shown in Fig. 4C, the red (propidium iodide positive cells) and green (Annexin V-FITC positive cells) fluorescence were the strongest in the virus group, which were reduced after treatment with PEG-SeNPs. These results indicated that PEG-SeNPs inhibited MDCK cells apoptosis induced by H1N1 infection.Fig. 4 The effect of PEG-SeNPs on the translocation of phosphatidylserine induced by virus infection. (A) Detection of apoptosis by flow cytometry. The upper right quadrant indicates the percentage of early apoptotic cells, and the lower right quadrant the percentage of late apoptotic or necrotic cells. The lower left quadrant represents cell survival. (B) The percentage of total apoptotic cells, including both early and late apoptotic cells. (C) The apoptosis of MDCK cells were photographed by fluorescence microscope. Experiments were repeated three times. P < 0.05 was considered to be statistically significant. # represents comparison with the control group, while * represents comparison with the virus group.

PEG-SeNPs inhibit MDCK cell apoptosis induced by the H1N1 virus

The cell cycle analysis was performed according to the distribution of propidium iodide-stained DNA. As shown in Fig. 5A, untreated cells were mainly distributed in the G0/G1 phase, while significant changes in the percentage of cells were observed in almost all G1, S, and G2/M phases in the virus-infected group. As indicated by Fig. 5B, the sub-G1 peak was significantly increased in H1N1 group, and the apoptosis rate reached 24.35%. There was no obvious apoptosis peak after 48 h of treatment of PEG-SeNPs, and the apoptosis rate was only 8.10%. These results proved that PEG-SeNPs could rescue MDCK cells apoptosis induced by the H1N1 virus.Fig. 5 The effect of PEG-SeNPs on the apoptosis of MDCK cells infected by the H1N1 virus. (A) The sub-G1 apoptotic cell population in the control, H1N1, PEG-SeNPs, H1N1 + PEG-SeNPs group was 1.80%, 24.35%, 3.93%, 8.10%, respectively. (B) Cell cycle assay involved quantitative detection of DNA content by flow cytometry and the analysis of cell cycle distribution, especially the proportion of apoptosis peaks after different treatments. Experiments were repeated three times. P < 0.05 was considered to be statistically significant. # represents comparison with the control group, while * represents comparison with the virus group.

PEG-SeNPs inhibit DNA damage after virus infection

The cell apoptosis was further verified by TUNEL and DAPI experiments. The fragmented DNA is stained green by TUNEL, while the cell nucleus is stained blue by PI solution. DNA fragmentation and nuclear condensation were observed in MDCK cells after H1N1 infection (Fig. 6B), while the green fluorescence was weakened and the nuclear morphology changes were effectively prevented after PEG-SeNPs treatment. The mean green fluorescence intensity was analyzed by the Image J software. As shown in Fig. 6A, the mean green fluorescence intensity was decreased after PEG-SeNPs treatment. These results further indicated that PEG-SeNPs rescued the apoptosis of H1N1 infected MDCK cells.Fig. 6 DNA fragmentation and nuclear coagulation examined using TUNEL-DAPI staining. (A) Compared to H1N1 group, the mean green fluorescence intensity was significantly reduced after PEG-SeNPs treatment. (B) Apoptotic cells were positively stained by TUNEL green fluorescence. Experiments were repeated three times. P < 0.05 was considered to be statistically significant. # represents comparison with the control group, while * represents comparison with the virus group.

PEG-SeNPs inhibited the production of reactive oxygen species

ROS is the class of active molecules with high oxidative activity, mainly including free radicals, oxygen ions, and peroxides41. The production of ROS often occurs after viral infection. Excessive ROS induces oxidative stress and enhances virus replication25. Mitochondria are the main source of ROS within cells, which are often detected by the fluorescent dye DHE. Compared with the control group, the relative levels of ROS in the H1N1 group, the PEG-SeNPs group, and the H1N1 + PEG-SeNPs group were 265%, 105%, and 125%, respectively (Fig. 7). The H1N1 group has the strongest DCF green fluorescence, while the H1N1 + PEG-SeNPs group was significantly weak. Therefore, we concluded that PEG-SeNPs might inhibit the virus-induced ROS production.Fig. 7 PEG-SeNPs inhibited the production of ROS induced by the virus. (A) The reactive oxygen levels of the H1N1 virus group, PEG-SeNPs, H1N1 + PEG-SeNPs group were 265%, 105%, 125%, respectively, compared with the control group (100%). Experiments were repeated three times. P < 0.05 was considered to be statistically significant. (B) The production of reactive oxygen species between different groups detected by a fluorescence microscope. # represents comparison with the control group, while * represents comparison with the virus group.

PEG-SeNPs inhibited the ROS mediated AKT, ATR, and P53 signal pathways

During ROS-mediated oxidative stress, multiple signaling pathways are seen to have significant effects42. The mechanism of PEG-SeNPs against the H1N1 virus was further explored by detecting related apoptosis proteins. The C-PARP protein was increased in H1N1 infected cells, and the PEG-SeNPs could inhibit C-PARP protein expression. Besides, PEG-SeNPs downregulated p-ATM, p-ATR and P53 protein expression induced by H1N1 infection (Fig. 8). In contrast, PEG-SeNPs upregulated Bcl-2, PARP and AKT protein expression induced by H1N1 infection. These results indicated that the AKT, ATR, and P53 signaling pathways were involved in PEG-SeNPs mediated apoptosis inhibition.Fig. 8 The protein expression of ATM, ATR, P53 and AKT by Western blot. PEG-SeNPs downregulated the protein expression including, p-ATM, p-ATR, P53, and C-PARP proteins. Meanwhile, PEG-SeNPs upregulated the protein expression of Bcl-2, AKT and PARP.

PEG-SeNPs can regulate the expression of cytokine

While ROS production is an important defensive mechanism against flu viral infection, the overproduction of ROS stimulates pro-inflammatory mediators, thereby inducing cytokine storm, promoting viral replication, and subsequently resulting in body damage25,43. Xu et al. reported that cell apoptosis and inflammatory reactions occurred after EV71 virus infection44. In this study, the secretion of cytokines in the cell supernatant was detected by flow cytometry to analyze the effect of PEG-SeNPs on the inflammation after viral infection. Several cytokines, including Interleukin-1β (IL-1β), Interleukin-5 (IL-5), Interleukin-6 (IL-6) and Tumor Necrosis Factor-Alpha (TNF-α), increased in the virus group and were alleviated after PEG-SeNPs treatment (Fig. 9). These results indicated that PEG-SeNPs could inhibit the inflammation after viral infection. The schematic diagram illustrated the anti-apoptosis mechanism of PEG-SeNPs in the H1N1 virus infection (Fig. 10).Fig. 9 The level of inflammatory factors after virus infection by flow cytometry. PEG-SeNPs suppressed the expression of inflammatory factors, including IL1β, IL-5, IL-6, and TNF-α. P < 0.05 was considered to be statistically significant. # represents comparison with the control group, while * represents comparison with the virus group.

Fig. 10 The schematic diagram of apoptosis signaling pathways participated in the inhibition of H1N1 by PEG-SeNPs. PEG-SeNPs inhibited H1N1-induced apoptosis and secretion of pro-inflammatory cytokines.

Discussion

As the widespread occurrence, significant harm, and the emergence of drug resistance are pressing concerns, there is an urgent need to develop new and effective anti-influenza drugs. Selenium, a vital trace element in the human body, has a long history of reducing the frequency and severity of viral infections45. Our research group conducted a screening of various selenium-containing compounds and found that PEG-SeNPs demonstrate notable effectiveness against influenza. In the current study, the anti‐influenza effect and underlying mechanism of PEG-SeNPs were explored. To evaluate therapeutic potency, the anti‐influenza effect was demonstrated by CCK-8 and PCR assay. The CCK-8 experiments indicate that PEG-SeNPs has minimal toxicity on MDCK cells but exhibits significant antiviral activity. Numerous studies proved that the PEG and SeNPs are safe in vivo and vitro31,35,40. Both our CCK-8 experiments result on MDCK cells line and the cytotoxicity result on normal kidney HepG2 cells in the previous study indicated the safety of PEG-SeNPs31. Furthermore, the inhibitory impact of PEG-SeNPs on viral amplification was directly evidenced through a PCR experiment targeting the Nucleoprotein (NP) gene of the H1N1 virus. Moreover, derived from the inhibitory effect of PEG-SeNPs on the H1N1 virus, the anti-influenza mechanism of PEG-SeNPs was further elucidated. PEG-SeNPs was newly recognized as a suppressor of apoptosis and inflammation related to oxidative damage caused by H1N1 virus.

Apoptosis is one of the major ways of programmed cell death (PCD) after virus infection. Many studies have confirmed the close relationship between viral infection and apoptosis46,47. Some viruses exploit the induction of apoptosis as a means to release and disseminate progeny viruses48. Influenza A viruses affects various cellular processes, including cell proliferation, protein synthesis and apoptosis49. Our date showed that PEG-SeNPs inhibits mitochondrial apoptosis pathway by JC-1 assay. Moreover, PEG-SeNPs inhibited phosphatidylserine eversion in H1N1 infected MDCK cells was evidenced by Annexin V-PI assay. JC-1 is a fluorescent dye widely utilized for assessing mitochondrial membrane potential (ΔΨm). A reduction in mitochondrial membrane potential is a key event in the early stages of apoptosis. Annexin V is a calcium-dependent phospholipid-binding protein that can specifically bind to phosphatidylserine (PS) exposed on the outer side of the cell membrane. When used in conjunction with propidium iodide (PI), it enables the differentiation between early apoptotic, late apoptotic, and dead cells. In our manuscript, compared to the control group, the mitochondrial membrane potential was reduced significantly to 35.5%, and 13.1% for the H1N1, and PEG-SeNPs + H1N1 group, respectively (Fig. 3A, B). In Fig. 4A and B, the early apoptosis rate is 4.47%, 24.59%, 8.11% and 13.51% for the Control, H1N1, and PEG-SeNPs + H1N1 group, respectively. The results from the JC-1 and Annexin V-PI assays in our manuscript are generally consistent in detecting early apoptosis. The discrepancies observed may be attributed to the different detection mechanisms of these methodologies. In addition, it was also proved that PEG-SeNPs could rescue MDCK cells apoptosis induced by the H1N1 virus through cell cycle analysis. DNA fragmentation and nuclear condensation were observed in MDCK cells after H1N1 infection by TUNEL and DAPI experiments. TUNEL and DAPI staining assays further evidenced the cell apoptosis mediated by H1N1 were inhibited by PEG-SeNPs. In general, PEG-SeNPs significantly reduced both the early and late apoptosis rates caused by H1N1 virus.

Furthermore, in our study, the mechanism of PEG-SeNPs inhibiting virus-induced cell apoptosis during infection is conducted to explore. In our study, PEG-SeNPs effectively inhibited the production of reactive oxygen species in H1N1-infected MDCK cells. ATM and ATR are central proteins in the DNA damage response pathway. The Ser15 residue of the p53 protein can be activated by both ATM and ATR, both in vivo and in vitro50. Bcl-2 is a protein connected to the outer membrane of mitochondria, which inhibits cell apoptosis. Under the stimulus of apoptosis, the Bax/Bcl-2 heterodimer reduces Mitochondrial Membrane Potential (MMP), increases membrane permeability, and releases cytochrome c, thereby activating the caspase enzyme family. P53 can downregulate the expression of Bcl-2 and jointly promote cell apoptosis51. In the present study, the expression levels of apoptosis signaling pathway-related proteins were detected. Poly ADP-ribose polymerase (PARP) is a DNA repair enzyme that plays a crucial role in DNA damage repair and apoptosis52. When cells experience stress-induced DNA damage, PARP becomes activated, either to engage in DNA repair or initiate DNA degradation. In this research, MDCK cells infected with the influenza virus exhibited elevated levels of PARP, which contributed to the promotion of DNA damage. However, treatment with SeD-3 effectively suppressed influenza virus-induced DNA damage and subsequent apoptosis. In our study, H1N1-infected cells exhibited a marked downregulation in the expression of apoptosis-related proteins such as ATM/ATR, AKT and PARP, along with a notable upregulation in the expression of P53 when compared to the control group. Several studies have also demonstrated that IVA infection leads to production of ROS, which promote apoptosis, lung injury, and inflammation53. Consistent with previous findings46, our study demonstrated H1N1 virus infection triggers the production of reactive oxygen species (ROS). However, PEG-SeNPs effectively inhibited ROS production following H1N1 infection. Collectively, the results of our study demonstrated that PEG-SeNPs regulation on virus-induced cell apoptosis via Reactive Oxygen Species Mediated AKT, ATM/ATR, and P53 signaling pathways.

Besides, ROS play a vital role in regulation of cytokines. ROS overproduction stimulates pro-inflammatory mediators, thereby inducing cytokine storm, promoting viral replication, and subsequently resulting in body damage25. IL-5 is a powerful pro-inflammatory cytokine. The localized activation of IL-1β stands as a pivotal step in mediating the pro-inflammatory response, leading to the subsequent activation of secondary inflammatory mediators, including IL-654. Similar to IL-1β, TNF-α is a pleiotropic pro-inflammatory cytokine that belongs to the TNF ligand superfamily. TNF-α governs a wide array of functions, encompassing the regulation of various developmental and immune processes, including inflammation, differentiation, lipid metabolism, and apoptosis54,55. It is also linked to several diseases. In the present study, several cytokines, including IL-1β, IL-5, IL-6 and TNF-α, were increased in the virus group and decreased after PEG-SeNPs treatment. These findings suggested that PEG-SeNPs alleviated inflammatory damage.

Materials and methods

Materials

Chloromethyl ketone (TPCK) (C0203), CCK-8 kit (Cell counting kit-8) (C0037), Fetal bovine serum (FBS) (C0234), Penicillin–Streptomycin Solution (100X) (C0222), Dulbecco’s modified eagle medium (DMEM) (C11995500BT), phosphate buffered saline (PBS) (ST478),propidium iodide (PI) (ST512), Enhanced mitochondrial membrane potential assay kit with JC-1(C2003S), Tunel-DAPI (C1098), Annexin V-FITC apoptosis detection kit(C1062M), Neuraminidase assay kit(P0306), BCA Protein assay kit(P0012S) and ECL kit (P0018S) were acquired from Beyotime (Jiangsu, China). (RT-PCR) kit was purchased from Takara (Kyoto, Japan). Anti-ATM (2873S), anti-p-ATM (5883S), anti-ATR (13934S), anti-p-ATR (30632S), anti-AKT(9272S), anti-p53(9282S), anti-PARP(9542S), anti-C-PARP(9544S), anti-Bcl-2(4223S), Caspase-3(9662S) and anti-β-actin(4970S) were supplied from Cell Signaling technology (Danvers, MA, USA). Anti-p-Bcl-2(AF3138) was supplied from Affinity Biosciences. Aimplex cytokine detection kit was provided by Quantobio (914002, Beijing, China). PEG-SeNPs was kindly providing by Tianfeng Chen research group, College of Chemistry and Materials, Jinan University China. The specific physico-chemical properties of PEG-SeNPs are described in their previous report31. As reported in their previous work, the PEG-SeNPs has monodisperse spherical structures with an average core diameter of about 5 nm, and a hydrodynamic diameter of 28.7 ± 4.2 nm due to the PEG coating. PEG coating on SeNPs leads to an increase in particle size and a slight decrease in the magnitude of the negative zeta potential compared to uncoated SeNPs.

Cell and virus culture

MDCK cells were purchased from American Type Culture Collection (CCL-34TM). Cells were cultured with DMEM supplemented with 10% FBS and 1% Penicillin/Streptomycin in a humidified atmosphere containing 5% CO2/ 95% air at 37 °C.

The H1N1 virus was obtained from the Guangzhou Women and Children's Medical Center of Guangzhou Medical University. The H1N1 virus titer used in the whole experiment was 0.01 MOI. The cell infection procedure was the following: MDCK cells were infected with H1N1 at MOI = 0.01 for 2 h, and then washed with PBS three times to remove excess H1N1 virus. Finally, cells were cultured in a medium containing 2% serum and 2 μg/ml TPCK.

To assess the antiviral activity of PEG-SeNPs, cells were subjected to H1N1 virus infection and treated with different concentrations of SeD‐3 over a 48-h period. Following the collection of culture supernatant, the H1N1 virus titer was determined through the measurement of TCID50.

TCID50 assay

The MDCK cells were seeded into a 96-well flat- bottom plate at a density of 1 × 105 cells/well. Then the virus solution is diluted tenfold, ranging from 10−1 to 10−10. The series of diluted virus solutions were sequentially inoculated into the 96-well plate with 100 μL in each well for 2 h. Eight replicate wells were prepared for each dilution. Finally, the virus solutions were removed, and the cells were cultured in the medium for daily monitoring under a microscope (Leica Microsystems, Wetzlar, Germany, DMi8) to observe cytopathic effect (CPE) appearance. The Reed-Muench method was used for calculating TCID50.

Cell survival rate assays

The CCK-8 assays were performed to detect cell proliferation and the antiviral activity of PEG-SeNPs as previously reported. MDCK cells were seeded in a 96‐well plate (1 × 105 cells/well) for 24 h and then treated with the H1N1 virus for 2 h. Subsequently, cells were incubated with 100 μl of PEG-SeNPs of different concentrations (4–64 μM) for 48 h. Finally, 10 μl of the CCK-8 kit was added to each well and incubated for an additional 1 h at 37 °C. The absorbance was measured at 570 nm using a multimode microplate reader (Thermo Scientific, Vantaa, Finland, Varioskan LUX)56.

Virus proliferation after PEG-SeNPs treatment

The mRNA level of H1N1 was detected by fluorescence quantitative RT-PCR as previously reported46. RNA extraction followed the instructions of the RNA extraction kit (Qiagen). The primers designed for the NP gene included a forward primer with the sequence 5′‐AGGATGTGCTCTGATGC‐3′ and a reverse primer with the sequence 5′‐TCTCACCCCTCCAGAAGTTC‐3′. For the GAPDH gene, the forward primer sequence was 5′‐CGCCAAGAAGGTGATCATTTC‐3′, and the reverse primer sequence was 5′‐CAGGAGGCGTTCGAGATGAC‐3′. Relative gene expression levels were calculated using the 2−△△Ct method with β-actin as control.

Production of ROS

The ROS in cells were detected based on the principle that the non-fluorescent DCFH could be oxidized into a green fluorescent DCF by cellular ROS as previously described with modifications57. As mentioned above, the MDCK cells were incubated with the virus for 2 h, washed 3 times with PBS, and then added PEG-SeNPs. DCFH-DA was diluted with serum-free culture medium to a final concentration of 10 μmol/L. The cell culture medium in the 6-well plate was removed and incubated with 1 mL diluted DCFH-DA for 20 min at 37 °C. Finally, the cells were observed by a fluorescence microscope (Leica Microsystems, Wetzlar, Germany, DMi8). Additionally, the fluorescence intensity was quantified by Multimode microplate reader (Thermo Scientific, Vantaa, Finland, Varioskan LUX) with an excitation wavelength of 488 nm and an emission wavelength of 525 nm.

JC-1 experiment

The transition of JC-1 from red fluorescence to green was used as a marker of early cell apoptosis. Briefly, cells were well mixed with 1 mL JC-1 working solution and incubated at 37 °C for 20 min. During the incubation period, prepare 2 ml of JC-1 staining buffer (1X) by diluting JC-1 staining buffer (5X) with distilled 8 ml of distilled water. Place the prepared JC-1 staining buffer (1X) on ice. After the 37 °C incubation, aspirate the supernatant, and wash the cells twice with JC-1 staining buffer (1X). Subsequently, the cells were observed under a fluorescence microscope with an excitation wavelength of 525 nm and an emission wavelength of 590 nm.

Additionally, the cells from different treatment group were digested, collected, and stained with 0.5 ml of JC-1 working solution at 37 °C for 20 min. The supernatant was then discarded after centrifuging at 600 g 4 °C for 3–4 min. After washing the cells twice with JC-1 staining buffer (1X), the cells were then resuspended with JC-1 staining buffer and detected by a flow cytometer.

Annexin V-FITC experiment

The Annexin V-FITC experiment was used to detect early and late apoptosis. H1N1 infected MDCK cells were treated with 2 ml of 16 nm PEG-SeNPs. The cells were then digested, collected, and stained with 195 μl of Annexin V-FITC binding solution, 5 μl of Annexin V-FITC and 10 μl of propidium iodide staining solution, respectively, at room temperature for 15 min in the dark. During the incubation process, cells were re-suspended 2–3 times to improve staining efficiency. The fluorescence was detected by flow cytometry after staining. In addition, for fluorescence microscope observation, the cells were centrifuged at 1000 g for 5 min, collected, gently resuspended in 100 μl of Annexin V-FITC binding solution, and smeared onto a slide.

Cell cycle experiment

The cell cycle distribution was analyzed by flow cytometry as previously described42. H1N1 infected MDCK cells were treated with 2 ml of 16 nM PEG-SeNPs. After that, the cells were digested, collected, and washed once with PBS. They were then fixed with 70% pre-cooled ethanol at − 20 °C overnight. Then propidium iodide staining solution was prepared by combining 500 μl of staining buffer, 25 μl of propidium iodide (20 X), and 10 μl of RNase A per sample. Consequently, the fixed cells were washed with 1 ml PBS once and stained with 535 μl propidium iodide staining solution at 4 °C for 1 h in the dark. The fluorescence was detected by flow cytometry, and the cell cycle distribution, apoptotic cells with hypodiploid DNA content were analyzed by the Muliticycle software.

TUNEL experiment and DAPI staining

The DNA fragmentation of cells was evaluated by the TUNEL-DAPI experiment. Following the instructions of a TUNEL assay kit, cells in the 6-well plate were fixed with 4% paraformaldehyde for 30 min, added PBS containing 0.3% Triton X-100, and finally stained with 100 μl of TUNEL detection solution for 1 h. The TUNEL detection solution was freshly prepared with 10 μl of TdT enzyme, 90 μl of Fluorescein-dUTP Labeling Solution per sample. After that, cells were added with 1ug/ml DAPI staining solution for 15 min, washed with PBS to remove the excess dye, and observed under a fluorescence microscope.

Western blot

The expression of proteins were analyzed by western blot as previously reported58. The date of bands was showed in Supplementary material. Briefly, the cells were washed two times with PBS and then lysed on ice with RIPA lysis buffer containing 1% protease inhibitor. The protein concentrations were quantified using a BCA assay kit. Next, equal amounts of protein samples were separated by a 12% SDS-PAGE gel and then transferred to a polyvinylidene fluoride membrane. The membrane was blocked with 5% milk- TBST solution for 1 h. After incubation with the primary and the secondary antibody, the bands were identified using chemiluminescence (ECL) kits and detected by Gel imaging system (Sage Creation, BeiJing, China, Mini Chemi610). The gray value of each strip was evaluated using Image J software. Subsequently, the gray value of actin was considered as 1, and the gray value of other strips was compared to it, resulting in a ratio. Finally, the control group was set as 1, and each group was compared to the control group.

Cytokine detection

The culture supernatant of MDCK cells was collected and the level of cytokine were detected as previously reported59. Each well was mixed with a 20 µl of capture microsphere mixture (vortex for 45 s before use), and then with 20 µl of sample diluent and 20 µl cell supernatant. After shaking and mixing, each well was then mixed with 20 μl of detection antibody mixture and incubated for 2 h in a shaker at room temperature the in dark. Subsequently, 20 μl of SA-PE was added to each well, followed by incubation at room temperature in the dark with shaking for 30 min. Afterward, the wells were washed twice with 200 μl of buffer. Finally, the supernatant was aspirated and 200 μl of buffer was added for resuspension. The cytokines were detected using a flow cytometer (BD Bioscience, CA, USA, BD FACSCANCO II). Data acquisition and cytokine analysis were used by BD FACSDiva and FCAP Array 3.0 analysis software, respectively (Supplementary material).

Statistical analysis

All data are expressed as mean ± standard deviation (SD) and analyzed by SPSS13.0 software. The difference among three groups or more was compared by analysis of variance, two-sided test. A P-value < 0.05 was considered to be statistically significant. All experiments were repeated at least three times.

Conclusions

In summary, PEG-SeNPs shows a promising antiviral prospect. Furthermore, the underlying molecular mechanisms indicated that PEG-SeNPs effectively suppress H1N1 influenza virus-induced apoptosis through reactive oxygen species mediated AKT, ATM/ATR, and P53 signaling pathways. Additionally, PEG-SeNPs demonstrate the ability to alleviate inflammatory damage caused by the influenza virus. Cumulatively, the present study provides the possibility of using a nanosystem to inhibit H1N1 influenza virus-induced apoptosis and inflammation, thereby offering a novel strategy for potential anti-H1N1 influenza therapy.

Supplementary Information

Supplementary Information.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-71486-0.

Acknowledgements

Thanks for kindly providing PEG-SeNPs by Tianfeng Chen research group, College of Chemistry and Materials, Jinan University China.

Author contributions

M.G. designed the study, analyzed the experimental data and drafted the manuscript. Y.-D.Y., J.-P.C., H.-T.X., W.W. and J.-Y.S. carried out the experiments. C.-B.W., C.-Y.W. analyzed the data. B.Z. and Y.-H.L. refined the manuscript and coordinated the study. All authors read and approved the final manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Guangzhou Medical University Students’ Scientific Research In-novation Ability Improvement Project (02-408-2203-2080, 02-408-2304-19080XM and 02-408-240603131099), Guangdong Natural Science Foundation (2020A1515110648) and the tech-nology planning projects of Guangzhou (202201020628).

Data availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Kittikraisak W Wongrapee T Punjasamanvong S Piyaraj P Vachiraphan A Yoocharoen P Klungthong C Jones AR Tanathitikorn C Mott JA Influenza-Like symptom incidence, illness-associated expenses, and economic impact among healthcare personnel in Thailand: A prospective observational cohort study (2020–2021) Anna. Work Expo. Health 2023 67 330 344 10.1093/annweh/wxac089
Kittikraisak, W. et al. Influenza-Like symptom incidence, illness-associated expenses, and economic impact among healthcare personnel in Thailand: A prospective observational cohort study (2020–2021). Anna. Work Expo. Health 67, 330–344 (2023).10.1093/annweh/wxac089
2. Senevirathne A Jayathilaka E Haluwana DK Chathuranga K Senevirathne M Jeong JS Kim TW Lee JS De Zoysa M The aqueous leaf extract of the medicinal herb costus speciosus suppresses influenza A H1N1 viral activity under in vitro and in vivo conditions Viruses 2023 15 1375 10.3390/v15061375 37376674
Senevirathne, A. et al. The aqueous leaf extract of the medicinal herb costus speciosus suppresses influenza A H1N1 viral activity under in vitro and in vivo conditions. Viruses 15, 1375 (2023).37376674 10.3390/v15061375
3. Gierse LC Meene A Schultz D Schwaiger T Schröder C Mücke P Zühlke D Hinzke T Wang H Methling K Kreikemeyer B Bernhardt J Becher D Mettenleiter TC Lalk M Urich T Riedel K Influenza A H1N1 induced disturbance of the respiratory and fecal microbiome of German landrace pigs—a multi-omics characterization Microbiol. Spectr. 2021 9 e0018221 10.1128/Spectrum.00182-21 34612695
Gierse, L. C. et al. Influenza A H1N1 induced disturbance of the respiratory and fecal microbiome of German landrace pigs—a multi-omics characterization. Microbiol. Spectr. 9, e0018221 (2021).34612695 10.1128/Spectrum.00182-21
4. Shokry S Hegazy A Phytoestrogen β-sitosterol exhibits potent in vitro antiviral activity against influenza A viruses Vaccines 2023 11 228 10.3390/vaccines11020228 36851106
Shokry, S. & Hegazy, A. Phytoestrogen β-sitosterol exhibits potent in vitro antiviral activity against influenza A viruses. Vaccines 11, 228 (2023).36851106 10.3390/vaccines11020228
5. Zhang B Liu M Huang J Zeng Q Zhu Q Xu S Chen H H1N1 influenza A virus protein NS2 inhibits innate immune response by targeting IRF7 Viruses 2022 14 2411 10.3390/v14112411 36366509
Zhang, B. et al. H1N1 influenza A virus protein NS2 inhibits innate immune response by targeting IRF7. Viruses 14, 2411 (2022).36366509 10.3390/v14112411
6. Svyatchenko VA Ternovoi VA Lutkovskiy RY Protopopova EV Gudymo AS Danilchenko NV Susloparov IM Kolosova NP Ryzhikov AB Taranov OS Omigov VV Gavrilova EV Agafonov AP Maksyutov RA Loktev VB Human adenovirus and influenza A virus exacerbate SARS-CoV-2 infection in animal models Microorganisms 2023 11 180 10.3390/microorganisms11010180 36677472
Svyatchenko, V. A. et al. Human adenovirus and influenza A virus exacerbate SARS-CoV-2 infection in animal models. Microorganisms 11, 180 (2023).36677472 10.3390/microorganisms11010180
7. Sun Z Ke L Zhao Q Qu J Hu Y Gao H Peng Z The use of bioinformatics methods to identify the effects of SARS-CoV-2 and influenza viruses on the regulation of gene expression in patients Front. Immunol. 2023 14 1098688 10.3389/fimmu.2023.1098688 36911695
Sun, Z. et al. The use of bioinformatics methods to identify the effects of SARS-CoV-2 and influenza viruses on the regulation of gene expression in patients. Front. Immunol. 14, 1098688 (2023).36911695 10.3389/fimmu.2023.1098688
8. Praena B Wan XF Influenza virus infections in polarized cells Viruses 2022 14 1307 10.3390/v14061307 35746778
Praena, B. & Wan, X. F. Influenza virus infections in polarized cells. Viruses 14, 1307 (2022).35746778 10.3390/v14061307
9. Kumari R Sharma SD Kumar A Ende Z Mishina M Wang Y Falls Z Samudrala R Pohl J Knight PR Sambhara S Antiviral approaches against influenza virus Clin. Microbial. Rev. 2023 36 e0004022 10.1128/cmr.00040-22
Kumari, R. et al. Antiviral approaches against influenza virus. Clin. Microbial. Rev. 36, e0004022 (2023).10.1128/cmr.00040-22
10. Chan KKP Hui DSC Antiviral therapies for influenza Curr. Opin. Infect. Dis. 2023 36 124 131 10.1097/QCO.0000000000000910 36752709
Chan, K. K. P. & Hui, D. S. C. Antiviral therapies for influenza. Curr. Opin. Infect. Dis. 36, 124–131 (2023).36752709 10.1097/QCO.0000000000000910
11. Beigel JH Hayden FG Influenza therapeutics in clinical practice-challenges and recent advances Cold Spring Harbor Perspect. Med. 2021 11 a038463 10.1101/cshperspect.a038463
Beigel, J. H. & Hayden, F. G. Influenza therapeutics in clinical practice-challenges and recent advances. Cold Spring Harbor Perspect. Med. 11, a038463 (2021).10.1101/cshperspect.a038463
12. Hossain MG Akter S Dhole P Saha S Kazi T Majbauddin A Islam MS Analysis of the genetic diversity associated with the drug resistance and pathogenicity of influenza a virus isolated in Bangladesh from 2002 to 2019 Front. Microbial. 2021 12 735305 10.3389/fmicb.2021.735305
Hossain, M. G. et al. Analysis of the genetic diversity associated with the drug resistance and pathogenicity of influenza a virus isolated in Bangladesh from 2002 to 2019. Front. Microbial. 12, 735305 (2021).10.3389/fmicb.2021.735305
13. Abbadi N Mousa JJ Broadly protective neuraminidase-based influenza vaccines and monoclonal antibodies: Target epitopes and mechanisms of action Viruses 2023 15 200 10.3390/v15010200 36680239
Abbadi, N. & Mousa, J. J. Broadly protective neuraminidase-based influenza vaccines and monoclonal antibodies: Target epitopes and mechanisms of action. Viruses 15, 200 (2023).36680239 10.3390/v15010200
14. Tanner AR Dorey RB Brendish NJ Clark TW Influenza vaccination: protecting the most vulnerable Eur. Respir. Rev. 2021 30 200258 10.1183/16000617.0258-2020 33650528
Tanner, A. R., Dorey, R. B., Brendish, N. J. & Clark, T. W. Influenza vaccination: protecting the most vulnerable. Eur. Respir. Rev. 30, 200258 (2021).33650528 10.1183/16000617.0258-2020
15. Ferro C Florindo HF Santos HA Selenium nanoparticles for biomedical applications: From development and characterization to therapeutics Adv. Healthc. Mater. 2021 10 16 2100598 10.1002/adhm.202100598
Ferro, C., Florindo, H. F. & Santos, H. A. Selenium nanoparticles for biomedical applications: From development and characterization to therapeutics. Adv. Healthc. Mater. 10(16), 2100598 (2021).10.1002/adhm.202100598
16. Guo M Tang Y Hua L Li W Gong G Zhu Y Zhu B Xia Y Functionalized selenium nanoparticles enhance anticancer efficacy of doxorubicin for hepatocellular carcinoma therapy Adv. Mater. Sci. Eng. 2022 2022 3986373 10.1155/2022/3986373
Guo, M. et al. Functionalized selenium nanoparticles enhance anticancer efficacy of doxorubicin for hepatocellular carcinoma therapy. Adv. Mater. Sci. Eng. 2022, 3986373 (2022).10.1155/2022/3986373
17. Pecoraro BM Leal DF Frias-De-Diego A Browning M Odle J Crisci E The health benefits of selenium in food animals: A review J. Anim. Sci. Biotechnol. 2022 13 58 10.1186/s40104-022-00706-2 35550013
Pecoraro, B. M. et al. The health benefits of selenium in food animals: A review. J. Anim. Sci. Biotechnol. 13, 58 (2022).35550013 10.1186/s40104-022-00706-2
18. Genchi G Lauria G Catalano A Sinicropi MS Carocci A Biological activity of selenium and its impact on human health Int. J. Mol. Sci. 2023 24 2633 10.3390/ijms24032633 36768955
Genchi, G., Lauria, G., Catalano, A., Sinicropi, M. S. & Carocci, A. Biological activity of selenium and its impact on human health. Int. J. Mol. Sci. 24, 2633 (2023).36768955 10.3390/ijms24032633
19. de Souza DF da Silva MCS de Souza TC Rocha GC Kasuya MCM Eller MR Effect of selenium-enriched substrate on the chemical composition, mineral bioavailability, and yield of edible mushrooms Biol. Trace Elem. Res. 2023 201 3077 3087 10.1007/s12011-022-03396-z 35997887
de Souza, D. F. et al. Effect of selenium-enriched substrate on the chemical composition, mineral bioavailability, and yield of edible mushrooms. Biol. Trace Elem. Res. 201, 3077–3087 (2023).35997887 10.1007/s12011-022-03396-z
20. Lin C Zhang LJ Li B Zhang F Shen QR Kong GQ Wang XF Cui SH Dai R Cao WQ Zhang P Selenium-containing protein from selenium-enriched spirulina platensis attenuates high glucose-induced calcification of MOVAS cells by inhibiting ROS-mediated DNA damage and regulating MAPK and PI3K/AKT pathways Front. Physiol. 2020 11 791 10.3389/fphys.2020.00791 32733280
Lin, C. et al. Selenium-containing protein from selenium-enriched spirulina platensis attenuates high glucose-induced calcification of MOVAS cells by inhibiting ROS-mediated DNA damage and regulating MAPK and PI3K/AKT pathways. Front. Physiol. 11, 791 (2020).32733280 10.3389/fphys.2020.00791
21. Jankowski CSR Rabinowitz JD Selenium modulates cancer cell response to pharmacologic ascorbate Cancer Res. 2022 82 3486 3498 10.1158/0008-5472.CAN-22-0408 35916672
Jankowski, C. S. R. & Rabinowitz, J. D. Selenium modulates cancer cell response to pharmacologic ascorbate. Cancer Res. 82, 3486–3498 (2022).35916672 10.1158/0008-5472.CAN-22-0408
22. de Toledo J Fraga-Silva TFC Borim PA de Oliveira LRC Oliveira EDS Perico LL Hiruma-Lima CA de Souza AAL de Oliveira CAF Padilha PM Pinatto-Botelho MF Dos Santos AA Sartori A Zorzella-Pezavento SFG Organic selenium reaches the central nervous system and downmodulates local inflammation: A complementary therapy for multiple sclerosis? Front. Immunol. 2020 11 571844 10.3389/fimmu.2020.571844 33193354
de Toledo, J. et al. Organic selenium reaches the central nervous system and downmodulates local inflammation: A complementary therapy for multiple sclerosis?. Front. Immunol. 11, 571844 (2020).33193354 10.3389/fimmu.2020.571844
23. Schomburg L Selenium deficiency due to diet, pregnancy, severe illness, or COVID-19-a preventable trigger for autoimmune disease Int. J. Mol. Sci. 2021 22 8532 10.3390/ijms22168532 34445238
Schomburg, L. Selenium deficiency due to diet, pregnancy, severe illness, or COVID-19-a preventable trigger for autoimmune disease. Int. J. Mol. Sci. 22, 8532 (2021).34445238 10.3390/ijms22168532
24. Steinbrenner H Al-Quraishy S Dkhil MA Wunderlich F Sies H Dietary selenium in adjuvant therapy of viral and bacterial infections Adv. Nutr. 2015 6 73 82 10.3945/an.114.007575 25593145
Steinbrenner, H., Al-Quraishy, S., Dkhil, M. A., Wunderlich, F. & Sies, H. Dietary selenium in adjuvant therapy of viral and bacterial infections. Adv. Nutr. 6, 73–82 (2015).25593145 10.3945/an.114.007575
25. Guillin OM Vindry C Ohlmann T Chavatte L Selenium, selenoproteins and viral infection Nutrients 2019 11 2101 10.3390/nu11092101 31487871
Guillin, O. M., Vindry, C., Ohlmann, T. & Chavatte, L. Selenium, selenoproteins and viral infection. Nutrients 11, 2101 (2019).31487871 10.3390/nu11092101
26. Liu Q Zhao X Ma J Mu Y Wang Y Yang S Wu Y Wu F Zhou Y Selenium (Se) plays a key role in the biological effects of some viruses: Implications for COVID-19 Environ. Res. 2021 196 110984 10.1016/j.envres.2021.110984 33691157
Liu, Q. et al. Selenium (Se) plays a key role in the biological effects of some viruses: Implications for COVID-19. Environ. Res. 196, 110984 (2021).33691157 10.1016/j.envres.2021.110984
27. Das C Paul SS Saha A Singh T Saha A Im J Biswas G Silver-based nanomaterials as therapeutic agents against coronaviruses: A review Int. J. Nanomed. 2020 15 9301 9315 10.2147/IJN.S280976
Das, C. et al. Silver-based nanomaterials as therapeutic agents against coronaviruses: A review. Int. J. Nanomed. 15, 9301–9315 (2020).10.2147/IJN.S280976
28. Piri A Kim HR Park DH Hwang J Increased survivability of coronavirus and H1N1 influenza virus under electrostatic aerosol-to-hydrosol sampling J. Hazard. Mater. 2021 413 125417 10.1016/j.jhazmat.2021.125417 33930959
Piri, A., Kim, H. R., Park, D. H. & Hwang, J. Increased survivability of coronavirus and H1N1 influenza virus under electrostatic aerosol-to-hydrosol sampling. J. Hazard. Mater. 413, 125417 (2021).33930959 10.1016/j.jhazmat.2021.125417
29. Dawood MAO Basuini MFE Yilmaz S Abdel-Latif HMR Kari ZA Abdul Razab MKA Ahmed HA Alagawany M Gewaily MS Selenium nanoparticles as a natural antioxidant and metabolic regulator in aquaculture: A review Antioxidants 2021 10 1364 10.3390/antiox10091364 34572996
Dawood, M. A. O. et al. Selenium nanoparticles as a natural antioxidant and metabolic regulator in aquaculture: A review. Antioxidants 10, 1364 (2021).34572996 10.3390/antiox10091364
30. Ha HY Alfulaij N Berry MJ Seale LA From selenium absorption to selenoprotein degradation Biol. Trace Elem. Res. 2019 192 26 37 10.1007/s12011-019-01771-x 31222623
Ha, H. Y., Alfulaij, N., Berry, M. J. & Seale, L. A. From selenium absorption to selenoprotein degradation. Biol. Trace Elem. Res. 192, 26–37 (2019).31222623 10.1007/s12011-019-01771-x
31. Zheng S Li X Zhang Y Xie Q Wong YS Zheng W Chen T PEG-nanolized ultrasmall selenium nanoparticles overcome drug resistance in hepatocellular carcinoma HepG2 cells through induction of mitochondria dysfunction Int. J. Nanomed. 2012 7 3939 3949
Zheng, S. et al. PEG-nanolized ultrasmall selenium nanoparticles overcome drug resistance in hepatocellular carcinoma HepG2 cells through induction of mitochondria dysfunction. Int. J. Nanomed. 7, 3939–3949 (2012).
32. Su J Lai J Li J Li C Liu X Wang C Zhu B Li Y Selenium nanoparticles control H1N1 virus by inhibiting inflammatory response and cell apoptosis Molecules 2023 28 5920 10.3390/molecules28155920 37570890
Su, J. et al. Selenium nanoparticles control H1N1 virus by inhibiting inflammatory response and cell apoptosis. Molecules 28, 5920 (2023).37570890 10.3390/molecules28155920
33. Shao C Yu Z Luo T Zhou B Song Q Li Z Yu X Jiang S Zhou Y Dong W Zhou X Wang X Song H Chitosan-coated selenium nanoparticles attenuate PRRSV replication and ROS/JNK-mediated apoptosis in vitro Int. J. Nanomed. 2022 7 3043 3054 10.2147/IJN.S370585
Shao, C. et al. Chitosan-coated selenium nanoparticles attenuate PRRSV replication and ROS/JNK-mediated apoptosis in vitro. Int. J. Nanomed. 7, 3043–3054 (2022).10.2147/IJN.S370585
34. Li Y Chen D Su J Chen M Chen T Jia W Zhu B Selenium-ruthenium complex blocks H1N1 influenza virus-induced cell damage by activating GPx1/TrxR1 Theranostics 2023 13 1843 1859 10.7150/thno.83522 37064873
Li, Y. et al. Selenium-ruthenium complex blocks H1N1 influenza virus-induced cell damage by activating GPx1/TrxR1. Theranostics 13, 1843–1859 (2023).37064873 10.7150/thno.83522
35. D’Souza AA Shegokar R Polyethylene glycol (PEG): A versatile polymer for pharmaceutical applications Expert Opin. Drug Deliv. 2016 13 1257 1275 10.1080/17425247.2016.1182485 27116988
D’Souza, A. A. & Shegokar, R. Polyethylene glycol (PEG): A versatile polymer for pharmaceutical applications. Expert Opin. Drug Deliv. 13, 1257–1275 (2016).27116988 10.1080/17425247.2016.1182485
36. Lasowski F Rambarran T Rahmani V Brook MA Sheardown H PEG-containing siloxane materials by metal-free click-chemistry for ocular drug delivery applications J. Biomater. Sci. Polym. Ed. 2021 32 581 594 10.1080/09205063.2020.1851558 33187457
Lasowski, F., Rambarran, T., Rahmani, V., Brook, M. A. & Sheardown, H. PEG-containing siloxane materials by metal-free click-chemistry for ocular drug delivery applications. J. Biomater. Sci. Polym. Ed. 32, 581–594 (2021).33187457 10.1080/09205063.2020.1851558
37. Zhao W Xiong Y Zhangsun D Luo S DSPE-PEG modification of alpha-Conotoxin TxID Mar. Drugs 2019 17 342 10.3390/md17060342 31181805
Zhao, W., Xiong, Y., Zhangsun, D. & Luo, S. DSPE-PEG modification of alpha-Conotoxin TxID. Mar. Drugs 17, 342 (2019).31181805 10.3390/md17060342
38. Xu Q Hou J Rao J Li GH Liu YL Zhou J PEG modification enhances the in vivo stability of bioactive proteins immobilized on magnetic nanoparticle Biotechnol. Lett. 2020 42 1407 1418 10.1007/s10529-020-02867-4 32200524
Xu, Q. et al. PEG modification enhances the in vivo stability of bioactive proteins immobilized on magnetic nanoparticle. Biotechnol. Lett. 42, 1407–1418 (2020).32200524 10.1007/s10529-020-02867-4
39. Pasut G Veronese FM State of the art in PEGylation: The great versatility achieved after forty years of research J. Control. Release 2012 161 461 472 10.1016/j.jconrel.2011.10.037 22094104
Pasut, G. & Veronese, F. M. State of the art in PEGylation: The great versatility achieved after forty years of research. J. Control. Release 161, 461–472 (2012).22094104 10.1016/j.jconrel.2011.10.037
40. Mary TA Shanthi K Vimala K Soundarapandian K PEG functionalized selenium nanoparticles as a carrier of crocin to achieve anticancer synergism Rsc Adv. 2016 6 27 22936 22949 10.1039/C5RA25109E
Mary, T. A., Shanthi, K., Vimala, K. & Soundarapandian, K. PEG functionalized selenium nanoparticles as a carrier of crocin to achieve anticancer synergism. Rsc Adv. 6(27), 22936–22949 (2016).10.1039/C5RA25109E
41. Srinivas US Tan BWQ Vellayappan BA Jeyasekharan AD ROS and the DNA damage response in cancer Redox Biol. 2019 25 101084 10.1016/j.redox.2018.101084 30612957
Srinivas, U. S., Tan, B. W. Q., Vellayappan, B. A. & Jeyasekharan, A. D. ROS and the DNA damage response in cancer. Redox Biol. 25, 101084 (2019).30612957 10.1016/j.redox.2018.101084
42. Wang C Chen H Chen D Zhao M Lin Z Guo M Xu T Chen Y Hua L Lin T Tang Y Zhu B Li Y The inhibition of H1N1 influenza virus-induced apoptosis by surface decoration of selenium nanoparticles with β-Thujaplicin through reactive oxygen species-mediated AKT and p53 signaling pathways ACS Omega 2020 5 30633 30642 10.1021/acsomega.0c04624 33283112
Wang, C. et al. The inhibition of H1N1 influenza virus-induced apoptosis by surface decoration of selenium nanoparticles with β-Thujaplicin through reactive oxygen species-mediated AKT and p53 signaling pathways. ACS Omega 5, 30633–30642 (2020).33283112 10.1021/acsomega.0c04624
43. Choo WT Teoh ML Phang SM Convey P Yap WH Goh BH Beardall J Microalgae as potential anti-inflammatory natural product against human inflammatory skin diseases Front. Pharmacol. 2020 11 1086 10.3389/fphar.2020.01086 32848730
Choo, W. T. et al. Microalgae as potential anti-inflammatory natural product against human inflammatory skin diseases. Front. Pharmacol. 11, 1086 (2020).32848730 10.3389/fphar.2020.01086
44. Xu T Li Y Wu HL Chen H Wu H Guo M Zhao M Wang C Lin T Lin Z Chen D Xiang W Zhu B The inhibition of enterovirus 71 induced apoptosis by Durvillaea antarctica through P53 and STAT1 signaling pathway J. Med. Virol. 2021 93 3532 3538 10.1002/jmv.26693 33230830
Xu, T. et al. The inhibition of enterovirus 71 induced apoptosis by Durvillaea antarctica through P53 and STAT1 signaling pathway. J. Med. Virol. 93, 3532–3538 (2021).33230830 10.1002/jmv.26693
45. Martinez SS Huang Y Acuna L Laverde E Trujillo D Barbieri MA Tamargo J Campa A Baum MK Role of selenium in viral infections with a major focus on SARS-CoV-2 Int. J. Mol. Sci. 2021 23 280 10.3390/ijms23010280 35008706
Martinez, S. S. et al. Role of selenium in viral infections with a major focus on SARS-CoV-2. Int. J. Mol. Sci. 23, 280 (2021).35008706 10.3390/ijms23010280
46. Guo M Chen D Zhao M Xu T Zhang Y Xiao M Li Y Zhu B 5-Nitrobenzo[c][1, 2, 5]selenadiazole as therapeutic agents in the regulation of oxidative stress and inflammation induced by influenza A(H1N1)pdm09 in vitro and in vivo J. Med. Virol. 2023 95 e28920 10.1002/jmv.28920 37386905
Guo, M. et al. 5-Nitrobenzo[c][1, 2, 5]selenadiazole as therapeutic agents in the regulation of oxidative stress and inflammation induced by influenza A(H1N1)pdm09 in vitro and in vivo. J. Med. Virol. 95, e28920 (2023).37386905 10.1002/jmv.28920
47. Rex DAB Keshava Prasad TS Kandasamy RK Revisiting regulated cell death responses in viral infections Int. J. Mol. Sci. 2022 23 7023 10.3390/ijms23137023 35806033
Rex, D. A. B., Keshava Prasad, T. S. & Kandasamy, R. K. Revisiting regulated cell death responses in viral infections. Int. J. Mol. Sci. 23, 7023 (2022).35806033 10.3390/ijms23137023
48. Zhou X Jiang W Liu Z Liu S Liang X Virus infection and death receptor-mediated apoptosis Viruses 2017 9 316 10.3390/v9110316 29077026
Zhou, X., Jiang, W., Liu, Z., Liu, S. & Liang, X. Virus infection and death receptor-mediated apoptosis. Viruses 9, 316 (2017).29077026 10.3390/v9110316
49. Ampomah PB Lim LHK Influenza A virus-induced apoptosis and virus propagation Apoptosis Int. J. Program. Cell death 2020 25 1 11 10.1007/s10495-019-01575-3
Ampomah, P. B. & Lim, L. H. K. Influenza A virus-induced apoptosis and virus propagation. Apoptosis Int. J. Program. Cell death 25, 1–11 (2020).10.1007/s10495-019-01575-3
50. Xu J Xiao X Yan B Yuan Q Dong X Du Q Zhang J Shan L Green tea-derived theabrownin induces cellular senescence and apoptosis of hepatocellular carcinoma through p53 signaling activation and bypassed JNK signaling suppression Cancer Cell Int. 2022 22 39 10.1186/s12935-022-02468-3 35078476
Xu, J. et al. Green tea-derived theabrownin induces cellular senescence and apoptosis of hepatocellular carcinoma through p53 signaling activation and bypassed JNK signaling suppression. Cancer Cell Int. 22, 39 (2022).35078476 10.1186/s12935-022-02468-3
51. Wang H Guo M Wei H Chen Y Targeting p53 pathways: Mechanisms, structures, and advances in therapy Signal Transduct. Target. Ther. 2023 8 92 10.1038/s41392-023-01347-1 36859359
Wang, H., Guo, M., Wei, H. & Chen, Y. Targeting p53 pathways: Mechanisms, structures, and advances in therapy. Signal Transduct. Target. Ther. 8, 92 (2023).36859359 10.1038/s41392-023-01347-1
52. Luo H Chen L Cui Z Du J Yang H Qiu W Zhai L Liang H Tang H Poly(ADP-ribose)polymerase-1 affects hydroquinone-induced aberrant cell cycle and apoptosis through activation of p16/pRb signaling pathway in TK6 cells Ecotoxicol. Environ. Saf. 2022 232 113259 10.1016/j.ecoenv.2022.113259 35121258
Luo, H. et al. Poly(ADP-ribose)polymerase-1 affects hydroquinone-induced aberrant cell cycle and apoptosis through activation of p16/pRb signaling pathway in TK6 cells. Ecotoxicol. Environ. Saf. 232, 113259 (2022).35121258 10.1016/j.ecoenv.2022.113259
53. Chen KK Minakuchi M Wuputra K Ku CC Pan JB Kuo KK Lin YC Saito S Lin CS Yokoyama KK Redox control in the pathophysiology of influenza virus infection BMC Microbial. 2020 20 214 10.1186/s12866-020-01890-9
Chen, K. K. et al. Redox control in the pathophysiology of influenza virus infection. BMC Microbial. 20, 214 (2020).10.1186/s12866-020-01890-9
54. Kamali AN Zian Z Bautista JM Hamedifar H Hossein-Khannazer N Hosseinzadeh R Yazdani R Azizi G The potential role of pro-inflammatory and anti-inflammatory cytokines in epilepsy pathogenesis Endocr. Metab. Immune Disord. Drug Targets 2021 21 1760 1774 10.2174/1871530320999201116200940 33200702
Kamali, A. N. et al. The potential role of pro-inflammatory and anti-inflammatory cytokines in epilepsy pathogenesis. Endocr. Metab. Immune Disord. Drug Targets 21, 1760–1774 (2021).33200702 10.2174/1871530320999201116200940
55. Saha P Smith A TNF-α (tumor necrosis factor-α) Arterioscler. Thromb. Vascular Biol. 2018 38 2542 2543 10.1161/ATVBAHA.118.311660
Saha, P. & Smith, A. TNF-α (tumor necrosis factor-α). Arterioscler. Thromb. Vascular Biol. 38, 2542–2543 (2018).10.1161/ATVBAHA.118.311660
56. Guo M Zheng R Wu HL Chen D Su J Xu T Wu H Xiang W Li Y Zhu B Inhibition of enterovirus 71 infection by polysaccharides extracted from Picochlorum sp. 122 via the AKT and ATM/ATR signaling pathways Arch. Virol. 2021 166 3269 3274 10.1007/s00705-021-05229-1 34536128
Guo, M. et al. Inhibition of enterovirus 71 infection by polysaccharides extracted from Picochlorum sp. 122 via the AKT and ATM/ATR signaling pathways. Arch. Virol. 166, 3269–3274 (2021).34536128 10.1007/s00705-021-05229-1
57. Guo M Li Y Lin Z Zhao M Xiao M Wang C Xu T Xia Y Zhu B Surface decoration of selenium nanoparticles with curcumin induced HepG2 cell apoptosis through ROS mediated p53 and AKT signaling pathways RSC Adv. 2017 7 52456 52464 10.1039/C7RA08796A
Guo, M. et al. Surface decoration of selenium nanoparticles with curcumin induced HepG2 cell apoptosis through ROS mediated p53 and AKT signaling pathways. RSC Adv. 7, 52456–52464 (2017).10.1039/C7RA08796A
58. Gong G Li Y He K Yang Q Guo M Xu T Wang C Zhao M Chen Y Du M Li B Huang Y Zhu B The inhibition of H1N1 influenza induced apoptosis by sodium selenite through ROS-mediated signaling pathways RSC Adv. 2020 10 8002 8007 10.1039/C9RA09524A 35492195
Gong, G. et al. The inhibition of H1N1 influenza induced apoptosis by sodium selenite through ROS-mediated signaling pathways. RSC Adv. 10, 8002–8007 (2020).35492195 10.1039/C9RA09524A
59. Zheng R Li Y Chen D Su J Han N Chen H Ning Z Xiao M Zhao M Zhu B Changes of host immunity mediated by IFN-γ (+) CD8(+) T cells in children with adenovirus pneumonia in different severity of illness Viruses 2021 13 2384 10.3390/v13122384 34960654
Zheng, R. et al. Changes of host immunity mediated by IFN-γ (+) CD8(+) T cells in children with adenovirus pneumonia in different severity of illness. Viruses 13, 2384 (2021).34960654 10.3390/v13122384
