
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39266713
72743
10.1038/s41598-024-72743-y
Article
Recombinase-aid amplification combined with lateral flow detection assay for sex identification of the great white pelican (Pelecanus onocrotalus)
Zeng Fanwen 544678915@qq.com

1
Chen Xuanjiao 1
Zhong Wanhuan 3
Chen Tanzipeng 1
Sa Jiaqi 1
Wang Guoqian 1
Zhang Shouquan sqzhang@scau.edu.cn

2
Peng Shiming 18108438@qq.com

1
1 grid.508042.b Guangzhou Zoo & Guangzhou Wildlife Research Center, Guangzhou, 510075 China
2 grid.22935.3f 0000 0004 0530 8290 College of Animal Science of South, China Agricultural University, Guangzhou, 510642 China
3 grid.9227.e 0000000119573309 Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650201 China
12 9 2024
12 9 2024
2024
14 213327 2 2024
10 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Sex identification in avian species is essential for biodiversity conservation and ecological studies. However, the sex of nearly half of the birds could not be identified based on their external appearance. It is difficult to visually identify sex to monitor the ecology and conservation of wild populations. In this study, we designed primer pairs for large white pelican using recombinase-based isothermal amplification combined with a lateral flow dipstick (RAA-LFD) assay for chromo-helicase-DNA binding protein (CHD) genes mapped to W chromosomes and an ultra-conserved element (UCE) located on chromosome 6, respectively. Our result showed that the raaW4-RAA-LFD can detect up to 0.1 ng of genomic DNA (gDNA) templates of female pelicans in 30 min at 39 ℃ and accurately distinguish female from male without any cross reactivity. RaaUCE2-RAA-LFD can amplify both male and female pelicans with a detection limit of 25 pg. To further evaluate the assay, 15 white pelicans of unknown sex were tested using the RAA-LFD assay and conventional polymerase chain reaction (PCR). The results of the raaW4-RAA-LFD assay were consistent with those of the conventional PCR. The developed RAA-LFD assay is equipped with field-deployable instruments and offers a field platform for rapid and reliable sex identification in pelicans.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-72743-y.

Keywords

RAA-LFD assay
Great white pelican
Sex identification
Field research
Subject terms

Ecology
Molecular biology
Zoology
Guangzhou Zoo Research ProjectYL202401 issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Individual sex can provide important information in the fields of ecology and behavior1,2. The improvement in protocols for rapid and accurate sex identification of birds is of great importance in evolutionary biology, breeding, and conservation3,4. Many birds exhibit sexual size dimorphism, even at the nestling or subadult stage, enabling sex determination based on morphometry5. However, approximately 60% of bird species are monomorphic birds that are indistinguishable in their external morphology and behavior6. Therefore, accurately and quickly identifying the sex of birds is difficult. Currently, sex identification in birds is performed using morphological, surgical, cytological, or molecular methods7. Molecular sexing in birds is widely used because of its accuracy, minimal invasiveness, and convenience and was first initiated by Griffiths et al. in 1995 8,9. It is generally based on polymerase chain reaction (PCR) amplification of the duplication of the chromo-helicase-DNA-binding protein (CHD) sex-chromosome-specific gene located on the Z and W chromosomes8–10. With the development of this technology, multiple molecular methods have been applied for sex determination, including high-resolution melting analysis4, real-time PCR11, and loop-mediated isothermal amplification (LAMP)12. However, these methods either require expensive equipment or additional primers13,14.

Recombinase-based isothermal amplification assay, recombinase polymerase amplification (RPA), or recombinase-aided amplification (RAA) is a novel technique for nucleic acid isothermal amplification using a bacterial recombinase enzyme and isothermal polymerase in recent years15–17. The RPA/RAA technique could achieve exponential amplification of target DNA at 37–42 °C within 20–30 min. The RPA/RAA technique mainly utilized three crucial enzymes: a recombinase (anchor on a DNA single strand and search for homologous sequences), a strand displacing DNA polymerase (for amplification and extension), and a single-stranded DNA binding protein gp32 (stabilize the displaced strand DNA). The difference between RPA and RAA is the source of recombinant enzymes. The RPA recombinant enzyme is derived from bacteriophage T4, while the RAA recombinant enzyme is derived from bacteria or fungi. Furthermore, the amplification product of RPA/RAA can be monitored by gel electrophoresis, a fluorescent probe, gel electrophoresis, and lateral flow chromatography. Compared to conventional PCR, RPA/RAA offers a simpler and faster environment for gene amplification. Currently, it is widely used for pathogen detection18–20. Lateral flow chromatography strips (LFD) are suitable for visualizing RPA/RAA product21. Among the various visualization methods for RAA/RPA amplicons, the LFD assay is better suited for field applications because it allows rapid result visualization within 2–5 min without complex procedures22–24. Therefore, the RPA/RAA-LFD method could be applied to point-of-care testing (POCT) for sex identification of bird CHD genes.

The great white pelican (Pelecanus onocrotalus; order Pelecaniformes) is widely distributed throughout Eastern Europe, Asia, and Africa25. However, it appears that the population has severely declined and is hardly found in the wild as a result of urbanization, industrialization, and reduction in bird habitats. In 2021, the great white pelican was listed as a national priority wild animal protected by China. A recovery plan and reintroduction program are necessary for the conservation of the great white pelican. Determining the sex ratio of the population before reintroduction is critical. However, it is difficult to identify the sex of pelicans based on their external appearance alone, which is particularly evident in the nestlings26. Therefore, the aim of this study was to establish an RAA-LFD assay for sex determination of great white pelicans based on CHD located on the Z and W chromosomes (Fig. 1). To the best of our knowledge, this is the first study of pelican sex identification using isothermal amplification. Visualization of RAA-LFD detection will be extremely useful in bird conservation and captive breeding for the quick determination of sex.

Fig. 1 The workflow of the overall process for sex of pelican rapid determination based RAA-LFD assay. Fragment of the target gene is isothermally amplified by recombinase polymerase amplification at 39°C for 30 min. After the formation of double-labeled amplicon containing biotin and carboxyfluorescein (FAM), the amplication product travel in a buffer stream containing antibody-coated gold particles and trapped at the test line by biotin streptavidin affinity, resulting in an appearance of red color indicative of a positive result. Non-captured gold particles move through the test line and are fixed to the control line by anti-mouse antibodies.

Results

Primer design and screening

In this study, each four RAA primers for the CHD-W and UCE genes were obtained (Table 1). An RAA-AGE assay was performed to identify the best primers. In Fig. S1a, the primer pairs W1, W2, and W3 were amplified in both male and female DNA. Primer pair W4 successfully amplified specific fragments of 171 bp based on CHD-W but not CHD-Z, and the amplified product was pure. Therefore, W4 was determined as the best primer pair for subsequent studies. As shown in Fig. S1b, primer pairs UCE1-4 both amplified the target region. The RAA of UCE2 produced a single, pure band. Therefore, we selected UCE2 for the RAA-LFD primer pair. Furthermore, to be visualized using the LFD system, the forward primer consisted of an antigenic label FAM group at the 5′ end, and the reverse primer was labeled at the 5′-end with biotin.

Table 1 Primers sequences used in this study.

No.	Primer	Oligonucleotide (5′–3′)	Amplicon size (bp)	Application	Source	
1	2550F	GTTACTGATTCGTCTACGAGA	960 and/or 450	Conventional PCR	Fridolfsson and Ellegren (1999)	
2718R	ATTGAAATGATCCAGTGCTTG	
2	UCE-F	AAGAAAGGGACTAAAGCG	129	Conventional PCR	In this study	
UCE-R	CTCGGAGAAGATTGGAAA	
3	W1-F

W1-R

	CTGATTCGTCTACGAGAACGTGGCAACAGA	134	RAA-AGE	In this study	
TTGGCTACTACCAGCAAAATTCTTACCTGA	
4	W2-F

W2-R

	TTCGTCTACGAGAACGTGGCAACAGAGTAC	117	RAA-AGE	In this study	
GCAAAATTCTTACCTGAAAGGGAAACTGAC	
5	W3-F

W3-R

	TAGTAGCCAAGAAGCCTTGATGTTTACCGC	121	RAA-AGE	In this study	
TTTAGCATACAATAATTGCCAGTCTTTTCC	
6	W4-F

W4-R

	AGAGTATTTGAAGTATCGTCAGTTTCCCTT	171	RAA-AGE	In this study	
TTTAGCATACAATAATTGCCAGTCTTTTCC	
7	raaW4-F	FAM-AGAGTATTTGAAGTATCGTCAGTTTCCCTT	171	RAA-LFD	In this study	
raaW4-R	Biotin-TTTAGCATACAATAATTGCCAGTCTTTTCC	
8	UCE1-F

UCE1-R

	CTTTAGTTAAGAAATTCGCTCGCCATTATG	174	RAA-AGE	In this study	
CATTTTAATACCCTGCAGAACAGTCCTCAT	
9	UCE2-F

UCE2-R

	TCTTTGGTCTTTAGTTAAGAAATTCGCTCG	174	RAA-AGE	In this study	
TACCCTGCAGAACAGTCCTCATAACTCATC	
10	UCE3-F

UCE3-R

	CTTTAGTTAAGAAATTCGCTCGCCATTATG	252	RAA-AGE	In this study	
TTTATTGCCCAGAAAATTCCATTCTGCTAT	
11	UCE4-F

UCE4-R

	ATTATGGCATCATTAGGGAAACAAGGATAA	208	RAA-AGE	In this study	
ATTCTGCTATCTGATTCGAAAAGTCCAGTC	
12	raaUCE2-F	FAM-TCTTTGGTCTTTAGTTAAGAAATTCGCTCG	174	RAA-LFD	In this study	
raaUCE2-R	Biotin-TACCCTGCAGAACAGTCCTCATAACTCATC	
F: forward primer; R: reverse primer; FAM: Carboxyfluorescein.

Establishment of the RAA-LFD assay

The RAA-LFD assay is that the amplified products can be visualized. We used genomic DNA (gDNA) from females as a template for a positive female identification and male gDNA to control for male identification at 39 °C within 30 min in the RAA-LFD assay using raaW4 primer pair. The RAA production was visualized using LFD strips for 5 min. Positive reactions showed two separate lines, including the control and test lines, whereas only the control line appeared in the negative assay (Fig. S2). For false-negative signals, we carried out the evaluation by raaUCE2-RAA-LFD assay to be used as a positive control for DNA quality. This experiment was considered valid when the raaUCE2-RAA-LFD assay was performed on both females and males. That is, the raaUCE2-RAA-LFD analysis showed that there were both control and test lines in the LFD strip.

Specificity and sensitivity of the RAA-LFD assay

RaaW4-RAA-LFD specificity was tested using 20 great white pelicans and 2 pink-backed pelicans of known sex and compared with conventional PCR. According to the conventional PCR using the 2550 F/2718R primer set, female samples were identified by a 450- and 960- bp amplification product or a single 450- bp product, and male samples were characterized by a single 960-bp product. The results showed that the 22 pelicans were identified as 16 females and 6 males; however, one was not detected using conventional PCR (Fig. 2a). The raaW2-RAA-LFD analysis revealed that all 22 pelicans could be detected, among which 16 of the 22 birds were female and 6 were male, and the detection rate and PCR were 100% accurate (Fig. 2b).

Fig. 2 Comparative analysis of the specificity between conventional PCR (a) and raaW4-RAA-LFD assay (b). The PCR amplicon products were subjected to electrophoresis on a 2% agarose gel. M: DL2000 Marker. ♀: Female; ♂: Male.

We used four-fold serial dilutions of female pelican gDNA (100 ng, 25 ng, 6.3 ng, 1.6 ng, 0.4 ng, 0.1 ng, 0.1 ng, 25 pg, and 6.3 pg) to assess the sensitivity exhibited by the RAA-LFD assays and compared it with conventional PCR. As shown in Fig. S3, a detection limit of 1.6 ng gDNA was identified for female pelican feathers by conventional PCR using the 2550 F/2718R and UCR-F/R primers. The RAA reaction products for each concentration of female gDNA were tested separately on the LFD, and the color of the test line became lighter with decreasing concentration. We note that the limit of detection with raaW4 primers was 0.1 ng (Fig. 3a) and that of raaUCE2 primers was 25 pg (Fig. 3b) in RAA-LFD assay, respectively.

Fig. 3 Analysis of sensitivity RAA-LFD assay using four-fold serially diluted gDNA extracted from female pelican. The RAA amplified products using raaW4 (a) and raaUCE2 (b) primers were visible on the LFD at 5 min. NC: ddH2O.

Comparative validation of the RAA-LFD assay using field samples

To evaluate the diagnostic validity and reliability of the RAA-LFD assay, gDNA was extracted from 15 white pelicans of unknown sex. Simultaneously, we used the 2550 F/2718R primers from conventional PCR for detection. All pelican feather gDNA samples were successfully detected, and the RAA-LFD identified 11 females and 4 males (Table 2). The results of the RAA-LFD assay were consistent with the conventional PCR results.

Table 2 Comparative performances of RAA-LFD and conventional PCR assays for pelican sex identification.

Samples	RAA-LFD	Conventional PCR 2550 F/2718R	
RaaUCE2	RaaW4	
Female	Male	Female	Male	Female	Male	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	-	+	-	+	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	-	+	-	+	
Pelecanus onocrotalus	+	+	-	+	-	+	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	-	+	-	+	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	+	-	+	-	
Pelecanus onocrotalus	+	+	+	-	+	-	
The symbol “+” indicates that the method can detect; the symbol “-” indicates that the method cannot detect.

Discussion

Morphological sex identification in birds can be difficult if there is no significant sexual dimorphism. Many bird species exhibit one of the highest population declines owing to hunting and habitat fragmentation. Therefore, conservation has become a priority. Sex determination is difficult because of sexual monomorphism, and traditional sexing methods are traumatic. Molecular sexing is a minimally invasive, effective, and rapid technique to determine the sex of individuals1,27. Sex identification using molecular methods can be applied to monomorphic birds and is highly accurate because it targets the sex chromosomes directly28. Sexing methods for molecular DNA amplification using PCR have been widely used8. PCR detection of amplified nucleic acid products relies primarily on electrophoretic equipment and gel imaging systems29. Since the early 1990s, isothermal amplification methods for nucleic acids have been developed, some of which have been successfully commercialized for convenience30. Many isothermal amplification methods have also been used for sex identification of birds14,31,32. Compared to other isothermal amplification methods, the RPA/RAA technique has the advantages of short reaction time, simple method design, and low reaction temperature33–35. In this study, we confirmed the application of RAA-LFD to the diagnosis of sex using random samples. An RPA/RAA-LFD assay targeting the CHD gene was examined and demonstrated the ability to detect the sexing of pelicans with a high degree of specificity and sensitivity in 30 min. The sensitivity assay indicated that the detection limit of the RAA-LFD method was 100 times higher than that of the PCR. Furthermore, the analytical specificity assay showed that the assay could detect female pelicans but did not react with males. Fifteen clinical sample sets were evaluated using the RAA-LFD and PCR assays, and the results of the RAA-LFD assay were consistent with those of conventional PCR.

The CHD gene seems to have certain advantages in that it has significant sequence divergence between the W and Z chromosomes as a target for sex identification and has been used for sex identification in numerous avian species9,27,36. Classically established CHD-based 2550 F/2718R primer pairs are powerful tools for sex determination in most bird species. However, a preliminary test showed that they did not work as well as our established RAA-LFD because it performed worse at low DNA concentrations. Compared with traditional PCR, the RAA-LFD assay is generally more sensitive23,37. In this study, we designed specific primers using a differential sequence based on the CHD-W/CHD-Z genes and successfully amplified all female samples. In addition, to avoid false-negative scoring, the present method of identifying DNA quality by establishing the RAA-LFD of UCE was successfully applied to monitor RAA reactions. UCE genes have 99.9% identity in avian species, and we suggest using UCE as a positive control when applying isothermal amplification based bird sex identification4,38–40.

In the wild, bird sexing is a difficult task; therefore, the RAA-LFD method can be very useful in field research for fast and easy visualization of amplification products41–43. One advantage of the RAA-LFD assay is that the amplified products can be visualized using colloidal gold particles on the strip. The RAA-LFD method established in this study allows for RAA amplification and product visualization without any large laboratory equipment. Therefore, this method is suitable for rapid and simple DNA amplification in field tests. However, for field research further studies on simplified DNA extraction methods are required. In the present study, we used a DNA extraction kit that required approximately 2 h of laboratory work, which is unrealistic for field research. Therefore, it is necessary to develop a simple DNA extraction method that can be combined with RAA-LFD to allow easy, reliable, and quick sex determination in birds in the field using only basic laboratory tools12,44.

In summary, the CHD-W/CHD-Z primer sets of RAA-LFD were successfully applied to pelican sexing. For the amplification reaction, only at 39 °C was needed and without sophisticated equipment. The RAA amplicon analysis was performed on the LFD. Thus, the findings of this study provide a basis for RAA-LFD as a tool for simple, rapid, and sensitive sex identification in great white pelicans (Pelecanus onocrotalus), which could potentially be applied in the sexing and captive breeding management of pelicans.

Materials and methods

Sample collection

The 22 feather samples from two bird species, including 20 great white pelicans (Pelecanus onocrotalus) and 2 pink-backed pelicans (Pelecanus rufescens), were plucked during vaccination and obtained from the Guangzhou Zoo in Guangdong Province, China. Feathers were stored in a plastic bag labeled with a numerical code for a specific individual and frozen at − 20 °C until use. All experimental animal protocols were reviewed and approved by the Guangzhou Zoo Animal Use and Care Committee. All methods were performed in accordance with the relevant regulations and followed the recommendations outlined in the ARRIVE guidelines for conducting research.

DNA extraction

Approximately 2–10 mm segments from two to three individual feather calami were cut off and placed in a 1.5 mL Eppendorf tube. Genomic DNA (gDNA) was extracted using a HiPure Tissue & Blood DNA Kit (D3018; Megan, Guangzhou, China) according to the manufacturer’s protocol. After the extraction, DNAs were measured using a Nano-Drop ND-2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) and stored at − 20 ℃ until needed.

Primer design for sex determination

According to the guidelines of the RAA reaction kit manual, RAA primers [30–35 base pairs (bp), GC content 30–70%] specific for the ChromoHelicase-DNA-binding (CHD) gene sequences found on the Z and W chromosomes were self-designed by Primer Premier 5.0 software using the sequences derived from our Lab sequencing of pelicans (Table 1) and the primers were selected using the RAA agarose gel electrophoresis (RAA-AGE) assay. An optimal RAA primer pair was selected for the RAA-LFD assay. The RAA-LFD forward primer was labeled at the 5′-end with Carboxyfluorescein (FAM), reverse primer was labeled at the 5′ end with biotin.

A positive control for DNA quality and/or monitoring of RAA reactions consisted of highly conserved DNA in the so-called ultra-conserved element (UCE; GenBank: JQ331584.1) located on chromosome 6 of birds to design a primer set to develop the RAA-LFD assay, as previously described38. RAA primers based on the UCE gene were designed as described above. All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and are listed in Table 1.

Conventional PCR amplifications

PCR amplicons were prepared using 2550 F/2718R primers for the molecular sex identification of the pelican45. The PCR reaction was performed using 2 µL DNA solution obtained from feathers in a final volume of 20 µL containing 10 µL of 2× DreamTaq PCR Master Mix polymerase (K1081, ThermoFisher Scientific), 4.0 µL of ddH2O, and 1 µL (10 µM) of each 2550 F/2718R primer. The amplification protocol was composed of the following steps: initial denaturation at 94 °C for 3 min, followed by 35 cycles of 94 °C denaturation for 30 s, annealing at 49 ℃ for 45 s, and extension at 72 ℃ for 1 min, followed by a final extension at 72 ℃ for 5 min. Amplification products were separated using electrophoresis on a 2% agarose gel and visualized using an ultraviolet transilluminator (Bio-Rad). Distilled water was used as the negative control.

RAA-LFD reaction for sex identification

The RAA assay was performed using an RAA nucleic acid amplification kit (Zongche Bio-Sci&Tech Co., Ltd., Hangzhou, China) according to the manufacturer’s protocol. Each reaction system contained one RAA lyophilized powder, 29.4 µL of buffer A, 2 µL of forward primer (raaW4-F/raaUCE2-F; 10 µM), 2 µL of reverse primer (raaW4-R/raaUCE2-R; 10 µM), 1 µL DNA template, 13.1 µL of ddH2O, and 2.5 µL of buffer B. After reaction at 39 °C for 30 min, 1 µL of amplified product was immediately mixed with 99 µL PBS buffer and tested using for HybriDetect LFD (Milenia Biotech, Giessen, Germany) at room temperature (RT). The dipsticks were dipped in the diluted solution for 5 min prior to observation. For the raaW4-RAA-LFD assay, the dipstick indicated a female result when the control and test lines were both visible; if only the control line was visible, the result was considered to indicate male sex. It is worth noting that the assay were only valid when the test line of raaUCE2-RAA-LFD was visible. A positive control was constructed using female pelican gDNA. Distilled water was used as the negative control.

Evaluation of the RAA-LFD assay

To determine the specificity of the RAA-LFD assay, DNA extracted from feather samples of 22 pelicans of known sex, including six females and sixteen males, was used as the DNA template to perform the RAA-LFD assay, as described above. In addition, to detect the sensitivity of the RAA-LFD assay, a four-fold serial dilution of female pelican gDNA (100 ng, 25 ng; 6.3 ng; 1.6 ng; 0.4 ng; 0.1 ng; 25 pg; 6.3 pg; total eight dilutions) was used to amplify the RAA reaction and compared with that of conventional PCR. Finally, we collected 15 feathers of unidentified white pelicans from the Nansha Waterfowl Ecological Park, Guangzhou, and verified the field test of sex identification using the RAA-LFD assay. The effectiveness of the RAA-LFD assay was compared to that of conventional PCR using the 2550 F/2718R primer pair described above. Distilled water was used as the negative control.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Author contributions

Fanwen Zeng: Writing - review & editing. Xuanjiao Chen: Supervision. Wanhuan Zhong: Data curation. TanzipengChen: Validation & Investigation. Jiaqi Sa: Formal analysis & Visualization. Guoqian Wang: Software, Validation. Shouquan Zhang: Methodology. Shiming Peng: Conceptualization, Project administration. All authors have read and agreed to the published version of the manuscript.

Funding

The authors thank the Guangzhou Zoo Research Project (grant number: YL202401) for supporting this study.

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Morinha F Cabral JA Bastos E Molecular sexing of birds: a comparative review of polymerase chain reaction (PCR)-based methods Theriogenology 2012 78 703 714 10.1016/j.theriogenology.2012.04.015 22704393
Morinha, F., Cabral, J. A. & Bastos, E. Molecular sexing of birds: a comparative review of polymerase chain reaction (PCR)-based methods. Theriogenology. 78, 703–714. 10.1016/j.theriogenology.2012.04.015 (2012).22704393 10.1016/j.theriogenology.2012.04.015
2. Naim DM Nor SA Baharuddin MH Non-invasive sex identification of the white-bellied sea eagle (Haliaeetus leucogaster) through genetic analysis of feathers Genet. Mol. Research: GMR 2011 10 2505 2510 10.4238/2011.October.13.7 22009862
Naim, D. M., Nor, S. A. & Baharuddin, M. H. Non-invasive sex identification of the white-bellied sea eagle (Haliaeetus leucogaster) through genetic analysis of feathers. Genet. Mol. Research: GMR. 10, 2505–2510. 10.4238/2011.October.13.7 (2011).22009862 10.4238/2011.October.13.7
3. Hu RY [A simple and universal method for molecular sexing of birds] Shi Yan Sheng Wu Xue bao 2003 36 401 404 14724955
Hu, R. Y. et al. [A simple and universal method for molecular sexing of birds]. Shi Yan Sheng Wu Xue bao. 36, 401–404 (2003).14724955
4. Morinha F High-resolution melting analysis for bird sexing: a successful approach to molecular sex identification using different biological samples Mol. Ecol. Resour. 2013 13 473 483 10.1111/1755-0998.12081 23433263
Morinha, F. et al. High-resolution melting analysis for bird sexing: a successful approach to molecular sex identification using different biological samples. Mol. Ecol. Resour. 13, 473–483. 10.1111/1755-0998.12081 (2013).23433263 10.1111/1755-0998.12081
5. Patiño L Cruz M Martínez P Cedeño-Escobar, V. using PCR-RFLP for sexing of the endangered Galápagos petrel (Pterodroma phaeopygia) Genet. Mol. Research: GMR 2013 12 4760 4767 10.4238/2013.October.18.13 24222251
Patiño, L., Cruz, M. & Martínez, P. Cedeño-Escobar, V. using PCR-RFLP for sexing of the endangered Galápagos petrel (Pterodroma phaeopygia). Genet. Mol. Research: GMR. 12, 4760–4767. 10.4238/2013.October.18.13 (2013).24222251 10.4238/2013.October.18.13
6. Chinsamy A Chiappe LM Marugán-Lobón J Chunling G Fengjiao Z Gender identification of the mesozoic bird confuciusornis sanctus Nat. Commun. 2013 4 1381 10.1038/ncomms2377 23340421
Chinsamy, A., Chiappe, L. M., Marugán-Lobón, J., Chunling, G. & Fengjiao, Z. Gender identification of the mesozoic bird confuciusornis sanctus. Nat. Commun. 4, 1381. 10.1038/ncomms2377 (2013).23340421 10.1038/ncomms2377
7. Osman MA Sugnaseelan S Panandam JM Ab Ghani, N. I. Molecular sex identification of Malaysian White-Nest Swiftlet (Aerodramus fuciphagus Thunberg, 1812) Ecol. Evol. 2020 10 10440 10448 10.1002/ece3.6699 33072271
Osman, M. A., Sugnaseelan, S. & Panandam, J. M. Ab Ghani, N. I. Molecular sex identification of Malaysian White-Nest Swiftlet (Aerodramus fuciphagus Thunberg, 1812). Ecol. Evol. 10, 10440–10448. 10.1002/ece3.6699 (2020).33072271 10.1002/ece3.6699
8. Griffiths R Double MC Orr K Dawson RJ A DNA test to sex most birds Mol. Ecol. 1998 7 1071 1075 10.1046/j.1365-294x.1998.00389.x 9711866
Griffiths, R., Double, M. C., Orr, K. & Dawson, R. J. A DNA test to sex most birds. Mol. Ecol. 7, 1071–1075. 10.1046/j.1365-294x.1998.00389.x (1998).9711866 10.1046/j.1365-294x.1998.00389.x
9. Lee JC A novel strategy for avian species and gender identification using the CHD gene Mol. Cell Probes 2010 24 27 31 10.1016/j.mcp.2009.08.003 19716876
Lee, J. C. et al. A novel strategy for avian species and gender identification using the CHD gene. Mol. Cell Probes. 24, 27–31. 10.1016/j.mcp.2009.08.003 (2010).19716876 10.1016/j.mcp.2009.08.003
10. Çakmak E Akın Pekşen Ç Bilgin CC Comparison of three different primer sets for sexing birds J. Veterinary Diagn. Investigation: Official Publication Am. Association Veterinary Lab. Diagnosticians Inc 2017 29 59 63 10.1177/1040638716675197
Çakmak, E., Akın Pekşen, Ç. & Bilgin, C. C. Comparison of three different primer sets for sexing birds. J. Veterinary Diagn. Investigation: Official Publication Am. Association Veterinary Lab. Diagnosticians Inc. 29, 59–63. 10.1177/1040638716675197 (2017).10.1177/1040638716675197
11. Chang HW High-throughput gender identification of Accipitridae eagles with real-time PCR using TaqMan probes Theriogenology 2008 70 83 90 10.1016/j.theriogenology.2008.02.011 18440628
Chang, H. W. et al. High-throughput gender identification of Accipitridae eagles with real-time PCR using TaqMan probes. Theriogenology. 70, 83–90. 10.1016/j.theriogenology.2008.02.011 (2008).18440628 10.1016/j.theriogenology.2008.02.011
12. Changtor P Gupta YM Yimtragool N Optimization and application of loop-mediated isothermal amplification technique for sex identification in red-whiskered bulbul (Pycnonotus jocosus) Ecol. Evol. 2022 12 e9401 10.1002/ece3.9401 36225838
Changtor, P., Gupta, Y. M. & Yimtragool, N. Optimization and application of loop-mediated isothermal amplification technique for sex identification in red-whiskered bulbul (Pycnonotus jocosus). Ecol. Evol. 12, e9401. 10.1002/ece3.9401 (2022).36225838 10.1002/ece3.9401
13. Baert L Detection of murine norovirus 1 by using plaque assay, transfection assay, and real-time reverse transcription-PCR before and after heat exposure Appl. Environ. Microbiol. 2008 74 543 546 10.1128/aem.01039-07 18024676
Baert, L. et al. Detection of murine norovirus 1 by using plaque assay, transfection assay, and real-time reverse transcription-PCR before and after heat exposure. Appl. Environ. Microbiol. 74, 543–546. 10.1128/aem.01039-07 (2008).18024676 10.1128/aem.01039-07
14. Koch HR Blohm-Sievers E Liedvogel M Rapid sex determination of a wild passerine species using loop-mediated isothermal amplification (LAMP) Ecol. Evol. 2019 9 5849 5858 10.1002/ece3.5168 31161003
Koch, H. R., Blohm-Sievers, E. & Liedvogel, M. Rapid sex determination of a wild passerine species using loop-mediated isothermal amplification (LAMP). Ecol. Evol. 9, 5849–5858. 10.1002/ece3.5168 (2019).31161003 10.1002/ece3.5168
15. Gui L Quick detection of Carassius auratus Herpesvirus (CaHV) by recombinase-aid amplification lateral flow dipstick (RAA-LFD) method Front. Cell. Infect. Microbiol. 2022 12 981911 10.3389/fcimb.2022.981911 36171755
Gui, L. et al. Quick detection of Carassius auratus Herpesvirus (CaHV) by recombinase-aid amplification lateral flow dipstick (RAA-LFD) method. Front. Cell. Infect. Microbiol. 12, 981911. 10.3389/fcimb.2022.981911 (2022).36171755 10.3389/fcimb.2022.981911
16. Hou L Development of an isothermal recombinase-aided amplification assay for the rapid and visualized detection of Klebsiella pneumoniae J. Sci. Food. Agric. 2022 102 3879 3886 10.1002/jsfa.11737 34936095
Hou, L. et al. Development of an isothermal recombinase-aided amplification assay for the rapid and visualized detection of Klebsiella pneumoniae. J. Sci. Food. Agric. 102, 3879–3886. 10.1002/jsfa.11737 (2022).34936095 10.1002/jsfa.11737
17. Lin H Rapid Visual Detection of Plasmodium using recombinase-aided amplification with lateral Flow Dipstick Assay Front. Cell. Infect. Microbiol. 2022 12 922146 10.3389/fcimb.2022.922146 35811679
Lin, H. et al. Rapid Visual Detection of Plasmodium using recombinase-aided amplification with lateral Flow Dipstick Assay. Front. Cell. Infect. Microbiol. 12, 922146. 10.3389/fcimb.2022.922146 (2022).35811679 10.3389/fcimb.2022.922146
18. Wang H Rapid Visual Detection of Hepatitis C Virus using reverse transcription recombinase-aided amplification-lateral Flow Dipstick Front. Cell. Infect. Microbiol. 2022 12 816238 10.3389/fcimb.2022.816238 35252031
Wang, H. et al. Rapid Visual Detection of Hepatitis C Virus using reverse transcription recombinase-aided amplification-lateral Flow Dipstick. Front. Cell. Infect. Microbiol. 12, 816238. 10.3389/fcimb.2022.816238 (2022).35252031 10.3389/fcimb.2022.816238
19. Xiong Y Rapid visual detection of dengue virus by combining reverse transcription recombinase-aided amplification with lateral-flow dipstick assay Int. J. Infect. Diseases: IJID : Official Publication Int. Soc. Infect. Dis. 2020 95 406 412 10.1016/j.ijid.2020.03.075
Xiong, Y. et al. Rapid visual detection of dengue virus by combining reverse transcription recombinase-aided amplification with lateral-flow dipstick assay. Int. J. Infect. Diseases: IJID : Official Publication Int. Soc. Infect. Dis. 95, 406–412. 10.1016/j.ijid.2020.03.075 (2020).10.1016/j.ijid.2020.03.075
20. Zheng YZ Reverse transcription recombinase-aided amplification assay with lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus Front. Cell. Infect. Microbiol. 2021 11 613304 10.3389/fcimb.2021.613304 33598439
Zheng, Y. Z. et al. Reverse transcription recombinase-aided amplification assay with lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus. Front. Cell. Infect. Microbiol. 11, 613304. 10.3389/fcimb.2021.613304 (2021).33598439 10.3389/fcimb.2021.613304
21. Li J Macdonald J von Stetten F Review: a comprehensive summary of a decade development of the recombinase polymerase amplification Analyst 2018 144 31 67 10.1039/c8an01621f 30426974
Li, J., Macdonald, J. & von Stetten, F. Review: a comprehensive summary of a decade development of the recombinase polymerase amplification. Analyst. 144, 31–67. 10.1039/c8an01621f (2018).30426974 10.1039/c8an01621f
22. Bian Z Development of a recombinase polymerase amplification assay with lateral flow dipstick (RPA-LFD) for rapid detection of Shigella spp. and Enteroinvasive Escherichia coli PLoS One 2022 17 e0278869 10.1371/journal.pone.0278869 36508428
Bian, Z. et al. Development of a recombinase polymerase amplification assay with lateral flow dipstick (RPA-LFD) for rapid detection of Shigella spp. and Enteroinvasive Escherichia coli. PLoS One. 17, e0278869. 10.1371/journal.pone.0278869 (2022).36508428 10.1371/journal.pone.0278869
23. Onchan W Sensitive and rapid detection of Babesia species in dogs by recombinase polymerase amplification with lateral flow dipstick (RPA-LFD) Sci. Rep. 2022 12 20560 10.1038/s41598-022-25165-7 36446883
Onchan, W. et al. Sensitive and rapid detection of Babesia species in dogs by recombinase polymerase amplification with lateral flow dipstick (RPA-LFD). Sci. Rep. 12, 20560. 10.1038/s41598-022-25165-7 (2022).36446883 10.1038/s41598-022-25165-7
24. Ling, L., Liang, L., Wang, H., Lin, X. & Li, C. Real-time monitoring on the Chinese giant Salamander using RPA-LFD. Int. J. Mol. Sci. 2510.3390/ijms25094946 (2024).
25. Danel S Social learning in great white pelicans (Pelecanus onocrotalus): a preliminary study Learn. Behav. 2020 48 344 350 10.3758/s13420-019-00404-6 32052278
Danel, S. et al. Social learning in great white pelicans (Pelecanus onocrotalus): a preliminary study. Learn. Behav. 48, 344–350. 10.3758/s13420-019-00404-6 (2020).32052278 10.3758/s13420-019-00404-6
26. Haase, G. et al. Feather corticosterone measurements and behavioral observations in the Great White Pelican (Pelecanus onocrotalus) living under different Flight Restraint conditions in German zoos. Animals: Open. Access. J. MDPI. 1110.3390/ani11092522 (2021).
27. Griffiths R Daan S Dijkstra C Sex identification in birds using two CHD genes Proc. Biol. Sci. 1996 263 1251 1256 10.1098/rspb.1996.0184 8858876
Griffiths, R., Daan, S. & Dijkstra, C. Sex identification in birds using two CHD genes. Proc. Biol. Sci. 263, 1251–1256. 10.1098/rspb.1996.0184 (1996).8858876 10.1098/rspb.1996.0184
28. Purwaningrum M Molecular techniques for sex identification of captive birds Veterinary World 2019 12 1506 1513 10.14202/vetworld.2019.1506-1513 31749589
Purwaningrum, M. et al. Molecular techniques for sex identification of captive birds. Veterinary World. 12, 1506–1513. 10.14202/vetworld.2019.1506-1513 (2019).31749589 10.14202/vetworld.2019.1506-1513
29. Hirayama H Rapid sex chromosomal chimerism analysis in heterosexual twin female calves by Loop-mediated isothermal amplification Anim. Reprod. Sci. 2007 101 38 44 10.1016/j.anireprosci.2006.09.006 17011732
Hirayama, H. et al. Rapid sex chromosomal chimerism analysis in heterosexual twin female calves by Loop-mediated isothermal amplification. Anim. Reprod. Sci. 101, 38–44. 10.1016/j.anireprosci.2006.09.006 (2007).17011732 10.1016/j.anireprosci.2006.09.006
30. Zhao Y Chen F Li Q Wang L Fan C Isothermal amplification of nucleic acids Chem. Rev. 2015 115 12491 12545 10.1021/acs.chemrev.5b00428 26551336
Zhao, Y., Chen, F., Li, Q., Wang, L. & Fan, C. Isothermal amplification of nucleic acids. Chem. Rev. 115, 12491–12545. 10.1021/acs.chemrev.5b00428 (2015).26551336 10.1021/acs.chemrev.5b00428
31. Centeno-Cuadros A Abbasi I Nathan R Sex determination in the wild: a field application of loop-mediated isothermal amplification successfully determines sex across three raptor species Mol. Ecol. Resour. 2017 17 153 160 10.1111/1755-0998.12540 27235333
Centeno-Cuadros, A., Abbasi, I. & Nathan, R. Sex determination in the wild: a field application of loop-mediated isothermal amplification successfully determines sex across three raptor species. Mol. Ecol. Resour. 17, 153–160. 10.1111/1755-0998.12540 (2017).27235333 10.1111/1755-0998.12540
32. Chan KW A novel loop-mediated isothermal amplification approach for sex identification of Columbidae birds Theriogenology 2012 78 1329 1338 10.1016/j.theriogenology.2012.05.034 22898019
Chan, K. W. et al. A novel loop-mediated isothermal amplification approach for sex identification of Columbidae birds. Theriogenology. 78, 1329–1338. 10.1016/j.theriogenology.2012.05.034 (2012).22898019 10.1016/j.theriogenology.2012.05.034
33. Li J Development of a novel integrated isothermal amplification system for detection of bacteria-spiked blood samples AMB Express 2023 13 135 10.1186/s13568-023-01643-7 38019349
Li, J. et al. Development of a novel integrated isothermal amplification system for detection of bacteria-spiked blood samples. AMB Express. 13, 135. 10.1186/s13568-023-01643-7 (2023).38019349 10.1186/s13568-023-01643-7
34. Crannell ZA Rohrman B Richards-Kortum R Equipment-free incubation of recombinase polymerase amplification reactions using body heat PLoS One 2014 9 e112146 10.1371/journal.pone.0112146 25372030
Crannell, Z. A., Rohrman, B. & Richards-Kortum, R. Equipment-free incubation of recombinase polymerase amplification reactions using body heat. PLoS One. 9, e112146. 10.1371/journal.pone.0112146 (2014).25372030 10.1371/journal.pone.0112146
35. Kong M A wearable microfluidic device for rapid detection of HIV-1 DNA using recombinase polymerase amplification Talanta 2019 205 120155 10.1016/j.talanta.2019.120155 31450450
Kong, M. et al. A wearable microfluidic device for rapid detection of HIV-1 DNA using recombinase polymerase amplification. Talanta. 205, 120155. 10.1016/j.talanta.2019.120155 (2019).31450450 10.1016/j.talanta.2019.120155
36. Nota Y Takenaka O DNA extraction from urine and sex identification of birds Mol. Ecol. 1999 8 1237 1238 10.1046/j.1365-294x.1999.00682_2.x 10490329
Nota, Y. & Takenaka, O. DNA extraction from urine and sex identification of birds. Mol. Ecol. 8, 1237–1238. 10.1046/j.1365-294x.1999.00682_2.x (1999).10490329 10.1046/j.1365-294x.1999.00682_2.x
37. Preena PG Kumar TVA Johny TK Dharmaratnam A Swaminathan TR Quick hassle-free detection of cyprinid herpesvirus 2 (CyHV-2) in goldfish using recombinase polymerase amplification-lateral flow dipstick (RPA-LFD) assay Aquaculture International: J. Eur. Aquaculture Soc. 2022 30 1211 1220 10.1007/s10499-021-00806-2
Preena, P. G., Kumar, T. V. A., Johny, T. K., Dharmaratnam, A. & Swaminathan, T. R. Quick hassle-free detection of cyprinid herpesvirus 2 (CyHV-2) in goldfish using recombinase polymerase amplification-lateral flow dipstick (RPA-LFD) assay. Aquaculture International: J. Eur. Aquaculture Soc. 30, 1211–1220. 10.1007/s10499-021-00806-2 (2022).10.1007/s10499-021-00806-2
38. Centeno-Cuadros A Tella JL Delibes M Edelaar P Carrete M Validation of loop-mediated isothermal amplification for fast and portable sex determination across the phylogeny of birds Mol. Ecol. Resour. 2018 18 251 263 10.1111/1755-0998.12732 29091348
Centeno-Cuadros, A., Tella, J. L., Delibes, M., Edelaar, P. & Carrete, M. Validation of loop-mediated isothermal amplification for fast and portable sex determination across the phylogeny of birds. Mol. Ecol. Resour. 18, 251–263. 10.1111/1755-0998.12732 (2018).29091348 10.1111/1755-0998.12732
39. McCormack JE Tsai WL Faircloth BC Sequence capture of ultraconserved elements from bird museum specimens Mol. Ecol. Resour. 2016 16 1189 1203 10.1111/1755-0998.12466 26391430
McCormack, J. E., Tsai, W. L. & Faircloth, B. C. Sequence capture of ultraconserved elements from bird museum specimens. Mol. Ecol. Resour. 16, 1189–1203. 10.1111/1755-0998.12466 (2016).26391430 10.1111/1755-0998.12466
40. Bejerano G Ultraconserved elements in the human genome Science 2004 304 1321 1325 10.1126/science.1098119 15131266
Bejerano, G. et al. Ultraconserved elements in the human genome. Science. 304, 1321–1325. 10.1126/science.1098119 (2004).15131266 10.1126/science.1098119
41. Zeng J A nucleic acid detection assay combining reverse transcription recombinase-aided amplification with a lateral flow dipstick for the rapid visual detection of porcine deltacoronavirus Virulence 2022 13 1471 1485 10.1080/21505594.2022.2116157 36005235
Zeng, J. et al. A nucleic acid detection assay combining reverse transcription recombinase-aided amplification with a lateral flow dipstick for the rapid visual detection of porcine deltacoronavirus. Virulence. 13, 1471–1485. 10.1080/21505594.2022.2116157 (2022).36005235 10.1080/21505594.2022.2116157
42. Li Y Establishment of two assays based on reverse transcription recombinase-aided amplification technology for rapid detection of H5 subtype avian influenza virus Microbiol. Spectr. 2023 11 e0218623 10.1128/spectrum.02186-23 37811963
Li, Y. et al. Establishment of two assays based on reverse transcription recombinase-aided amplification technology for rapid detection of H5 subtype avian influenza virus. Microbiol. Spectr. 11, e0218623. 10.1128/spectrum.02186-23 (2023).37811963 10.1128/spectrum.02186-23
43. Wang W Reverse transcription recombinase-aided amplification assay combined with a lateral flow dipstick for detection of avian infectious bronchitis virus Poult. Sci. 2020 99 89 94 10.3382/ps/pez559 32416856
Wang, W. et al. Reverse transcription recombinase-aided amplification assay combined with a lateral flow dipstick for detection of avian infectious bronchitis virus. Poult. Sci. 99, 89–94. 10.3382/ps/pez559 (2020).32416856 10.3382/ps/pez559
44. Li D Zhao J Lan W Zhao Y Sun X Effect of food matrix on rapid detection of Vibrio parahaemolyticus in aquatic products based on toxR gene World J. Microbiol. Biotechnol. 2023 39 188 10.1007/s11274-023-03640-1 37156898
Li, D., Zhao, J., Lan, W., Zhao, Y. & Sun, X. Effect of food matrix on rapid detection of Vibrio parahaemolyticus in aquatic products based on toxR gene. World J. Microbiol. Biotechnol. 39, 188. 10.1007/s11274-023-03640-1 (2023).37156898 10.1007/s11274-023-03640-1
45. Fridolfsson AK Ellegren HA Simple and universal method for Molecular Sexing of Non-ratite Birds J. Avian Biol. 1999 30 116 121 10.2307/3677252
Fridolfsson, A. K. & Ellegren, H. A. Simple and universal method for Molecular Sexing of Non-ratite Birds. J. Avian Biol. 30, 116–121. 10.2307/3677252 (1999).10.2307/3677252
