
==== Front
BMC Oral Health
BMC Oral Health
BMC Oral Health
1472-6831
BioMed Central London

39261828
4834
10.1186/s12903-024-04834-1
Research
Serum mRNA levels of cytokeratin-19 and vascular endothelial growth factor in oral squamous cell carcinoma and oral potentially malignant disorders using RT-PCR
Senevirathna Kalpani 12
Mahakapuge Thilini Anupama Nanayakkarawasam 3
Jayawardana Nadeeka U. 4
Rajapakse Jayanthe 3
Gamage Chandrika Udumalagala 6
Seneviratne Bimalka 7
Perera Unil 8
Kanmodi Kehinde Kazeem kanmodikehinde@yahoo.com

5910
Jayasinghe Ruwan 1011
1 grid.449910.1 0000 0004 4677 4319 Department of Biochemistry, Uva Wellassa University of Sri Lanka, Badulla, Sri Lanka
2 https://ror.org/025h79t26 grid.11139.3b 0000 0000 9816 8637 Centre for Research in Oral Cancer, University of Peradeniya, Peradeniya, Sri Lanka
3 https://ror.org/025h79t26 grid.11139.3b 0000 0000 9816 8637 Department of Veterinary Pathobiology, University of Peradeniya, Peradeniya, Sri Lanka
4 https://ror.org/025h79t26 grid.11139.3b 0000 0000 9816 8637 Department of Agricultural Biology, University of Peradeniya, Peradeniya, Sri Lanka
5 https://ror.org/01sf06y89 grid.1004.5 0000 0001 2158 5405 Applied BioSciences, Macquarie University, Sydney, Australia
6 https://ror.org/02rm76t37 grid.267198.3 0000 0001 1091 4496 Department of Biochemistry, Sri Jayewardenepura University, Gangodawila, Sri Lanka
7 https://ror.org/02rm76t37 grid.267198.3 0000 0001 1091 4496 Department of Pathology, Sri Jayewardenepura University, Gangodawila, Sri Lanka
8 https://ror.org/03qt6ba18 grid.256304.6 0000 0004 1936 7400 Department of Physics & Astronomy, Georgia State University, Atlanta, USA
9 https://ror.org/00286hs46 grid.10818.30 0000 0004 0620 2260 School of Dentistry, University of Rwanda, Kigali, Rwanda
10 https://ror.org/00ztyd753 grid.449861.6 0000 0004 0485 9007 Faculty of Dentistry, University of Puthisastra, Phnom Penh, Cambodia
11 https://ror.org/025h79t26 grid.11139.3b 0000 0000 9816 8637 Department of Oral Medicine and Periodontology, University of Peradeniya, Peradeniya, Sri Lanka
11 9 2024
11 9 2024
2024
24 10625 6 2024
29 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Oral cancers, which include tumors of the oral cavity, salivary glands, and pharynx, are becoming increasingly prevalent worldwide. Squamous cell carcinoma accounts for over 90% of malignant oral lesions, with oral squamous cell carcinoma (OSCC) being notably common in the Indian subcontinent and other regions of Asia. This is especially true in South-Central Asia, including Sri Lanka, where it is particularly prevalent among men. This study aims to evaluate the levels of Vascular Endothelial Growth Factor-A (VEGF-A) and Cytokeratin-19 (CK-19) mRNAs in whole blood as a potential method for the early detection of OSCC.

Methods

The study included 40 patients (each from OSCC, Oral Submucous Fibrosis (OSF), Oral Leukoplakia (OLK), Oral Lichen Planus (OLP), and 10 healthy controls. The expression levels of VEGF-A and CK-19 mRNAs were measured from extracellular RNA extracted from whole blood samples using real-time reverse transcription polymerase chain reaction (RT-PCR) with sequence-specific primers. Receiver operating characteristic (ROC) curve analysis was used to evaluate the effectiveness of these biomarkers in detecting OSCC.

Results

The results demonstrated a significant increase in blood transcripts of the candidate mRNAs CK-19 and VEGF-A in patients with OSCC, OSF, OLK, and OLP. The Wilcoxon signed-rank test revealed a p-value of 0.002 for each specific comparison between diseased patients and healthy controls (i.e., OSCC vs. HC, OSF vs. HC, OLP vs. HC, OLK vs. HC) for both CK-19 and VEGF-A. When these two biomarkers were used together, they provided a 60% predictive probability for patients with OSCC (p = 0.023).

Conclusion

This study highlights the efficacy of blood mRNA transcriptome diagnostics in detecting OSCC. This innovative clinical approach has the potential to be a robust, efficient, and reliable tool for early cancer detection. Blood-based transcriptomes could be further explored for their effectiveness in various health contexts and for routine health monitoring.

Keywords

Oral cancer
Oral potentially malignant disorders
Polymerase chain reaction
Blood
Early detection
mRNA
http://dx.doi.org/10.13039/100008968 National Research Council Sri Lanka 22031 22031 Sri Jayewardenepura UniversityFMS/Q-12/2021 FMS/Q-12/2021 FMS/Q-12/2021 http://dx.doi.org/10.13039/501100008907 University of Peradeniya D/F/CROC/URG/2022/29/D/CL/07 D/F/CROC/URG/2022/29/D/CL/07 D/F/CROC/URG/2022/29/D/CL/07 D/F/CROC/URG/2022/29/D/CL/07 D/F/CROC/URG/2022/29/D/CL/07 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

As the sixth most prevalent cancer worldwide, oral and oropharyngeal malignancies are a growing health issue [1–3]. South Asian countries have the highest frequency of oral cancer in men, accounting for 25% of all new cases of cancer [3]. Oral cancer has a 50% 5-year survival rate [1, 3]. OSCC accounts for 95% of oral cavity malignancies, while smoking, betel quid chewing, and excessive alcohol use are major causes [1]. Because alcohol, tobacco, and areca nut use persist despite public awareness and educational campaigns, primary prevention alone has failed [3–5]. The oral cavity’s direct accessibility aids early identification of OSCCs and Oral potentially malignant disorders (OPMDs), yet 60% of OSCCs in Sri Lanka are detected at advanced clinical stages [2, 6]. Late OSCC presentation has poor prognosis and lower rates of survival due to local, regional and distant metastases [3, 6]. The proportion of patients with advanced-stage OSCC has remained stable for 40 years, and despite a large portion of the population receiving regular oral health checks and dental care, survival rates have not improved [3].

VEGF, also known as VEGF-A, is a protein originally purified from a tumor-derived fluid, recognized for its vascular permeability activity [7]. A few years later, a protein with angiogenic activity was independently purified and named VEGF [8]. Molecular cloning subsequently revealed that these two proteins were identical, encoded by a single gene [9]. The VEGF family includes VEGF-A, VEGF-B, VEGF-C, VEGF-D, PlGF (placental growth factor), VEGF-E (Orf-VEGF), and Trimeresurus flavoviridis svVEGF. Except for the latter two members, five VEGF family genes are present in mammalian genomes, including humans [10]. VEGF-A serves multiple functions, including promoting angiogenesis, increasing vascular permeability, and stimulating cell migration in macrophage lineage and endothelial cells. Recently, anti–VEGF-VEGFR drugs, such as anti–VEGF-A neutralizing antibodies and multikinase inhibitors, have been developed and are widely used for treating major solid tumors [11, 12]. Elevated levels of VEGF mRNA or protein have been found to be associated with aggressive progression and poor prognosis in several forms of cancers, such as pancreatic, gastric, colorectal, and breast carcinomas [13–17]. The potential of VEGF protein or mRNA as a predictive marker for oral cancer progression and prognosis is a promising prospect. However, the specific role of VEGF-A in the pathophysiology of oral cancer remains to be clarified [18].

Cytokeratins (CK19) belong to the Keratin family of intermediate filament proteins, consisting of 20 polypeptides. The family mentioned is crucial for maintaining the structural integrity of epithelial cells and serves as a highly effective indicator for tumors [19, 20]. The primary roles of these indicators are to facilitate signal transduction, respond to stress, induce apoptosis, maintain cell integrity, and promote cellular proliferation [21, 22]. Nevertheless, Cytokeratins are subject to intricate regulation, which involves posttranslational modifications of amino acids and interactions with associated proteins [21]. Malignant epithelial cells contain wild-type filamentous polypeptides [23].

CK19 is found in the periderm and epithelial cells of the kidney and the organs of the digestive systema (including the pancreas and gallbladder) [24]. CK19 mRNA has been detected in various cancers, including hepatocellular carcinoma, cholangiocellular carcinoma, colorectal neoplasm, nonmedullary thyroid carcinoma, untreated early-stage cervical carcinoma, breast cancer, and lung cancers [25]. This study aims to (a) evaluate the expression levels of CK-19 mRNAs and VEGF-A in blood specimens of patients with active OSCC lesions, OPMDs (such as oral submucous fibrosis (OSF), oral leukoplakia (OLK), and oral lichen planus (OLP), and healthy controls, and (b) compare the histopathological grade of OSCC with the obtained VEGF-A expression findings.

Methods

Sample collection and preparation

This study was conducted in accordance with the Helsinki Declaration of 1964 (as amended in October 2013 by the World Medical Association General Assembly), at the Dental Teaching Hospital of the University of Peradeniya, Sri Lanka between March, 2023 to October 2023. The study was ethically approved by Ethical Review Committee of the Faculty of Dental Sciences, University of Peradeniya under the reference number ERC/FDS/UOP/E/2021/14, and all patients provided written informed consent prior to participation in this study. Further, participation was informed, anonymous, and voluntary. Individuals under 18 years of age and those physically or mentally unable to respond to the data collection tools were excluded. Eligible participants were adults over 18 years without any physical or mental incapacities, newly diagnosed, and had not undergone any prior interventions such as chemotherapy, radiation, surgery, or alternative therapies. None of the patients or study controls had a medical history of cancer, hepatitis, HIV infection, immunodeficiency, or autoimmune disorders. Control participants were meticulously matched with the experimental group by age and sex. Healthy controls were selected following a detailed oral cavity examination by a specialist in oral medicine, ensuring the absence of any pathological lesions. All participants provided informed consent by signing an official form.

The criteria for diagnosing the oral lesions in our study involved both histopathological confirmation and clinical examination. OSCC was diagnosed through histopathological examination, which confirmed malignant epithelial cells exhibiting features such as keratinization, cellular atypia, and invasion of surrounding tissues, supported by clinical findings consistent with malignant lesions. OLK was identified by the presence of white plaques or patches on the oral mucosa that could not be classified as any other condition clinically or pathologically; histopathological examination was done to assess the dysplastic changes and rule out malignant transformation. OLP was diagnosed based on clinical examination, which revealed bilateral white reticular or lace-like patterns on the buccal mucosa, tongue, or gingiva, and confirmed by histopathological examination showing characteristic features like band-like lymphocytic infiltrate at the epithelial-connective tissue interface and degeneration of the basal cell layer. OSF was diagnosed through clinical examination indicating progressive fibrosis of the submucosal tissues, leading to restricted mouth opening and blanching of the oral mucosa; histopathological examination confirmed the presence of dense collagenous connective tissue with reduced vascularity and chronic inflammatory infiltrate. The demographic and clinical information such as sex, age, drinking and smoking habits, clinical history, treatments, and instances of recurrence were recorded. To ensure confidentiality, all patient identifiers were encoded.

We calculated the sample size using G*Power 3.1 with an F test ANOVA: Fixed effects, omnibus, one-way. At a significance level (α) of 0.05 and power (1-β) of 0.90, with an effect size (f) of 0.6, the required sample size was determined to be 50. These 50 participants were then distributed among the groups for oral cancer, OLK, OLP, OSF, and controls.

A total of 2 mL of blood was withdrawn in EDTA tubes from healthy donors (n = 10), patients with OSCC (n = 10), OLK (n = 10), OLP (n = 10), and OSF (n = 10). 1 mL of human whole blood was mixed with 5 mL of Buffer EL in an appropriately sized tube/falcon tube (15 mL). The sample was incubated for 10–15 min on ice and mixed by vertexing briefly 2 times during incubation. Afterward, the mixture was centrifuged at 400 x g for 10 min at 4 °C, completely removed, and the supernatant was discarded. 2 mL of Buffer EL was added to the cell pellet and resuspended the cells by vertexing briefly. Again, centrifuged the mixture at 400 x g for 10 min at 4 °C, and completely removed and discarded supernatant. 600 µL of Buffer RLT was added to pelleted leukocytes and vortexed well, followed by samples stored at − 70 °C until complete RNA extraction.

RNA isolation

Upon thawing the cell pellets, total RNA extraction was performed according to the manufacturer’s instructions of the Qiagen QIAamp RNA Blood Kit ®. The QIAamp RNA Blood Mini Kit streamlines the extraction of RNA from the blood via a rapid spin-column method. It begins by selectively lysing red blood cells and collecting white cells through centrifugation. These white cells are then lysed under potent denaturing conditions that swiftly deactivate RNases. Following this, the sample is homogenized using the QIAshredder spin column and subsequently applied to the QIAamp spin column. Here, total RNA attaches to the QIAamp membrane while impurities are eliminated through a series of washes, resulting in pure RNA that can be eluted in 30–100 µl of RNase-free water (included with the kit). This pure RNA is then ready for direct utilization in various downstream applications. The extracted RNA’s purity and quantity were assessed via spectrophotometric analysis employing a NanoDrop spectrophotometer, focusing on the A260/A280 ratio.

cDNA synthesis

The total RNA was reverse transcribed using GoScript™ Reverse Transcriptase from Promega Corporation, Madison, Wisconsin, United States, following the manufacturer’s guidelines. Subsequently, the samples were stored at -20 °C for further analysis.

Real-time RT-PCR

Real-time RT-PCR analysis of VEGF-A, CK-19, and GAPDH was conducted on 50 study participants, with each sample analyzed in triplicate. The PCR amplification was carried out in a 10 µL reaction mixture, comprising a final concentration of 10 µmol for both sense and antisense primers, 2 µL of cDNA, and combined with 10 µL of GoTaq® qPCR Master Mix (Promega Corporation, Madison, USA). Quantification was performed using the QuantStudioTM 6 Flex Real-Time PCR Instrument from Thermo Fisher Scientific. The initial cDNA/RNA amount for a specific template was deduced from a previously established standard curve [26]. The sequences and specifications of the PCR primer set (in the 5’-3’ direction) were as follows (Table 1). The relative expression of each specific product was calculated by 2-ΔΔCT (CT = fluorescence threshold value; ΔCT = CT of the target gene - CT of the reference gene (GAPDH); ΔΔCT = ΔCT of the oral cancer/OPMD sample - ΔCT of the calibrator sample).

Table 1 Specification of the primers used in real-time RT-PCR [27]

Parameter	CK19-mRNA	VEGF-A	GAPDH	
F primer	TCCGAACCAAGTTTGAGAC	ATCACGAAGTGGTGAAGTTC	TGAAGGTCGGAGTCAACGGATTTGGT	
Length of primer	19	20	26	
R primer	AATCCACCTCCACACTGA	TGCTGTAGGAAGCTCATCTC	CATGTGGGCCATGAGGTCCACCAC	
Length of primer	18	20	24	
Length of proliferation piece	222	265	929	
Optimum annealing temperature	58.4 oC	60 oC	60 oC	

Evaluation

Statistical analyses and diagram creation were conducted using GraphPad Prism 4.0 software. The Wilcoxon Signed Rank test was employed for statistical assessment to compare each diseased vs. control group. To appraise the biomarker’s efficacy in distinguishing between tumor and control samples in individuals’ whole blood without relying on a subjective threshold, a Receiver Operating Characteristic (ROC) curve was generated. This curve illustrates the relationship between sensitivity (true positives) and 1-specificity (false positives), treating each recorded value as a potential cutoff point. The Area Under the Curve (AUC) was computed to evaluate the overall discriminatory capability of the marker. A biomarker with limited discriminatory value would exhibit a ROC curve closely mirroring the diagonal line, resulting in an AUC value of around 0.5. In contrast, a dependable discriminatory test would shift the ROC curve toward the upper left corner, yielding an AUC value approaching 1.0.

Results

The study cohort comprised 50 individuals, 36 were men, and 14 were women, indicating a slight preference for men. The study included 10 patients diagnosed with OSCC (4 with well-differentiated OSCC, 3 with moderately differentiated OSCC and 3 with poorly differentiated OSCC), 10 with OLP, 10 with OLK displaying varying degrees of dysplasia (2 with keratosis with moderate epithelial dysplasia, 4 with keratosis with mild epithelial dysplasia, 2 with keratosis without dysplasia, and, 2 with verrucous hyperplasia), 10 with OSF displaying diverse degrees of dysplasia (2 with mild epithelial dysplasia, 1 with OSF (Advanced stage) and 7 with no dysplasia), and ten meticulously matched healthy control subjects (Table 2).

Table 2 Clinicopathological characteristics of the patients in the study (n = 50)

Parameters	Study population (n = 50)	
OSCC	OLK	OSF	OLP	HC	
Total	10	10	10	10	10	
Age (years)						
Median range	56(37–77)	47(27–59)	43(28–68)	48(18–64)	37(24–68)	
Gender						
 Male

 Female

	8

2

	9

1

	8

2

	4

6

	7

3

	
Past medical history/ drug history						
 Yes

 No

	4

6

	5

5

	4

6

	2

8

	0

10

	
Areca nut chewing						
 Yes

 No

	8

2

	7

3

	10

0

	5

5

	0

10

	
Smoking history						
 Yes

 No

	3

7

	6

4

	5

5

	2

8

	0

10

	
Alcohol consumption						
 Yes

 No

	8

2

	3

7

	7

3

	2

8

	3

7

	

Upon examining the associations between VEGF-A and CK-19 levels and the clinicopathological characteristics of OSCC and OPMD patients, no significant association was identified for age, gender, past medical history, betel quid chewing habit, smoking habit, and alcohol consumption. However, the following associations were detected between the presence of OSCC/OPMD and the age of the patients (Pearson correlation = − 0.351; p = 0.012), presence of OPMD/OSCC vs. drug history of the individual (Pearson correlation = − 0.033; p = 0.018), presence of OPMD/OSCC vs. betel chewing (Pearson correlation = − 0.612; p = 0.000), presence of OPMD/OSCC vs. alcohol consumption (Pearson correlation = − 0.284; p = 0.046), gender vs. smoking (Pearson correlation = − 0.428; p = 0.002), gender vs. alcohol consumption (Pearson correlation = − 0.586; p = 0.000), age vs. drug history (Pearson correlation = − 0.111; p = 0.047) and age vs. past medical history (Pearson correlation = 0.303; p = 0.033).

Since the dataset was not normally distributed, we employed the Spearman Correlation test to evaluate the monotonic relationship between the variables without assuming a linear connection. The p-values for each marker indicate whether there was no statistically significant correlation between their concentrations and dysplasia severity, categorized as follows: 0 = no dysplasia, 1 = mild dysplasia, 2 = moderate dysplasia, and 3 = invasive cancer. The Spearman correlation coefficient for VEGF-A and dysplasia severity was 0.096, with a p-value of 0.506, while for CK-19, the correlation coefficient was 0.003, with a p-value of 0.983.

The results affirmed a notable increase in blood transcripts of the 2 candidate mRNAs CK-19 and VEGF-A—in patients with OSCC, OSF, OLK, and OLP. Wilcoxon signed-rank test showed p = 0.002 for each specific comparison: diseased versus controls (i.e., OSCC versus HC, OSF versus HC, OLP versus HC, OLK versus HC) for CK-19 and VEGF. These genes were stratified into two tiers based on the magnitude of elevation: high up-regulated mRNA, encompassing VEGF-A (36.73-fold-OSCC; 1.84-fold-OSF; 19.00-fold-OLK; 18.17-fold-OLP; 3.01-fold-HC); lower up-regulated mRNAs, including CK-19 (8.721-fold-OSCC; 5.800-fold-OSF; 6.706-fold-OLP; 9.505-fold-OLK; 2.249-fold-HC) (Fig. 1). After conducting binary logistic regression analysis, predictive probability values were collected and used to create ROC curves (Fig. 2). The ROC curves were subsequently utilized to calculate the area under the curves (AUC) for the prediction probability of each biomarker, as specified in Table 3.

Fig. 1 Circulating levels of VEGF-A and CK-19 (a) The box-plot diagram shows VEGF-A mRNA expression levels (b) The box-plot graph illustrates the Cytokeratin (CK-19) mRNA expression levels

Table 3 Areas under the curve (AUC) of the four combined biomarkers

Predictive probabilities	Sensitivity
(%)	Specificity
(%)	Cut of probability (%)	Area	Asymptotic sig.	Std Error	Asymptotic 95% C.I. Intervals	
Lower Bound	Upper Bound	
OSCC	60	70	50.64	0.8	0.023*	0.105	0.595	1.000	
OSF	60	50	50.96	0.6	0.45	0.13	0.345	0.855	
OLP	30	90	50.99	0.61	0.406	0.13	0.355	0.865	
OLK	30	70	49.27	0.68	0.174	0.124	0.437	0.923	

Fig. 2 Receiver operating characteristics (ROC) curve analysis using blood VEGF-A and CK-19 levels in blood in OSCC, OSF, OLP, and OLK patients compared with controls. (a) ROC curve of OSCC vs. HC (b) ROC curve of OLP vs. HC (c) ROC curve of OSF vs. HC (d) ROC curve of OLK vs. HC

Discussion

Angiogenesis plays a crucial role in the initiation, development, and metastasis of tumors, with VEGF recognized as a potent angiogenic factor driving the formation of new blood vessels during tumor growth [28, 29]. VEGF is known to specifically stimulate the proliferation of vascular endothelial cells. Elevated expression of VEGF was not only observed in the tissue of OSCC but also had a notable impact on serum levels. In a recent study led by Edirisinghe et al., a direct correlation was observed between the expression of the VEGF-A gene, serum levels, tissue VEGFR-2 levels, and the tumor’s stage and grade. These results provide significant evidence endorsing the potential of VEGF-A as a biomarker for the early detection of OSCC [30].

The initial investigation led by Folkman et al. showcased VEGF’s angiogenic capabilities in pre-malignant lesions [31]. This research highlighted the stimulation of blood vessel formation as cells progressed from excessive growth to the development of abnormal tissue. Few studies have explored angiogenesis in the progression of clinically diagnosed OLK towards malignancy [32]. The increase in angiogenesis is evident during the transition from OLK to dysplasia and, ultimately, to OSCC. In OSCC, a study by Gandolfo et al. revealed heightened VEGF expression in leukoplakia, contributing to blood vessel formation beneath the epithelium [32]. Moreover, VEGF expression was significantly higher in leukoplakia with dysplastic alterations compared to those without dysplasia. Specifically, in the context of oral leukoplakia, the expression of VEGF-A can be utilized to assess the malignant evolution of tongue OLK-OSCCs [32]. These investigations collectively indicate that VEGF holds promise as a valuable indicator for diagnosing the malignant transformation of oral leukoplakia.

In a study conducted by Rai et al., the investigation aimed to establish a link between VEGF gene polymorphism and OSF [33]. The results provided compelling evidence indicating a significant correlation between the VEGF − 460 C/T gene polymorphism and OSF in patients. Notably, the observation of polymorphism in advanced stages underscores the importance of VEGF as a biomarker in both the malignant transformation and progression of OSF phases [33]. The progression of OPMDs to malignancy has been associated with the downregulation of E-cadherin and the upregulation of VEGF [34]. The expression of VEGF increased consistently as the disease advanced from normal to higher stages of oral epithelial dysplasia and eventually to cancer. However, in the present study the level of VEGF-A level was downregulated compared to the healthy controls.

Sharma et al. observed a notable rise in vascularity during the early stages of OSF. As OSF advanced, there was a discernible down-regulation in VEGF expression [35]. These findings imply the potential for symptom improvement in oral fibrosis through vascular reconstruction [35].

OLP presents as a persistent inflammatory condition with an autoimmune inflammatory origin [36]. Additionally, Hazzaa et al.‘s investigation uncovered notable immune expression of VEGF in the connective tissue of OLP compared to the control group [37], a finding consistent with Salem et al.‘s results [38]. Moreover, Tao et al. bolstered these findings by illustrating a strong correlation between VEGF immune expression, angiogenesis, and OLP lesions, in contrast to the control group [39]. It’s worth mentioning that immune cells like macrophages, along with resident cells like fibroblasts, release lymph-angiogenic factors, specifically VEGF-C and VEGF-A, in inflamed tissues, highlighting the crucial role of angiogenesis and lymph angiogenesis in OLP development. Furthermore, these discoveries suggest a significant link between angiogenesis and the diverse clinical manifestations of OLP lesions, providing fresh insights into underlying mechanisms and potential treatment strategies [37].

CK19 is a member of the broad category of intermediate filament proteins identified as the Keratin family, comprising approximately 20 polypeptides. The primary role of this family is to uphold the integrity of epithelial cells. These proteins serve as crucial indicators for the diagnosis and management of tumors [40]. The involvement of CK19 has been linked to the migration and infiltration of cancer cells, potentially contributing to the development of distant metastasis through its facilitation of extracellular breakdown and cell motility [41]. A recent study conducted by Rashid et al. revealed that in the patients’ group, 19 individuals showed positive CK19 markers, yielding a sensitivity of 53%. In contrast, the normal group had a total of eight positive cases out of 36 [27]. A statistical analysis employing a two-sample binomial test demonstrated a significant difference in the number of positive instances between the two groups (P-value = 0.011). The researchers concluded that these findings establish a diagnostic screening tool for the early detection of OSCC in its initial stages. To enhance the reliability of the results, it is recommended to carry out further research with larger sample sizes [27].

There is limited literature regarding studies on CK19 gene expression in OPMD. However, several studies utilizing immunohistochemistry have been conducted, shedding light on the involvement of CK-19 in OPMDs. Investigating the role of CKs in OLP has the potential to enhance the understanding and differential diagnosis of this condition. Researchers analyzed the expression of CK10, CK13, CK14, and CK19 in OLP cases, considering their significant expression in the healthy oral mucous membrane [42, 43]. The expression pattern of CK-19 in the healthy nonkeratinized oral mucous membrane shows inconsistencies: Vander Velden described the heterogeneous expression of CK-19 in both the basal and suprabasal regions of the epithelial cells [44]. Referring to a study by Maeda et al., flow cytometry analysis of OLP tissues revealed six specimens with consistent staining in the basal layer, four areas without staining, and three areas showing no staining at all [45]. Boisnic et al. reported positive staining of keratin 19 in multiple basal regions [42]. The research illustrated that as OLP damage progresses, keratinized epithelial cell layers may eventually express CK-19 [46].

OLK serves as an early indicator of oral epithelial malignancy, demanding a thorough investigation to comprehend molecular changes during its transformation and prevent its progression. Multiple molecular-biological and clinicopathological studies have enhanced our understanding of cytokeratin expression alterations in cancer biology [47]. Intermediate filaments (IFs) play a crucial role in the biological features and developmental stages of epithelial organ cells. In the basal layers of basal cells, Ck 5 and Ck 14 signify stratified epithelium associated with cell proliferation [48]. The intermediate layers of keratinizing stratified epithelium express CKs 1 and 10, indicating cellular differentiation [48]. Conversely, glandular epithelia exhibit distinct CKs 8/18 and 19. Alterations in precancerous oral epithelium may be connected to the expression of CKs 8/18 and 19 in the suprabasal layer [47].

In a study conducted by Fillies et al., immunohistochemical staining was utilized to demonstrate a significantly higher expression of CK19 in cases of epithelial transformation. The research observed a statistically significant difference in expression levels between OLK and OSCC (p < 0.01), as well as between OLK and oral lichenoid dysplasia (OLD) (p = 0.021). Similar findings are well-documented in the existing literature, where Ck 19 expression is frequently noted in dysplastic lesions [49, 50] and is primarily considered an indicator of impaired epithelial differentiation [51].

Cytokeratin fragment antigen 21 − 1 (CYFRA21-1), resulting from caspase-3 action on CK-19, has been detected in the serum and saliva of patients with fibrosis, including OSF, and those with malignancy [52]. The decrease in CK-19 and the appearance of CYFRA21-1 in OSF are likely linked to stromal hypoxia-induced activation of caspase-3 and − 9 [53, 54]. In OSF, where CK-19 is reduced, its elevation is observed in OED [52, 55]. Moreover, CK-19 exhibits a gradual increase with advancing grades of OED and OSCC [55, 56]. Its expression is particularly elevated at the invasive edge, serving as an independent indicator of unfavorable prognosis [56, 57]. Although the mechanism underlying changes in CK-19 expression during the malignant transformation of OSF remains unexplored, the heightened CK-19 expression in OED, OSCC, and malignant OSF could be associated with increased matrix stiffness due to progressive matrix cross-linking. The augmented stiffness in OSF mucosa is evidenced by a thickened basement membrane, subepithelial fibrosis, and elevated collagen density [58]. Therefore, studies with substantial sample sizes are imperative to elucidate the role of CK-19 in both OSCC and OPMD.

In our study, no significant difference was observed in the intensity levels of VEGF-A and CK-19 among OSCC, OSF, OLP, and OLK unless considered in the context of disease vs. healthy groups, such as OSCC vs. HC, OSF vs. HC, OLP vs. HC, and OLK vs. HC. However, when combined, these two markers demonstrated effectiveness in detecting OSCC alone with relatively high sensitivity and specificity (refer to Table 3) (p = 0.023). Therefore, our study suggests that CK-19 and VEGF do not play a significant role independently in the transformation of OPMD to OSCC. Even though, these findings indicate significant overexpression of these genes in diseased states compared to healthy controls, suggesting their potential role in the pathogenesis of these conditions. Further gene expression studies on different cytokeratin’s and VEGF individually are warranted to explore broader diagnostic applications in the future, thereby enhancing their diagnostic and prognostic implications in early detection of oral cancer and OPMD.

Acknowledgements

We are grateful to the staff of the Diagnostic Clinic and the Oral Maxillofacial Clinic in the Department of Oral Medicine at the Faculty of Dental Sciences, University of Peradeniya, as well as to other colleagues in Oral Surgery and Oral Medicine who referred patients for this study.

Author contributions

Study conception and design: KS, TANM, and RJ; Data analysis and interpretation: KS, TANM; Writing original manuscript: KS; Writing reviewing and editing manuscript: KS, TANM, NUJ, CUG, KKK, and RJ; Supervision: TANM, NUJ, JR, CUG, UP, BR, KKK, and RJ; Publication funding acquisition: KKK; All authors have read and approved the manuscript.

Funding

This research was supported by funding from the National Research Council of Sri Lanka (Grant number 22031), University Research Grants from Sri Jayewardenepura University (Grant number FMS/Q-12/2021), and a University Research Grant from the University of Peradeniya (D/F/CROC/URG/2022/29/D/CL/07).

Data availability

The authors confirm that the data underpinning the findings of this study can be obtained from the corresponding author upon request.

Declarations

Ethics approval and consent to participate

The study was conducted at the Dental Teaching Hospital, University of Peradeniya, Sri Lanka, following approval from the Ethical Review Committee of the Faculty of Dental Sciences, University of Peradeniya (protocol number: ERC/FDS/UOP/E/2021/14). All patients provided written informed consent prior to participation in this study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

AUC Area Under the Curve

CYFRA21-1 Cytokeratin fragment antigen 21 − 1

CK-19 Cytokeratin-19

OLK Oral Leukoplakia

OLP Oral Lichen Planus

OLD Oral lichenoid dysplasia

OPMDs Oral potentially malignant disorders

OSCC Oral squamous cell carcinoma

OSF Oral Submucous Fibrosis

RT-PCR Real-time reverse transcription polymerase chain reaction

ROC Receiver operating characteristic

VEGF-A Vascular Endothelial Growth Factor-A

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Papanakou S, Nikitakis N, Sklavounou-Andrikopoulou A. Epidemiology, etiology and prevention of oral cancer. Archives Hellenic Medicine/Arheia Ellenikes Iatrikes. 2013;30(5).
2. Sankaranarayanan R Ramadas K Thara S Muwonge R Thomas G Anju G Mathew B Long term effect of visual screening on oral cancer incidence and mortality in a randomized trial in Kerala, India Oral Oncol 2013 49 4 314 21 10.1016/j.oraloncology.2012.11.004 23265945
Sankaranarayanan R, Ramadas K, Thara S, Muwonge R, Thomas G, Anju G, Mathew B. Long term effect of visual screening on oral cancer incidence and mortality in a randomized trial in Kerala, India. Oral Oncol. 2013;49(4):314–21.23265945 10.1016/j.oraloncology.2012.11.004
3. Warnakulasuriya S Global epidemiology of oral and oropharyngeal cancer Oral Oncol 2009 45 4–5 309 16 10.1016/j.oraloncology.2008.06.002 18804401
Warnakulasuriya S. Global epidemiology of oral and oropharyngeal cancer. Oral Oncol. 2009;45(4–5):309–16.18804401 10.1016/j.oraloncology.2008.06.002
4. Ferlay JS Soerjomataram I Ervik M Dikshit R Eser S Mathers C Rebelo M Parkin DM Forman D Bray F Cancer incidence and mortality worldwide: IARC CancerBase Globocan 2012 2013 1 11
Ferlay JS, Soerjomataram I, Ervik M, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D, Bray F. Cancer incidence and mortality worldwide: IARC CancerBase. Globocan. 2012;2013(1):11.
5. Psoter WJ Morse DE Sánchez-Ayendez M Vélez Vega CM Aguilar ML Buxó-Martinez CJ Psoter JA Kerr AR Lane CM Scaringi VJ Elias A Increasing opportunistic oral cancer screening examinations: findings from focus groups with general dentists in Puerto Rico J Cancer Educ 2015 30 277 83 10.1007/s13187-014-0679-x 24894606
Psoter WJ, Morse DE, Sánchez-Ayendez M, Vélez Vega CM, Aguilar ML, Buxó-Martinez CJ, Psoter JA, Kerr AR, Lane CM, Scaringi VJ, Elias A. Increasing opportunistic oral cancer screening examinations: findings from focus groups with general dentists in Puerto Rico. J Cancer Educ. 2015;30:277–83.24894606 10.1007/s13187-014-0679-x
6. Brocklehurst P, Kujan O, O’Malley L, Ogden GR, Shepherd S, Glenny AM. Screening programmes for the early detection and prevention of oral cancer. Cochrane Database Syst Reviews. 2013(11).
7. Senger DR Galli SJ Dvorak AM Perruzzi CA Harvey VS Dvorak HF Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid Science 1983 219 4587 983 5 10.1126/science.6823562 6823562
Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF. Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science. 1983;219(4587):983–5.6823562 10.1126/science.6823562
8. Leung DW Cachianes G Kuang WJ Goeddel DV Ferrara N Vascular endothelial growth factor is a secreted angiogenic mitogen Science 1989 246 4935 1306 9 10.1126/science.2479986 2479986
Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science. 1989;246(4935):1306–9.2479986 10.1126/science.2479986
9. Ferrara N Kerbel RS Angiogenesis as a therapeutic target Nature 2005 438 7070 967 74 10.1038/nature04483 16355214
Ferrara N, Kerbel RS. Angiogenesis as a therapeutic target. Nature. 2005;438(7070):967–74.16355214 10.1038/nature04483
10. Muller YA, Li B, Christinger HW, Wells JA, Cunningham BC, De Vos AM. Vascular endothelial growth factor: crystal structure and functional mapping of the kinase domain receptor binding site. Proc Natl Acad Sci. 1997;94(14):7192–7.
11. Hurwitz H Fehrenbacher L Novotny W Cartwright T Hainsworth J Heim W Berlin J Baron A Griffing S Holmgren E Ferrara N Bevacizumab plus Irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer N Engl J Med 2004 350 23 2335 42 10.1056/NEJMoa032691 15175435
Hurwitz H, Fehrenbacher L, Novotny W, Cartwright T, Hainsworth J, Heim W, Berlin J, Baron A, Griffing S, Holmgren E, Ferrara N. Bevacizumab plus Irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer. N Engl J Med. 2004;350(23):2335–42.15175435 10.1056/NEJMoa032691
12. Sandler A Gray R Perry MC Brahmer J Schiller JH Dowlati A Lilenbaum R Johnson DH Paclitaxel–carboplatin alone or with bevacizumab for non–small-cell lung cancer N Engl J Med 2006 355 24 2542 50 10.1056/NEJMoa061884 17167137
Sandler A, Gray R, Perry MC, Brahmer J, Schiller JH, Dowlati A, Lilenbaum R, Johnson DH. Paclitaxel–carboplatin alone or with bevacizumab for non–small-cell lung cancer. N Engl J Med. 2006;355(24):2542–50.17167137 10.1056/NEJMoa061884
13. Deng YT Chen HM Cheng SJ Chiang CP Kuo MY Arecoline-stimulated connective tissue growth factor production in human buccal mucosal fibroblasts: modulation by curcumin Oral Oncol 2009 45 9 e99 105 10.1016/j.oraloncology.2009.04.004 19457704
Deng YT, Chen HM, Cheng SJ, Chiang CP, Kuo MY. Arecoline-stimulated connective tissue growth factor production in human buccal mucosal fibroblasts: modulation by curcumin. Oral Oncol. 2009;45(9):e99–105.19457704 10.1016/j.oraloncology.2009.04.004
14. Takahashi Y Cleary KR Mai M Kitadai Y Bucana CD Ellis LM Significance of vessel count and vascular endothelial growth factor and its receptor (KDR) in intestinal-type gastric cancer Clin cancer Research: Official J Am Association Cancer Res 1996 2 10 1679 84
Takahashi Y, Cleary KR, Mai M, Kitadai Y, Bucana CD, Ellis LM. Significance of vessel count and vascular endothelial growth factor and its receptor (KDR) in intestinal-type gastric cancer. Clin cancer Research: Official J Am Association Cancer Res. 1996;2(10):1679–84.
15. Yu JX Zhang XT Liao YQ Zhang QY Chen H Lin M Kumar S Relationship between expression of CD105 and growth factors in malignant tumors of gastrointestinal tract and its significance World J Gastroenterology: WJG 2003 9 12 2866 10.3748/wjg.v9.i12.2866
Yu JX, Zhang XT, Liao YQ, Zhang QY, Chen H, Lin M, Kumar S. Relationship between expression of CD105 and growth factors in malignant tumors of gastrointestinal tract and its significance. World J Gastroenterology: WJG. 2003;9(12):2866.10.3748/wjg.v9.i12.2866
16. Ikeda N Adachi M Taki T Huang C Hashida H Takabayashi A Sho M Nakajima Y Kanehiro H Hisanaga M Nakano H Prognostic significance of angiogenesis in human pancreatic cancer Br J Cancer 1999 79 9 1553 63 10.1038/sj.bjc.6690248 10188906
Ikeda N, Adachi M, Taki T, Huang C, Hashida H, Takabayashi A, Sho M, Nakajima Y, Kanehiro H, Hisanaga M, Nakano H. Prognostic significance of angiogenesis in human pancreatic cancer. Br J Cancer. 1999;79(9):1553–63.10188906 10.1038/sj.bjc.6690248
17. Berns EM Klijn JG Look MP Grebenchtchikov N Vossen R Peters H Geurts-Moespot A Portengen H van Staveren IL Meijer-van Gelder ME Bakker B Combined vascular endothelial growth factor and TP53 status predicts poor response to tamoxifen therapy in estrogen receptor-positive advanced breast cancer Clin Cancer Res 2003 9 4 1253 8 12684392
Berns EM, Klijn JG, Look MP, Grebenchtchikov N, Vossen R, Peters H, Geurts-Moespot A, Portengen H, van Staveren IL, Meijer-van Gelder ME, Bakker B. Combined vascular endothelial growth factor and TP53 status predicts poor response to tamoxifen therapy in estrogen receptor-positive advanced breast cancer. Clin Cancer Res. 2003;9(4):1253–8.12684392
18. Dissanayaka DW Wijeratne KM Amarasinghe KA Jayasinghe RD Jayasooriya PR Mendis BR Lombardi T A preliminary study on early detection of oral Cancer with opportunistic screening: insights from Dental surgeons in Sri Lanka Cancers 2023 15 23 5511 10.3390/cancers15235511 38067215
Dissanayaka DW, Wijeratne KM, Amarasinghe KA, Jayasinghe RD, Jayasooriya PR, Mendis BR, Lombardi T. A preliminary study on early detection of oral Cancer with opportunistic screening: insights from Dental surgeons in Sri Lanka. Cancers. 2023;15(23):5511.38067215 10.3390/cancers15235511
19. Jou YJ Lin CD Lai CH Chen CH Kao JY Chen SY Tsai MH Huang SH Lin CW Proteomic identification of salivary transferrin as a biomarker for early detection of oral cancer Anal Chim Acta 2010 681 1–2 41 8 10.1016/j.aca.2010.09.030 21035601
Jou YJ, Lin CD, Lai CH, Chen CH, Kao JY, Chen SY, Tsai MH, Huang SH, Lin CW. Proteomic identification of salivary transferrin as a biomarker for early detection of oral cancer. Anal Chim Acta. 2010;681(1–2):41–8.21035601 10.1016/j.aca.2010.09.030
20. Moshref BN. Expression of CK19-mRNA and CEA-mRNA biomarkers in pleural fluid of patients with non-small cell lung cancer.
21. Alix-Panabières C Vendrell JP Slijper M Pellé O Barbotte E Mercier G Jacot W Fabbro M Pantel K Full-length cytokeratin-19 is released by human tumor cells: a potential role in metastatic progression of breast cancer Breast Cancer Res 2009 11 1 0 10.1186/bcr2326
Alix-Panabières C, Vendrell JP, Slijper M, Pellé O, Barbotte E, Mercier G, Jacot W, Fabbro M, Pantel K. Full-length cytokeratin-19 is released by human tumor cells: a potential role in metastatic progression of breast cancer. Breast Cancer Res. 2009;11:1–0.10.1186/bcr2326
22. Olszewska E, Sudhoff H. Comparative cytokeratin distribution patterns in cholesteatoma epithelium. Histol Histopathol. 2007.
23. Oloomi M, Yardehnavi N, Bouzari S, Moazzezy N. Non-coding CK19 RNA in peripheral blood and tissue of breast cancer patients. Acta Medica Iranica. 2013:75–86.
24. Leelawat K Narong S Udomchaiprasertkul W Wannaprasert J Treepongkaruna SA Subwongcharoen S Ratanashu-Ek T. Prognostic relevance of circulating CK19 mRNA in advanced malignant biliary tract diseases World J Gastroenterology: WJG 2012 18 2 175 10.3748/wjg.v18.i2.175
Leelawat K, Narong S, Udomchaiprasertkul W, Wannaprasert J, Treepongkaruna SA, Subwongcharoen S. Ratanashu-Ek T. Prognostic relevance of circulating CK19 mRNA in advanced malignant biliary tract diseases. World J Gastroenterology: WJG. 2012;18(2):175.10.3748/wjg.v18.i2.175
25. Bremmer F Ströbel P Jarry H Strecker J Gaisa N Strauß A Schweyer S Radzun HJ Behnes CL CK19 is a sensitive marker for yolk sac tumours of the testis Diagn Pathol 2015 10 1 7 10.1186/s13000-015-0243-y 25591792
Bremmer F, Ströbel P, Jarry H, Strecker J, Gaisa N, Strauß A, Schweyer S, Radzun HJ, Behnes CL. CK19 is a sensitive marker for yolk sac tumours of the testis. Diagn Pathol. 2015;10:1–7.25591792 10.1186/s13000-015-0243-y
26. Ginzinger DG Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream Exp Hematol 2002 30 6 503 12 10.1016/S0301-472X(02)00806-8 12063017
Ginzinger DG. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol. 2002;30(6):503–12.12063017 10.1016/S0301-472X(02)00806-8
27. Rashid F Naji T Mohamadnia A Bahrami N mRNA biomarkers for detection of oral squamous cell cancer Asian Pac J Cancer Care 2018 3 1 1 10.31557/apjcc.2018.3.1.1
Rashid F, Naji T, Mohamadnia A, Bahrami N. mRNA biomarkers for detection of oral squamous cell cancer. Asian Pac J Cancer Care. 2018;3(1):1.10.31557/apjcc.2018.3.1.1
28. Dvorak HF Brown LF Detmar M Dvorak AM Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis Am J Pathol 1995 146 5 1029 7538264
Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am J Pathol. 1995;146(5):1029.7538264
29. Kim KJ Li B Winer J Armanini M Gillett N Phillips HS Ferrara N Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo Nature 1993 362 6423 841 4 10.1038/362841a0 7683111
Kim KJ, Li B, Winer J, Armanini M, Gillett N, Phillips HS, Ferrara N. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature. 1993;362(6423):841–4.7683111 10.1038/362841a0
30. Edirisinghe ST Weerasekera M De Silva DK Devmini MT Pathmaperuma S Wijesinghe GK Nisansala T Maddumage A Huzaini H Rich AM De Silva H Vascular endothelial growth factor A (VEGF-A) and vascular endothelial growth factor receptor 2 (VEGFR-2) as potential biomarkers for oral squamous cell carcinoma: a Sri Lankan study Asian Pac J cancer Prevention: APJCP 2023 24 1 267 10.31557/APJCP.2023.24.1.267
Edirisinghe ST, Weerasekera M, De Silva DK, Devmini MT, Pathmaperuma S, Wijesinghe GK, Nisansala T, Maddumage A, Huzaini H, Rich AM, De Silva H. Vascular endothelial growth factor A (VEGF-A) and vascular endothelial growth factor receptor 2 (VEGFR-2) as potential biomarkers for oral squamous cell carcinoma: a Sri Lankan study. Asian Pac J cancer Prevention: APJCP. 2023;24(1):267.10.31557/APJCP.2023.24.1.267
31. Folkman J Watson K Ingber D Hanahan D Induction of angiogenesis during the transition from hyperplasia to neoplasia Nature 1989 339 6219 58 61 10.1038/339058a0 2469964
Folkman J, Watson K, Ingber D, Hanahan D. Induction of angiogenesis during the transition from hyperplasia to neoplasia. Nature. 1989;339(6219):58–61.2469964 10.1038/339058a0
32. Gandolfo M, Keszler A, Lanfranchi H, Itoiz ME. Increased subepithelial vascularization and VEGF expression reveal potentially malignant changes in human oral mucosa lesions. Oral surgery, oral medicine, oral Pathology, oral Radiology, and endodontology. 2011;111(4):486–93.
33. Rai DV Guttal KS Kulkarni BB Hiremath S Burde KN Vascular endothelial growth factor (VEGF) gene polymorphism in oral submucous fibrosis subjects-A preliminary study Asian J Med Sci 2016 7 5 10 6 10.3126/ajms.v7i5.15064
Rai DV, Guttal KS, Kulkarni BB, Hiremath S, Burde KN. Vascular endothelial growth factor (VEGF) gene polymorphism in oral submucous fibrosis subjects-A preliminary study. Asian J Med Sci. 2016;7(5):10–6.10.3126/ajms.v7i5.15064
34. Sharada P Swaminathan U Nagamalini BR Kumar KV Ashwini BK Lavanya VL Coalition of E-cadherin and vascular endothelial growth factor expression in predicting malignant transformation in common oral potentially malignant disorders J Oral Maxillofacial Pathol 2018 22 1 40 7 10.4103/jomfp.JOMFP_13_18
Sharada P, Swaminathan U, Nagamalini BR, Kumar KV, Ashwini BK, Lavanya VL. Coalition of E-cadherin and vascular endothelial growth factor expression in predicting malignant transformation in common oral potentially malignant disorders. J Oral Maxillofacial Pathol. 2018;22(1):40–7.10.4103/jomfp.JOMFP_13_18
35. Sharma E Tyagi N Gupta V Narwal A Vij H Lakhnotra D Role of angiogenesis in oral submucous fibrosis using vascular endothelial growth factor and CD34: an immunohistochemical study Indian J Dent Res 2019 30 5 755 62 10.4103/ijdr.IJDR_186_17 31854369
Sharma E, Tyagi N, Gupta V, Narwal A, Vij H, Lakhnotra D. Role of angiogenesis in oral submucous fibrosis using vascular endothelial growth factor and CD34: an immunohistochemical study. Indian J Dent Res. 2019;30(5):755–62.31854369 10.4103/ijdr.IJDR_186_17
36. Lavanya N Jayanthi P Rao UK Ranganathan K Oral lichen planus: an update on pathogenesis and treatment J oral Maxillofacial Pathol 2011 15 2 127 32 10.4103/0973-029X.84474
Lavanya N, Jayanthi P, Rao UK, Ranganathan K. Oral lichen planus: an update on pathogenesis and treatment. J oral Maxillofacial Pathol. 2011;15(2):127–32.10.4103/0973-029X.84474
37. Hazzaa HH El Shiekh MA Abdelgawad N Gouda OM Kamal NM Correlation of VEGF and MMP-2 levels in oral lichen planus: an in vivo immunohistochemical study J oral Biology Craniofac Res 2020 10 4 747 52 10.1016/j.jobcr.2020.10.009
Hazzaa HH, El Shiekh MA, Abdelgawad N, Gouda OM, Kamal NM. Correlation of VEGF and MMP-2 levels in oral lichen planus: an in vivo immunohistochemical study. J oral Biology Craniofac Res. 2020;10(4):747–52.10.1016/j.jobcr.2020.10.009
38. Salem SA Aly DG Youssef NS Immunohistochemical assessment of angiogenesis and vascular endothelial growth factor expression in cutaneous lichen planus: relation to the degree of inflammation Eur J Dermatology 2011 21 2 197 202 10.1684/ejd.2011.1221
Salem SA, Aly DG, Youssef NS. Immunohistochemical assessment of angiogenesis and vascular endothelial growth factor expression in cutaneous lichen planus: relation to the degree of inflammation. Eur J Dermatology. 2011;21(2):197–202.10.1684/ejd.2011.1221
39. Tao X, Huang Y, Li R, Qing R, Ma L, Rhodus NL, Cheng B. Assessment of local angiogenesis and vascular endothelial growth factor in the patients with atrophic-erosive and reticular oral lichen planus. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 2007;103(5):661-9.
40. Jou YJ Lin CD Lai CH Tang CH Huang SH Tsai MH Chen SY Kao JY Lin CW Salivary zinc finger protein 510 peptide as a novel biomarker for detection of oral squamous cell carcinoma in early stages Clin Chim Acta 2011 412 15–16 1357 65 10.1016/j.cca.2011.04.004 21497587
Jou YJ, Lin CD, Lai CH, Tang CH, Huang SH, Tsai MH, Chen SY, Kao JY, Lin CW. Salivary zinc finger protein 510 peptide as a novel biomarker for detection of oral squamous cell carcinoma in early stages. Clin Chim Acta. 2011;412(15–16):1357–65.21497587 10.1016/j.cca.2011.04.004
41. Lee YM Song DE Kim TY Sung TY Yoon JH Chung KW Hong SJ Risk factors for distant metastasis in patients with minimally invasive follicular thyroid carcinoma PLoS ONE 2016 11 5 e0155489 10.1371/journal.pone.0155489 27171147
Lee YM, Song DE, Kim TY, Sung TY, Yoon JH, Chung KW, Hong SJ. Risk factors for distant metastasis in patients with minimally invasive follicular thyroid carcinoma. PLoS ONE. 2016;11(5):e0155489.27171147 10.1371/journal.pone.0155489
42. Boisnic S Ouhayoun JP Branchet MC Frances C Beranger JY Le Charpentier Y Szpirglas H Alteration of cytokeratin expression in oral lichen planus. Oral surgery, oral medicine, oral Pathology Oral Radiol Endodontology 1995 79 2 207 15
Boisnic S, Ouhayoun JP, Branchet MC, Frances C, Beranger JY, Le Charpentier Y, Szpirglas H. Alteration of cytokeratin expression in oral lichen planus. Oral surgery, oral medicine, oral Pathology. Oral Radiol Endodontology. 1995;79(2):207–15.
43. Moll R Franke WW Schiller DL Geiger B Krepler R The catalog of human cytokeratins: patterns of expression in normal epithelia, tumors and cultured cells Cell 1982 31 1 11 24 10.1016/0092-8674(82)90400-7 6186379
Moll R, Franke WW, Schiller DL, Geiger B, Krepler R. The catalog of human cytokeratins: patterns of expression in normal epithelia, tumors and cultured cells. Cell. 1982;31(1):11–24.6186379 10.1016/0092-8674(82)90400-7
44. van der Velden LA, Manni JJ, Ramaekers FC, Kuijpers W. Expression of intermediate filament proteins in benign lesions of the oral mucosa. European archives of oto-rhino-laryngology. 1999;256:514–9.
45. Maeda H Reibel J Holmstrup P Keratin staining pattern in clinically normal and diseased oral mucosa of lichen planus patients Eur J Oral Sci 1994 102 4 210 5 10.1111/j.1600-0722.1994.tb01182.x
Maeda H, Reibel J, Holmstrup P. Keratin staining pattern in clinically normal and diseased oral mucosa of lichen planus patients. Eur J Oral Sci. 1994;102(4):210–5.10.1111/j.1600-0722.1994.tb01182.x
46. Jacques CM Pereira AL Maia V Cuzzi T Ramos-e-Silva M Expression of cytokeratins 10, 13, 14 and 19 in oral lichen planus J Oral Sci 2009 51 3 355 65 10.2334/josnusd.51.355 19776502
Jacques CM, Pereira AL, Maia V, Cuzzi T, Ramos-e-Silva M. Expression of cytokeratins 10, 13, 14 and 19 in oral lichen planus. J Oral Sci. 2009;51(3):355–65.19776502 10.2334/josnusd.51.355
47. Fillies T Jogschies M Kleinheinz J Brandt B Joos U Buerger H Cytokeratin alteration in oral leukoplakia and oral squamous cell carcinoma Oncol Rep 2007 18 3 639 43 17671713
Fillies T, Jogschies M, Kleinheinz J, Brandt B, Joos U, Buerger H. Cytokeratin alteration in oral leukoplakia and oral squamous cell carcinoma. Oncol Rep. 2007;18(3):639–43.17671713
48. Presland RB Jurevic RJ Making sense of the epithelial barrier: what molecular biology and genetics tell us about the functions of oral mucosal and epidermal tissues J Dent Educ 2002 66 4 564 74 10.1002/j.0022-0337.2002.66.4.tb03536.x 12014572
Presland RB, Jurevic RJ. Making sense of the epithelial barrier: what molecular biology and genetics tell us about the functions of oral mucosal and epidermal tissues. J Dent Educ. 2002;66(4):564–74.12014572 10.1002/j.0022-0337.2002.66.4.tb03536.x
49. Reibel J Prognosis of oral pre-malignant lesions: significance of clinical, histopathological, and molecular biological characteristics Crit Reviews Oral Biology Med 2003 14 1 47 62 10.1177/154411130301400105
Reibel J. Prognosis of oral pre-malignant lesions: significance of clinical, histopathological, and molecular biological characteristics. Crit Reviews Oral Biology Med. 2003;14(1):47–62.10.1177/154411130301400105
50. Takeda T Sugihara K Hirayama Y Hirano M Tanuma JI Semba I Immunohistological evaluation of Ki-67, p63, CK19 and p53 expression in oral epithelial dysplasias J oral Pathol Med 2006 35 6 369 75 10.1111/j.1600-0714.2006.00444.x 16762018
Takeda T, Sugihara K, Hirayama Y, Hirano M, Tanuma JI, Semba I. Immunohistological evaluation of Ki-67, p63, CK19 and p53 expression in oral epithelial dysplasias. J oral Pathol Med. 2006;35(6):369–75.16762018 10.1111/j.1600-0714.2006.00444.x
51. Su L Morgan PR Lane EB Keratin 14 and 19 expression in normal, dysplastic and malignant oral epithelia. A study using in situ hybridization and immunohistochemistry J oral Pathol Med 1996 25 6 293 301 10.1111/j.1600-0714.1996.tb00265.x 8887072
Su L, Morgan PR, Lane EB. Keratin 14 and 19 expression in normal, dysplastic and malignant oral epithelia. A study using in situ hybridization and immunohistochemistry. J oral Pathol Med. 1996;25(6):293–301.8887072 10.1111/j.1600-0714.1996.tb00265.x
52. Rajkumar K Ramya R Nandhini G Rajashree P Ramesh Kumar A Nirmala Anandan S Salivary and serum level of CYFRA 21-1 in oral precancer and oral squamous cell carcinoma Oral Dis 2015 21 1 90 6 10.1111/odi.12216 24304502
Rajkumar K, Ramya R, Nandhini G, Rajashree P, Ramesh Kumar A, Nirmala Anandan S. Salivary and serum level of CYFRA 21-1 in oral precancer and oral squamous cell carcinoma. Oral Dis. 2015;21(1):90–6.24304502 10.1111/odi.12216
53. Garnier P Prigent-Tessier A Van Hoecke M Bertrand N Demougeot C Sordet O Swanson RA Marie C Beley A Hypoxia induces caspase‐9 and caspase‐3 activation without neuronal death in gerbil brains Eur J Neurosci 2004 20 4 937 46 10.1111/j.1460-9568.2004.03551.x 15305862
Garnier P, Prigent-Tessier A, Van Hoecke M, Bertrand N, Demougeot C, Sordet O, Swanson RA, Marie C, Beley A. Hypoxia induces caspase‐9 and caspase‐3 activation without neuronal death in gerbil brains. Eur J Neurosci. 2004;20(4):937–46.15305862 10.1111/j.1460-9568.2004.03551.x
54. Veeravarmal V Austin RD Siddavaram N Thiruneelakandan S Nassar MH Caspase-3 expression in normal oral epithelium, oral submucous fibrosis and oral squamous cell carcinoma J Oral Maxillofacial Pathol 2016 20 3 445 52 10.4103/0973-029X.190947
Veeravarmal V, Austin RD, Siddavaram N, Thiruneelakandan S, Nassar MH. Caspase-3 expression in normal oral epithelium, oral submucous fibrosis and oral squamous cell carcinoma. J Oral Maxillofacial Pathol. 2016;20(3):445–52.10.4103/0973-029X.190947
55. Safadi RA Musleh AS Al-Khateeb TH Hamasha AA Analysis of immunohistochemical expression of k19 in oral epithelial dysplasia and oral squamous cell carcinoma using color deconvolution-image analysis method Head Neck Pathol 2010 4 282 9 10.1007/s12105-010-0210-6 20882374
Safadi RA, Musleh AS, Al-Khateeb TH, Hamasha AA. Analysis of immunohistochemical expression of k19 in oral epithelial dysplasia and oral squamous cell carcinoma using color deconvolution-image analysis method. Head Neck Pathol. 2010;4:282–9.20882374 10.1007/s12105-010-0210-6
56. Khanom R, Sakamoto K, Kumar Pal S, Shimada Y, Morita KI, Omura K, Miki Y, Yamaguchi A. Expression of basal cell keratin 15 and keratin 19 in oral squamous neoplasms represents diverse pathophysiologies.
57. Ernst J Ikenberg K Apel B Schumann DM Huber G Studer G Rordorf T Riesterer O Rössle M Korol D Bredell MG Expression of CK19 is an independent predictor of negative outcome for patients with squamous cell carcinoma of the tongue Oncotarget 2016 7 46 76151 10.18632/oncotarget.12691 27764819
Ernst J, Ikenberg K, Apel B, Schumann DM, Huber G, Studer G, Rordorf T, Riesterer O, Rössle M, Korol D, Bredell MG. Expression of CK19 is an independent predictor of negative outcome for patients with squamous cell carcinoma of the tongue. Oncotarget. 2016;7(46):76151.27764819 10.18632/oncotarget.12691
58. Das RK Anura A Pal M Bag S Majumdar S Barui A Chakraborty C Ray AK Sengupta S Paul RR Chatterjee J Epithelio-mesenchymal transitional attributes in oral sub-mucous fibrosis Exp Mol Pathol 2013 95 3 259 69 10.1016/j.yexmp.2013.08.006 23994666
Das RK, Anura A, Pal M, Bag S, Majumdar S, Barui A, Chakraborty C, Ray AK, Sengupta S, Paul RR, Chatterjee J. Epithelio-mesenchymal transitional attributes in oral sub-mucous fibrosis. Exp Mol Pathol. 2013;95(3):259–69.23994666 10.1016/j.yexmp.2013.08.006
