
==== Front
Exp Ther Med
Exp Ther Med
ETM
Experimental and Therapeutic Medicine
1792-0981
1792-1015
D.A. Spandidos

ETM-28-5-12695
10.3892/etm.2024.12695
Articles
Identification of key genes in diabetic nephropathy based on lipid metabolism
Yang Meng
Wang Jian
Meng Hu
Xu Jian
Xie Yu
Kong Weiying
Department of Nephrology, The First People's Hospital of Yunnan Province, The Affiliated Hospital of Kunming University of Science and Technology, Kunming, Yunnan 650032, P.R. China
Correspondence to: Dr Meng Yang, Department of Nephrology, The First People's Hospital of Yunnan Province, The Affiliated Hospital of Kunming University of Science and Technology, 157 Jinbi Road, Kunming, Yunnan 650032, P.R. China 13648897447@126.com
11 2024
23 8 2024
23 8 2024
28 5 40602 12 2023
20 6 2024
Copyright: © 2024 Yang et al.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
Diabetic nephropathy (DN) is a common systemic microvascular complication of diabetes with a high incidence rate. Notably, the disturbance of lipid metabolism is associated with DN progression. The present study aimed to identify lipid metabolism-related hub genes associated with DN for improved diagnosis of DN. The gene expression profile data of DN and healthy samples (GSE142153) were obtained from the Gene Expression Omnibus database, and the lipid metabolism-related genes were obtained from the Molecular Signatures Database. Differentially expressed genes (DEGs) between DN and healthy samples were analyzed. The weighted gene co-expression network analysis (WGCNA) was performed to examine the relationship between genes and clinical traits to identify the key module genes associated with DN. Next, the Venn Diagram R package was used to identify the lipid metabolism-related genes associated with DN and their protein-protein interaction (PPI) network was constructed. Subsequently, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed. The hub genes were identified using machine-learning algorithms. The Gene Set Enrichment Analysis (GSEA) was used to analyze the functions of the hub genes. The present study also investigated the immune infiltration discrepancies between DN and healthy samples, and assessed the correlation between the immune cells and hub genes. Finally, the expression levels of key genes were verified by reverse transcription-quantitative (RT-q)PCR. The present study determined 1,445 DEGs in DN samples. In addition, 694 DN-related genes in MEyellow and MEturquoise modules were identified by WGCNA. Next, the Venn Diagram R package was used to identify 17 lipid metabolism-related genes and to construct a PPI network. GO analysis revealed that these 17 genes were markedly associated with ‘phospholipid biosynthetic process’ and ‘cholesterol biosynthetic process’, while the KEGG analysis showed that they were enriched in ‘glycerophospholipid metabolism’ and ‘fatty acid degradation’. In addition, SAMD8 and CYP51A1 were identified through the intersections of two machine-learning algorithms. The results of GSEA revealed that the ‘mitochondrial matrix’ and ‘GTPase activity’ were the markedly enriched GO terms in both SAMD8 and CYP51A1. Their KEGG pathways were mainly concentrated in the ‘pathways of neurodegeneration-multiple diseases’. Immune infiltration analysis showed that nine types of immune cells had different expression levels in DN (diseased) and healthy samples. Notably, SAMD8 and CYP51A1 were both markedly associated with activated B cells and effector memory CD8 T cells. Finally, RT-qPCR confirmed the high expression of SAMD8 and CYP51A1 in DN. In conclusion, lipid metabolism-related genes SAMD8 and CYP51A1 may play key roles in DN. The present study provides fundamental information on lipid metabolism that may aid the diagnosis and treatment of DN.

diabetic nephropathy
weighted gene co-expression network analysis
lipid metabolism-related hub genes
immune infiltration
Funding: The present study was supported by the Kunming Medical University Basic Research Joint Project (grant no. 202301AY070001-295).
==== Body
pmcIntroduction

The prevalence of diabetes mellitus is increasing annually worldwide; it is estimated that by 2030, the global diabetic population will reach approximately 4.39 billion (1). Diabetic nephropathy (DN), one of the most common and serious systemic microvascular complications of diabetes (2). A previous study reported a prevalence rate of DN among Chinese adults as high as 30.9% in the diabetic population and identified DN as a major cause of end-stage renal disease (ESRD) worldwide (3). Therefore, it is essential to implement proactive and early preventative and treatment strategies for delaying the progression of DN to ESRD (4-6). The incidence of DN is generally considered to vary based on genetic background and some associated risk factors (7), and DN is considered to result from the interaction between hemodynamic and metabolic factors. Its pathogenesis involves multiple factors and pathways, including lipid metabolism disorders and renal ectopic lipid accumulation (8-10).

DN is mainly characterized by glomerular damage and tubulointerstitial lesions. It has a complex pathogenesis, involving nephritis, interstitial fibrosis (also known as pulmonary fibrosis), renal tubular atrophy and abnormal lipid metabolism (11-14). There is growing evidence that dyslipidemia plays a crucial role in the development of DN (11,15). Patients with DN often present with significant dyslipidemia. In dyslipidemia, high level of triglycerides, low levels of HDL cholesterol and lipoproteins with altered composition are transported and deposited in the kidney. This process activates the inflammatory responses and causes oxidative stress, mitochondrial dysfunction and cell death, thereby damaging the kidney (12,16-19). A previous study has shown that changes in renal triglyceride and cholesterol metabolism can lead to lipid accumulation in DN, and there is a highly significant association between renal function, inflammation and lipid metabolism-related genes (11). Another study explored the role of annexin A1 (ANXA1) in diabetic mice and proximal tubular epithelial cells (PTECs) treated with high glucose plus palmitic acid and found that ANXA1 may regulate lipid metabolism in PTECs, thereby improving disease progression (20). Disordered lipid metabolism is a key factor responsible for DN progression. Ectopic lipid deposition is aggravated in DN, which promotes tubular cell inflammation and apoptosis. As a result, DN-induced pathological changes are further aggravated (21-23). Diacylglycerol, triacylglycerol (TAG), and lysophosphatidylcholine (LPC) are significantly upregulated in patients with DN (19). Among these, phosphatidylethanolamine (PE) is an important multifunctional glycerophospholipid, and its metabolic abnormalities are closely associated with lipid metabolism disorders in DN (24-27). but the regulatory role of lipid metabolism-related genes in DN remains to be elucidated.

Bioinformatics methods are powerful tools for identifying potential key genes involved in a disease. Therefore, they have attracted increasing attention in recent years for analyzing microarray data. The present study investigated the influence of lipid metabolism on DN by analyzing lipid metabolism-related genes through machine-learning algorithms and integrating their potential functional pathways. In addition, it performed immune infiltration analysis to explore the association between key genes of lipid metabolism and immune cells. Finally, it verified these key genes by reverse transcription-quantitative (RT-q)PCR.

Materials and methods

Data source

Gene expression profiles from the GSE142153 dataset (28), comprising data from peripheral blood samples obtained from 23 patients with DN and 10 healthy controls, were downloaded from the Gene Expression Omnibus database (ncbi.nlm.nih.gov/geo/), which was obtained from the GPL6480 platform (Table SI). This dataset included microarray data, which were presented in the form of raw signal intensities or gene expression levels. In addition, 904 lipid metabolism-related genes were acquired from the Molecular Signature Database (https://www.gsea-msigdb.org/gsea/msigdb).

Differential expression analysis

The present study employed the R package limma (29) to analyze the differentially expressed genes (DEGs) between DN and healthy samples in the GSE142153 dataset, based on the criteria |log2FC| >0.5 and P<0.05. Next, the ggplot2(30) and pheatmap (31) packages in R (version 4.0.2, 2020, R-project.org/) were used to generate the volcano plot and heatmap of DEGs, respectively.

Weighted gene co-expression network analysis (WGCNA)

To find the genes linked with DN, the WGCNA package in R (32) was performed to construct a co-expression network based on the 23 DN samples and 10 healthy samples in the GSE142153 dataset. First, to ensure the accuracy of the analysis, these samples were clustered to remove the outliers. Next, to ensure the interactions of genes accord with the scale-free distribution to the maximum extent, the soft threshold of all data was determined. Subsequently, the dissimilarity coefficients of genes were calculated and the systematic clustering tree was obtained. For each gene module, the minimum module size was set as 150 with the criteria of the dynamic tree cutting, and similar modules were merged. Ultimately, the relationships among the modules and clinical traits (DN and healthy) were calculated to identify the key modules (correlation coefficient |cor| ≥0.6, P≤0.05). Module membership (MM) correlation between key module genes and the modules, and the gene significance (GS) correlation between key module genes and clinical traits were further calculated to identify the genes in DN (|MM| >0.8 and |GS| >0.2) (33).

Identification and protein-protein interaction (PPI) of the lipid metabolism-related genes in DN

The present study intersected DEGs, key module genes and 904 lipid metabolism-related genes to identify lipid metabolism-related genes in DN using the Venn Diagram R package (34). The associations among these genes were determined. In addition, a PPI network was constructed using STRING (https://cn.string-db.org/) database (confidence=0.15) (35) to analyze the interaction between the proteins of lipid metabolism-related genes in DN.

Functional enrichment analysis

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed to investigate the potential role of lipid metabolism-related genes in DN using the clusterProfiler R package (36). The results were visualized using GOplot (37) and the enrichplot package (38).

Screening and Gene Set Enrichment Analysis (GSEA) of lipid metabolism-related hub genes in DN

To identify the hub genes of lipid metabolism in DN, two classification models were established using 23 DN and 10 healthy samples: The Least Absolute Shrinkage and Selector Operation (LASSO) algorithm model in R package glmnet (39) and the Support Vector Machine-Recursive Feature Elimination (SVM-RFE) algorithm model in R package e1071(40). The efficiency of these two models was determined using a 10-fold cross-validation method. The intersections of the results obtained using these two models were employed as the lipid metabolism-related hub genes in DN for the subsequent research. In addition, the R package clusterProfiler (36) was used to perform GSEA of the hub genes. The correlations between hub genes and other genes was determined using the default gene sets in the org. Hs. eg. db package (version 3.12.0, bioconductor.org/packages/release/data/annotation/html/org.Hs.eg.db.html). The significance thresholds were |Normalized Enrichment Score (NES)| >1, P<0.05 and q<0.2.

Immune infiltration evaluation

To investigate discrepancies in immune cell infiltration between the DN and healthy samples, the present study evaluated 28 types of immune cell infiltrations in the 23 DN and 10 healthy samples in the GSE142153 dataset using the ‘ssGSEA’ method in the GSVA R package (41). A heatmap was plotted of the ssGSEA scores of immune cells for each sample. The various immune cells between DN and healthy samples were evaluated using Wilcoxon rank-sum test and the results were visualized through the Vioplot package (version 0.3.7; github.com/TomKellyGenetics/vioplot). Ultimately, the Pearson correlation coefficients between each immune cell, the immune cells and hub genes were calculated and visualized using corrplot package in R (42).

RT-qPCR

The present study collected peripheral blood mononuclear cell samples from 10 healthy subjects and 10 patients with DN from the First People's Hospital of Yunnan Province (Kunming, China). The patient samples were collected between 1 and 30 March, 2022. All subjects provided written informed consent before participating in the study. The present study was approved by the Ethics Committee of The First People's Hospital of Yunnan Province (approval no. 2022GJ227).

First, RNA was extracted using TRlzol® (Invitrogen; Thermo Fisher Scientific, Inc.). RT was performed with SweScript First-Strand cDNA Synthesis Kit (Servicebio, Wuhan, China) according to the manufacturer's protocols. qPCR) was performed strictly according to the manufacturer's instructions for 2xUniversal Blue SYBR Green qPCR Master Mix (Servicebio, Wuhan, China). qPCR reaction mixture comprised 3 µl of cDNA, 5 µl of 2xUniversal Blue SYBR Green qPCR Master Mix (Servicebio, Wuhan, China) and 1 µl of forward and reverse primer (Tsingke, China) also at a concentration of 10 µM. qPCR was performed using the CFX96 Real-Time PCR Detection System (Bio-Rad, China) according to the following steps: pre-denaturation at 95˚C for 1 min, followed by 40 cycles of denaturation at 95˚C for 20 sec, annealing at 55˚C for 20 sec, and extension at 72˚C for 30 sec. GAPDH was used as the internal reference gene, and the relative expression levels of key genes were calculated using the 2-ΔΔCq method (43). All systematic analyses were performed in triplicate. qPCR primer sequences are shown in Table I.

Statistical analysis

All analyses were carried out in R language (version 4.0.2). Differences between groups were analyzed by Wilcoxon rank-sum test. P<0.05. The Independent-samples t-test was employed. Assuming normal distribution and equal variances, the mean and SEM) were calculated for each group. All systematic analyses were performed in triplicate.

Results

Identification of DEGs

The present study identified 1,445 DEGs between the DN and healthy samples in the GSE142153 dataset. Among the DEGs present in DN samples, 707 genes were upregulated and 738 were downregulated. A volcano plot and a heatmap of these genes are in Fig. 1.

Screening of genes in key modules by WGCNA

A sample clustering tree after excluding the outliers (GSM4221586) was plotted (Fig. 2A and B). The network accorded with the scale-free distribution to the maximum extent possible when the soft threshold was 7 (Fig. 2C). After determining the soft threshold, the gene dendrogram was constructed and 15 co-expression modules were found by setting the minimum module size at 150 (Fig. 2D). The correlations among the modules and DN and healthy samples showed that MEyellow was positively correlated with DN, whereas MEturquoise had a negative correlation with DN (Fig. 2E). Finally, 694 DN-related genes in MEyellow and MEturquoise with |MM| >0.8 and |GS| >0.2 were identified (Fig. 2F and G).

Identification and PPI of the lipid metabolism-related genes in DN

A Venn diagram was used to identify 17 genes associated with lipid metabolism in DN through the intersections of 1,445 DEGs, 694 DN-related genes in the MEyellow and MEturquoise modules, and 904 lipid metabolism-related genes (Fig. 3A). The correlation analysis among these 17 genes demonstrated a strong correlation between IDI1 and PTS (Fig. 3B). The aforementioned 17 lipid metabolism-related genes were then uploaded into the STRING database. However, the SAMD8 and TNFAIP8L2 genes were excluded from the STRING database as they did not show any interaction. Next, a PPI network of 15 genes with a confidence of 0.15 was constructed. The degree scores of these 15 genes are shown in a bar chart (Fig. 3C and D).

Functional enrichment analyses

GO and KEGG functional enrichment analyses were conducted to investigate the potential functions of the 17 lipid metabolism-related genes implicated in DN. Notably, 5 KEGG pathways and 23 GO entries belonging to the biological process (BP) category were identified (P.adjust <0.05 and count >2). The BP results showed that these 17 lipid metabolism-related genes were closely associated with the ‘phospholipid biosynthetic process’, ‘alcohol biosynthetic process’ and ‘cholesterol biosynthetic process’ (Fig. 4A). The KEGG analysis demonstrated that the markedly enriched pathways associated with these genes included ‘glycerophospholipid metabolism’, ‘steroid biosynthesis’ and ‘fatty acid degradation’ (Fig. 4B).

Identification and GSEA of hub genes

To identify hub genes among the aforementioned 17 lipid metabolism-related genes, LASSO and SVM-RFE algorithm models were established based on the data obtained from 23 DN samples and 10 healthy samples. LASSO algorithm identified four genes as feature genes (Fig. 5A and B). Three genes were identified as feature genes by the SVM-RFE algorithm (Fig. 5C), which are the first three genes in Table SII. The intersections of these two algorithm models revealed two overlapping genes, SAMD8 and CYP51A1 (Fig. 5D). The top 10 most important GO and KEGG terms of the GSEA results of SAMD8 and CYP51A1 were screened. ‘mitochondrial matrix’ and ‘GTPase activity’ were identified as the common markedly enriched GO term in both SAMD8 and CYP51A1 (Fig. 5E and G). The following common markedly enriched KEGG pathways for SAMD8 and CYP51A1 were identified: ‘Alzheimer disease’, ‘IL-17 signaling pathway’, ‘pathways of neurodegeneration-multiple diseases’ and ‘TGF-beta signaling pathway’ (Fig. 5F and H).

Immune infiltration analysis

The ssGSEA was employed to evaluate the infiltration levels of 28 immune cell types in both DN and healthy samples. A heatmap displaying the ssGSEA scores is shown in Fig. 6A. A total of nine immune cell types were significantly different between DN and healthy samples: Activated B cells, CD56bright natural killer cells, effector memory CD4 T cells, effector memory CD8 T cells, mast cells, memory B cells, plasmacytoid dendritic cells, T follicular helper cells and type 1 T helper cells. These cell types exhibited significant differences between the DN and healthy samples, as visualized using a violin chart (Fig. 6B). Furthermore, the Pearson correlation coefficients of the immune cell types showed that monocytes exhibited a markedly positive correlation with plasmacytoid and immature dendritic cells (Fig. 6C). Finally, the Pearson correlation coefficients between immune cells and hub genes (SAMD8 and CYP51A1) were calculated. SAMD8 and CYP51A1 were both correlated with the activated B cells, effector memory CD8 T cells, memory B cells and T follicular helper cells (|cor| >0.4; Fig. 6D and E).

Expression of SAMD8 and CYP51A1

The RT-qPCR analysis showed a higher expression of SAMD8 and CYP51A1 in DN samples than in those from normal subjects, which was consistent with the aforementioned results of the present study (Fig. 7A and B).

Discussion

Lipid metabolism plays an important role in the progression of DN, but the specific mechanism of action between the two remains to be elucidated. The present study identified two hub genes, SAMD8 and CYP51A1, using LASSO and SVM-RFE algorithms. SAMD8, which encodes sphingomyelin synthase-related protein (SMSr), is located in the cytosol and endoplasmic reticulum, and acts as a component of the endoplasmic reticulum membrane (44). SAMD8 can participate in the regulation of ceramide biosynthesis by activating ceramide choline phosphotransferase and sphingomyelin synthase activities. Tafesse et al (45) reported that SAMD8 acts as a suppressor of ceramide-mediated apoptosis. Notably, disruption of the catalytic activity of SMSr can increase the endoplasmic reticulum ceramide levels and mislocalize them to the mitochondria, triggering the mitochondrial apoptosis pathway (45). The association between ceramide and DN has been reported (46). Notably, ceramides are abundant in the kidney, and they regulate diverse cellular events, including differentiation, growth arrest and apoptosis (47-49). Studies on humans and animal models have demonstrated that the accumulation of lipids and their metabolites in tissues, including those of the kidney, can cause lipid toxicity (50,51). Reducing the accumulation of ceramide may improve insulin resistance, steatohepatitis and other metabolic disorders (52). Therefore, it was hypothesized that SAMD8 could be implicated in DN by affecting the synthesis of ceramide.

CYP51A1, a member of the cytochrome P450 superfamily of enzymes, catalyzes the removal of the 14-methyl group in lanosterol, a key step in the synthesis of cholesterol (53,54). Patients with DN are characterized by an increased plasma concentration of cholesterol (15), reduced expression of lipoprotein lipase, disruption of reverse cholesterol transport and reduced number of receptors mediating lipid uptake (8). Therefore, CYP51A1 could be involved in the development of DN by regulating cholesterol synthesis. However, to the best of our knowledge, the role of SAMD8 and CYP51A1 in DN has not been reported, and the present study was the first to discover the role of two key genes in DN, which may provide a new target for the treatment of DN.

The KEGG analysis of the 17 lipid metabolism-related genes identified the following representative pathways: ‘Glycerophospholipid metabolism’, ‘steroid biosynthesis’ and ‘fatty acid degradation’. Notably, all the terms (‘phospholipid biosynthetic process’, ‘alcohol biosynthetic process’, and ‘cholesterol biosynthetic process’) identified through GO analysis are from the BP category. Studies have shown that abdominal subcutaneous fat deposition and elevated non-esterified fatty acids (NEFA) in plasma, which are characteristics of patients with type 2 diabetes, contribute to the development and progression of lipotoxicity (55,56). Dyslipidemia and insulin resistance can disturb the function of adipose tissue, causing an increase in the plasma concentrations of NEFA, and an imbalance between pro- and anti-inflammatory adipokines (57). This process activates intracellular lipid metabolism-related pathways, thereby promoting the deposition of fatty acids in non-adipose tissues (58). The resulting micro-inflammatory state and production of reactive oxygen species can induce lipids to undergo oxidative stress modification. The modified lipids participate in intercellular signal transduction and exacerbate inflammation, oxidative stress and lipid peroxidation (14). This cascade of events can cause cells to employ adaptive protective mechanisms of mitophagy, autophagy and apoptosis, thereby damaging the cells (18,59).

In contrast to healthy subjects, various immune cell types (activated B cells, CD56bright natural killer cells, effector memory CD4 T cells, effector memory CD8 T, mast cells, memory B cells, plasmacytoid dendritic cells, T follicular helper cells and type 1 T helper cells) exhibited different levels in patients with DN, as shown by the immune infiltration analysis. Previous studies have demonstrated that patients with DN often present with renal inflammation, which is closely associated with the onset and progression of DN (60-63). Wilson et al (64) reported immune cell infiltration and abnormal angiogenesis as early indicators of DN. Elevated monocyte counts and monocyte:HDL ratio can be detected in patients with DN, suggesting that monocytes play a key role in the inflammatory response to DN (65-67). According to the conventional pathological mechanisms of DN, in addition to altered hemodynamics, factors such as advanced glycation end products (AGE), oxidized lipids, free radicals and fatty acids produced from numerous biological mechanisms of glucotoxicity and lipotoxicity can cause inflammatory responses (68,69). The presence of AGE receptors in macrophages, endothelial cells and mesenchymal cells allows monocyte activation and the subsequent release of inflammatory cytokines (IL-1, IL-6, IL-18, CRP and TNF-α) (66). Monocyte activation can lead to chronic inflammation and atherosclerosis in the kidney (70). Long term, these alterations can change renal hemodynamics, glomerular filtration rate and blood pressure (71). Notably, the key genes identified in the present study, SAMD8 and CYP51A1, were correlated with various immune cell types, such as activated B cells, effector memory CD8 T cells, memory B cells and T follicular helper cells. Hence, it may be suggested that these two genes could influence the development of DN not only through lipid metabolism but also by mediating the related immune processes.

There were certain limitations in the present study. Firstly, despite attempts to select a dataset with the largest possible sample size for analysis, the small sample size remained a drawback. Subsequently, the expression of SAMD8 and CYP51A1 was validated using RT-qPCR; however, protein-level validation was not performed and further investigation into the underlying mechanism was also lacking. However, the present study has some significance. It identified the key genes related to lipid metabolism in DN for the first time, and explored the signaling pathways enriched by these key genes and their relationship with the immune environment through enrichment analysis and immune infiltration analysis. The present study offers valuable insights for elucidating the relationship between DN and lipid metabolism, and for providing a new reference point for clinical treatment and diagnosis of DN. Next, the mechanism of key genes in DN will be further verified through animal modeling.

In conclusion, the present study demonstrated that SAMD8 and CYP51A1 were key hub genes responsible for lipid metabolism in DN. They were markedly upregulated in DN and closely related to the immune response in DN.

Supplementary Material

GSE142153 clinical dataset

Model feature gene ranking table.

Acknowledgements

Not applicable.

Availability of data and materials

The data analyzed in the present study may be found in the GEO database under accession number GSE142153 or at the following URL: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi. The other data generated in the present study may be requested from the corresponding author.

Authors' contributions

MY wrote the manuscript and made substantial contributions to conception and design. JW and HM were responsible for data analysis and processing. JX and YX interpreted data. WK collected clinical samples and performed qPCR experiments. MY and JW confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of The First People's Hospital of Yunnan Province (approval no. 2022GJ227). Written informed consent was obtained from all participants.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Figure 1 Analysis of differentially expressed genes. (A) Volcano plot of differences between DN and healthy groups. Red dots indicate that the gene expression is upregulated (DN vs. healthy samples), blue dots indicate that the gene expression is downregulated, and black dots indicate the difference is not significant. (B) Heatmap plot of differences between DN and healthy groups. Blue represents DN samples and red represents control samples. The higher the expression, the darker the color. DN, diabetic nephropathy.

Figure 2 WGCNA. (A) Sample dendrogram and trait heatmap. The clustering was based on the expression data of DN samples. The genes with the highest average expression values were used for WGCNA. The red color was proportional to DN trait. (B) Cluster analysis of DN samples. The red line was used to distinguish the outlier samples. The threshold was set as 140 and one outlier sample, that is, GSM4221586, was identified. (C) Soft threshold filtering. Analysis of the scale-free fit index for various soft-thresholding powers (β). Analysis of the mean connectivity for various soft thresholding powers. In all, 7 was the greatest fit power value. (D) Gene dendrogram and module colors. The cluster dendrogram of co-expression genes in DN. Each branch in the figure represents one gene and every color below represents one co-expression module. (E) Heatmap of association between module eigengenes and DN. The turquoise and yellow modules were the most associated with DN. (F) Module membership in yellow module was the most positively corelated with DN. (G) Module membership in turquoise module was the most negatively corelated with DN. DN, diabetic nephropathy; WGCNA, weighted gene co-expression network analysis.

Figure 3 PPI network of hub genes. (A) A Venn diagram revealed 17 key genes among lipid metabolism-related genes, Module Gene and DEGs by overlapping them. (B) Expression correlation analysis revealed IDI1 and PTS had a notable correlation among these 17 genes. (C) PPI network of 15 genes, removing SAMD8 and TNFAIP8L2. Edges indicate interaction between two genes. Degree indicates the number of edges directly connected to a node. A node with a higher Degree has more connections in the network and thus exerts greater influence. (D) Degree scores of the PPI network. DEGs, differentially expressed genes; PPI, protein-protein network.

Figure 4 GO and KEGG functional enrichment analyses. (A) GO functional enrichment analysis, listing the top 10 GO entries. (B) Most enriched KEGG pathways. The x-axis shows the ratio number of genes and the y-axis shows the KEGG pathway terms. GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure 5 Identification of hub genes. (A) LASSO logistic coefficient penalty plot. Each curve represents the change of the coefficient of each independent variable. (B) Misclassification error plot. The x-axis is log λ and the y-axis is the cross-validation error. The lowest error rate was achieved when λ.min=0.0948, four genes were identified as signature genes. (C) SVM-RFE algorithm, obtaining three signature genes. The y-axis shows the accuracy under different features. After selecting the first three features, the model achieved the highest accuracy. (D) Venn diagram of two overlapping genes (SAMD8 and CYP51A1) obtained through the intersections of LASSO and SVM models. (E) GSEA, the top 10 most important GO terms in SAMD8. (F) GSEA, the top 10 most important KEGG pathways of SAMD8. (G) GSEA, the top 10 most important GO terms in CYP51A1. (H) GSEA, the top 10 most important KEGG pathways of CYP51A1. LASSO, Least Absolute Shrinkage and Selector Operation; SVM, support vector machines; RFE, recursive feature elimination; GSEA, Gene Set Enrichment Analysis; GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure 6 Analysis of immune cell infiltration landscape. (A) Heatmap of the infiltration of 28 immune cells into the DN and healthy samples. (B) Violin chart of immune cell infiltration score. There were nine immune cell types were significantly different in DN and healthy samples (P<0.05). (C) Pearson correlation coefficients among all immune cells. Red indicates positive correlation; blue indicates negative correlation. (D) Pearson correlation coefficients among immune cells and the hub gene SAMD8. (E) Pearson correlation coefficients among immune cells and the hub gene CYP51A1. Both SAMD8 and CYP51A1 were correlated with activated B cell, effector memory CD8 T cell, memory B cell and T follicular helper cell (|cor| >0.5, P<0.05). DN, diabetic nephropathy.

Figure 7 Reverse transcription-quantitative PCR validation. (A) Higher expression of CYP51A1 in DN blood samples. (B) Higher expression of SAMD8 in DN blood samples. ****P<0.0001. DN, diabetic nephropathy; N, normal.

Table I Reverse transcription-quantitative PCR primer sequences.

Primer	Sequence, 5'-3')	
SAMD8	F: CCTTTCATCAGTGCTCTTCAGA	
 	R: AATCATGCCACATACTTCCGTC	
CYP51A1	F: TAAGGCAATCCAGAAACGCA	
 	R: CCAAAAAGAAGCCCATCCAA	
β-actin	F: GGAAGGTGAAGGTCGGAGT	
 	R: TGAGGTCAATGAAGGGGTC	
F, forward; R, reverse.
==== Refs
References

1 Thipsawat S Early detection of diabetic nephropathy in patient with type 2 diabetes mellitus: A review of the literature Diab Vasc Dis Res 18 14791641211058856 2021 10.1177/14791641211058856 34791910
2 Saran R Robinson B Abbott KC Bragg-Gresham J Chen X Gipson D Gu H Hirth RA Hutton D Jin Y US renal data system 2019 annual data report: Epidemiology of kidney disease in the United States Am J Kidney Dis 75 (1 Suppl 1) A6 A7 2020 10.1053/j.ajkd.2019.09.003 31704083
3 Zhou Y Echouffo-Tcheugui JB Gu JJ Ruan XN Zhao GM Xu WH Yang LM Zhang H Qiu H Narayan KM Sun Q Prevalence of chronic kidney disease across levels of glycemia among adults in Pudong New Area, Shanghai, China BMC Nephrology 14 253 2013 10.1186/1471-2369-14-253 24238578
4 Kawanami D Matoba K Utsunomiya K Signaling pathways in diabetic nephropathy Histol Histopathol 31 1059 1067 2016 10.14670/HH-11-777 27094540
5 Quan KY Yap CG Jahan NK Pillai N Review of early circulating biomolecules associated with diabetes nephropathy-Ideal candidates for early biomarker array test for DN Diabetes Res Clin Pract 182 109122 2021 10.1016/j.diabres.2021.109122 34742785
6 Samsu N Diabetic Nephropathy: Challenges in Pathogenesis, Diagnosis, and Treatment Biomed Res Int 2021 1497449 2021 10.1155/2021/1497449 34307650
7 Magee C Grieve DJ Watson CJ Brazil DP Diabetic nephropathy: A tangled web to unweave Cardiovasc Drugs 31 579 592 2017 10.1007/s10557-017-6755-9 28956186
8 Vaziri ND Disorders of lipid metabolism in nephrotic syndrome: Mechanisms and consequences Kidney Int 90 41 52 2016 10.1016/j.kint.2016.02.026 27165836
9 Cooper ME Interaction of metabolic and haemodynamic factors in mediating experimental diabetic nephropathy Diabetologia 44 1957 1972 2001 10.1007/s001250100000 11719827
10 Forbes JM Fukami K Cooper ME Diabetic nephropathy: Where hemodynamics meets metabolism Exp Clin Endocrinol Diabetes 115 69 84 2007 10.1055/s-2007-949721 17318765
11 Herman-Edelstein M Scherzer P Tobar A Levi M Gafter U Altered renal lipid metabolism and renal lipid accumulation in human diabetic nephropathy J Lipid Res 55 561 572 2014 10.1194/jlr.P040501 24371263
12 Yang W Luo Y Yang S Zeng M Zhang S Liu J Han Y Liu Y Zhu X Wu H Ectopic lipid accumulation: Potential role in tubular injury and inflammation in diabetic kidney disease Clin Sci (Lond) 132 2407 2422 2018 10.1042/CS20180702 30348828
13 Vallon V Thomson SC The tubular hypothesis of nephron filtration and diabetic kidney disease Nat Rev Nephrol 16 317 336 2020 10.1038/s41581-020-0256-y 32152499
14 Baum P Toyka KV Blüher M Kosacka J Nowicki M Inflammatory mechanisms in the pathophysiology of diabetic peripheral neuropathy (DN)-New aspects Int J Mol Sci 22 10835 2021 10.3390/ijms221910835 34639176
15 Kawanami D Matoba K Utsunomiya K Dyslipidemia in diabetic nephropathy Ren Replace Ther 2 16 2016
16 Lu CC Ma KL Ruan XZ Liu BC The emerging roles of microparticles in diabetic nephropathy Int J Biol Sci 13 1118 1125 2017 10.7150/ijbs.21140 29104503
17 Ferrara D Montecucco F Dallegri F Carbone F Impact of different ectopic fat depots on cardiovascular and metabolic diseases J Cell Physiol 234 21630 21641 2019 10.1002/jcp.28821 31106419
18 Nishi H Higashihara T Inagi R Lipotoxicity in kidney, heart, and skeletal muscle dysfunction Nutrients 11 1664 2019 10.3390/nu11071664 31330812
19 Xu T Xu X Zhang L Zhang K Wei Q Zhu L Yu Y Xiao L Lin L Qian W Lipidomics reveals serum specific lipid alterations in diabetic nephropathy Front Endocrinol (Lausanne) 12 781417 2021 10.3389/fendo.2021.781417 34956093
20 Wu L Liu C Chang DY Zhan R Zhao M Man Lam S Shui G Zhao MH Zheng L Chen M The attenuation of diabetic nephropathy by annexin A1 via regulation of lipid metabolism through the AMPK/PPARα/CPT1b pathway Diabetes 70 2192 2203 2021 10.2337/db21-0050 34103347
21 Thongnak L Pongchaidecha A Lungkaphin A Renal lipid metabolism and lipotoxicity in diabetes Am J Med Sci 359 84 99 2020 10.1016/j.amjms.2019.11.004 32039770
22 Zhao YH Fan YJ Resveratrol improves lipid metabolism in diabetic nephropathy rats Front Biosci (Landmark Ed) 25 1913 1924 2020 10.2741/4885 32472765
23 Han Y Xiong S Zhao H Yang S Yang M Zhu X Jiang N Xiong X Gao P Wei L Lipophagy deficiency exacerbates ectopic lipid accumulation and tubular cells injury in diabetic nephropathy Cell Death Dis 12 1031 2021 10.1038/s41419-021-04326-y 34718329
24 Patel D Witt SN Ethanolamine and Phosphatidylethanolamine: Partners in health and disease Oxid Med Cell Longev 2017 4829180 2017 10.1155/2017/4829180 28785375
25 van der Veen JN Kennelly JP Wan S Vance JE Vance DE Jacobs RL The critical role of phosphatidylcholine and phosphatidylethanolamine metabolism in health and disease Biochim Biophys Acta Biomembr 1859 (9 Pt B) 1558 1572 2017 10.1016/j.bbamem.2017.04.006 28411170
26 Ravandi A Kuksis A Shaikh NA Glucosylated Glycerophosphoethanolamines are the Major LDL glycation products and increase LDL susceptibility to oxidation evidence of their presence in atherosclerotic lesions Arterioscler Thromb Vasc Biol 20 467 477 2000 10.1161/01.atv.20.2.467 10669645
27 Vlassara H Palace MR Glycoxidation: The menace of diabetes and aging Mt Sinai J Med 70 232 241 2003 12968196
28 Sur S Nguyen M Boada P Sigdel TK Sollinger H Sarwal MM FcER1: A novel molecule implicated in the progression of human diabetic kidney disease Front Immunol 12 769972 2021 10.3389/fimmu.2021.769972 34925339
29 Ritchie ME Phipson B Wu D Hu Y Law CW Shi W Smyth GK limma powers differential expression analyses for RNA-sequencing and microarray studies Nucleic Acids Res 43 e47 2015 10.1093/nar/gkv007 25605792
30 Ito K Murphy D Application of ggplot2 to Pharmacometric Graphics CPT Pharmacometrics Syst Pharmacol 2 e79 2013 10.1038/psp.2013.56 24132163
31 Hu K Become competent in generating RNA-Seq heat maps in one day for novices without prior R experience Methods Mol Biol 2239 269 303 2021 10.1007/978-1-0716-1084-8_17 33226625
32 Chen H Boutros PC VennDiagram: A package for the generation of highly-customizable Venn and Euler diagrams in R BMC Bioinformatics 12 35 2011 10.1186/1471-2105-12-35 21269502
33 Tang J Kong D Cui Q Wang K Zhang D Gong Y Wu G Prognostic genes of breast cancer identified by gene co-expression network analysis Front Oncol 8 374 2018 10.3389/fonc.2018.00374 30254986
34 Langfelder P Horvath S WGCNA: An R package for weighted correlation network analysis BMC Bioinformatics 9 559 2008 10.1186/1471-2105-9-559 19114008
35 Szklarczyk D Gable AL Nastou KC Lyon D Kirsch R Pyysalo S Doncheva NT Legeay M Fang T Bork P The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets Nucleic Acids Res 49 (D1) D605 D612 2021 10.1093/nar/gkaa1074 33237311
36 Wu T Hu E Xu S Chen M Guo P Dai Z Feng T Zhou L Tang W Zhan L clusterProfiler 4.0: A universal enrichment tool for interpreting omics data Innovation (Camb) 2 100141 2021 10.1016/j.xinn.2021.100141 34557778
37 Walter W Sanchez-Cabo F Ricote M GOplot: An R package for visually combining expression data with functional analysis Bioinformatics 31 2912 2914 2015 10.1093/bioinformatics/btv300 25964631
38 Xu Q Xu H Deng R Wang Z Li N Qi Z Zhao J Huang W Multi-omics analysis reveals prognostic value of tumor mutation burden in hepatocellular carcinoma Cancer Cell Int 21 342 2021 10.1186/s12935-021-02049-w 34217320
39 Zhang M Zhu K Pu H Wang Z Zhao H Zhang J Wang Y An immune-related signature predicts survival in patients with lung adenocarcinoma Front Oncol 9 1314 2019 10.3389/fonc.2019.01314 31921619
40 Sanz H Valim C Vegas E Oller JM Reverter F SVM-RFE: Selection and visualization of the most relevant features through non-linear kernels BMC Bioinformatics 19 432 2018 10.1186/s12859-018-2451-4 30453885
41 Hänzelmann S Castelo R Guinney J GSVA: Gene set variation analysis for microarray and RNA-seq data BMC Bioinformatics 14 7 2013 10.1186/1471-2105-14-7 23323831
42 Pei L Li J Xu Z Chen N Wu X Chen J Effect of high hydrostatic pressure on aroma components, amino acids, and fatty acids of Hami melon (Cucumis melo L. var. reticulatus naud.) juice Food Sci Nutr 8 1394 1405 2020 10.1002/fsn3.1406 32180949
43 Strezoska Ž Licon A Haimes J Spayd KJ Patel KM Sullivan K Jastrzebski K Simpson KJ Leake D van Brabant Smith A Vermeulen A Optimized PCR conditions and increased shRNA fold representation improve reproducibility of pooled shRNA screens PLoS One 7 e42341 2012 10.1371/journal.pone.0042341 22870320
44 Cabukusta B Nettebrock NT Kol M Hilderink A Tafesse FG Holthuis JCM Ceramide phosphoethanolamine synthase SMSr is a target of caspase-6 during apoptotic cell death Biosci Rep 37 BSR20170867 2017 10.1042/BSR20170867 28659495
45 Tafesse FG Vacaru AM Bosma EF Hermansson M Jain A Hilderink A Somerharju P Holthuis JC Sphingomyelin synthase-related protein SMSr is a suppressor of ceramide-induced mitochondrial apoptosis J Cell Sci 127 (Pt 2) 445 454 2014 10.1242/jcs.138933 24259670
46 Srivastava SP Shi S Koya D Kanasaki K Lipid mediators in diabetic nephropathy Fibrogenesis Tissue Repair 7 12 2014 10.1186/1755-1536-7-12 25206927
47 Woodcock J Sphingosine and ceramide signalling in apoptosis IUBMB Life 58 462 466 2006 10.1080/15216540600871118 16916783
48 Tani M Ito M Igarashi Y Ceramide/sphingosine/sphingosine 1-phosphate metabolism on the cell surface and in the extracellular space Cell Signal 19 229 237 2007 10.1016/j.cellsig.2006.07.001 16963225
49 Kuzmenko DI Klimentyeva TK Role of ceramide in apoptosis and development of insulin resistance Biochemistry (Mosc) 81 913 927 2016 10.1134/S0006297916090017 27682164
50 Summers SA The ART of lowering ceramides Cell Metab 22 195 196 2015 10.1016/j.cmet.2015.07.019 26244926
51 Symons JD Abel ED Lipotoxicity contributes to endothelial dysfunction: A focus on the contribution from ceramide Rev Endocr Metab Disord 14 59 68 2013 10.1007/s11154-012-9235-3 23292334
52 Chavez JA Summers SA A ceramide-centric view of insulin resistance Cell Metab 15 585 594 2012 10.1016/j.cmet.2012.04.002 22560211
53 Park JW Byrd A Lee CM Morgan ET Nitric oxide stimulates cellular degradation of human CYP51A1, the highly conserved lanosterol 14α-demethylase Biochem J 474 3241 3252 2017 10.1042/BCJ20170459 28830911
54 Kaluzhskiy L Ershov P Yablokov E Shkel T Grabovec I Mezentsev Y Gnedenko O Usanov S Shabunya P Fatykhava S Human Lanosterol 14-Alpha Demethylase (CYP51A1) is a putative target for natural flavonoid luteolin 7,3'-Disulfate Molecules 26 2237 2021 10.3390/molecules26082237 33924405
55 Opazo-Ríos L Mas S Marín-Royo G Mezzano S Gómez-Guerrero C Moreno JA Egido J Lipotoxicity and diabetic nephropathy: Novel mechanistic insights and therapeutic opportunities Int J Mol Sci 21 2632 2020 10.3390/ijms21072632 32290082
56 Charles MA Eschwège E Thibult N Claude JR Warnet JM Rosselin GE Girard J Balkau B The role of non-esterified fatty acids in the deterioration of glucose tolerance in Caucasian subjects: Results of the Paris Prospective Study Diabetologia 40 1101 1106 1997 10.1007/s001250050793 9300248
57 Meex RCR Blaak EE van Loon LJC Lipotoxicity plays a key role in the development of both insulin resistance and muscle atrophy in patients with type 2 diabetes Obes Rev 20 1205 1217 2019 10.1111/obr.12862 31240819
58 Gai Z Wang T Visentin M Kullak-Ublick GA Fu X Wang Z Lipid accumulation and chronic kidney disease Nutrients 11 722 2019 10.3390/nu11040722 30925738
59 Jaishy B Abel ED Lipids, lysosomes, and autophagy J Lipid Res 57 1619 1635 2016 10.1194/jlr.R067520 27330054
60 Pérez-Morales RE Del Pino MD Valdivielso JM Ortiz A Mora-Fernández C Navarro-González JF Inflammation in diabetic kidney disease Nephron 143 12 16 2019 10.1159/000493278 30273931
61 Shao BY Zhang SF Li HD Meng XM Chen HY Epigenetics and inflammation in diabetic nephropathy Front Physiol 12 649587 2021 10.3389/fphys.2021.649587 34025445
62 Wang Y Zhao M Zhang Y Identification of fibronectin 1 (FN1) and complement component 3 (C3) as immune infiltration-related biomarkers for diabetic nephropathy using integrated bioinformatic analysis Bioengineered 12 5386 5401 2021 10.1080/21655979.2021.1960766 34424825
63 Huang M Zhu Z Nong C Liang Z Ma J Li G Bioinformatics analysis identifies diagnostic biomarkers and their correlation with immune infiltration in diabetic nephropathy Ann Transl Med 10 669 2022 10.21037/atm-22-1682 35845512
64 Wilson PC Wu H Kirita Y Uchimura K Ledru N Rennke HG Welling PA Waikar SS Humphreys BD The single-cell transcriptomic landscape of early human diabetic nephropathy Proc Natl Acad Sci USA 116 19619 19625 2019 10.1073/pnas.1908706116 31506348
65 Onalan E The relationship between monocyte to high-density lipoprotein cholesterol ratio and diabetic nephropathy Pak J Med Sci 35 1081 1086 2019 10.12669/pjms.35.4.534 31372147
66 Huang Q Wu H Wo M Ma J Fei X Song Y Monocyte-lymphocyte ratio is a valuable predictor for diabetic nephropathy in patients with type 2 diabetes Medicine (Baltimore) 99 e20190 2020 10.1097/MD.0000000000020190 32384513
67 Efe FK The association between monocyte HDL ratio and albuminuria in diabetic nephropathy Pak J Med Sci 37 1128 1132 2021 10.12669/pjms.37.4.3882 34290795
68 Ancuta P Wang J Gabuzda D CD16+ monocytes produce IL-6, CCL2, and matrix metalloproteinase-9 upon interaction with CX3CL1-expressing endothelial cells J Leukoc Biol 80 1156 1164 2006 10.1189/jlb.0206125 17056766
69 Tang G Li S Zhang C Chen H Wang N Feng Y Clinical efficacies, underlying mechanisms and molecular targets of Chinese medicines for diabetic nephropathy treatment and management Acta Pharm Sin B 11 2749 2767 2021 10.1016/j.apsb.2020.12.020 34589395
70 Ji L Chen Y Wang H Zhang W He L Wu J Liu Y Overexpression of Sirt6 promotes M2 macrophage transformation, alleviating renal injury in diabetic nephropathy Int J Oncol 55 103 115 2019 10.3892/ijo.2019.4800 31115579
71 Wolf G New insights into the pathophysiology of diabetic nephropathy: From haemodynamics to molecular pathology Eur J Clin Invest 34 785 796 2004 10.1111/j.1365-2362.2004.01429.x 15606719
