
==== Front
BMC Cardiovasc Disord
BMC Cardiovasc Disord
BMC Cardiovascular Disorders
1471-2261
BioMed Central London

39261809
4160
10.1186/s12872-024-04160-y
Research
Polymorphisms of CD247 gene is associated with dilated cardiomyopathy in Chinese Han population
Li Chunmei 1
Xie XiaoChuan 1
Li Kun 2
Rao Li 250903162@qq.com

1
1 https://ror.org/007mrxy13 grid.412901.f 0000 0004 1770 1022 Department of Cardiology, West China Hospital of Sichuan University, 37 Guo Xue Xiang, Chengdu, 610041 China
2 https://ror.org/007mrxy13 grid.412901.f 0000 0004 1770 1022 Department of Anesthesiology, West China Hospital of Sichuan University, Chengdu, 610041 China
12 9 2024
12 9 2024
2024
24 4877 5 2024
3 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Dilated cardiomyopathy (DCM) is a major cause of heart failure and heart transplantation. Recently, some studies have reported that the autoimmune response in myocardial cells might be related to the pathogenesis of DCM. The CD247 gene has been previously found to be involved in autoimmune disease. Therefore, our study aimed to clarify the hypothesis that there is a certain linkage between polymorphisms of the CD247 gene and the triggering of DCM risk.

Methods

In the present study, two single nucleotide polymorphisms (SNPs) of the CD247 gene, rs12141731 and rs858543, were genotyped by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) in 355 DCM patients and 404 age- and sex-matched controls.

Results

Pearson’s chi-squared test for the CD247 gene revealed that SNP rs858543 (p = 0.001, OR = 0.72, 95% CI = (0.588–0.882), but not SNP rs12141731, was associated with DCM in the Chinese Han population. Haplotype analysis revealed that the CC haplotype was associated with increased DCM susceptibility, while CT was a protective haplotype. Cox multivariate survival analysis indicated that the rs858543 TT genotype (HR: 0.608, 95% CI = 0.402–0.921, p = 0.019) was an independent multivariate predictor for longer overall survival in DCM patients. CD247 mRNA expression levels were significantly decreased in DCM patients (p = 0.02).

Conclusions

Our study suggested that a polymorphism in the CD247 gene may be a risk factor for DCM in the Chinese Han population.

Trial registration

ChiCTR2000029701.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12872-024-04160-y.

Keywords

CD247
Genetic polymorphisms
Dilated cardiomyopathy
the Key Research and Development Projects of Sichuan Province2020YFS0245 2020YFS0245 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Dilated cardiomyopathy (DCM) is characterized by the enlargement of one or both ventricles and systolic dysfunction with reduced ejection fraction [1, 2]. In the late stages of DCM, the major clinical manifestations include progressive congestive heart failure, arrhythmias, thromboembolism, and sudden death [3, 4]. The morbidity and mortality of DCM are very high [5]. The main goal of treatment measures, which include beta-blockers, ACE inhibitors, angiotensin-II receptor antagonists, diuretics, aldosterone antagonists, digitalis and resynchronization therapy, is to alleviate symptoms and myocardial damage in DCM patients. Many patients may eventually need to undergo heart transplantation to sustain life [3]. Therefore, the study of etiologies is very important for the diagnosis and treatment of DCM. However, the etiology of DCM, despite years of study, remains unclear [6]. Previous researchers have reported that genetic factors, uncontrolled apoptosis, toxicity and metabolism may play important roles in the pathogenesis of DCM [5, 7]. Recently, several studies have shown that immune abnormalities are becoming more obvious in the triggers of DCM by the following points [5, 7–11]. First, previous studies have shown that some pathologically related cardiac-specific autoantibodies, such as cardiac troponin I, the β1-adrenoceptor and α-myosin, are related to DCM [12–14]. Second, myocarditis caused by viral infection may be linked to DCM, and 67% of DCM have been related to viral genomes in large samples of endomyocardial biopsy [15]. Third, more than 150 individuals with DCM who underwent EMB had interstitial and endothelial immune activation [8]. Furthermore, infiltration of CD4 + and CD8 + T cells has also been detected in patients with DCM by endomyocardial biopsy. In addition, DCM mice exhibit myocardial fibrosis and an increase in the left ventricular end-diastolic dimension via the transfer of lymphocytes [8–10]. This evidence strengthens the view that immune abnormalities may play an important role in the pathogenesis of DCM.

Currently, related studies have reported that the CD247 gene is involved in many autoimmune-related disorders, such as systemic lupus erythematous (SLE) [16], rheumatoid arthritis [17], and immunodeficiency virus infection [18], via the CD4 + T-cell-mediated immune pathway. Previous researchers have shown that CD4 + T cells are significantly increased in DCM patients during inflammation, and the proportion of CD4 + T cells is obviously linked to systolic dysfunction and increased end-diastolic volume, which is similar to the changes in DCM patient hearts [10, 19–21]. A previous study also showed that the CD247 gene may be involved in cardiovascular disease, such as hypertension, by altering T lymphocyte infiltration [22]. In addition, the CD247 gene encodes CD3ζ protein. Research suggests that genetic variation in the CD247 gene is closely related to the regulation of disease cell apoptosis, which may regulate the cellular inflammatory response and apoptosis through the expression of the ZAP-70 protein and/or related cytokines and may participate in the occurrence and development of diseases [23]. Therefore, we speculate that the CD247 gene is related to the regulation of cell apoptosis and that its encoded protein may regulate cell proliferation, differentiation, apoptosis, oxidative stress, inflammation, etc., through ZAP-70 and downstream MAPK and/or PI3K/Akt pathways, participating in the occurrence and development of DCM.

Furthermore, it has been reported that SNPs rs12141731 and rs858543 in the CD247 gene are significantly linked to SLE [24, 25]. These results indicate that CD247 gene polymorphisms may be genetic factors that affect susceptibility to some cardiovascular diseases, such as DCM, caused by CD4 + T-cell-mediated abnormalities in immune pathways.

Based on the above findings, we hypothesized that there is a certain linkage between polymorphisms of the CD247 gene and DCM risk. To test this hypothesis, we investigated two single nucleotide polymorphisms (SNPs) (rs12141731 and rs858543) that were identified as SNPs in the International HapMap project (http://hapmap.ncbi.nlm.nih.gov/) in the CD247 gene in patients with DCM by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques. We also discuss the associations of established clinical prognostic factors with survival in DCM patients in the present study.

Subjects and methods

Subjects

This study included 355 unrelated DCM patients from the West China Hospital of Sichuan University between 2006 and 2022. The clinical diagnosis of DCM was determined by using the revised criteria established by the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the Classification of Cardiomyopathy (DCM group) [26] from 2003 to 2007; the clinical diagnosis of DCM was determined by using the 2006 American Heart Association (AHA) criteria after 2007 [27]. Patients with hypertension, tachyarrhythmia, coronary heart disease, valvular heart disease, acute viral myocarditis, heavy alcohol intake, Emery–Dreifuss muscular dystrophy, skeletal myopathies, Parkinson’s disease, Alzheimer’s disease, or systemic diseases of putative autoimmune origin were intentionally excluded. The control group also included four hundred and four healthy unrelated individuals according to a routine health survey. This study used PASS15.0 software to evaluate the expected sample size and calculated the expected sample size to be 312 patients based on the expected population standard deviation (σ = 0.9) and allowable error (δ = 0.1). The case group (n = 355) and control group (n = 404) included in this study met the expected sample size requirements.

All subjects were Han individuals who lived in the Sichuan Province of southwestern China. The study was supported by the hospital Ethics Committee. Written informed consent was obtained from all participants. The trial has been registered on the Chinese Clinical Trial Registry. (Clinical Trial Number: ChiCTR2000029701)

Patient follow-up

A total of 175 patients who left a telephone number were scheduled for follow-up every three months. The clinical follow-up was performed in a blinded manner without respect to the patient’s genetic status. The end point during follow-up was cardiac death, which included death due to sudden cardiac or death pump failure. Conventional echocardiography was conducted in all patients using Philips Sonos7500 and iE33 echocardiography systems (Philips Medical Systems, Bothell, WA, USA). The LVEF (left ventricular ejection fraction) was measured using the biplane Simpson method using images acquired in the apical four-chamber and apical two-chamber views. Serum brain natriuretic peptide (BNP) levels were measured by enzyme-linked immunosorbent assay (ELISA) kits in the laboratory department of West China Hospital, Sichuan University.

DNA isolation and genotyping

Genomic DNA was extracted from 200 µl of EDTA-anticoagulated peripheral blood samples by using a DNA isolation kit from Bioteke (Peking, China). The primers and restriction enzymes used in the genotyping analysis are displayed in Table 1. The sequence of the rs12141731 locus was as follows: upstream primer, 5’-CCACCCGACTGGAGTCAA-3’; downstream primer, 5’-GAAGACCCGCCTTCTTTCTT-3’. The sequence of the rs858543 locus was as follows: upstream primer, 5’-CAGATGGGCAGGATAGGAAG-3’; downstream primer, 5’-TTTCTCCCTGGTTCCTGCTA-3’. PCR-RFLP was performed as follows: 50 ng of genomic DNA was amplified in a 25 µl reaction mixture containing 75 mM Tris-HCl (pH 9), 1.5 mM MgCl2, 150 mM KCl, 2 mM (NH4)SO4, 200 pmol dNTPs, 10 pmol of each primer and 1.5 U of Taq (Biomede, China). The PCR conditions were as follows: 94 °C for 5 min; 36 cycles of 94 °C for 30 s, 62.2 °C for 45 s, and 72 °C for 55 s; and a final extension at 72 °C for 10 min (Eppendorf, Germany). The PCR products were digested with the corresponding restriction enzymes (HincII and MboI, New England Biolabs, MA, USA) for 2 h at 37 °C and analyzed on 6% polyacrylamide gels via silver staining. Approximately 20% of the samples were randomly selected for the repeated assays. The C allele of the rs12141731 SNP locus can be cleaved by HincII restriction endonuclease, while the T allele cannot be cleaved. Therefore, the CC genotype shows two fragments (including 145 bp and 16 bp), while the CT heterozygous genotype has three fragments (including 161 bp, 145 bp, and 16 bp), while the TT genotype only has one fragment of 161 bp (Fig. 1a). The T allele of the rs858543 SNP locus can be cleaved by MboI restriction endonuclease, while the C allele cannot be cleaved. Therefore, two fragments (including 126 bp and 34 bp) can be seen in the TT genotype, three fragments (including 160 bp, 126 bp, and 34 bp) in the CT genotype, and only one fragment of 160 bp in the CC genotype (Fig. 1b).

Fig. 1 a Genotyping of CD247 gene rs12141731 SNP site after HincII digestion. (The 16 bp fragment has run out of the swimming lane due to its too small.) b Genotyping of CD247 gene rs858543 SNP site after MboI digestion. (The 34 bp fragment has run out of the swimming lane due to its too small)

Table 1 Polymorphic SNPs markers, PCR primers, restriction enzymes and corresponding alleles

Marker	Primer sequence (5’- -3’)	Product
(bp)	Annealing temperature(0C)	Restriction
enzyme	Allele(bp)	
rs12141731	CCACCCGACTGGAGTCAA	161	37	HincII	T (161)	
	GAAGACCCGCCTTCTTTCTT				C (145, 16)	
rs858543	CAGATGGGCAGGATAGGAAG	160	37	MboI	C (160)	
	TTTCTCCCTGGTTCCTGCTA				T(126, 34)	

CD247 mRNA determination

CD247 mRNA expression data were available for analysis for 51 patients and 55 controls. Total RNA was extracted and purified from blood samples using TRIzol® Reagent (Life Technologies, USA) according to the manufacturer’s protocol. Reverse transcription-PCR (RT‒PCR) was performed with a one-step RT‒PCR kit according to the manufacturer’s instructions (Bioneer, South Korea). Quantitative real-time PCR was carried out using SYBR Green PCR Master Mix (Roche, Switzerland), and the samples were amplified in a thermocycler as follows: 95 °C for 10 min (1 cycle), 95 °C for 15 s, 60 °C for 30 s (60 cycles), 72 °C for 45 s, 60 °C for 20 min and 95 °C for 15 s (1 cycle). The sequences of the primer pairs for CD247 and their predicted sizes were as follows: sense, ATGGGCTCCCTCTCATCAGT; antisense, GCTTGGTGGTTTGCTACGAC (106 bp). The data were normalized for beta-actin (β-actin) expression using the comparative threshold cycle method. Triplicate Ct values were averaged, and the relative expression levels were determined as 2–ΔΔCt.

Statistical analysis

All the statistical analyses were performed using SPSS ver. 22.0 (SPSS, IBM). Pearson’s chi-squared test and Student’s t test were applied to compare categorical variables (gender) and continuous variables (age, systolic blood pressure, diastolic blood pressure, heart rate, left ventricular end-diastolic diameter, left ventricular end-diastolic volume, left ventricular ejection fraction, and brain natriuretic peptide). Genotype frequencies of these two SNPs were obtained by directed counting, and the allele frequencies were calculated by dividing the total allele counts by the quantity of objects. Hardy–Weinberg equilibrium was established by the chi-square test. The Pearson χ2 method was used to test whether the genotype frequency distribution of each SNP locus conformed to Hardy‒Weinberg equilibrium. The Pearson chi-squared test was also applied for comparison of the genotype frequencies and the allele frequencies between the DCM and control groups. Accordingly, odds ratios (OR) and 95% confidence intervals (95% CI) were calculated to assess the effects of any difference between genotypes or alleles. Genotypic association tests were performed by SNPstatsin, a case‒control pattern presuming codominant, dominant, or log-additive genetic models [28]. The linkage disequilibrium (LD) between polymorphisms was quantified using SHESIS software. (Available online: http://analysis.biox.cn/myAnalysis.php). Survival rates were calculated using the Kaplan–Meier method, with differences assessed by the log rank test. Univariate and multivariate Cox proportional hazards regression analyses were performed to evaluate the associations of genetic and clinical variables with the end point of cardiac death. CD247 mRNA expression levels were compared between patients and controls with Mann–Whitney nonparametric tests. Statistical comparisons of the relative expression of mRNA between the different genotypes of the two SNPs in the gene were performed with the Kruskal–Wallis and Mann–Whitney nonparametric tests in DCM samples. Continuous data are presented as the means ± SDs. In all analyses, p < 0.05 was considered to indicate statistical significance.

Results

Baseline clinical and echocardiographic characteristics

The baseline clinical and echocardiographic characteristics of all participants are displayed in Table 2. There was no significant difference between DCM patients and controls in sex or age (p > 0.05). A significantly increased heart rate left ventricular end-diastolic volume (LVEDV), and BNP and decreased LVEF, systolic blood pressure (SBP), diastolic blood pressure (DBP) (p < 0.05) and a more severe NYHA functional class were detected in DCM patients.

Table 2 Baseline characteristics of controls and dilated cardiomyopathy (DCM) patients

Variable	Patients(n = 355)	Control(n = 404)	
Gender (male/female)	217/138	249/155	
Age (years)	51.89 ± 14.92	54.85 ± 13.41	
NYHA	II: 43; III: 229; IV: 83	I: 345; II:59	
SBP (mmHg)	103.27 ± 13.76*	123.23 ± 8.76	
DBP (mmHg)	68.19 ± 10.16*	83.78 ± 4.82	
Heart rate, beats/min	79.33 ± 9.27*	71.53 ± 10.29	
LVEDV(mL)	216.48 ± 81.84*	97.35 ± 17.23	
LVEF (%)	34.12 ± 12.51*	67.62 ± 5.99	
BNP(pg/mL)	4411.59 ± 2495.31*	101.62 ± 55.96	
NYHA, New York Heart Association; SBP, systolic blood pressure; DBP, diastolic blood pressure; LVEDV, left ventricular end-diastolic volume; LVEF, left ventricular ejection fraction; BNP, brain natriuretic peptide

* Patients vs. Controls

p < 0.05. Data are presented as the mean ± SD

Distribution of allele frequencies and genotypes in patients with DCM

The genotype distributions of these two SNPs of CD247 in the DCM and control groups met the assumption of the Hardy‒Weinberg equilibrium (p > 0.05), indicating that the included study subjects were representative of the population. We analyzed the allele frequencies of the two SNPs by using the chi-squared test in the DCM and control groups. The distributions of the allele frequencies and genotypes of the two SNPs are summarized in Table 3. Compared with those in the control group, the frequency of the T allele decreased in the DCM group (0.5 vs. 0.58, OR = 0.72, 95% CI = 0.588–0.882, p = 0.001) at SNP rs858543. However, there was no significant difference between the two groups for the allele frequencies of the SNP rs12141731 (OR = 0.977, 95% CI = 0.799–1.196, p = 0.824). The results of genotypic association tests performed by SNPstatsin are also summarized in Table 3. These results indicated that rs858543 in CD247 is related to DCM in a dominant genetic model (p = 0.01, OR = 0.66, 95% CI = 0.48–0.91), while rs12141731 in CD247 is not associated with DCM in the Chinese Han population.

Table 3 Allele frequencies and genotype frequencies of SNPs in CD247 gene among DCM patients and controls and their association with DCM risk

SNP		Patients
n = 355(46.77%)	Controls n = 404(53.23%)	OR (95%CI)	p value	
rs12141731	Allele					
	C	374(0.53)	421(0.52)	0.977(0.799–1.196)	0.824	
	T	336(0.47)	387(0.48)			
	Genotype					
	C/C	94 (26.5%)	105 (26%)	1.00		
Codominant	C/T	186 (52.4%)	211 (52.2%)	1.02 (0.72–1.43)	0.97	
	T/T	75 (21.1%)	88 (21.8%)	1.05 (0.69–1.59)		
Dominant	C/C	94 (26.5%)	105 (26%)	1.00		
	C/T-T/T	261 (73.5%)	299 (74%)	1.03 (0.74–1.42)	0.88	
Recessive	C/C-C/T	280 (78.9%)	316 (78.2%)	1.00		
	T/T	75 (21.1%)	88 (21.8%)	1.04 (0.73–1.47)	0.83	
Overdominant	C/C-T/T	169 (47.6%)	193 (47.8%)	1.00		
	C/T	186 (52.4%)	211 (52.2%)	0.99 (0.75–1.32)	0.9	
rs858543	Allele					
	T	357(0.5)	472(0.58)	0.72(0.588–0.882)	0.001	
	C	353(0.5)	336(0.42)			
	Genotype					
	T/T	87 (24.5%)	133 (32.9%)	1.00		
Codominant	C/T	183 (51.5%)	206 (51%)	0.74 (0.53–1.03)	0.0051	
	C/C	85 (23.9%)	65 (16.1%)	0.50 (0.33–0.76)		
Dominant	T/T	87 (24.5%)	133 (32.9%)	1.00		
	C/T-C/C	268 (75.5%)	271 (67.1%)	0.66 (0.48–0.91)	0.01	
Recessive	T/T-C/T	270 (76.1%)	339 (83.9%)	1.00		
	C/C	85 (23.9%)	65 (16.1%)	0.61 (0.42–0.87)	0.0067	
Overdominant	T/T-C/C	172 (48.5%)	198 (49%)	1.00		
	C/T	183 (51.5%)	206 (51%)	0.98 (0.74–1.30)	0.88	
Significant p values after multiple testing adjustment (p < 0.025) are shown in italic bold; SNP, single nucleotide polymorphism; DCM, dilated cardiomyopathy; OR, odd ratio; CI, confidence interval

Linkage disequilibrium and haplotype analysis

LD was conducted for the two variants by using SHESIS software (available online: http://analysis.biox.cn/myAnalysis.php). The SNPs rs12141731 and rs858543 were not in linkage disequilibrium (D′=0.072, r2 = 0.004). We further analyzed four haplotype combinations. We found a significant association in the distribution of two haplotype frequencies (CT and CC) between cases and controls (p < 0.05) (Table 4). The CC haplotype was significantly associated with increased DCM susceptibility, while CT was a protective haplotype.

Table 4 Haplotypefrequencies of the CD247 gene in the patients with DCM and in controls

CD247 gene (rs12141731/rs858543) haplotypes	Frequency	OR (95% CI)	p Value	
CT	173.50(0.244)	237.23(0.294)	0.778(0.619–0.978)	0.031	
CC	200.50(0.282)	183.77(0.227)	1.337(1.060–1.685)	0.014	
TT	183.50(0.258)	234.77(0.291)	0.851(0.678–1.067)	0.162	
TC	152.50(0.215)	152.23(0.188)	1.178(0.917–1.515)	0.200	
Haplotypes with frequency less than 3.0% were not analyzed; significant p value after multiple testing adjustment (p < 0.05) is shown in italic bold; OR, odd ratio; CI, confidence interval

Cox regression analysis of cardiac death in DCM patients

Survival analysis of patients with the two SNPs of the CD247 gene revealed that 175 DCM patients were followed for a mean period of 43.45 ± 21.54 months. During follow-up, all patients received continuous medication treatment, and no patients underwent heart transplantation. One hundred thirty-two patients (75.4%) ,died 35 because of sudden cardiac death and 97 because of pump failure. Univariate analysis demonstrated that patients with the rs858543 TT genotype had longer overall survival than did those with the CT + CC genotype (HR: 0.632, 95% CI = 0.423–0.943; p = 0.025) (Fig. 2a). Additionally, female sex (HR: 1.235, 95% CI = 0.833–1.832, p = 0.294), age (HR: 1.011, 95% CI = 0.997–1.025, p = 0.113), SBP (HR: 0.997, 95% CI = 0.982–1.012, p = 0.692), DBP (HR: 0.992, 95% CI = 0.975–1.010, p = 0.401), heart rate (HR: 1.014, 95% CI = 0.992–1.036, p = 0.223) were not significant predictors of survival in patients with DCM, while NYHA class (HR: 0.585, 95% CI = 0.406–0.843, p = 0.004), LVEDV (HR: 1.003, 95% CI = 1.000-1.005, p = 0.003) and decreased LVEF (HR: 0.976, 95% CI = 0.960–0.992, p = 0.003), BNP (HR: 0.658, 95% CI = 0.451–0.961, p = 0 No statistically significant association between the rs12141731 polymorphism and overall survival time was found via univariate survival analysis (Fig. 2b). Variables including SNP rs858543, NYHA functional class, LVEDV, LVEF, and BNP were analyzed in the subsequent multivariate Cox model. Cox multivariate analysis indicated that the SNP rs858543 TT genotype (HR: 0.608, 95% CI = 0.402–0.921, p = 0.019) was an independent multivariate predictor for longer overall survival in DCM patients. However, the NYHA class (HR: 0.621, 95% CI = 0.409–0.944, p = 0.026) together with decreased LVEF (HR: 0.975, 95% CI = 0.960–0.991, p = 0.002) and BNP (HR: 0.605, 95% CI = 0.408–0.897, p = 0.012) were independent multivariate predictors for shorter overall survival in DCM patients (Table 5).

Fig. 2 Kaplan–Meier survival curves free of cardiac death for 175 DCM patients based on rs12141731 and rs858543

Table 5 Cox regression analysis of cardiac death in patients with DCM

Characteristics	Overall Survival	
Univariate Survival Analysis	Multivariate Survival Analysis	
HR	95%CI	p Value	HR	95%CI	p Value	
SNP rs731							
Dominant	C/C	1						
C/T-T/T	0.788	0.523–1.185	0.252				
SNP rs543							
Dominate	T/T	1						
C/T-C/C	0.632	0.423–0.943	0.025	0.608	0.402–0.921	0.019	
SEX(FEMALE)	1.235	0.833–1.832	0.294				
Age	1.011	0.997–1.025	0.113				
NYHA	0.585	0.406–0.843	0.004	0.621	0.409–0.944	0.026	
SBP (mmHg)	0.997	0.982–1.012	0.692				
DBP (mmHg)	0.992	0.975–1.010	0.401				
HR(beats/min)	1.014	0.992–1.036	0.223				
LVEDV(ml)	1.003	1.000-1.005	0.003	1.002	0.999–1.004	0.208	
LVEF (%)	0.976	0.960–0.992	0.003	0.975	0.960–0.991	0.002	
BNP * >7897 pg/m	0.658	0.451–0.961	0.030	0.605	0.408–0.897	0.012	
The variables analyzed in the multivariate Cox model included SNP rs7986131, gender, age, NYHA functional class, SBP, DBP, HR, LVEDD, LVEDV and LVEF, BNP; p < 0.05 was considered to be statistically significant and the values were given in italic bold font; SNP, single nucleotide polymorphism; NYHA, New York Heart Association; SBP, systolic blood pressure; DBP, diastolic blood pressure; HR, hazard ratio; CI, confidence interval; LVEDD, left ventricular end-diastolic diameter; LVEDV, left ventricular end-diastolic volume; LVEF, left ventricular ejection fraction; BNP, brain natriuretic peptide

Comparisons of the relative expression of mRNAs between the different genotypes of the two SNPs in the CD247 gene

CD247 mRNA relative expression was significantly lower in the DCM group (p = 0.02) than in the control group (Fig. 3a). However, there was no relationship between CD247 mRNA expression and rs12141731 or rs858543 polymorphisms (p = 0.701 and p = 0.242, respectively) (Fig. 3b and c).

Fig. 3 aCD247 mRNA expression was significantly decreased in DCM blood samples (p = 0.02). b No significant relationship was found between CD247 mRNA expression and polymorphism of rs12141731 in DCM samples(p = 0.701). c No significant relationship was found between CD247 mRNA expression and polymorphism of rs858543 in DCM samples(p = 0.242). p value was calculated by Mann–Whitney and Kruskal–Wallis test on log-transformed values

Discussion

As reported in previous studies, autoimmune abnormalities may be related to the pathogenesis of DCM [8, 9]. The immune system mainly includes cellular immunity, which involves mainly T cells involved in the immune response, and humoral immunity, which involves mainly T cells and B cells involved in the immune response. Normally, both the cellular and humoral immune components of the immune system kill foreign viruses, bacteria, and other materials to protect the body through immune activation. However, an increasing number of studies have confirmed that overactivation of the immune system may trigger a large amount of immune cell activation and ultimately lead to diseases such as systemic lupus erythematous16, rheumatoid arthritis [17], myocarditis and DCM [5, 7]. Previous studies have reported that T cells are vital initiators and mediators in the course of autoimmune myocarditis disease [19, 20]. In addition, infiltration of CD4 + T and CD8 + T cells has been detected in patients with myocarditis and DCM via endomyocardial biopsies [9, 10, 29]. The role of CD4 + T cells, which are considered initiators and markers of myocarditis progression, is much greater than that of CD8 + T cells in the progression of autoimmune myocarditis according to immunohistochemistry [9, 10, 30]. An increased proportion of CD4 + T cells was obviously related to the deterioration of systolic function and increased end-diastolic volumes in DCM patients [19–21]. Furthermore, previous studies have shown that IL-2 levels are a marker of CD4 + T-cell activation [21]. CD4 + T-cell clone expansion is accompanied by increased IL-2 levels in patients with DCM [21]. Unregulated IL-2 levels are significantly increased and are considered an independent clinical predictor for the progression of DCM [31]. Therefore, the above findings suggested that the CD4 + T-IL-2 pathway may be involved in the pathogenesis of dilated cardiomyopathy through immune responses.

Previous researchers have reported that the CD247 gene plays an important role in many autoimmune abnormality diseases by regulating human CD4 + T-cell differentiation and activation via the CD3 zeta chain [16–18, 32]. The CD247 gene is mapped to the chromosome at lq24.2 and encodes the T-cell receptor zeta chain (CD3ζ), which is a component of the T-cell receptor (TCR) signaling machinery and is important for effector CD4 + T-cell activation [32]. Many studies have reported that deficient expression of the CD3ζ-chain is linked to many autoimmune abnormality diseases through its involvement in effector CD4 + T-cell activation and generation [16–18, 32]. After the loss of CD3ζ protein expression, the expression and phosphorylation levels of related protein tyrosine kinases (ZAP-70 proteins), as well as the expression levels of cytokines such as IL-2, IL-4, IL-10, IL-17 A, IFN-γ, and TNF-α, significantly changed. Cell inflammation and apoptosis are increased, while cell proliferation and differentiation are decreased [33]. When ZAP-70 undergoes phosphorylation and activation, activated ZAP-70 activates downstream related proteins, thereby activating the MAPK and PI3K/Akt signaling pathways [23] and regulating cell proliferation, differentiation, apoptosis, oxidative stress, and inflammation. It is closely related to the regulation of cell proliferation, differentiation, apoptosis, oxidative stress, inflammation, and other factors.

Furthermore, CD3ζ-chain (CD247 gene) expression is associated with IL-2 leakage in chronic inflammatory disease [34, 35]. In an AngII-induced hypertension mouse model, a previous study revealed that CD247 gene knockout is involved in the regulation of blood pressure by altering T lymphocyte function [22]. Taken together, the above findings suggest that the CD247 gene—CD4 + T-cell—IL-2-mediated pathway axis may play a vital role in the pathogenesis of some cardiovascular conditions, such as DCM.

However, whether SNPs in the CD247 gene influence susceptibility to DCM has not been confirmed. This study is the first to show the relationship between DCM and SNPs in the CD247 gene. In the present study, we evaluated whether the polymorphism of the CD247 gene is a factor influencing susceptibility to DCM by comparing two SNP loci in DCM patients and normal controls. Therefore, we selected two SNPs (rs858543 and rs12141731) in the CD247 gene. The two SNP locus are in the 5’ region (intron 1) of CD247, suggesting a possible role in the regulation of the expression of this gene [21]. However, our results showed that rs858543 was significantly linked to DCM. At this locus, the frequency of the T allele was obviously lower in DCM patients than in normal controls, which suggested that the T allele may be a protective factor against DCM. One possible reason is that mutation of the rs858543 locus is highly important for regulating gene function. However, there was no obvious association between rs12141731 and DCM. One possible reason is that the rs12141731 locus does not affect protein function. Another possible reason is that our study included a small sample size.

Our results showed that CC was significantly associated with increased DCM susceptibility, while CT was a protective haplotype. The results demonstrated that haplotype analysis of the two SNPs might be vital for predicting DCM susceptibility.

Interestingly, patients with the rs858543 TT genotype had longer overall DCM survival, which was also related to decreased DCM risk in the present study. Previous studies have reported that deficient expression of the CD3ζ-chain is linked to autoimmune abnormality diseases such as SLE [16], rheumatoid arthritis [17], some chronic infection diseases [18], hypertension [22] and renal carcinoma [32] via effector CD4 + T-cell activation and generation. Studies of the CD4 + T-cell pathway in the heart of DCM patients have shown that CD4 + T cells are significantly increased in DCM patients during inflammation and that the proportion of CD4 + T cells is strongly linked to systolic dysfunction and increased end-diastolic volumes [10, 19–21]. Accordingly, the CD247 gene-CD4 + T-cell-mediated pathway is involved in DCM progression. This result suggested the distinct genetic contributions of the rs858543 TT genotype in controlling the onset and outcome of DCM.

Our results showed that the expression of CD247 mRNA in the DCM group was significantly lower than that in the control group, which suggested that the CD247 gene is involved in the triggering of DCM and is consistent with previous findings from other researchers [16–18, 32]. However, we discovered that there was a lack of association between the two SNP genotypes and CD247 mRNA expression. Two reasons may explain these results. (1) Studies with small sample sizes were included. (2) Other SNPs in the CD247 gene may participate in the regulation of CD247 transcription.

Conclusion

In conclusion, the above results suggested that the CD247 gene may play an important role in triggering DCM in the Chinese Han population. This study is the first to display the relationship between DCM and SNPs in the CD247 gene. Several issues remain to be resolved in the future: (1) whether CD247 gene SNPs are linked to the amount of CD4 + T cells and IL-2 expressed in DCM; (2) studies should be conducted in other populations to exclude population-oriented association diseases; and (3) studies should be conducted to investigate the molecular mechanisms of the CD247 gene that are correlated with susceptibility to DCM.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Supplementary Material 4

Abbreviations

DCM Dilated Cardiomyopathy

PCR-RFLP Polymerase Chain Reaction-Restriction Fragment Length Polymorphism

SNP Single Nucleotide Polymorphism

OR Odds Ratio

CI Confidence Intervals

Author contributions

CM.L. wrote the main manuscript text and prepared Tables 2 and 5; Fig. 1. XC.X.prepared Fig. 2; Table 1 . K.L.prepared Tables 3 and 4. L.R. prepared Fig. 3 . All authors reviewed the manuscript.

Funding

This study was funded by the Key Research and Development Projects of Sichuan Province (Grant number 2020YFS0245).

Data availability

The datasets generated and/or analysed during the current study are available in the dbSNP repository, the International HapMap project (http://hapmap.ncbi.nlm.nih.gov/). The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions. The datasets used and analyzed in the current study are included within the article.

Declarations

Ethics approval and consent to participate

The present study was approved by the hospital Ethics Committee. Written informed consent was obtained from all participants.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
5. References

1. Watkins H Ashrafian H Redwood C Inherited cardiomyopathies N Engl J Med 2011 364 17 1643 56 10.1056/NEJMra0902923 21524215
Watkins H, Ashrafian H, Redwood C. Inherited cardiomyopathies. N Engl J Med. 2011;364(17):1643–56.21524215 10.1056/NEJMra0902923
2. Bironaite D Daunoravicius D Bogomolovas J Cibiras S Vitkus D Zurauskas E Zasytyte I Rucinskas K Labeit S Venalis A Molecular mechanisms behind progressing chronic inflammatory dilated cardiomyopathy BMC Cardiovasc Disord 2015 15 26 10.1186/s12872-015-0017-1 25888309
Bironaite D, Daunoravicius D, Bogomolovas J, Cibiras S, Vitkus D, Zurauskas E, Zasytyte I, Rucinskas K, Labeit S, Venalis A, et al. Molecular mechanisms behind progressing chronic inflammatory dilated cardiomyopathy. BMC Cardiovasc Disord. 2015;15:26.25888309 10.1186/s12872-015-0017-1
3. Tsirka AE Trinkaus K Chen SC Lipshultz SE Towbin JA Colan SD Exil V Strauss AW Canter CE:improved outcomes of pediatric dilated cardiomyopathy with utilization of heart transplantation J Am Coll Cardiol 2004 44 2 391 7 10.1016/j.jacc.2004.04.035 15261937
Tsirka AE, Trinkaus K, Chen SC, Lipshultz SE, Towbin JA, Colan SD, Exil V, Strauss AW. Canter CE:improved outcomes of pediatric dilated cardiomyopathy with utilization of heart transplantation. J Am Coll Cardiol. 2004;44(2):391–7.15261937 10.1016/j.jacc.2004.04.035
4. Hunt SA, Abraham WT, Chin MH, Feldman AM, Francis GS, Ganiats TG, Jessup M, Konstam MA, Mancini DM, Michl K, College of Cardiology/American Heart Association Task Force on Practice Guidelines. Writing Committee to Update the 2001 Guidelines for the Evaluation and Management of Heart Failure): developed in collaboration with the American College of Chest Physicians and the International Society for Heart and Lung Transplantation: endorsed by the Heart Rhythm Society. Circulation : ACC/AHA 2005 Guideline Update for the Diagnosis and Management of Chronic Heart Failure in the Adult: a report of the American (2005, 112(12):e154-235.
5. Hazebroek M Dennert R Heymans S Idiopathic dilated cardiomyopathy: possible triggers and treatment strategies Neth Heart Journal: Monthly J Neth Soc Cardiol Neth Heart Foundation 2012 20 7–8 332 5 10.1007/s12471-012-0285-7
Hazebroek M, Dennert R, Heymans S. Idiopathic dilated cardiomyopathy: possible triggers and treatment strategies. Neth Heart Journal: Monthly J Neth Soc Cardiol Neth Heart Foundation. 2012;20(7–8):332–5.10.1007/s12471-012-0285-7
6. Felker Thompson Hare Hruban Clemetson Howard Baughman Kasper Underlying causes and long-term survival in patients with initially unexplained cardiomyopathy N Engl J Med 2000 342 15 1077 84 10.1056/NEJM200004133421502 10760308
Felker GM, Thompson RE, Hare JM, Hruban RH, Clemetson DE, Howard DL, Baughman KL, Kasper EK. Underlying causes and long-term survival in patients with initially unexplained cardiomyopathy. N Engl J Med. 2000;342(15):1077–84.10760308 10.1056/NEJM200004133421502
7. Lappe JM Pelfrey CM Tang WH Recent insights into the role of autoimmunity in idiopathic dilated cardiomyopathy J Card Fail 2008 14 6 521 30 10.1016/j.cardfail.2008.02.016 18672201
Lappe JM, Pelfrey CM, Tang WH. Recent insights into the role of autoimmunity in idiopathic dilated cardiomyopathy. J Card Fail. 2008;14(6):521–30.18672201 10.1016/j.cardfail.2008.02.016
8. Kuhl U Noutsias M Seeberg B Schultheiss HP Immunohistological evidence for a chronic intramyocardial inflammatory process in dilated cardiomyopathy Heart 1996 75 3 295 300 10.1136/hrt.75.3.295 8800996
Kuhl U, Noutsias M, Seeberg B, Schultheiss HP. Immunohistological evidence for a chronic intramyocardial inflammatory process in dilated cardiomyopathy. Heart. 1996;75(3):295–300.8800996 10.1136/hrt.75.3.295
9. Omerovic E Bollano E Andersson B Kujacic V Schulze W Hjalmarson A Waagstein F Fu M Induction of cardiomyopathy in severe combined immunodeficiency mice by transfer of lymphocytes from patients with idiopathic dilated cardiomyopathy Autoimmunity 2000 32 4 271 80 10.3109/08916930008994101 11191286
Omerovic E, Bollano E, Andersson B, Kujacic V, Schulze W, Hjalmarson A, Waagstein F, Fu M. Induction of cardiomyopathy in severe combined immunodeficiency mice by transfer of lymphocytes from patients with idiopathic dilated cardiomyopathy. Autoimmunity. 2000;32(4):271–80.11191286 10.3109/08916930008994101
10. Noutsias M Pauschinger M Schultheiss H Kh U Phenotypic characterization of infiltrates in dilated cardiomyopathy - diagnostic significance of T-lymphocytes and macrophages in inflammatory cardiomyopathy Med Sci Monitor: Int Med J Experimental Clin Res 2002 8 7 CR478 487
Noutsias M, Pauschinger M, Schultheiss H, Kh U. Phenotypic characterization of infiltrates in dilated cardiomyopathy - diagnostic significance of T-lymphocytes and macrophages in inflammatory cardiomyopathy. Med Sci Monitor: Int Med J Experimental Clin Res. 2002;8(7):CR478–487.
11. Limas CJ Iakovis P Anyfantakis A Kroupis C Cokkinos DV Familial clustering of autoimmune diseases in patients with dilated cardiomyopathy Am J Cardiol 2004 93 9 1189 91 10.1016/j.amjcard.2004.01.060 15110223
Limas CJ, Iakovis P, Anyfantakis A, Kroupis C, Cokkinos DV. Familial clustering of autoimmune diseases in patients with dilated cardiomyopathy. Am J Cardiol. 2004;93(9):1189–91.15110223 10.1016/j.amjcard.2004.01.060
12. Caforio AL Grazzini M Mann JM Keeling PJ Bottazzo GF McKenna WJ Schiaffino S Identification of alpha- and beta-cardiac myosin heavy chain isoforms as major autoantigens in dilated cardiomyopathy Circulation 1992 85 5 1734 42 10.1161/01.CIR.85.5.1734 1533350
Caforio AL, Grazzini M, Mann JM, Keeling PJ, Bottazzo GF, McKenna WJ, Schiaffino S. Identification of alpha- and beta-cardiac myosin heavy chain isoforms as major autoantigens in dilated cardiomyopathy. Circulation. 1992;85(5):1734–42.1533350 10.1161/01.CIR.85.5.1734
13. Iwata M Yoshikawa T Baba A Anzai T Mitamura H Ogawa S Autoantibodies against the second extracellular loop of beta1-adrenergic receptors predict ventricular tachycardia and sudden death in patients with idiopathic dilated cardiomyopathy J Am Coll Cardiol 2001 37 2 418 24 10.1016/S0735-1097(00)01109-8 11216956
Iwata M, Yoshikawa T, Baba A, Anzai T, Mitamura H, Ogawa S. Autoantibodies against the second extracellular loop of beta1-adrenergic receptors predict ventricular tachycardia and sudden death in patients with idiopathic dilated cardiomyopathy. J Am Coll Cardiol. 2001;37(2):418–24.11216956 10.1016/S0735-1097(00)01109-8
14. Horwich TB Patel J MacLellan WR Fonarow GC Cardiac troponin I is associated with impaired hemodynamics, progressive left ventricular dysfunction, and increased mortality rates in advanced heart failure Circulation 2003 108 7 833 8 10.1161/01.CIR.0000084543.79097.34 12912820
Horwich TB, Patel J, MacLellan WR, Fonarow GC. Cardiac troponin I is associated with impaired hemodynamics, progressive left ventricular dysfunction, and increased mortality rates in advanced heart failure. Circulation. 2003;108(7):833–8.12912820 10.1161/01.CIR.0000084543.79097.34
15. Kuhl U Pauschinger M Seeberg B Lassner D Noutsias M Poller W Schultheiss HP Viral persistence in the myocardium is associated with progressive cardiac dysfunction Circulation 2005 112 13 1965 70 10.1161/CIRCULATIONAHA.105.548156 16172268
Kuhl U, Pauschinger M, Seeberg B, Lassner D, Noutsias M, Poller W, Schultheiss HP. Viral persistence in the myocardium is associated with progressive cardiac dysfunction. Circulation. 2005;112(13):1965–70.16172268 10.1161/CIRCULATIONAHA.105.548156
16. Liossis SN Ding XZ Dennis GJ Tsokos GC Altered pattern of TCR/CD3-mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. Deficient expression of the T-cell receptor zeta chain J Clin Investig 1998 101 7 1448 57 10.1172/JCI1457 9525988
Liossis SN, Ding XZ, Dennis GJ, Tsokos GC. Altered pattern of TCR/CD3-mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. Deficient expression of the T-cell receptor zeta chain. J Clin Investig. 1998;101(7):1448–57.9525988 10.1172/JCI1457
17. Maurice MM Lankester AC Bezemer AC Geertsma MF Tak PP Breedveld FC van Lier RA Verweij CL: defective TCR-mediated signaling in synovial T cells in rheumatoid arthritis J Immunol 1997 159 6 2973 8 10.4049/jimmunol.159.6.2973 9300721
Maurice MM, Lankester AC, Bezemer AC, Geertsma MF, Tak PP, Breedveld FC, van Lier RA. Verweij CL: defective TCR-mediated signaling in synovial T cells in rheumatoid arthritis. J Immunol. 1997;159(6):2973–8.9300721 10.4049/jimmunol.159.6.2973
18. Geertsma MF van Wengen-Stevenhagen A van Dam EM Risberg K Kroon FP Groeneveld PH Nibbering PH Decreased expression of zeta molecules by T lymphocytes is correlated with disease progression in human immunodeficiency virus-infected persons J Infect Dis 1999 180 3 649 58 10.1086/314941 10438351
Geertsma MF, van Wengen-Stevenhagen A, van Dam EM, Risberg K, Kroon FP, Groeneveld PH, Nibbering PH. Decreased expression of zeta molecules by T lymphocytes is correlated with disease progression in human immunodeficiency virus-infected persons. J Infect Dis. 1999;180(3):649–58.10438351 10.1086/314941
19. Afanasyeva M Georgakopoulos D Belardi DF Ramsundar AC Barin JG Kass DA Rose NR:quantitative analysis of myocardial inflammation by flow cytometry in murine autoimmune myocarditis: correlation with cardiac function Am J Pathol 2004 164 3 807 15 10.1016/S0002-9440(10)63169-0 14982835
Afanasyeva M, Georgakopoulos D, Belardi DF, Ramsundar AC, Barin JG, Kass DA. Rose NR:quantitative analysis of myocardial inflammation by flow cytometry in murine autoimmune myocarditis: correlation with cardiac function. Am J Pathol. 2004;164(3):807–15.14982835 10.1016/S0002-9440(10)63169-0
20. Afanasyeva M Georgakopoulos D Rose NR Autoimmune myocarditis: cellular mediators of cardiac dysfunction Autoimmun rev 2004 3 7–8 476 86 10.1016/j.autrev.2004.08.009 15546794
Afanasyeva M, Georgakopoulos D, Rose NR. Autoimmune myocarditis: cellular mediators of cardiac dysfunction. Autoimmun rev. 2004;3(7–8):476–86.15546794 10.1016/j.autrev.2004.08.009
21. Efthimiadis I Skendros P Sarantopoulos A Boura P CD4+/CD25 + T-Lymphocytes and Th1/Th2 regulation in dilated cardiomyopathy Hippokratia 2011 15 4 335 42 24391416
Efthimiadis I, Skendros P, Sarantopoulos A, Boura P. CD4+/CD25 + T-Lymphocytes and Th1/Th2 regulation in dilated cardiomyopathy. Hippokratia. 2011;15(4):335–42.24391416
22. Rudemiller N Lund H Jacob HJ Geurts AM Mattson DL PhysGen knockout P: CD247 modulates blood pressure by altering T-lymphocyte infiltration in the kidney Hypertension 2014 63 3 559 64 10.1161/HYPERTENSIONAHA.113.02191 24343121
Rudemiller N, Lund H, Jacob HJ, Geurts AM, Mattson DL. PhysGen knockout P: CD247 modulates blood pressure by altering T-lymphocyte infiltration in the kidney. Hypertension. 2014;63(3):559–64.24343121 10.1161/HYPERTENSIONAHA.113.02191
23. Au-Yeung BB Shah NH Shen L Weiss A ZAP-70 in Signaling, Biology, and Disease Annu Rev Immunol 2018 36 127 56 10.1146/annurev-immunol-042617-053335 29237129
Au-Yeung BB, Shah NH, Shen L, Weiss A. ZAP-70 in Signaling, Biology, and Disease. Annu Rev Immunol. 2018;36:127–56.29237129 10.1146/annurev-immunol-042617-053335
24. Martins M Williams AH Comeau M Marion M Ziegler JT Freedman BI Merrill JT Glenn SB Kelly JA Sivils KM Genetic association of CD247 (CD3zeta) with SLE in a large-scale multiethnic study Genes Immun 2015 16 2 142 50 10.1038/gene.2014.73 25569266
Martins M, Williams AH, Comeau M, Marion M, Ziegler JT, Freedman BI, Merrill JT, Glenn SB, Kelly JA, Sivils KM, et al. Genetic association of CD247 (CD3zeta) with SLE in a large-scale multiethnic study. Genes Immun. 2015;16(2):142–50.25569266 10.1038/gene.2014.73
25. Li R, Yang W, Zhang J, Hirankarn N, Pan HF, Mok CC et al. Association of CD247 with systemic lupus erythematosus in Asian populations.Lupus. 2012, 21(1):75–83.
26. Richardson P Report of the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the definition and classification of cardiomyopathies Circulation 1996 93 5 841 2 10.1161/01.CIR.93.5.841 8598070
Richardson P, et al. Report of the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the definition and classification of cardiomyopathies. Circulation. 1996;93(5):841–2.8598070 10.1161/01.CIR.93.5.841
27. Maron BJ et al. Contemporary definitions and classification of the cardiomyopathies an American heart association scientific statement from the council on clinical cardiology, heart failure and transplantation committee; quality of care and outcomes research and functional genomics and translational biology interdisciplinary working groups; and council on epidemiology and prevention. Circulation 2006, 113(14): 1807–16.
28. Sole X Guino E Valls J Iniesta R Moreno V SNPStats: a web tool for the analysis of association studies Bioinformatics 2006 22 15 1928 29 10.1093/bioinformatics/btl268 16720584
Sole X, Guino E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the analysis of association studies. Bioinformatics. 2006;22(15):1928–29.16720584 10.1093/bioinformatics/btl268
29. Wang Y Afanasyeva M Hill SL Rose NR Characterization of murine autoimmune myocarditis induced by self and foreign cardiac myosin Autoimmunity 1999 31 151 62 10.3109/08916939908994060 10739332
Wang Y, Afanasyeva M, Hill SL, Rose NR. Characterization of murine autoimmune myocarditis induced by self and foreign cardiac myosin. Autoimmunity. 1999;31:151–62.10739332 10.3109/08916939908994060
30. Georgakopoulos D Mitzner WA Chen CH Byrne BJ Millar HD Hare JM In vivo murine left ventricular pressure– volume relations by miniaturized conductance micromanom- etry Am J Physiol 1998 274 4 Pt 2 H1416 22 9575947
Georgakopoulos D, Mitzner WA, Chen CH, Byrne BJ, Millar HD, Hare JM, et al. In vivo murine left ventricular pressure– volume relations by miniaturized conductance micromanom- etry. Am J Physiol. 1998;274(4 Pt 2):H1416–22.9575947
31. Limas CJ Hasikidis C Iakovou J Kroupis C Haidaroglou A Cokkinos DV Prognostic significance of soluble interleukin-2 receptor levels in patients with dilated cardiomyopathy Eur J Clin Invest 2003 33 443 8 10.1046/j.1365-2362.2003.01111.x 12795639
Limas CJ, Hasikidis C, Iakovou J, Kroupis C, Haidaroglou A, Cokkinos DV. Prognostic significance of soluble interleukin-2 receptor levels in patients with dilated cardiomyopathy. Eur J Clin Invest. 2003;33:443–8.12795639 10.1046/j.1365-2362.2003.01111.x
32. Sandeep Krishnan VG, Warke MP, Nambiar HK, Wong GC, Tsokos. and Donna L. Farber.Generation and biochemical analysis of human effector CD4 T cells: alterations in tyrosine phosphorylation and loss of CD3ζ expression.Blood,2001;97(12):3851–9.
33. Deng GM Beltran J Chen C Terhorst C Tsokos GC T cell CD3zeta deficiency enables multiorgan tissue inflammation J Immunol 2013 191 7 3563 7 10.4049/jimmunol.1300634 23980209
Deng GM, Beltran J, Chen C, Terhorst C, Tsokos GC. T cell CD3zeta deficiency enables multiorgan tissue inflammation. J Immunol. 2013;191(7):3563–7.23980209 10.4049/jimmunol.1300634
34. Ehlers S Smith KA Differentiation of T-cell lymphokine gene expression: the in vitro acquisition of T-cell memory J Exp Med 1991 173 25 36 10.1084/jem.173.1.25 1898663
Ehlers S, Smith KA. Differentiation of T-cell lymphokine gene expression: the in vitro acquisition of T-cell memory. J Exp Med. 1991;173:25–36.1898663 10.1084/jem.173.1.25
35. Nambiar MP Fisher CU Warke VG Krishnan S Mitchell JP Delaney N Reconstitution of deficient T-cell receptor zeta chain restores T-cell signaling and augments T-cell Receptor/CD3-induced interleukin-2 production in patients with systemic lupus erythematosus Arthritis Rheum 2003 48 1948 55 10.1002/art.11072 12847689
Nambiar MP, Fisher CU, Warke VG, Krishnan S, Mitchell JP, Delaney N, et al. Reconstitution of deficient T-cell receptor zeta chain restores T-cell signaling and augments T-cell Receptor/CD3-induced interleukin-2 production in patients with systemic lupus erythematosus. Arthritis Rheum. 2003;48:1948–55.12847689 10.1002/art.11072
