
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39266641
72115
10.1038/s41598-024-72115-6
Article
Influenza induces lung lymphangiogenesis independent of YAP/TAZ activity in lymphatic endothelial cells
Crossey Erin ecrossey@bu.edu

1
Carty Senegal 1
Shao Fengzhi 1
Henao-Vasquez Jhonatan 1
Ysasi Alexandra B. 1
Zeng Michelle 1
Hinds Anne 1
Lo Ming 23
Tilston-Lunel Andrew 4
Varelas Xaralabos 4
Jones Matthew R. 1
Fine Alan 1
1 https://ror.org/05qwgg493 grid.189504.1 0000 0004 1936 7558 Division of Pulmonary, Allergy, Sleep and Critical Care, Department of Medicine, Boston University Chobanian and Avedisian School of Medicine, 72 East Concord St, R-304, Boston, MA 02118 USA
2 https://ror.org/05qwgg493 grid.189504.1 0000 0004 1936 7558 Department of Pathology and Laboratory Medicine, Boston University Chobanian and Avedisian School of Medicine, Boston, MA USA
3 https://ror.org/05qwgg493 grid.189504.1 0000 0004 1936 7558 Comparative Pathology Laboratory, Boston University National Emerging and Infectious Disease Laboratories, Boston, MA USA
4 https://ror.org/05qwgg493 grid.189504.1 0000 0004 1936 7558 Department of Biochemistry and Cell Biology, Boston University Chobanian and Avedisian School of Medicine, Boston, MA USA
12 9 2024
12 9 2024
2024
14 2132412 2 2024
3 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
The lymphatic system consists of a vessel network lined by specialized lymphatic endothelial cells (LECs) that are responsible for tissue fluid homeostasis and immune cell trafficking. The mechanisms for organ-specific LEC responses to environmental cues are not well understood. We found robust lymphangiogenesis during influenza A virus infection in the adult mouse lung. We show that the number of LECs increases twofold at 7 days post-influenza infection (dpi) and threefold at 21 dpi, and that lymphangiogenesis is preceded by lymphatic dilation. We also show that the expanded lymphatic network enhances fluid drainage to mediastinal lymph nodes. Using EdU labeling, we found that a significantly higher number of pulmonary LECs are proliferating at 7 dpi compared to LECs in homeostatic conditions. Lineage tracing during influenza indicates that new pulmonary LECs are derived from preexisting LECs rather than non-LEC progenitors. Lastly, using a conditional LEC-specific YAP/TAZ knockout model, we established that lymphangiogenesis, fluid transport and the immune response to influenza are independent of YAP/TAZ activity in LECs. These findings were unexpected, as they indicate that YAP/TAZ signaling is not crucial for these processes.

Subject terms

Infection
Respiratory tract diseases
American Heart Association Postdoctoral Fellowship23POST1022559 Crossey Erin http://dx.doi.org/10.13039/100000050 National Heart, Lung, and Blood Institute 5R01HL136725-03 American Heart Association Predoctoral Fellowship831211 Carty Senegal issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

The pulmonary lymphatic vasculature plays a number of crucial roles in orchestrating the response to infection and tissue injury1. These vessels are lined with specialized lymphatic endothelial cells (LECs), which maintain their identity through the constitutive expression of Prospero homeobox protein 1 (PROX1)2 and are characterized by vascular endothelial growth factor receptor 3 (VEGFR3) expression3–5. Lymphatics modulate interstitial fluid drainage and transport immune cells and antigen to lymph nodes6. Signaling between LECs and immune cells also directs chemotaxis7 and immune cell proliferation8. During respiratory tract inflammation, these functions are essential, as excessive tissue fluid buildup or an ineffective immune response could severely compromise lung function.

New lymphatic vessel growth, or lymphangiogenesis, can be observed in inflamed tissue9. Although this has been shown in the respiratory system in response to several types of injury, including bacterial infection10,11 and pulmonary fibrosis12,13, it is unknown whether it occurs in response to acute viral infections such as influenza.

Influenza viruses target the respiratory epithelium, triggering severe inflammation14. In spite of advances in prophylaxis and treatment approaches, influenza infection is associated with 14% of acute respiratory disease-related hospitalizations15 and an estimated 290,000–650,000 annual respiratory deaths worldwide16. Concentrating on the host's response, which is pivotal in determining influenza's severity and outcome, opens avenues for novel therapeutic interventions. In this context, lymphatic vessel dysfunction might weaken tissue resilience and impede pathogen removal. Facilitating pulmonary lymphatic responses could theoretically, therefore, enhance viral elimination, counteract damaging immune dysregulation and strengthen fluid removal in severe cases. The Hippo pathway, known for its high conservation and central role in cell proliferation, organ development and morphogenesis, and tissue responses to injury could be key in guiding lymphatic endothelial cell behavior during influenza infection17–19.

Mechanical stimuli, such as stretch and shear forces are common environmental cues that modulate Hippo signaling17,18,20,21. In Hippo signaling, two downstream effectors jointly regulate gene expression: Yes-associated protein (YAP), encoded by the Yap1 gene, and Transcriptional co-activator with PDZ-binding motif (TAZ), encoded by the Wwtr1 gene. YAP and TAZ protein activity depend on intracellular localization. Nuclear YAP and TAZ regulate a wide variety of target genes, whereas cytoplasmic YAP and TAZ are targeted for degradation22. Notably, YAP/TAZ depletion23,24 or hyperactivation23 in LECs during embryonic development results in structurally aberrant and poorly functional lymphatics and lethality, highlighting its importance in early development of the lymphatic system. In adults, however, intact Hippo signaling in LECs is less critical for maintaining lymphatic integrity during homeostasis23. The functional role(s) of Hippo signaling in adult lung LECs, particularly during inflammatory responses, remain unexplored.

In blood endothelial cells, mechanosensitive signaling20,21 and molecular signals such as vascular endothelial growth factor A (VEGF-A)25–27 act through the Hippo pathway to regulate cell proliferation. The major pro-lymphangiogenic growth factor, VEGF-C, also influences Hippo signaling23,24. While increased fluid influx and altered levels of cytokines and growth factors are key characteristics of the lung’s inflammatory response, to our knowledge, no study has investigated what role YAP/TAZ signaling might play in pulmonary lymphatic vessels as they respond to influenza-induced inflammation.

Here we show that the pulmonary lymphatic system undergoes extensive dilation and lymphangiogenesis in a mouse model of influenza infection. We show by lineage tracing that the expanded lymphatic network in the lung derives from existing LECs. We also demonstrate that there is a significantly higher number of proliferating pulmonary LECs during influenza. The resulting lymphatic network exhibits increased fluid drainage from the lung to mediastinal lymph nodes. In view of these findings, we investigated the role of the Hippo signaling pathway in LECs during influenza. Our results demonstrate that LEC-specific deletion of these Hippo pathway effectors revealed that YAP/TAZ signaling is dispensable for pulmonary lymphangiogenesis, lymphatic drainage and host response in the adult lung during influenza. These findings were unanticipated, as they suggest that Hippo-dependent signaling is not crucial for these processes in adults. This discovery yields new avenues for understanding the mechanisms underlying pulmonary responses to influenza A infection and the regulation of lymphatic function in adult lungs.

Results

Pulmonary lymphangiogenesis in influenza pneumonia

To investigate the pulmonary lymphatic vessel responses to influenza infection, we intratracheally infected the left lobe of mice with PR8 influenza and harvested left lungs at 3-, 7- and 21-days post-infection (dpi) for paraffin-embedding and sectioning. Mice were weighed daily during the time-course of infection to assess morbidity (Supp. Fig. 1). To quantify LECs, comparable sections of the left lung containing a range of proximal and distal airways were obtained from control and infected mice. We then stained for VEGFR3 in lung sections of influenza-infected and control mice to identify lymphatic vessels. We observed a significant and sustained enlargement in the diameter of VEGFR3-positive vessels in the lung during influenza infection as soon as 3 dpi and until at least 21 dpi (Fig. 1A and B). This indicated that the lymphatic vessels are dilated in response to influenza infection.Fig. 1 Lymphatic vessels dilate during influenza infection. (A) VEGFR3-positive lymphatic vessels (brown; also denoted with red stars) visualized via IHC are more dilated in influenza-infected lungs than in controls. (B) For each mouse, 20 lymphatic vessel diameters were measured using 3 separate histologic sections; mean and SD are shown for n = 3 mice per condition per time point (3-, 7-, and 21-dpi). Statistical significance by unpaired two tailed t-test with Welch’s correction.

To determine whether lymphangiogenesis accompanied vessel dilation, we quantified the lung LEC population by labeling LEC nuclei during a time-course of influenza infection. In order to do this, we stained for PROX1 at 3, 7 and 21 dpi and enumerated LECs in each histological section comparing influenza-infected lungs with controls. This experiment revealed a doubling of LECs by 7 dpi that continued to increase through 21 dpi (Fig. 2A and B). Our findings indicate that influenza infection not only leads to the enlargement of existing lymphatic vessels but also stimulates the expansion of LEC number. To assess the overall pattern of lung lymphangiogenesis in influenza, we examined the left lungs of control and infected PROX1-CreERT2/tdTomato mice at 7dpi. In this study, we found uniform expansion of the lymphatic network (Supp. Fig. 2).Fig. 2 Influenza infection induces pulmonary lymphangiogenesis. (A) PROX1-positive LEC nuclei (brown; also denoted with black arrowheads) visualized via IHC are more numerous in influenza-infected lungs than in controls at 7 and 21 dpi. (B) For each mouse, LEC nuclei were quantified using 3–5 tissue sections from influenza-infected and control mice; mean and SD are shown for n = 3–5 mice per condition per time point. Statistical significance by unpaired one tailed t-test with Welch’s correction.

Pulmonary lymphangiogenesis in influenza is driven by LEC proliferation

To identify the source of new LECs in the lymphatic network in influenza-infected lungs, we employed two independent approaches. Firstly, to label nascent DNA incorporation, 5-Ethynyl-2-deoxyuridine (EdU) was administered to mice during influenza infection. Lungs were harvested at 7 dpi and immunofluorescently co-stained for PROX1 and EdU (Fig. 3A and B). While proliferating LECs were very rarely observed in control tissues, approximately 20% of LECs in influenza-infected lungs had incorporated EdU by 7 dpi (3b). Of note, EdU uptake in LECs was noted in all regions of the lung. Secondly, we investigated the possibility that an exogenous progenitor cell might play a role in influenza-induced lymphangiogenesis. To address this question, tamoxifen-induced LEC lineage labeling was performed in PROX1-CreERT2/tdTomato mice prior to influenza infection. The proportion of tdTomato positive LECs observed during influenza infection was then compared to control lungs. Despite the increased number of LECs observed during influenza (data not shown), there was a similar proportion of lineage labeled cells at 7 dpi (Fig. 3C and D). These findings demonstrate that PROX1-negative progenitor cells are not contributing to lymphangiogenesis during influenza. However, we cannot exclude the possibility of a PROX1-positive progenitor. Notably, EdU uptake in LECs was not observed in the liver, heart, or esophageal tissues, indicating that LEC proliferation during influenza was specific to the lungs (data not shown). Taken together, these results suggest endogenous lung LEC proliferation in response to influenza infection contributes to LEC expansion.Fig. 3 LECs proliferate in response to influenza infection. (A) C57Bl/6 mice were administered saline or PR8 followed by EdU injections, and lungs were harvested at 7 dpi followed by IF staining for PROX1 and EdU. White arrowheads indicate PROX1+/EdU+ cells. (B) The number of PROX1 + LECs that costained for EdU was quantified; mean and SD are shown for n = 9 mice per condition. Statistical significance by unpaired two-tailed Mann Whitney test. (C) Prox1-CreERT2/TdTomato mice were administered tamoxifen prior to saline or PR8 administration, and lungs were harvested at 7 dpi followed by IF staining for PROX1 and tdTomato. White arrowheads indicate PROX1+/TdTomato+ cells. (D) The number of PROX1 + LECs that costained for tdTomato was quantified; mean and SD are shown for n = 5 mice per condition. Statistical significance by unpaired two-tailed Mann Whitney test.

Lymphatic transport in influenza pneumonia

Consistent with published literature, influenza infection leads to pronounced inflammation, and pulmonary edema. In this regard, we observed significantly higher lung wet-to-dry weight ratios during influenza infection as compared to controls, indicative of pulmonary edema (Fig. 4A). To investigate the functional properties of the expanded lymphatic network, we instilled a 10 kDa fluorescent dextran molecule into the left lung airspaces and measured fluorescence in the lung-draining mediastinal lymph node (mLN) (Fig. 4B and C). We observed a significantly higher fluorescent signal in the mLNs of influenza-infected mice as compared to control at 15 min. There was minimal fluorescent signal detected in non-draining inguinal LNs indicating local lymphatic drainage as opposed to blood vessel drainage was primarily responsible for transport of dextran (data not shown). Collectively, these findings indicate that the expanded lymphatic network in the influenza-infected lung is associated with enhanced lymphatic transport.Fig. 4 Lymphatic fluid drainage from the lung is enhanced during influenza infection. (A) Lung wet to dry weight ratios were obtained at 7 dpi from C57Bl/6 mice administered saline or PR8; mean and SD are shown for n = 9 mice per condition. Statistical significance by unpaired two-tailed Mann Whitney test. (B) Example histologic section of a mediastinal LN stained for VEGFR3 (red) and Dextran-488 (green). (C) Fluorometric quantification of Dextran-488 in mediastinal LN 15 min after instillation into left lung lobe. Mean and SD are shown for n = 8–10 mice per condition. Statistical significance by unpaired two-tailed Mann Whitney test.

Role of Hippo signaling during influenza-induced pulmonary lymphangiogenesis

The Hippo pathway is a fundamental mediator of cell proliferation during development and is activated in response to injury and mechanical cues. Notably, Hippo signaling in LECs is critical for lymphangiogenesis and lymphatic patterning during embryonic development23,24. To determine the role for Hippo signaling in LECs during influenza-induced lymphangiogenesis, we utilized a previously published model of Hippo pathway deletion in LECs (Prox1-CreERT2/Yap1(YAP)-fl/Wwtr1(TAZ)-fl, hereafter YAP/TAZ△LEC). In all experiments, Cre(−) littermates given tamoxifen were used as controls.

First, we validated YAP and TAZ depletion in LECs using immunofluorescent staining of lung histologic sections and by validating the presence of the floxed YAP and TAZ alleles after tamoxifen administration (Supp. Figs. 3 and 4). To confirm efficient PROX1-Cre-mediated recombination, we analyzed tdTomato expression in LECs in mice at least 2 weeks after tamoxifen administration to Prox1-CreERT2/TdTomato mice (Supp. Fig. 5). Next, we analyzed influenza-infected lungs for differences in histologic lymphatic phenotype, including lymphatic vessel diameter measurement and LEC enumeration as previously described. We identified no significant differences in these two parameters between Cre(+) and Cre(−) YAP/TAZ△LEC littermates, either at baseline, 7 or 16 dpi (Fig. 5A–F). Similarly, no differences in Prox1 or Flt4 mRNA were observed in whole lung homogenates obtained from either Cre(+) or Cre(−) YAP/TAZ△LEC littermates at 7 dpi (Fig. 5G).Fig. 5 There is no significant difference in lymphatic histologic scoring or lymphatic fluid drainage from the lung between Cre(−) and Cre(+) YAP/TAZ△LEC littermates at baseline or during influenza. (A) Experimental design; image created in BioRender. (B,C) VEGFR3-positive lymphatic vessels (brown, also denoted with red stars; airway, AW; blood vessel, BV) visualized via IHC in Cre(−) or Cre(+) littermates had similar diameters at baseline and during influenza at 7 or 16 dpi. For each mouse, 20 lymphatic vessel diameters were measured using 3 separate histologic sections; mean and SD are shown for n = 3 mice per condition per time point. Statistical significance by unpaired two-tailed Mann Whitney test. (D–F) PROX1-positive LEC nuclei (brown) were visualized via IHC at baseline or during influenza at 7 or 16 dpi for Cre(−) and Cre(+) littermates. For each mouse, LEC nuclei were quantified using 3 tissue sections from influenza-infected and control mice; mean and SD are shown for n = 3 mice per condition per time point. Statistical significance by unpaired two tailed t-test with Welch’s correction. (G) Prox1 and Flt4 mRNA was quantified from left lobes collected from Cre(−) or Cre(+) littermates at 7 dpi after influenza infection. Median and IQR are shown for n = 7–17 mice per group. Statistical significance by unpaired two-tailed Mann Whitney test. (H) Lung wet to dry weight ratios were obtained at 7 dpi from Cre(−) or Cre(+) littermates administered saline or PR8 IT instillations; mean and SD are shown for n = 5–16 mice per condition per timepoint. Statistical significance by unpaired two-tailed Mann Whitney test. (I–J) Fluorometric quantification of Dextran-488 in mediastinal LN 50 min (saline) or 15 min (influenza) after IT instillation into left lung lobe of Cre(−) or Cre(+) littermates. Mean and SD are shown for n = 3–10 mice per condition per timepoint. Statistical significance by unpaired two-tailed Mann Whitney test.

To determine whether there were differences in pulmonary edema in the context of Hippo deletions, we measured lung wet-to-dry weight ratios during influenza as well as control conditions, and found no difference between Cre(+) and Cre(−) YAP/TAZ△LEC littermates (Fig. 5H).

The dextran transport assay was utilized to interrogate the functionality of lymphatics for passive drainage in uninfected lungs. In these experiments, no significant difference was observed in fluorescent signal measured in the lung-draining mLNs of Cre(+) vs Cre(−) YAP/TAZ△LEC littermates at baseline or at 7dpi (Fig. 5I and J). Collectively, the targeted deletion of YAP and TAZ in LECs did not affect lymphangiogenesis or lung lymphatic drainage at baseline or during influenza pneumonia.

Infection severity and inflammatory response after deletion of YAP and TAZ in LECs

Infection severity28 and inflammatory responses9,29 are known to be affected by aberrant lymphatic function. To address this issue, we first compared survival and weight loss curves after influenza pneumonia in Cre(+) and Cre(−) YAP/TAZ△LEC littermates. No mice reached the humane endpoint in either group, and we found no differences in weight change during or after influenza infection between the two Cre genotypes (Fig. 6A). We then assessed infection severity by plaque assay and qRT-PCR for influenza nucleoprotein (NP) mRNA in murine lungs at 7 dpi and found no difference in these readouts between Cre genotypes (Fig. 6B and C). We also characterized the inflammatory response to influenza in the lung at 7 and 16 dpi in both Cre genotypes. These timepoints mark two critical phases: the lowest point of weight loss and the subsequent return to baseline weight after influenza infection. Detailed inflammation scoring and histopathologic characterization was provided by a veterinary pathologist who was blinded to genotypes. In summary, there were no apparent differences due to YAP/TAZ-deletion in morphological histopathology as assessed by the percent area of consolidation or semiquantitative pathology score (Fig. 6D and E, Supp. Tables 1 and 2).Fig. 6 There is no significant difference in infection severity between Cre(−) and Cre(+) YAP/TAZ△LEC littermates after influenza challenge. (A) Weight change for C57Bl/6 mice and Cre(−) and Cre(+) YAP/TAZ△LEC littermates after saline or influenza challenge. Mean and SEM are shown. (B) Influenza PFU recovered from left lobes of Cre(−) or Cre(+) littermates at 7 dpi after influenza challenge. Median and IQR are shown for n = 12 mice per group. Statistical significance by unpaired two-tailed Mann Whitney test. (C) Nucleoprotein (NP) mRNA was quantified from left lobes collected from Cre(−) or Cre(+) littermates at 7 dpi after influenza infection. Median and IQR are shown for n = 16–17 mice per group. Statistical significance by unpaired two-tailed Mann Whitney test. (D,E) Histopathological scoring by a blinded veterinary pathologist was performed using H&E-stained lung sections from Cre(−) or Cre(+) littermates at 7 dpi after influenza infection; representative sections are shown. Mean and SD are shown for n = 3 mice per group. Statistical significance by unpaired two-tailed Mann Whitney test.

Lastly, to evaluate differences in immune cell transit between the lung and the lung-draining mLN, we designed an 11-color flow cytometry panel to determine the immunophenotype of the lymph node at 2 and 7 dpi. Using markers for T- cells (CD4, CD8) and B-cells (CD19) as well as markers for dendritic cell subtypes (Ly6C, CD11c, CD11b and CD103), we were able to define cell populations known to be important in the developing adaptive immune response, for which a functional lymphatic vasculature is known to be crucial28,30. While we did observe predictable differences in the mLN immunophenotype between 2 and 7 dpi, we identified no differences in any of the defined immune cell populations between Cre(+) or Cre(−) YAP/TAZ△LEC littermates (Fig. 7A and B).Fig. 7 There is no significant difference in mLN immunophenotype between Cre(−) and Cre(+) YAP/TAZ△LEC littermates after influenza challenge. An 11-color flow cytometry panel was used to determine the immunophenotype of the mLN of Cre(−) or Cre(+) littermates at 2 dpi (A) and 7 dpi (B). After the exclusion of doublets and debris, dead cells were excluded using live/dead staining. Immune cells were identified using the pan-hematopoietic marker CD45 (including separate stains for intravascular vs tissue resident CD45(+) cells). The panel included markers for T-cells (CD4, CD8), B-cells (CD19) as well as dendritic cell subtypes (Ly6C, CD11b and CD103 positive and negative subsets of CD11c(+) cells). Monocytes, macrophages and granulocytes were classified generally using Ly6C, CD64, Ly6G and Siglec F. Mean and SD are shown for n = 3–5 mice per group per timepoint.

Discussion

Our studies demonstrate that the pulmonary lymphatic system expands significantly during severe influenza, via both dilation and lymphangiogenesis. This is a stark change from the quiescent state of the lymphatic plexus during homeostasis31 and is reminiscent of the rapid lymphatic growth seen in development32. Furthermore, our findings demonstrate that lymphangiogenesis occurs primarily through proliferation of existing LECs, without an apparent involvement of an exogenous precursor. Moreover, we found that following this expansion, the lymphatic vasculature displays enhanced fluid transport in the presence of significant influenza-induced pulmonary edema. It is important to note that pulmonary edema in the context of influenza is a complex multifactorial process resulting from inflammation, capillary leak and damage to microanatomic barriers. These events are initiated early in the course of infection and, importantly, prior to the onset of lymphangiogenesis. It is not surprising, therefore, to observe residual edema despite increased lymphatic flow at 7dpi. Furthermore, while increased lymphatic fluid transport could have implications for dissemination of virus in other contexts33, the PR8 model of infection is self-limited and not characterized by dissemination from the lung34.

The inflammation resulting from influenza infection may trigger responses in LECs through mechanical signals. For example, alterations in extracellular matrix (ECM) composition may modulate matrix stiffness, as has been reported in pulmonary fibrosis35. Higher fluid volume within the lymphatics can increase circumferential stretch36. As YAP/TAZ intracellular localization is sensitive to such physical changes37–39, we investigated whether the Hippo pathway plays a part in orchestrating the lymphatic response to influenza-induced inflammation.

We found that during influenza-induced lymphangiogenesis, the targeted deletion of YAP and TAZ in PROX1-expressing cells had no effect on fluid transport from the lung to the draining lymph nodes at baseline or during influenza infection. Lymphatic vessel diameter, LEC number, Prox1 and Flt4 mRNA transcription and lung wet-to-dry weight ratios at 7 dpi were also unaffected by LEC-specific YAP/TAZ deletion.

Previous work has yielded conflicting findings regarding the regulatory relationship between YAP/TAZ and PROX1. Using PROX1-driven, Cre-mediated deletion of YAP and TAZ, Cho et. al. find that YAP and TAZ activity opposes PROX1 expression during development, limiting lymphangiogenesis23. Conversely, in vitro experiments show that both YAP and TAZ knockdown and hyperactivation are associated with diminished PROX1 expression24. In our studies, the lymphatic remodeling we observed in response to influenza was not perturbed or enhanced in YAP/TAZ△LEC animals. In this regard, deleting these effectors did not significantly affect the morphological or functional characteristics measured. While Hippo signaling is involved in fundamental cellular events during both development and in tissue repair in the adult17, our results show that YAP and TAZ do not play a role in lung LECs during the lymphangiogenic response to influenza. In this respect, the role of Hippo signaling during lung lymphangiogenesis in adulthood contrasts with its apparent function during development. Overall, our work demonstrates that during inflammation-induced expansion of pre-existing lymphatic vasculature during adulthood, Hippo signaling is dispensable in LECs.

Broadly speaking, it is important to note that the precise role of an expanded lymphatic network accompanying tissue injury remains controversial and possibly organ and context-dependent9,10,12,13,27,40–43. In tracheal Mycoplasma pulmonis infection, inhibiting lymphangiogenesis promotes edema and interferes with immune cell trafficking to lymph nodes10, while in a mouse model of pulmonary fibrosis, promoting lymphangiogenesis was shown to reduce type I collagen accumulation12. Further, in a mouse model of aspiration pneumonia, inhibition of lymphatic growth improved oxygen saturation41. However, inducing lymphangiogenesis reduced inflammation, improved lymphatic drainage and increased left lung aeration in mouse lung transplant allografts27. In the skin, lymphangiogenesis facilitates tissue resilience9,42. Most notably, genetic blockade of lymphangiogenesis did not significantly affect cardiac function in a mouse model of myocardial infarction43. Whether an expanded lymphatic network facilitates tissue recovery from diffuse lung injury will require additional study. This study demonstrates that Hippo signaling is not critical for lymphatic function and expansion during influenza. The question as to whether the expanded network is required for recovery remains to be answered.

Materials and methods

Mice

C57BL/6J mice were obtained from Jackson laboratories and housed in the Boston University Animal Science Center on a 12-h light–dark cycle with access to food and water ad libitum. Prox1-Cre-ERT2 mice and TdTomato reporter mice were obtained from The Jackson Laboratory (strain #022075 and strain #007914, respectively). The YAPloxP/loxP mice and Wwtr1/TAZloxP/loxP mice used to generate the YAP/TAZ△LEC mice reported here were provided by Dr. Jeffrey Wrana (LTRI institute) (Jackson Laboratory Strain #030532). Our study examined both male and female animals with the sex of the mice randomized across experimental groups. Similar findings are reported for both sexes. At time of sacrifice, mice were ethically euthanized using isoflurane and inferior vena cava incision. All methods were carried out in accordance with relevant IACUC guidelines and regulations and are reported in accordance with ARRIVE guidelines. All animal experiments were performed in compliance with approved Boston University animal protocols PROTO201800710_TR01 and PROTO201800057_TR01.

Influenza infection

Mice aged 8–16 weeks were anesthetized via intraperitoneal injection of 75 mg/kg ketamine and 10 mg/kg xylazine and infected with 20–400 PFU of influenza A/H1N1/Puerto Rico/8/34 (PR8) virus via intratracheal instillation directed into the left lung lobe. Mice were weighed daily post-infection until time of sacrifice or until all animals had returned to their pre-infection weights. In all studies, a humane endpoint of reaching 70% of starting body weight was employed.

Tamoxifen administration

To induce Cre activity, Prox1-Cre-ERT2 mice aged 6–12 weeks were administered 100 mg/kg tamoxifen dissolved in corn oil to a concentration of 30 mg/mL via intra-peritoneal injection daily for 5 days, then rested for at least 14 days before experimental use.

EdU administration

To induce EdU labeling of proliferating cells, influenza infected or control C57BL/6J mice aged 8–12 weeks were administered 10 mg/kg EdU dissolved in sterile saline to a concentration of 2.5 mg/mL via intra-peritoneal injection daily from 4 to 6 dpi.

Tissue processing

Mice were euthanized and their lungs perfused through the left ventricle of the heart using 10 mL of ice-cold HBSS. Left lungs were fixed overnight at 4 °C in 4% paraformaldehyde, then washed in PBS (pH 7.4), dehydrated and embedded in paraffin. Paraffin embedded lungs were cut into 5 µm sections using a microtome and dried overnight at 42 °C. Comparable anterior/posterior sections of the left lung containing a range of proximal and distal airways were obtained from each mouse throughout the study.

Immunostaining and microscopy

Paraffin-embedded tissue sections were deparaffinized in xylene and then rehydrated. Antigen- retrieval was performed by heating with citrate-based antigen-unmasking solution (Vector). For experiments using HRP detection, endogenous peroxidase was quenched using 3% hydrogen peroxide in methanol. Non-specific antigen binding was blocked using donkey serum. Sections were incubated with primary antibodies at the dilutions shown below before application of secondary antibodies. Samples containing EdU were also counter stained per protocol using the Click-IT™ EdU Cell Proliferation Kit (Invitrogen #C10339). For HRP detection, Vectastain ABC and DAB kits were used. Sections were counterstained using hematoxylin, dehydrated and cover slipped. Samples using immunofluorescent antibodies were counter-stained with DAPI before analysis.

For PROX1 nuclei counting, non-serial murine lung tissue sections approximately 350 µm apart were stained as described above. Nuclei were visualized via light microscopy using a Nikon Eclipse E200 microscope or Leica DM4 B microscope with a Leica DFC7000 T camera. Immunofluorescent samples were imaged using a Leica DM4 B microscope with a Leica DFC7000 T camera. Whole lungs from Prox1-Cre-ERT2/TdTomato mice were imaged using a Zeiss STEMI 508 DOC Stereo Microscope with a NIGHTSEA green fluorescence light source and an AXIOCAM 208 8MP HD/4K camera. We would also like to acknowledge S10OD030269 instrumentation for supporting the microscopic analysis. See Table 1 for list of antibodies and dilutions.Table 1 List of antibodies used for histologic staining.

Antibody	Application	Source	Catalog #	Dilution	
Rabbit ⍺-PROX1 (EPR19273)	Immunostaining	Abcam	ab199359	1:500 for immunostaining	
Goat ⍺-VEGFR3	Immunostaining	R&D Systems	AF743	1:500	
Rabbit ⍺-TAZ (E8E9G)	Immunostaining	Cell Signaling Technologies	83669	1:100	
Rabbit ⍺-YAP (D8H1X, XP)	Immunostaining	Cell Signaling Technologies	14074	1:100	
Goat ⍺-PROX1	Immunostaining	R&D Systems	AF2727	1:300 in conjunction with YAP/TAZ staining	

Histopathology scoring and quantitative image analysis

Digitalized whole slide images (WSI) of brightfield H&E were generated using PhenoImager HT 2.0 Automated Quantitative Pathology Image System (Akoya Biosciences, Marlborough, Massachusetts, USA). H&E-stained slides were scanned at a 200× magnification using a bright field scan profile. Quantification of the pulmonary inflammatory lesions were achieved by using the HALO image analysis software v3.5 (Indica labs). Each image was first annotated by a veterinary pathologist to define the regions of interest for image analysis. Total examined pulmonary parenchyma with associated airways of three replicate sections were included in the region of interest. All processing artifacts (i.e. tissue folds and dust) were also manually removed via exclusion annotations. Using the random forest V2 algorithm provided with HALO image analysis software, two classes were defined: normal and pulmonary consolidation. The full spectrum of histopathological changes was included in the algorithm, which included lymphoplasmacytic and histiocytic interstitial pneumonia and type 2 pneumocyte hyperplasia and dysplasia. The exact same classifier algorithm was applied to all images in this study to yield the pulmonary consolidation quantification results. The pathologist reviewed all the slides in a blinded fashion and developed ordinal histopathology criteria for scoring (Supplemental Tables 1 and 2).Table 2 List of antibodies used for flow cytometry.

Cell types	Target	Fluorophore	Concentration/dilution	Source and catalog #	
Live/dead	7-AAD	7-AAD	1:60	BD Biosci. 51-68981e	
Leukocytes	CD45 (clone 30-F11)	Per-CP 5.5	0.2 mg/mL	Biolegend 103131	
CD45.2 (IV) (clone 104)	BUV737	0.2 mg/mL	BD Biosci. 612778	
T cells	CD4	APC-Cy7	0.2 mg/mL	Biolegend 100413	
CD8a	BV510	0.05 mg/mL	Biolegend 100751	
B cells	CD19	BUV395	0.2 mg/mL	BD Biosci. 563557	
Dendritic cells	CD11b	PE	0.2 mg/mL	Biolegend 101207	
CD11c	APC	0.2 mg/mL	Invitrogen 17-0114-81	
CD103 (clone 2E7)	PE-Cy7	0.2 mg/mL	Biolegend 121425	
Ly6c	Efluor450	0.2 mg/mL	Invitrogen 48-5932-80/2	
Dump gate	CD64	FITC	0.5 mg/mL	Biolegend 161007	
Ly6g	FITC	0.5 mg/mL	Biolegend 127606	
Siglec F	FITC	0.5 mg/mL	Biolegend 155503	

For quantitative image analysis of YAP and TAZ immunofluorescent staining in LECs in lung histologic sections, PROX1 staining was used to localize the cells of interest and median fluorescence intensity (MFI) of either YAP or TAZ staining was quantified using CellProfilerR. Data were obtained by imaging all LECs on at least 3 separate non-serial histologic lung sections per mouse.

Flow cytometry

Mice were anesthetized via intraperitoneal injection of 75 mg/kg ketamine and 10 mg/kg xylazine and injected retro-orbitally with 2 ug of IV CD45.2 antibody. This was allowed to circulate for 3 min prior to sacrifice. Mediastinal lymph nodes (mLNs) were collected from influenza infected mice as well as controls and placed in 1 mL of cold PBS. LN tissue was passed through a 100 um strainer in a petri dish by crushing with a rubber syringe plunger and the strainer was washed with 3 mL cold FACS buffer. The single cell suspension was placed in 15 mL FACS tubes and centrifuged at 300×g at 4 °C for 5 min, and the cell pellet was resuspended in 2 mL FACS buffer. Cell number was enumerated using a hemocytometer. Cell suspensions were diluted to 1 × 106 cells/mL and 1 mL of cell suspension (1 × 106 cells) placed in new FACS tubes. Cell solutions were blocked with anti-CD16/32 (FcBlock, eBioscience) at a dilution of 1 ug per 1 × 106 cells. Fluorochrome-conjugated monoclonal antibody staining was performed using the antibodies and dilutions noted in the table for 30 min on ice in the dark. Excess antibody was removed by washing with 1 mL FACS buffer and centrifugation at 300×g at 4 °C for 5 min. The cell pellet was resuspended in 300 μL FACS buffer. Cells were stained with 7-AAD Viability Staining Solution (BD Biosci.). Unstained cells, single-stained OneComp eBeads (eBioscience), and fluorescence-minus-one (FMO) controls were used for each analysis. Data were acquired on a BD LSR II flow cytometer (BD Biosciences) using BD FACSDiva software. FlowJoR 10 was utilized for data analysis. See Table 2 for list of antibodies and dilutions.

qRT-PCR

RNA isolation from mouse whole lung homogenates was performed using the Direct-zol RNA Microprep kit (Zymo Research) according to the manufacturer’s instructions. qRT-PCR was performed using the Taqman and QuantStudio 3 (Applied Biosystems) systems according to the manufacturer’s instructions. See Table 3 for list of primers and probes.Table 3 List of primers and probes used for PCR and qRT-PCR.

Target	Primer/probe	Source and catalog #	
Prox1	Mm00435969_m1	TaqManR 4331182	
Flt4	Mm01292604_m1	TaqManR 4331182	
Yap1	Mm00494240_m1	TaqManR 4331182	
F: AATCGAGAAACCGCTGGGG (sense)	IDT DNA (custom)	
R: GGAGGCCAAACCTGACAACTA (antisense)	IDT DNA (custom)	
Taz	Mm00504978_m1	TaqManR 4331182	
F: GACATTCCAATCCTCCCACTAC (sense)	IDT DNA (custom)	
R: GGTCCAGCCCATAACTACTTTAC (antisense)	IDT DNA (custom)	
Influenza Nucleoprotein (NP)	PR8seg5-F: 5′-CGT TCT CCATCAGTCTCCATC-3′	IDT DNA (custom)	
PR8seg5-R: 5′-GAGTGACATCAAAATCATGGCG-3′	
Probe: 5′-AGGCACCAAACGGTCTTACGAACA-3′	

Viral plaque assay

Left lung lobes from influenza infected mice were minced using a sterile razor blade in a petri dish, transferred to a bullet blender tube in 2 mL of viral growth media (as below), and homogenized. Cell debris was pelleted by centrifugation at 5000×g at 4 °C for 5 min, and supernatant was collected and used to infect MDCK cells. Plaques were enumerated after 3 days44.

Viral growth media (500 mL):475 mL of DMEM (ThermoFisher ref 11995-065).

5 mL Pen/Strep 100x (ThermoFisher 15140122).

12.5 mL of 1 M HEPES (Sigma-Aldrich H0887).

5 mL Glutamax 100x (ThermoFisher 35050061).

3 mL of 35% BSA stock (Sigma-Aldrich A7409) OR 3.3 ml of 30% BSA.

Lung wet to dry weight ratio

Left lung lobes were collected from influenza infected and uninfected mice. Lungs were weighed immediately after collection to obtain the wet weight, then desiccated for 48 h at 65 °C and weighed again to obtain the dry weight45.

Dextran transport assay

Mice were anesthetized via intraperitoneal injection of 75 mg/kg ketamine and 10 mg/kg xylazine before injection intratracheally into the left lung lobe with 10 μL of 10 mg/mL of 10 kDa Dextran-488 (Invitrogen #D22910) dissolved in sterile normal saline (NS), or equivalent volume of NS (vehicle-only) for control mice46. Mice were allowed to recover for 15 or 50 min prior to sacrifice. Mediastinal LNs and inguinal LNs were collected from each mouse and placed in 280 μL of protein extraction buffer (EB; Tris pH 7.4 25 mM, NaCl 50 mM, 0.5% Na deoxycholate, 2% NP-40, and 0.2% SDS dissolved in ddH2O) with proteinase inhibitor (Roche #11836153001, final 1× concentration). LN tissue was passed through a 70 μm strainer in a petri dish by crushing with a rubber syringe plunger and the strainer was washed with 200μL cold EB. Cell debris was pelleted by centrifugation at 15,000×g at 4 °C for 20 min, and supernatant was collected. Fluorometric quantification was performed using an Agilent BioTek Synergy LX Multi-Mode fluorescence plate reader. Fluorometric values for mLNs were obtained by subtracting background fluorescence as measured in inguinal LNs.

Statistical analysis

Statistical significance was determined using a two-tailed Student’s t-test in the case of data shown to be parametric via the Shapiro–Wilk test. Welches’ correction was used to account for differences in variance. If the data was non-parametric, a Mann–Whitney U test was used. A p-value of 0.05 was used as the threshold for statistical significance.

Supplementary Information

Supplementary Information.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-72115-6.

Acknowledgements

We would like to acknowledge our funding sources: American Heart Association Predoctoral Fellowship Award Number 831211 American Heart Association Postdoctoral Fellowship Award Number 23POST1022559 National Institutes of Health, NHLBI R01 Project Number 5R01HL136725-03

Author contributions

EC, SC—designed research studies, conducted experiments, acquired and analyzed data, and wrote manuscript*. FS—assisted with conducting experiments. JHV, ATL—assisted with conducting experiments and provided reagents. ABY, MZ, AH—assisted with conducting experiments. ML—acquired and analyzed data. XV—designed research studies, edited manuscript. MRJ, AF—designed research studies, edited manuscript. *Order of co-first authorship was determined based on EC conducting most of the experiments and SC writing most of the manuscript.

Data availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Erin Crossey and Senegal Carty.

These authors jointly supervised this work: Matthew R. Jones and Alan Fine.
==== Refs
References

1. Stump B Lymphatic changes in respiratory diseases: More than just remodeling of the lung? Am. J. Respir. Cell Mol. Biol. 2017 57 272 279 10.1165/rcmb.2016-0290TR 28443685
Stump, B. et al. Lymphatic changes in respiratory diseases: More than just remodeling of the lung?. Am. J. Respir. Cell Mol. Biol. 57, 272–279 (2017).28443685 10.1165/rcmb.2016-0290TR
2. Wigle JT An essential role for Prox1 in the induction of the lymphatic endothelial cell phenotype EMBO J. 2002 21 1505 1513 10.1093/emboj/21.7.1505 11927535
Wigle, J. T. et al. An essential role for Prox1 in the induction of the lymphatic endothelial cell phenotype. EMBO J. 21, 1505–1513 (2002).11927535 10.1093/emboj/21.7.1505
3. Kaipainen A Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development Proc. Natl. Acad. Sci. 1995 92 3566 3570 10.1073/pnas.92.8.3566 7724599
Kaipainen, A. et al. Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development. Proc. Natl. Acad. Sci. 92, 3566–3570 (1995).7724599 10.1073/pnas.92.8.3566
4. Wigle JT Oliver G Prox1 function is required for the development of the murine lymphatic system Cell 1999 98 769 778 10.1016/S0092-8674(00)81511-1 10499794
Wigle, J. T. & Oliver, G. Prox1 function is required for the development of the murine lymphatic system. Cell 98, 769–778 (1999).10499794 10.1016/S0092-8674(00)81511-1
5. Jussila L Lymphatic endothelium and Kaposi’s sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor receptor-31 Cancer Res. 1998 58 1599 1604 9563467
Jussila, L. et al. Lymphatic endothelium and Kaposi’s sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor receptor-31. Cancer Res. 58, 1599–1604 (1998).9563467
6. Mehrara BJ The emerging importance of lymphatics in health and disease: An NIH workshop report J. Clin. Investig. 2023 10.1172/JCI171582 37655664
Mehrara, B. J. et al. The emerging importance of lymphatics in health and disease: An NIH workshop report. J. Clin. Investig.10.1172/JCI171582 (2023).37655664 10.1172/JCI171582
7. Steele MM Lund AW Afferent lymphatic transport and peripheral tissue immunity J. Immunol. 2021 206 264 272 10.4049/jimmunol.2001060 33397740
Steele, M. M. & Lund, A. W. Afferent lymphatic transport and peripheral tissue immunity. J. Immunol. 206, 264–272 (2021).33397740 10.4049/jimmunol.2001060
8. Amezcua Vesely MC Effector TH17 cells give rise to long-Lived TRM cells that are essential for an immediate response against bacterial infection Cell 2019 178 1176 1188.e15 10.1016/j.cell.2019.07.032 31442406
Amezcua Vesely, M. C. et al. Effector TH17 cells give rise to long-Lived TRM cells that are essential for an immediate response against bacterial infection. Cell 178, 1176-1188.e15 (2019).31442406 10.1016/j.cell.2019.07.032
9. Schwager S Detmar M Inflammation and lymphatic function Front. Immunol. 2019 10 308 10.3389/fimmu.2019.00308 30863410
Schwager, S. & Detmar, M. Inflammation and lymphatic function. Front. Immunol. 10, 308 (2019).30863410 10.3389/fimmu.2019.00308
10. Baluk P Pathogenesis of persistent lymphatic vessel hyperplasia in chronic airway inflammation J. Clin. Investig. 2005 115 247 257 10.1172/JCI200522037 15668734
Baluk, P. et al. Pathogenesis of persistent lymphatic vessel hyperplasia in chronic airway inflammation. J. Clin. Investig. 115, 247–257 (2005).15668734 10.1172/JCI200522037
11. Harding J Lymphangiogenesis is induced by mycobacterial granulomas via vascular endothelial growth factor receptor-3 and supports systemic T-cell responses against mycobacterial antigen Am. J. Pathol. 2015 185 432 445 10.1016/j.ajpath.2014.09.020 25597700
Harding, J. et al. Lymphangiogenesis is induced by mycobacterial granulomas via vascular endothelial growth factor receptor-3 and supports systemic T-cell responses against mycobacterial antigen. Am. J. Pathol. 185, 432–445 (2015).25597700 10.1016/j.ajpath.2014.09.020
12. Baluk P Lymphatic proliferation ameliorates pulmonary fibrosis after lung injury Am. J. Pathol. 2020 190 2355 2375 10.1016/j.ajpath.2020.08.018 33039355
Baluk, P. et al. Lymphatic proliferation ameliorates pulmonary fibrosis after lung injury. Am. J. Pathol. 190, 2355–2375 (2020).33039355 10.1016/j.ajpath.2020.08.018
13. El-Chemaly S Abnormal lymphangiogenesis in idiopathic pulmonary fibrosis with insights into cellular and molecular mechanisms Proc. Natl. Acad. Sci. USA 2009 106 3958 3963 10.1073/pnas.0813368106 19237567
El-Chemaly, S. et al. Abnormal lymphangiogenesis in idiopathic pulmonary fibrosis with insights into cellular and molecular mechanisms. Proc. Natl. Acad. Sci. USA 106, 3958–3963 (2009).19237567 10.1073/pnas.0813368106
14. Krammer F Influenza Nat. Rev. Dis. Primers 2018 4 3 10.1038/s41572-018-0002-y 29955068
Krammer, F. et al. Influenza. Nat. Rev. Dis. Primers 4, 3 (2018).29955068 10.1038/s41572-018-0002-y
15. Lafond KE Global burden of influenza-associated lower respiratory tract infections and hospitalizations among adults: A systematic review and meta-analysis PLoS Med. 2021 18 e1003550 10.1371/journal.pmed.1003550 33647033
Lafond, K. E. et al. Global burden of influenza-associated lower respiratory tract infections and hospitalizations among adults: A systematic review and meta-analysis. PLoS Med. 18, e1003550 (2021).33647033 10.1371/journal.pmed.1003550
16. Iuliano AD Estimates of global seasonal influenza-associated respiratory mortality: A modelling study Lancet 2018 391 1285 1300 10.1016/S0140-6736(17)33293-2 29248255
Iuliano, A. D. et al. Estimates of global seasonal influenza-associated respiratory mortality: A modelling study. Lancet 391, 1285–1300 (2018).29248255 10.1016/S0140-6736(17)33293-2
17. Zheng Y Pan D The hippo signaling pathway in development and disease Dev. Cell 2019 50 264 282 10.1016/j.devcel.2019.06.003 31386861
Zheng, Y. & Pan, D. The hippo signaling pathway in development and disease. Dev. Cell 50, 264–282 (2019).31386861 10.1016/j.devcel.2019.06.003
18. Boopathy GTK Hong W Role of hippo pathway-YAP/TAZ signaling in angiogenesis Front. Cell Dev. Biol. 2019 7 49 10.3389/fcell.2019.00049 31024911
Boopathy, G. T. K. & Hong, W. Role of hippo pathway-YAP/TAZ signaling in angiogenesis. Front. Cell Dev. Biol. 7, 49 (2019).31024911 10.3389/fcell.2019.00049
19. Varelas X The Hippo pathway effectors TAZ and YAP in development, homeostasis and disease Development 2014 141 1614 1626 10.1242/dev.102376 24715453
Varelas, X. The Hippo pathway effectors TAZ and YAP in development, homeostasis and disease. Development 141, 1614–1626 (2014).24715453 10.1242/dev.102376
20. Wang K-C Flow-dependent YAP/TAZ activities regulate endothelial phenotypes and atherosclerosis Proc. Natl. Acad. Sci. USA 2016 113 11525 11530 10.1073/pnas.1613121113 27671657
Wang, K.-C. et al. Flow-dependent YAP/TAZ activities regulate endothelial phenotypes and atherosclerosis. Proc. Natl. Acad. Sci. USA 113, 11525–11530 (2016).27671657 10.1073/pnas.1613121113
21. Neto F YAP and TAZ regulate adherens junction dynamics and endothelial cell distribution during vascular development eLife 2018 7 e31037 10.7554/eLife.31037 29400648
Neto, F. et al. YAP and TAZ regulate adherens junction dynamics and endothelial cell distribution during vascular development. eLife 7, e31037 (2018).29400648 10.7554/eLife.31037
22. Meng Z Moroishi T Guan K-L Mechanisms of Hippo pathway regulation Genes Dev. 2016 30 1 17 10.1101/gad.274027.115 26728553
Meng, Z., Moroishi, T. & Guan, K.-L. Mechanisms of Hippo pathway regulation. Genes Dev. 30, 1–17 (2016).26728553 10.1101/gad.274027.115
23. Cho H YAP and TAZ negatively regulate Prox1 during developmental and pathologic lymphangiogenesis Circ. Res. 2019 124 225 242 10.1161/CIRCRESAHA.118.313707 30582452
Cho, H. et al. YAP and TAZ negatively regulate Prox1 during developmental and pathologic lymphangiogenesis. Circ. Res. 124, 225–242 (2019).30582452 10.1161/CIRCRESAHA.118.313707
24. Cha B YAP and TAZ maintain PROX1 expression in the developing lymphatic and lymphovenous valves in response to VEGF-C signaling Development 2020 10.1242/dev.195453 33060128
Cha, B. et al. YAP and TAZ maintain PROX1 expression in the developing lymphatic and lymphovenous valves in response to VEGF-C signaling. Development10.1242/dev.195453 (2020).33060128 10.1242/dev.195453
25. Kim J YAP/TAZ regulates sprouting angiogenesis and vascular barrier maturation J. Clin. Investig. 2017 127 3441 3461 10.1172/JCI93825 28805663
Kim, J. et al. YAP/TAZ regulates sprouting angiogenesis and vascular barrier maturation. J. Clin. Investig. 127, 3441–3461 (2017).28805663 10.1172/JCI93825
26. Wang X YAP/TAZ orchestrate VEGF signaling during developmental angiogenesis Dev. Cell 2017 42 462 478.e7 10.1016/j.devcel.2017.08.002 28867486
Wang, X. et al. YAP/TAZ orchestrate VEGF signaling during developmental angiogenesis. Dev. Cell 42, 462-478.e7 (2017).28867486 10.1016/j.devcel.2017.08.002
27. Azad T A LATS biosensor screen identifies VEGFR as a regulator of the Hippo pathway in angiogenesis Nat. Commun. 2018 9 1061 10.1038/s41467-018-03278-w 29535383
Azad, T. et al. A LATS biosensor screen identifies VEGFR as a regulator of the Hippo pathway in angiogenesis. Nat. Commun. 9, 1061 (2018).29535383 10.1038/s41467-018-03278-w
28. Loo CP Lymphatic vessels balance viral dissemination and immune activation following cutaneous viral infection Cell Rep. 2017 20 3176 3187 10.1016/j.celrep.2017.09.006 28954233
Loo, C. P. et al. Lymphatic vessels balance viral dissemination and immune activation following cutaneous viral infection. Cell Rep. 20, 3176–3187 (2017).28954233 10.1016/j.celrep.2017.09.006
29. Wang W Lymphatic endothelial transcription factor Tbx1 promotes an immunosuppressive microenvironment to facilitate post-myocardial infarction repair Immunity 2023 56 2342 2357.e10 10.1016/j.immuni.2023.07.019 37625409
Wang, W. et al. Lymphatic endothelial transcription factor Tbx1 promotes an immunosuppressive microenvironment to facilitate post-myocardial infarction repair. Immunity 56, 2342-2357.e10 (2023).37625409 10.1016/j.immuni.2023.07.019
30. Grant SM The lymph node at a glance—How spatial organization optimizes the immune response J. Cell Sci. 2020 10.1242/jcs.241828 32393600
Grant, S. M. et al. The lymph node at a glance—How spatial organization optimizes the immune response. J. Cell Sci.10.1242/jcs.241828 (2020).32393600 10.1242/jcs.241828
31. Connor AL Kelley PM Tempero RM Invariant asymmetry renews the lymphatic vasculature during homeostasis J. Transl. Med. 2016 14 209 10.1186/s12967-016-0964-z 27400749
Connor, A. L., Kelley, P. M. & Tempero, R. M. Invariant asymmetry renews the lymphatic vasculature during homeostasis. J. Transl. Med. 14, 209 (2016).27400749 10.1186/s12967-016-0964-z
32. Alitalo K Tammela T Petrova TV Lymphangiogenesis in development and human disease Nature 2005 438 946 953 10.1038/nature04480 16355212
Alitalo, K., Tammela, T. & Petrova, T. V. Lymphangiogenesis in development and human disease. Nature 438, 946–953 (2005).16355212 10.1038/nature04480
33. Churchill M Infection-induced lymphatic zippering restricts fluid transport and viral dissemination from skin J. Exp. Med. 2022 10.1084/jem.20211830 35510953
Churchill, M. et al. Infection-induced lymphatic zippering restricts fluid transport and viral dissemination from skin. J. Exp. Med.10.1084/jem.20211830 (2022).35510953 10.1084/jem.20211830
34. Tran V Highly sensitive real-time in vivo imaging of an influenza reporter virus reveals dynamics of replication and spread J. Virol. 2013 87 13321 13329 10.1128/JVI.02381-13 24089552
Tran, V. et al. Highly sensitive real-time in vivo imaging of an influenza reporter virus reveals dynamics of replication and spread. J. Virol. 87, 13321–13329 (2013).24089552 10.1128/JVI.02381-13
35. Liu F Feedback amplification of fibrosis through matrix stiffening and COX-2 suppression J. Cell Biol. 2010 190 693 706 10.1083/jcb.201004082 20733059
Liu, F. et al. Feedback amplification of fibrosis through matrix stiffening and COX-2 suppression. J. Cell Biol. 190, 693–706 (2010).20733059 10.1083/jcb.201004082
36. Zawieja DC Contractile physiology of lymphatics Lymphatic Res. Biol. 2009 7 87 96 10.1089/lrb.2009.0007
Zawieja, D. C. Contractile physiology of lymphatics. Lymphatic Res. Biol. 7, 87–96 (2009).10.1089/lrb.2009.0007
37. Alderfer L Matrix stiffness primes lymphatic tube formation directed by vascular endothelial growth factor-C FASEB J. 2021 35 e21498 10.1096/fj.202002426RR 33774872
Alderfer, L. et al. Matrix stiffness primes lymphatic tube formation directed by vascular endothelial growth factor-C. FASEB J. 35, e21498 (2021).33774872 10.1096/fj.202002426RR
38. Aragona M A Mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors Cell 2013 154 1047 1059 10.1016/j.cell.2013.07.042 23954413
Aragona, M. et al. A Mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154, 1047–1059 (2013).23954413 10.1016/j.cell.2013.07.042
39. Dupont S Role of YAP/TAZ in mechanotransduction Nature 2011 474 179 183 10.1038/nature10137 21654799
Dupont, S. et al. Role of YAP/TAZ in mechanotransduction. Nature 474, 179–183 (2011).21654799 10.1038/nature10137
40. Krebs R Critical role of VEGF-C/VEGFR-3 signaling in innate and adaptive immune responses in experimental obliterative bronchiolitis Am. J. Pathol. 2012 181 1607 1620 10.1016/j.ajpath.2012.07.021 22959907
Krebs, R. et al. Critical role of VEGF-C/VEGFR-3 signaling in innate and adaptive immune responses in experimental obliterative bronchiolitis. Am. J. Pathol. 181, 1607–1620 (2012).22959907 10.1016/j.ajpath.2012.07.021
41. Nihei M Chronic inflammation, lymphangiogenesis, and effect of an anti-VEGFR therapy in a mouse model and in human patients with aspiration pneumonia J. Pathol. 2015 235 632 645 10.1002/path.4473 25348279
Nihei, M. et al. Chronic inflammation, lymphangiogenesis, and effect of an anti-VEGFR therapy in a mouse model and in human patients with aspiration pneumonia. J. Pathol. 235, 632–645 (2015).25348279 10.1002/path.4473
42. Weinkopff T Leishmania major infection-induced VEGF-A/VEGFR-2 signaling promotes lymphangiogenesis that controls disease J. Immunol. 2016 197 1823 1831 10.4049/jimmunol.1600717 27474074
Weinkopff, T. et al. Leishmania major infection-induced VEGF-A/VEGFR-2 signaling promotes lymphangiogenesis that controls disease. J. Immunol. 197, 1823–1831 (2016).27474074 10.4049/jimmunol.1600717
43. Keller TCS 4th Genetic blockade of lymphangiogenesis does not impair cardiac function after myocardial infarction J. Clin. Investig. 2021 10.1172/JCI147070 34491912
Keller, T. C. S. 4th. et al. Genetic blockade of lymphangiogenesis does not impair cardiac function after myocardial infarction. J. Clin. Investig.10.1172/JCI147070 (2021).34491912 10.1172/JCI147070
44. Kim M Inhibition of influenza virus internalization by (−)-epigallocatechin-3-gallate Antiviral Res. 2013 100 460 472 10.1016/j.antiviral.2013.08.002 23954192
Kim, M. et al. Inhibition of influenza virus internalization by (−)-epigallocatechin-3-gallate. Antiviral Res. 100, 460–472 (2013).23954192 10.1016/j.antiviral.2013.08.002
45. Quinton LJ Alveolar epithelial STAT3, IL-6 family cytokines, and host defense during Escherichia coli pneumonia Am. J. Respir. Cell Mol. Biol. 2008 38 699 706 10.1165/rcmb.2007-0365OC 18192501
Quinton, L. J. et al. Alveolar epithelial STAT3, IL-6 family cytokines, and host defense during Escherichia coli pneumonia. Am. J. Respir. Cell Mol. Biol. 38, 699–706 (2008).18192501 10.1165/rcmb.2007-0365OC
46. Cui Y Therapeutic lymphangiogenesis ameliorates established acute lung allograft rejection J. Clin. Investig. 2015 125 4255 4268 10.1172/JCI79693 26485284
Cui, Y. et al. Therapeutic lymphangiogenesis ameliorates established acute lung allograft rejection. J. Clin. Investig. 125, 4255–4268 (2015).26485284 10.1172/JCI79693
