
==== Front
Transl Oncol
Transl Oncol
Translational Oncology
1936-5233
Neoplasia Press

S1936-5233(23)00070-0
10.1016/j.tranon.2023.101684
101684
Original Research
CREB3 facilitates Donafenib resistance in hepatocellular carcinoma cells via the LSD1/CoREST/p65 axis by transcriptionally activating long noncoding RNA ZFAS1
Hou Xunbo a#
Xu Qiannan b#
Liu Ruibao xunbohou@hotmail.com
a⁎
a Department of Interventional, Harbin Medical University Cancer Hospital, No. 150, Haping Rd, Nangang District, Harbin, Heilongjiang 150081, PR China
b Department of Anesthesiology, The Fourth Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150001, PR China
⁎ Corresponding author. xunbohou@hotmail.com
# Xunbo Hou and Qiannan Xu contributed equally to this research.

29 11 2023
6 2024
29 11 2023
44 1016849 2 2023
11 4 2023
27 4 2023
© 2023 The Authors. Published by Elsevier Inc.
2023

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Highlights

• ZFAS1 expression is high in Donafenib-resistant HCC cells;.

• Silencing ZFAS1 promotes the sensitivity of HCC cells to Donafenib;.

• CREB3 is upregulated in DR HCC cells and induces ZFAS1 expression;.

• ZFAS1 recruits LSD1/CoREST to p65 promoter to elevate p65;.

• CREB3 promotes Donafenib resistance in HCC cells by elevating p65 expression.

Objective

Drug resistance greatly limits the therapeutic effect of a drug. This study aimed to explore the role of long noncoding RNA ZFAS1 in Donafenib resistance of hepatocellular carcinoma (HCC) cells.

Methods

The expression of CREB3, ZFAS1, and p65 in HCC cell lines was measured by RT-qPCR and western blotting. After transfection with sh-ZFAS1, sh-CREB3, or sh-CREB3 + oe-p65 in Donafenib-resistent (DR) HCC cell lines, the transfection efficiency was evaluated by RT-qPCR and western blotting. The proliferation and IC50 to Donafenib of HCC cell lines was examined by MTT assay. Cell proliferation and apoptosis were examined by colony formation and flow cytometry assays. Then, the correlation amongst CREB3, ZFAS1, LSD1/CoREST, and p65 was analysed by ChIP, dual-luciferase reporter gene, and RIP assays.

Results

ZFAS1, CREB3, and p65 were upregulated in HepG2-DR and Huh7-DR cells. Silencing of ZFAS1 or CREB3 enhanced the sensitivity of HCC cells to Donafenib, inhibited cell proliferation and IC50, and increased cell apoptosis, which were reversed by p65 overexpression. Mechanistically, CREB3 bound to ZFAS1 promoter to augment ZFAS1 transcriptional expression, and ZFAS1 recruited LSD1/CoREST to the p65 promoter region to decrease H3K4 methylation and elevate p65 transcriptional expression.

Conclusion

CREB3 overexpression contributed to Donafenib resistance in HCC cells by activating the ZFAS1/p65 axis.

Keywords

ZFAS1
CREB3
p65
LSD1/CoREST
Hepatocellular carcinoma
Donafenib
Drug resistance
==== Body
pmcIntroduction

Hepatocellular carcinoma (HCC) is a primary liver malignancy and a major cause of death associated with cancer worldwide [1]. HCC patients at the early stages can be curatively treated through local ablation, liver transplantation, or surgical resection, while catheter-based local therapy and immune checkpoint and kinase inhibitors have proven as efficient therapeutic regimens for patients with intermediate and advanced HCC [2]. Sorafenib is an inhibitor of multi-kinases, which can enhance apoptosis and restrain angiogenesis and cell proliferation in tumors, thus being utilized as a potent first-line treatment for advanced HCC [3]. Donafenib (a deuterated ramification of sorafenib) is an oral small molecule inhibitor of multi-receptor kinases, which was first approved in China in June 2021 for patients with unresectable HCC without prior systemic therapy [4]. Resistance in chemotherapy presents a primary barrier to cancer treatment, which includes two categories, intrinsic resistance (owing to factors in the cancer tissues or cells) or extrinsic resistance (acquired drug resistance due to diverse adapted responses) [5]. Moreover, there are still barriers to HCC treatment with oral tyrosine kinase inhibitors because of gene alteration [6]. Therefore, it is of paramount significance to ascertain the mechanism of Donafenib resistance in HCC for improving HCC treatment.

Long non-coding RNAs (lncRNAs) are existed in the cytoplasm or nucleus and regulate the stability and expression of the downstream targets at the transcriptional, post-transcriptional, and epigenetic levels through interaction with proteins, DNA, or RNA [7]. LncRNAs often are differentially expressed in HCC, which perform an integral function in facilitating HCC progression [8,9]. For instance, lncRNA PDPK2P fosters HCC progression via the 1, 3 phosphoinositide-dependant protein kinase 1/AKT/caspase 3 pathway [10]. LncRNA SNHG14 enhances cell migration, proliferation, and invasion in HCC via the microRNA (miR)−876–5p/SSR2 axis [11]. Of note, lncRNA Zinc Finger NFX1-Type Containing 1 antisense RNA 1 (ZFAS1) was also observed to foster HCC cell invasion by binding to miR-150 [12]. A preceding publication elaborated that silencing of ZFAS1 enhanced cisplatin chemosensitivity in cervical cancer [13]. Some transcription factors are believed to interact functionally with RNA to promote the proper modulation of gene expression [14]. A former paper depicted that the transcription factor cAMP response element binding Protein 3 (CREB3) can transcriptionally activate ZFAS1 expression to accelerate papillary thyroid cancer progression [15]. A prior work reported that ZFAS1 can bind directly to lysine-specific demethylase 1 (LSD1) and corepressor of repressor element-1 silencing transcription factor (CoREST) in gastric cancer cells [16]. Phosphorylation of LSD1 was documented to be essential for the binding of p65 to promote p65 demethylation, resulting in the enhancement of p65 stability [17]. He et al. revealed that ZFAS1 can orchestrate neuronal secretion of NF-κB p65 [18]. p65 is implicated in Sulfiredoxin 1-stimulated HCC oncogenesis and metastasis [19]. Of note, p65 downregulation was identified to be implicated in the facilitating effects of interleukin-6 on Adriamycin sensitivity of natural killer/T-cell lymphoma cells [20].

Therefore, we conjectured that the transcription factor CREB3 influences p65 expression in HCC by regulating ZFAS1 and LSD1/CoREST, thereby affecting drug resistance in HCC. This paper was intended to address the effect and mechanisms of action of CREB3 on Donafenib resistance in HCC via the ZFAS1/LSD1/CoREST/p65 axis.

Materials and methods

Patient samples

The serum of 30 patients with HCC treated with Donafenib and 30 healthy individuals were collected for the detection of various indexes. The patients were included in our study with the following criteria: 1) patients aged 18 to 75 years with no gender restriction; 2) patients with sufficient and stably changed anabolic function of the liver; 3) patients with total bilirubin levels of 〈 2.0 mg/dL and albumin levels of 〉 3.0 g/dL; 4) patients in electrocorticography physical status of 0−1; 5) patients with disease progression during adjuvant therapy (with Donafenib) or within 6 months after completion of all adjuvant therapies (with Donafenib) or with failed oxaliplatin-based chemotherapy more than 6 months after completion of adjuvant therapy (with Donafenib; 6) patients with the expected survival of ≥ 12 weeks; 7) patients able to cooperate in observing adverse events and efficacy; 8) patients fully informed about this study and voluntarily signing a written informed consent.

Patients were excluded if they matched the following criteria: 1) patients with any significant clinical and laboratory abnormalities that were considered to affect safety evaluation, such as uncontrollable active infection, uncontrollable diabetes, hypertension that could not be reduced with optimal treatment to the following ranges (systolic blood pressure < 140 mmHg and diastolic blood pressure < 90 mmHg), and peripheral neuropathy at grade III or higher (NCI CTC AEv4.03); 2) patients with inoperable HCC at Barcelona Clinic Liver Cancer (BCLC) intermediate stage and tumour load of ≤ 50%; 3) patients with stage A HCC (≤ 5 cm) that was inoperable and not amenable to radiofrequency ablation; 4) patients with BCLC intermediate stage HCC and failed transarterial chemoembolization therapy; 5) patients with downstaging conversion therapy prior to radical HCC surgery; 6) patients with bridging therapy prior to liver transplantation for HCC; 7) patients with stage A HCC who were too old and frail to tolerate surgery or who did not undergo surgery; 8) patients with suspected history of hypersensitivity to Donafenib tosilate tablets or similar drugs.

Cell culture and drug preparation

Human HCC cell lines Huh7 and HepG2 (Procell, Wuhan, China) were cultivated in Dulbecco's modified Eagle medium (DMEM, Gibco, Grand Island, NY, USA) with 10% foetal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco) at 37 °C with 5% CO2.

Donafenib tosylate prodrug (Zelgen, Suzhou, China) was dissolved in 50% distilled water, 25% ethanol (Sinopharm Chemical Reagent, Shanghai, China), and 25% polyethylene glycol (PEG400, Sinopharm Chemical Reagent) to obtain 5 mg/mL stock solution [21].

Cell transfection

Short hairpin RNAs (shRNA) targeting ZFAS1 (sh-ZFAS1–1 and sh-ZFAS1–2) or CREB3 (sh-CREB3–1 and sh-CREB3–2) and the overexpressed vector of p65 (oe-p65) were constructed into the lentiviral silencing vector pLKO.1-EGFP-Puro and the overexpression vector pCDH—CMV-MCS-EF1-CopGFP-T2A-Puro (GenePharma, Shanghai, China), respectively. The lentiviral plasmids were transfected into 293T cells for packaging as per the protocols of the Lenti-X HTX Packaging System (Clontech, San Francisco, CA, USA). HCC cells (2 × 105) were seeded to 12-well plates. After 24 h of cell adhesion, cells underwent 10-day cultivation with a mixture of viral solution (2 × 105 TU) and polybrane (6 μg, TR-1003, Sigma-Aldrich, St. Louis, MO, USA) in media encompassing puromycin (Invitrogen, Carlsbad, CA, USA) to attain stably transfected cells. The shRNA sequences are provided in Table 1.Table 1 Silencing sequences of short hairpin RNAs.

Table 1Name	Sequences (5′−3′)	
sh-NC-(ZFAS1)	TTCTCCGAACGTGTCACGT	
sh-ZFAS1–1	TCCAAAATCCATTCTGTAC	
sh-ZFAS1–2	AATCAAAGCCTGGTTTTGG	
sh-NC-(CREB3)	AACCAATACAACCCTCTCT	
Note: sh, short hairpin RNA; NC, negative control.

Construction of drug-resistant cell lines

Donafenib-resistant (DR) cell lines were constructed by cultivating HCC cells in excellent condition during logarithmic growth phase with complete medium containing progressively increasing doses of Donafenib. Briefly, HCC cell lines were cultivated in a medium sequentially supplemented with different concentrations of Donafenib [the final concentrations were inhibition concentration (IC)6.25, IC12.5, IC25, to IC50 for the parental cell lines, respectively] for 2–3 weeks until the cells grew stably and reached > 80% viability. The complete medium containing Donafenib was renewed every 48 h. Stable logarithmically growing cells at each dose were collected and frozen for subsequent use. The cells cultivated at the final dose were cultivated off-drug for one week and served as the drug-resistant cell line for subsequent experiments [22].

3-(4, 5-dimethylthiazol-2-yl)−2, 5-diphenyltetrazolium bromide (MTT) assay for cell viability and IC50

Cell suspensions (5 × 104 cells/mL, 100 μL) were seeded to a 96-well plate for 24-h cultivation in a 5% CO2 incubator (37 °C). Then, cell suspensions were treated for 48 h with different concentrations of Donafenib, and the original culture medium was removed. The cells were cultivated for 4 h with 90 μL serum-free DMEM and 20 μL of 0.5% MTT solution (5 mg/mL, Beyotime, Shanghai, China) per well in a 5% CO2 incubator (37 °C). The cultivation was terminated after the medium in each well was discarded. Each well was supplemented with 200 μL dimethyl sulfoxide and shaken for 10 min on a shaker to dissolve crystals repeatedly, followed by examination of the absorbence value (optical density, OD570) at 570 nm on an automatic microplate reader. The cell survival rate was calculated with the formula: OD570 of the experimental group/OD570 of the control group × 100%, and the cell survival curve was plotted to calculate the IC50 of each cell line [22,23].

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total cell and tissue RNA was extracted using TRIZOL (Invitrogen) and underwent reverse transcription as instructed in the manuals of the reverse transcription kit (TaKaRa, Tokyo, Japan). Gene expression was determined as per the protocols of the fluorescent quantitative PCR kit (SYBR Green Mix, Roche Diagnostics, Indianapolis, IN, USA) on a LightCycler 480 fluorescent quantitative PCR instrument (Roche Diagnostics). The operation was conducted firstly at 95 °C for 10 s, then at 95 °C for 5 s, 60 °C for 10 s, and 72 °C for 10 s for 45 cycles, and finally at 72 °C for 5 min. Quantitative PCR was conducted with 3 replicates for each reaction. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was applied as the internal reference for data analysis that was conducted using the 2−ΔΔCt method. The primers are listed in Table 2.Table 2 Primer sequences.

Table 2Name of primer	Sequences (5′−3′)	
ZFAS1-F	ACGTGCAGACATCTACAACCT	
ZFAS1-R	TACTTCCAACACCCGCAT	
CREB3-F	CTGGTGACCAAGACCTGCTG	
CREB3-R	GCTCGGTACCTCAGAAAGCG	
p65-F	CTTCCAAGAAGAGCAGCGTG	
p65-R	GATCTTGAGCTCGGCAGTGT	
GAPDH-F	AGAAGGCTGGGGCTCATTTG	
GAPDH-R	AGGGGCCATCCACAGTCTTC	
U6-F	AAAGCAAATCATCGGACGACC	
U6-R	GTACAACACATTGTTTCCTCGGA	
Note: F, forward; R, reverse.

Western blotting

Radio-Immunoprecipitation assay lysis solution (Beyotime) was applied to lyse cells for protein isolation, with a bicinchoninic acid kit (Beyotime) for protein concentration measurement. The protein was denatured with an equal volume of loading buffer (Beyotime) through 3-min heating in a boiling-water bath, followed by 3-min electrophoresis (80 V) and 1–2 h of electrophoresis (120 V) after bromophenol blue entered the separation gel. The protein was transferred to membranes in an ice bath with 300 mA current for 60 min, after which the membranes were rinsed for 1–2 min with washing solution and sealed with blocking solution for 60 min (room temperature) or overnight (4 °C). Afterwards, the membranes underwent 1-h incubation on a shaker at room temperature with primary antibodies (Abcam, Cambridge, UK) against CREB3 (ab180119, 1:1000), p65 (ab32536, 1:1000) and GAPDH (ab8245, 1:5000). Subsequently, the membranes underwent 1-h incubation in goat anti-rabbit Immunoglobulin G (IgG, ab6702, 1:5000, Abcam) or goat anti-mouse IgG (ab6708, 1:5000, Abcam) secondary antibodies at room temperature. Detection was performed on a chemiluminescence imaging system (Bio-Rad, Hercules, CA, USA) after dropwise addition of developing solution to the membranes.

Nucleus and cytoplasm extraction

The cytoplasm and nucleus were detached in the light of the protocols of the PARIS™ kit (AM1556, Thermo Fisher, Waltham, MA, USA). Briefly, HCC cells underwent 10-min lysing on ice with cell fraction buffer and 3-min centrifugation at 500 g and 4 °C. Thereafter, the supernatant was attained as the cytoplasmic fraction. After washing of the precipitate with cell fraction buffer, the nucleus fraction was harvested by centrifuging the precipitate. ZFAS1 expression was examined in the cytoplasm or nucleus through RT-qPCR, with GAPDH and U6 as controls of expression in the cytoplasm and nucleus, respectively [24].

Chromatin immunoprecipitation (ChIP) assay

ChIP assay was carried out with an EZ-Magna ChIP TMA kit (17–10,086, EMD Millipore, Billerica, MA, USA). Huh7 cells during logarithmic growth phase were cross-linked with 1% formaldehyde, which was terminated with 125 mM glycine for 5 min at room temperature. Subsequent to two washes with pre-chilled phosphate-buffered saline (PBS), cells were harvested through 5-min centrifugation at 2000 g and resuspended in cell lysate to achieve a final cell concentration of 2 × 106 cells per 200 μL. The cell suspension was supplemented with protease inhibitor mixture, centrifuged at 5000 g for 5 min, resuspended with nuclear separation buffer, lysed in an ice-water bath for 10 min, and ultrasonicated to acquire 200–1000 bp chromatin fragments. Chromatin fragments were centrifuged for 10 min at 14,000 g and 4 °C with the supernatants attained. For each group, 100 μL supernatants (DNA fragment) were mixed upside down for 1 h with 900 μL ChIP dilution buffer, 20 μL protease inhibitor cocktail (PIC, 50 ×), and 60 μL Protein A Agarose/Salmon Sperm DNA at 4 °C, left to stand for 10 min at 4 °C, and centrifuged at 700 g for 1 min. The supernatants were harvested, of which 20 μL was utilized as Input. For the experimental groups, the supernatants were mixed upside down with 1 μL rabbit antibodies against CREB3 (11,275–1-AP, Proteintech, Rosemont, IL, USA), LSD1 (ab129195, Abcam), histone 3 lysine 4 monomethylation (H3K4me1, ab176877, Abcam), H3K4 dimethylation (H3K4me2, ab32356, Abcam), or IgG (ab172730, Abcam, as the NC) and 60 μL Protein A Agarose/Salmon Sperm DNA at 4 °C for 2 h, allowed to stand for 10 min, and centrifuged at 700 g for 1 min. Subsequent to the discarding of the supernatants, the precipitate was washed with l mL low salt buffer, high salt buffer, lithium chloride solution, and tromethamine-ethylene-diamine tetra-acetic acid buffer (twice). The precipitate was eluted twice with 250 μL ChIP wash buffer, followed by the de-crosslinking with 20 μL NaCl (5 M) and the recovery of DNA. The enriched chromatin fragments were evaluated by RT-qPCR [15,16]. The primer sequences were as follows: ZFAS1 forward, 5′-ACCAGAGTGGGACGCAGGA-3′ and reverse, 5′-TCCCCAGACCCCCATCAC-3′; p65 forward, 5′-TGGCTGTATCGTAAGCTGGC-3′ and R, 5′-GCATCAAGAGCTTTGCGGAG-3′.

Dual-luciferase reporter gene assay

Dual-luciferase reporter gene plasmids encompassing wild-type ZFAS1 promoter (ZFAS1-WT), mutant ZFAS1 promoter (ZFAS1-Mut, sequences between mutations of 1061–1174 and 689–702, Supplementary Table 1), and p65 promoter were respectively constructed and co-transfected with sh-NC, sh-ZFAS1, or sh-CREB3 into Huh7 cells. Subsequent to 24-h transfection, the cells were lysed and centrifuged for 1 min at 13,000 g, with the supernatants obtained. Luciferase activity was determined using a dual-luciferase reporter gene assay kit (16,185, Thermo Fisher). Specifically, each cell sample was added with 100 μL Firefly luciferase working solution to measure Firefly luciferase and 100 μL Renilla luciferase working solution to detect Renilla luciferase (the internal reference). The ratio of Firefly to Renilla luciferase activity was the relative luciferase activity [15,16].

RNA immunoprecipitation (RIP) assay

After twice washing with pre-cooled PBS and centrifugation (1500 rpm, 5 min), cells were lysed with an equal volume of RIP lysis buffer. After magnetic beads were resuspended with 100 µL RIP Wash Buffer, 5 µg LSD1 antibody (ab129195, 1:100, Abcam) or COREST antibody (ab183711, 1:100, Abcam) was added for 30-min incubation with the beads (IgG antibody [ab172730, 1:100, Abcam] as the negative control) at room temperature. The centrifuge tube was placed on a magnetic rack and the supernatant was discarded. Next, the bead-antibody complex was washed twice by the addition of 500 µL RIP wash buffer and vibration. After the supernatant was eliminated, 500 µL RIP wash buffer was added and vibrated, and the tube was preserved on ice. Then the tube was placed on the magnetic rack and the supernatant was abandoned, after which 900 µL RIP immunoprecipitation buffer was added into each tube. The prepared cell lysate was thawed quickly, centrifuged at 14,000 rpm for 10 min at 4 °C, and 100 µL supernatant was collected for overnight incubation with the bead-antibody complex at 4 °C. After transient centrifugation, the centrifuge tube was placed on a magnetic rack and the supernatant was dumped, followed by addition of 500 µL RIP wash buffer and vibration and this operation was repeated six times to wash the complex. After that, the bead-antibody-RNA complex was added with 150 µL Proteinase K buffer and incubated at 55 °C for 30 min to purify the RNA. After RNA extraction, target gene expression was tested by RT-qPCR. Three independent repeated experiments were carried out.

Colony formation assay for cell proliferation

HCC cells were trypsinized, centrifuged for 5 min at 25 °C and 1500 rpm, and resuspended in the complete medium. Cells were seeded in 24-well plates (200 cells per well) encompassing 1 mL complete medium pre-warmed at 37 °C and cultivated for 10 days with 1 µM Donafenib at 37 °C with 5% CO2, followed by the removal of the medium and two PBS washes. Cells were fixed for 20 min in 100% methanol (1.5 mL/well, Sigma-Aldrich), followed by the discarding of the methanol. After 5-min staining with Giemsa solution (Sigma-Aldrich) in the dark, the 24-well plates were inverted and dried on clean absorbent paper. An optical microscope (Axiovert 200, Zeiss, Oberkochen, Germany) was employed to calculate the number of cell colonies.

Flow cytometry for cell apoptosis

Apoptosis was tested using the Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) double staining method. Specifically, cells were seeded in 6-well plates at 2 × 105 cells/well and treated for 48 h with 1 µM Donafenib, followed by the removal of the medium. After being washed with PBS pre-chilled at 4 °C, cells were trypsinized, collected to 15 mL centrifuge tubes, and centrifuged at 800 g. The supernatants were discarded and the precipitate was washed twice with PBS. As described in the manuals of Annexin V-FITC Apoptosis Detection Kit I (BD Biosciences, San Jose, CA, USA), cells were resuspended in 500 μL binding buffer and mixed with 5 μL FITC and 5 μL PI in the dark, followed by 15-min incubation. At last, apoptosis was examined on a flow cytometer (BD FACSCalibur, BD Biosciences).

Statistical analysis

All experiments were repeated individually at least three times. All data were stated as mean ± standard deviation and analysed using SPSS 13.0 software (SPSS Inc., Chicago, IL, USA), with P < 0.05 representing that the difference was statistically significant. Comparisons were performed between the two groups using the Student's t-test and amongst multiple groups using one-way analysis of variance and Tukey's post hoc test.

Results

ZFAS1 expression was high in DR HCC cell lines

To delve into the interaction between ZFAS1 and Donafenib resistance, DR HCC cell lines (HepG2-DR and Huh7-DR) were constructed through treatment with different concentrations of Donafenib. MTT assay was employed to test the IC50 of each cell line, which manifested that IC50 of the parental HepG2 and Huh7 cell lines were (0.12 ± 0.003) μM and (0.0095 ± 0.003) μM, while IC50 of HepG2-DR and Huh7-DR cells was (6.2 ± 0.043) μM and (5.4 ± 0.051) μM, respectively (Fig. 1A). As displayed in Fig. 1B, ZFAS1 expression was higher in HepG2-DR and Huh7-DR cells than in the parental HepG2 and Huh7 cell lines. In addition, ZFAS1 distribution in the nucleus was also appreciably augmented in HepG2-DR and Huh7-DR cells relative to the parental HepG2 and Huh7 cell lines (Fig. 1C). In addition, ZFAS1 levels in serum specimens were appreciably higher in HCC patients treated with Donafenib than in healthy volunteers (Supplementary Figure 1A). Collectively, ZFAS1 was expressed highly in DR HCC cell lines.Fig. 1 Knockdown of ZFAS1 facilitates Donafenib resistance in HCC cells.

Fig 1Notes: (A) MTT assay was adopted to measure the proliferation and IC50 in HCC cell lines. (B) RT-qPCR was applied to evaluate ZFAS1 expression in HCC cell lines, * P < 0.05 compared with the WT group. (C) After separation of nucleus and cytoplasm, RT-qPCR was conducted to detect ZFAS1 expression in HCC cell lines, * P < 0.05 compared with the WT group. (D) RT-qPCR was performed to assess the silencing effect of shRNAs targeting ZFAS1, * P < 0.05 compared with the sh-NC group. HepG2-DR and Huh7-DR cells were transfected with sh-ZFAS1 and treated with Donafenib. (E) ZFAS1 expression in HepG2-DR and Huh7-DR cells was measured using RT-qPCR. (F) Colony formation assay was employed to examine clone formation rate of HepG2-DR and Huh7-DR cells. (G) Flow cytometry was utilized to determine the apoptosis in HepG2-DR and Huh7-DR cells. (H) MTT assay was adopted to measure the proliferation and IC50 of HepG2-DR and Huh7-DR cells. * P < 0.05 compared with the sh-NC group. ZFAS1, lncRNA Zinc Finger NFX1-Type Containing 1 antisense RNA 1; HCC, hepatocellular carcinoma; DR, Donafenib-resistant.

Silencing of ZFAS1 enhanced the sensitivity of HCC cells to Donafenib

shRNAs targeting ZFAS1 were designed to dissect the influence of ZFAS1 on Donafenib resistance in HCC cells. sh-ZFAS1–1 was detected to have better silencing efficiency, which, thereby, was chosen for the follow-up experiments (Fig. 1D). Next, ZFAS1 was knocked down in HepG2-DR and Huh7-DR cells (Fig. 1E), followed by Donafenib treatment. Colony formation assay and flow cytometry results demonstrated that knockdown of ZFAS1 decreased cell proliferation and enhanced Donafenib-induced apoptosis (Fig. 1F-G). MTT assay exhibited that the survival and IC50 of HepG2-DR and Huh7-DR cells were noticeably reduced after knockdown of ZFAS1 (Fig. 1H). Conclusively, silencing of ZFAS1 facilitated the Donafenib sensitivity of HCC cells.

The transcription factor CREB3 activated ZFAS1 expression in HCC cells

CREB3 was predicted to be a transcription factor for ZFAS1 in the JASPAR database (https://jaspar.genereg.net/) (Fig. 2A) and contained two binding sites in the ZFAS1 promoter region (Supplementary Table 1). The analysis by the Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database (http://gepia2.cancer-pku.cn/#index) indicated that CREB3 was highly expressed in HCC (Fig. 2B) and positively correlated with ZFAS1 expression (Fig. 2C). CREB3 expression in the serum specimens was also substantially higher in HCC patients treated with Donafenib than in healthy volunteers (Supplementary Figure 1B). Pearson correlation coefficient further confirmed the positive correlation between CREB3 and ZFAS1 in HCC (Fig. 2D). The RT-qPCR and western blotting results exhibited that CREB3 expression was higher in HepG2-DR and Huh7-DR cells than in HepG2 and Huh7 cells (Fig. 2E). ChIP assay further demonstrated that the CREB3 antibodies enriched the ZFAS1 promoter sequence (Fig. 2F). Subsequently, we transfected Huh7 cells with sh-CREB3 or its negative control and then tested the expression of CREB3. RT-qPCR presented that sh-CREB3 transfection markedly reduced the expression of CREB3 in Huh7 cells (Fig. 2G), suggesting a good transfection efficiency. Dual-luciferase reporter gene assay was designed to further verify the binding relationship between CREB3 and ZFAS1, and the results displayed that both binding sites of ZFAS1 were essential for transcription because mutations in either the first or second site had no effect on luciferase activity (Fig. 2H-I), which were consistent with previous findings [15]. In addition, RT-qPCR results documented that ZFAS1 expression was markedly declined after knocking down CREB3 (Fig. 2J). In summary, the transcription factor CREB3 might bind to the ZFAS1 promoter and activate ZFAS1 expression in HCC cells.Fig. 2 Transcription factor CREB3 binds to the ZFAS1 promoter to increase ZFAS1 expression.

Fig 2Notes: (A) The binding sites of CREB3 were predicted by JASPAR database. (B) GEPIA2 database predicted a prominently high expression of CREB3 gene in HCC, in which red represented HCC and grey represented the normal control, * P < 0.05 for comparison between two groups. (C) Correlation analysis between CREB3 and ZFAS1 using GEPIA2 in HCC. (D) The correlation between CREB3 and ZFAS1 in HCC was evaluated by Pearson correlation coefficient. (E) RT-qPCR and western blotting were applied to determine CREB3 expression in HCC cell lines, * P < 0.05 compared with the WT group. (F) ChIP assay was carried out to evaluate the enrichment of CREB3 protein in the ZFAS1 promoter, * P < 0.05 compared with the IgG group. (G) RT-qPCR was conducted to detect transfection efficiency, * P < 0.05 compared with the sh-NC group. (H-I) Dual-luciferase reporter gene assay was performed in Huh7 cell line after co-transfection of full-length ZFAS1 promoter or ZFAS1 promoter fragment at deletion site 1 or site 2 with sh-CREB3 vector or blank vector, * P < 0.05 compared with the sh-NC group. (J) RT-qPCR was performed to test ZFAS1 expression in Huh7 cell lines, * P < 0.05 compared with the sh-NC group. CREB3, cAMP response element binding Protein 3; ZFAS1, lncRNA Zinc Finger NFX1-Type Containing 1 antisense RNA 1; HCC, hepatocellular carcinoma.

ZFAS1 interacted with LSD1/CoREST to foster p65 transcriptional expression

Results from RT-qPCR revealed that the serum of HCC patients treated with Donafenib had obviously higher p65 expression than the serum of healthy volunteers (Supplementary Figure 1C). According to Pearson correlation coefficient, p65 was positively correlated with ZFAS1 expression in HCC (Fig. 3A). As reflected by RT-qPCR and western blotting results, p65 expression was elevated in HepG2-DR and Huh7-DR cells versus HepG2 and Huh7 cells (Fig. 3B-C). In comparison with the IgG group, ZFAS1 combined with LSD1 or CoREST was significantly increased (Fig. 3D), displayed by RIP assay. The results of ChIP assay demonstrated that knockdown of ZFAS1 or CREB3 downregulated LSD1 protein but upregulated H3K4me1 and H3K4me2 proteins enriched in the p65 promoter (Fig. 3E). Dual-luciferase reporter gene assay displayed that knockdown of ZFAS1 or CREB3 lowered the luciferase activity of the p65 promoter (Fig. 3F). Moreover, RT-qPCR and western blotting data highlighted that knockdown of ZFAS1 or CREB3 apparently reduced p65 expression (Fig. 3G-H). Summarily, ZFAS1 enhanced the transcriptional expression of p65 by interacting with LSD1/CoREST.Fig. 3 ZFAS1 enhances p65 expression by interacting with LSD1/CoREST.

Fig 3Notes: (A) The correlation between ZFAS1 and p65 in HCC was analysed via Pearson correlation coefficient. (B) RT-qPCR was implemented to assess CREB3 expression in HCC cell lines, * P < 0.05 compared with the WT group. (C) Western blotting was employed to test CREB3 expression in HCC cell lines, * P < 0.05 compared with the WT group. (D) The interaction between ZFAS1 and LSD1/CoREST was assessed by RIP assay. (E) After knockdown of ZFAS1 or CREB3, ChIP assay was adopted to measure the enrichment of LSD1, H3K4me1, and H3K4me2 in p65 promoter, * P < 0.05 compared with the anti-IgG group. (F) Dual-luciferase reporter gene assay was employed to validate the binding relationship between CREB3/ZFAS1 and p65, * P < 0.05 compared with the sh-NC group. (G) RT-qPCR was carried out to assess p65 expression in Huh7 cells, * P < 0.05 compared with the sh-NC group. (H) Western blotting was utilized to determine p65 expression in Huh7 cells, * P < 0.05 compared with the sh-NC group. CREB3, cAMP response element binding Protein 3; ZFAS1, lncRNA Zinc Finger NFX1-Type Containing 1 antisense RNA 1; HCC, hepatocellular carcinoma; LSD1, lysine-specific demethylase 1; CoREST, corepressor of repressor element-1 silencing transcription factor; H3K4me1, histone 3 lysine 4 monomethylation.

Overexpression of p65 abolished the repressive impact of CREB3 knockdown on Donafenib resistance in HCC cells

After transfection of sh-CREB3 and/or oe-p65 in HepG2-DR and Huh7-DR cells, RT-qPCR and western blotting presented that sh-CREB3 transfection conspicuously downregulated CREB3, ZFAS1, and p65 expression, whilst further oe-p65 transfection elevated p65 expression but unaffected CREB3 and ZFAS1 expression in the presence of sh-CREB3 (Fig. 4A-B), which suggested successful transfection. Following Donafenib treatment in stably transfected cells, colony formation assay and flow cytometry depicted that knockdown of CREB3 decreased the proliferation and augmented Donafenib-induced apoptosis of HepG2-DR and Huh7-DR cells, while further overexpression of p65 negated this phenomenon (Fig. 4C-D). MTT assay results manifested that the survival and IC50 of HepG2-DR and Huh7-DR cells were considerably reduced by knockdown of CREB3, which was abrogated by further overexpression of p65 (Fig. 4E). These data illustrated that CREB3 promoted Donafenib resistance in HCC cells by elevating p65 expression.Fig. 4 CREB3 upregulates p65 expression to enhance Donafenib resistance in HCC cells.

Fig 4Notes: HepG2-DR and Huh7-DR cells were transfected with sh-CREB3 and/or oe-p65. (A) CREB3, ZFAS1, and p65 expression was measured using RT-qPCR. (B) CREB3 and p65 expression was detected using western blotting. Stably transfected HepG2-DR and Huh7-DR cells were treated with Donafenib. (C) The colony formation rate of cells was assessed using colony formation assay. (D) Flow cytometry was applied to examine the apoptosis of cells. (E) MTT was adopted to determine the proliferation and IC50 of cells. * P < 0.05 compared with the sh-NC + oe-NC group; #P < 0.05 compared with the sh-CREB3 + oe-NC group. CREB3, cAMP response element binding Protein 3; ZFAS1, lncRNA Zinc Finger NFX1-Type Containing 1 antisense RNA 1; HCC, hepatocellular carcinoma; DR, Donafenib-resistant.

Discussion

Donafenib is generated by the creative replacement of a methyl group on the sorafenib molecule with a tri-deuteriomethyl group, which can down-regulate the activities of several receptor tyrosine kinases and exert anti-proliferative effects in tumors [25]. Donafenib has been manifested to enhance the overall survival of advanced HCC patients with excellent safety and tolerability [26]. Drug resistance has developed in HCC patients to cause declines in the overall survival of cancer patients [27]. Therefore, there is a substantial necessity to identify the genes that contribute to Donafenib resistance in HCC. Through construction of DR HCC cell lines and loss- and gain-of-function experiments, the present study discovered that CREB3 promoted Donafenib resistance in HCC cells by upregulating p65 through the interaction between ZFAS1 and LSD1/CoREST.

ZFAS1 acts as a cancer-promoting gene in diverse cancers. For example, ZFAS1 facilitates glioma progression, colorectal cancer metastasis, and pancreatic cancer metastasis and proliferation [28], [29], [30]. Of note, the research of Guo et al. demonstrated a high ZFAS1 expression in HCC [31]. Likewise, Lin et al. observed that ZFAS1 expression was high in sorafenib-resistant HCC cells [32]. These findings corroborated our data of higher ZFAS1 expression in DR HCC cell lines and the serum from HCC patients treated with Donafenib. In addition, ZFAS1 was documented to boost HCC cell proliferation through epigenetic suppression of miR-193a-3p [33]. Duan et al. observed that silencing of ZFAS1 facilitated apoptosis and declined epithelial-mesenchymal transition, invasion, migration, and viability of HCC cells [24]. A prior research disclosed that ZFAS1 knockdown diminished IC50 and proliferation while enhanced apoptosis of Adriamycin-resistant paediatric acute myeloid leukaemia cells [34]. Consistently, the present study discovered that silencing of ZFAS1 enhanced the apoptosis and curbed the proliferation, survival, and IC50 of HepG2-DR and Huh7-DR cells. Therefore, ZFAS1 might facilitate Donafenib resistance in HCC.

It has been widely reported that transcription factors impact disease development through regulation of gene expression [35]. A range of carcinogenic transcription factors are proven to be overexpressed in HCC, initiating the transcription of protein-coding genes and non-coding genes, like lncRNAs [36]. In addition, Wang et al. stated that CREB3 activated ZFAS1 expression to promote papillary thyroid cancer metastasis [15]. Similarly, the database used in our research predicted that CREB3 was a transcription factor for ZFAS1, and further experimental results confirmed that the transcription factor CREB3 bound to the ZFAS1 promoter and elevated ZFAS1 expression. CREB3 acts as a tumour promoting gene in numerous cancers, although its role in HCC has not been explored. For instance, CREB3 was overexpressed in osteosarcoma tissues and cells, and ectopic CREB3 accelerated osteosarcoma cell proliferation [37]. In addition, CREB3 knockdown caused the facilitation of glioblastoma cell apoptosis [38]. These observations suggested that CREB3 might act as an oncogene in HCC and promote Donafenib resistance of HCC cells. For verification, a series of experiments were performed in our study. Concordantly, our data identified that CREB3 was upregulated in DR HCC cell lines and the serum from HCC patients treated with Donafenib and that silencing of CREB3 increased HepG2-DR and Huh7-DR cell apoptosis and their proliferation, survival, and IC50.

LncRNAs can function as manipulators of DNA methylation or scaffolds for histone modifications to influence critical pathways in liver carcinogenesis [39]. In gastric cancer, ZFAS1 can interact with the histone methyltransferase LSD1/CoREST to modulate downstream gene expression [16]. LSD1 can enhance p65 protein stability by reducing H3K4me2 methyl levels to participate in sorafenib resistance in HCC [40]. Concordant results were noted in the present study that ZFAS1 bound to LSD1/CoREST and that knockdown of ZFAS1 or CREB3 resulted in a reduction of LSD1 protein enriched in the p65 promoter, a rise in H3K4me1 and H3K4me2 levels, and a decrease in p65 expression. Collectively, ZFAS1 might interact with LSD1/CoREST to facilitate the transcriptional expression of p65 in HCC. Further functional experiments manifested highly expressed p65 in DR HCC cells and the serum from HCC patients treated with Donafenib and that overexpressing p65 annulled the promotive impact of silencing ZFAS1 on the sensitivity of HCC cells to Donafenib. Comparably, Yu et al. demonstrated that sorafenib-resistant HCC cells had elevated NF-κB p65 expression and CYP1A2 could sensitize sorafenib-resistant HCC cells to sorafenib by decreasing cell proliferation through suppression of the NF-κB p65 axis [41]. NF-κB p65 inactivation was reported to suppress paclitaxel resistance of mesenchymal primary breast cancer cells [42]. The research of Ning et al. deciphered that upregulation of phosphorylated p65 in the nucleus facilitated proliferation and restricted apoptosis of chemotherapy-resistant multiple myeloma cells, thus promoting drug resistance of multiple myeloma cells [43].

Conclusion

In conclusion, CREB3 enhanced Donafenib resistance in HCC cells via p65 upregulation by facilitating ZFAS1 recruitment of LSD1/CoREST to the p65 promoter region and repressing H3K4 methylation. This paper is hoping to offer some theoretical basis for clinical trials of Donafenib resistance, with a view to potentiating the therapeutic effect of Donafenib.

Ethics approval and consent to participate

Patients were fully informed about this study and voluntarily signed a written informed consent. The study was approved by the Ethic Committee of Harbin Medical University Cancer Hospital.

Consent to publish

Not applicable.

Availability of data and materials

The datasets used or analysed during the current study are available from the corresponding author on reasonable request.

Credit authorship contribution statement

HXB conceived the ideas. HXB designed the experiments. HXB and XQN performed the experiments. HXB and XQN analysed the data. HXB and XQN provided critical materials. HXB and XQN wrote the manuscript. LRB supervised the study. HXB and XQN contributed equally to this research. All the authors have read and approved the final version for publication.

Funding

Not applicable.

Declaration of competing interest

The authors declare there is no conflict of interests.

Appendix Supplementary materials

Image, image 1

Image, application 2

Image, application 3

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.tranon.2023.101684.
==== Refs
References

1 Khemlina G. Ikeda S. Kurzrock R. The biology of Hepatocellular carcinoma: implications for genomic and immune therapies Mol. Cancer 16 1 2017 149 28854942
2 Yang J.D. Hainaut P. Gores G.J. A global view of hepatocellular carcinoma: trends, risk, prevention and management Nat. Rev. Gastroenterol. Hepatol. 16 10 2019 589 604 31439937
3 Tang W. Chen Z. Zhang W. The mechanisms of sorafenib resistance in hepatocellular carcinoma: theoretical basis and therapeutic aspects Signal. Transduct. Target Ther. 5 1 2020 87 32532960
4 Keam S.J. Duggan S. Donafenib: first approval Drugs. 81 16 2021 1915 1920 34591285
5 Haider T. Pandey V. Banjare N. Drug resistance in cancer: mechanisms and tackling strategies Pharmacol. Rep. 72 5 2020 1125 1151 32700248
6 Mou L. Tian X. Zhou B. Improving outcomes of tyrosine kinase inhibitors in hepatocellular carcinoma: new data and ongoing trials Front. Oncol. 11 2021 752725
7 Huo X. Han S. Wu G. Dysregulated long noncoding RNAs (lncRNAs) in hepatocellular carcinoma: implications for tumorigenesis, disease progression, and liver cancer stem cells Mol. Cancer 16 1 2017 165 29061150
8 Wong L.S. Wong C.M. Decoding the roles of long noncoding RNAs in hepatocellular carcinoma Int. J. Mol. Sci. 22 6 2021
9 Zeng C. Tang Y. Jiang Y. Long noncoding RNAs as biomarkers for the diagnosis of hepatocellular carcinoma: a meta-analysis Pathol. Res. Pract. 224 2021 153546
10 Pan W. Li W. Zhao J. lncRNA-PDPK2P promotes hepatocellular carcinoma progression through the PDK1/AKT/Caspase 3 pathway Mol. Oncol. 13 10 2019 2246 2258 31368655
11 Liao Z. Zhang H. Su C. Long noncoding RNA SNHG14 promotes hepatocellular carcinoma progression by regulating miR-876-5p/SSR2 axis J. Exp. Clin. Cancer Res. 40 1 2021 36 33485374
12 Li T. Xie J. Shen C. Amplification of long noncoding RNA ZFAS1 promotes metastasis in hepatocellular carcinoma Cancer Res. 75 15 2015 3181 3191 26069248
13 Feng L.L. Shen F.R. Zhou J.H. Expression of the lncRNA ZFAS1 in cervical cancer and its correlation with prognosis and chemosensitivity Gene 696 2019 105 112 30738960
14 Holmes Z.E. Hamilton D.J. Hwang T. The Sox2 transcription factor binds RNA Nat. Commun. 11 1 2020 1805 32286318
15 Wang G. Le Y. Wei L. CREB3 transactivates lncRNA ZFAS1 to promote papillary thyroid carcinoma metastasis by modulating miR-373-3p/MMP3 regulatory axis Int. J. Endocrinol. 2021 2021 9981683
16 Nie F. Yu X. Huang M. Long noncoding RNA ZFAS1 promotes gastric cancer cells proliferation by epigenetically repressing KLF2 and NKD2 expression Oncotarget 8 24 2017 38227 38238 27246976
17 Kim D. Nam H.J. Lee W. PKCalpha-LSD1-NF-kappaB-signaling cascade is crucial for epigenetic control of the inflammatory response Mol. Cell 69 3 2018 398 411 e6 29395062
18 He C. Su C. Zhang W. Modulatory potential of LncRNA Zfas1 for inflammation and neuronal apoptosis in temporal lobe epilepsy Yonsei Med. J. 62 3 2021 215 223 33635011
19 Lv X. Yu H. Zhang Q. SRXN1 stimulates hepatocellular carcinoma tumorigenesis and metastasis through modulating ROS/p65/BTG2 signalling J. Cell. Mol. Med. 24 18 2020 10714 10729 32746503
20 Gao M. Liu L. Zhang X. Interleukin-6 reverses Adriamycin resistance in nasal NK/T-cell lymphoma via downregulation of ABCC4 and inactivation of the JAK2/STAT3/NF-kappaB/P65 pathway Environ. Toxicol. Pharmacol. 85 2021 103639
21 Li T. Shi Q. Liu J. Donafenib-loaded callispheres beads embolization in a VX2 liver tumor: investigating efficacy, safety, and improvement of tumor angiogenesis after embolization J. Hepatocell. Carcinoma 8 2021 1525 1535 34888263
22 Chen M. Wu L. Tu J. miR-590-5p suppresses hepatocellular carcinoma chemoresistance by targeting YAP1 expression EBioMedicine 35 2018 142 154 30111512
23 Chen Y. Zhao H. Li H. LINC01234/MicroRNA-31-5p/MAGEA3 axis mediates the proliferation and chemoresistance of hepatocellular carcinoma cells Mol. Ther Nucleic Acids 19 2020 168 178 31838274
24 Duan R. Li C. Wang F. The long noncoding RNA ZFAS1 potentiates the development of hepatocellular carcinoma via the microRNA-624/MDK/ERK/JNK/P38 signaling pathway Onco Targets Ther 13 2020 4431 4444 32547074
25 Li X. Qiu M. Wang S. A Phase I dose-escalation, pharmacokinetics and food-effect study of oral donafenib in patients with advanced solid tumours Cancer Chemother. Pharmacol. 85 3 2020 593 604 32008115
26 Li Q. Zhu H. Donafenib treatment for hepatocellular carcinoma: a case report Medicine (Baltimore). 100 25 2021 e26373 34160411
27 Wu Y. Zhang J. Li Q. Autophagy, an accomplice or antagonist of drug resistance in HCC? Cell Death. Dis. 12 3 2021 266 33712559
28 Deng H. Wang M. Xu Q. ZFAS1 promotes colorectal cancer metastasis through modulating miR-34b/SOX4 targeting Cell Biochem. Biophys. 79 2 2021 387 396 33725330
29 Li X. Luo Y. Liu L. The long noncoding RNA ZFAS1 promotes the progression of glioma by regulating the miR-150-5p/PLP2 axis J. Cell. Physiol. 235 3 2020 2937 2946 31535380
30 Rao M. Xu S. Zhang Y. Long non-coding RNA ZFAS1 promotes pancreatic cancer proliferation and metastasis by sponging miR-497-5p to regulate HMGA2 expression Cell Death. Dis. 12 10 2021 859 34552050
31 Guo Z.W. Meng Y. Zhai X.M. Translated long non-coding ribonucleic acid ZFAS1 promotes cancer cell migration by elevating reactive oxygen species production in hepatocellular carcinoma Front. Genet. 10 2019 1111 31781169
32 Lin J.C. Yang P.M. Liu T.P. PERK/ATF4-dependent ZFAS1 upregulation is associated with sorafenib resistance in hepatocellular carcinoma cells Int. J. Mol. Sci. 22 11 2021
33 Zhou H.L. Zhou Y.F. Feng Z.T. Long noncoding RNA ZFAS1 promotes hepatocellular carcinoma proliferation by epigenetically repressing miR-193a-3p Eur. Rev. Med. Pharmacol. Sci. 23 22 2019 9840 9847 31799651
34 Li Q. Wang J. Long noncoding RNA ZFAS1 enhances adriamycin resistance in pediatric acute myeloid leukemia through the miR-195/Myb axis RSC Adv. 9 48 2019 28126 28134 35530496
35 Wang J. Gu J. You A. The transcription factor USF1 promotes glioma cell invasion and migration by activating lncRNA HAS2-AS1 Biosci. Rep. 40 8 2020
36 Huang Z. Zhou J.K. Peng Y. The role of long noncoding RNAs in hepatocellular carcinoma Mol. Cancer 19 1 2020 77 32295598
37 Wu Y. Xie Z. Chen J. Circular RNA circTADA2A promotes osteosarcoma progression and metastasis by sponging miR-203a-3p and regulating CREB3 expression Mol. Cancer 18 1 2019 73 30940151
38 Hu Y. Chu L. Liu J. Knockdown of CREB3 activates endoplasmic reticulum stress and induces apoptosis in glioblastoma Aging (Albany NY) 11 19 2019 8156 8168 31612863
39 Yuan S.X. Zhang J. Xu Q.G. Long noncoding RNA, the methylation of genomic elements and their emerging crosstalk in hepatocellular carcinoma Cancer Lett. 379 2 2016 239 244 26282784
40 Hu B. Xu Y. Li Y.C. CD13 promotes hepatocellular carcinogenesis and sorafenib resistance by activating HDAC5-LSD1-NF-kappaB oncogenic signaling Clin. Transl. Med. 10 8 2020 e233 33377659
41 Yu J. Wang N. Gong Z. Cytochrome P450 1A2 overcomes nuclear factor kappa B-mediated sorafenib resistance in hepatocellular carcinoma Oncogene 40 3 2021 492 507 33184472
42 Esparza-Lopez J. Longoria O. De La Cruz-Escobar E.N. Paclitaxel resistance is mediated by NF-kappaB on mesenchymal primary breast cancer cells Oncol. Lett. 23 2 2022 50 34992683
43 Ning J. Yang R. Wang H. HMGB1 enhances chemotherapy resistance in multiple myeloma cells by activating the nuclear factor-kappaB pathway Exp. Ther. Med. 22 1 2021 705 34007314
