
==== Front
QJM
QJM
qjmedj
QJM: An International Journal of Medicine
1460-2725
1460-2393
Oxford University Press

38429952
10.1093/qjmed/hcae038
hcae038
Translational Science
AcademicSubjects/MED00010
Clinical characteristics and induced pluripotent stem cells (iPSCs) disease model of Fabry disease caused by a novel GLA mutation
Gao L Data curation Formal analysis Methodology Writing - original draft Writing - review & editing Department of Nephrology, Children's Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, China
The Children's hospital, Zhejiang University School of Medicine, Hangzhou 310058, China

Lu Z Conceptualization Data curation Formal analysis Writing - original draft Department of Nephrology, Children's Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, China

Zhang Y Data curation Formal analysis Methodology The Children's hospital, Zhejiang University School of Medicine, Hangzhou 310058, China
Institute of Translational Medicine, Zhejiang University School of Medicine, Hangzhou 310058, China

Liu L Formal analysis Methodology Writing - original draft Department of Nephrology, Children's Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, China
The Children's hospital, Zhejiang University School of Medicine, Hangzhou 310058, China

Sun J Data curation Formal analysis Department of Nephrology, Children's Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, China
The Children's hospital, Zhejiang University School of Medicine, Hangzhou 310058, China

Fu H Conceptualization Project administration Writing - original draft Department of Nephrology, Children's Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, China

https://orcid.org/0000-0002-6076-3806
Mao J Conceptualization Funding acquisition Writing - review & editing Department of Nephrology, Children's Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, China

Hu L Conceptualization Funding acquisition Writing - original draft Writing - review & editing Department of Nephrology, Children's Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, China

Address correspondence to Dr. L. Hu, Dr. J. Mao. Department of Nephrology, Children’s Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Binsheng Road, hangzhou City, 310003, zhejiang Province, China. email: hulidan@zju.edu.cn, maojh88@zju.edu.cn
L.Gao and Z.Lu contributed equally to this work.

8 2024
01 3 2024
01 3 2024
117 8 566573
13 11 2023
19 2 2024
07 6 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of the Association of Physicians.
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (https://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com

Abstract

Background

Fabry disease (FD) is a rare X-linked inherited disease caused by mutations in the galactosidase alpha (GLA) gene. We established a cohort of FD patients and performed whole-exome sequencing to identify some novel mutations.

Aim

The aim of this study is to investigate the etiology of the novel mutation (c.72G > A, p. Trp24*)in the GLA gene in affected patients by using induced pluripotent stem cells (iPSCs) as a valuable tool.

Methods

We explored the clinical implications of this proband and examined the deleteriousness and conservation of the mutation site through bioinformatics analysis. Simultaneously, we collected the peripheral blood mononuclear cells of the affected patient, then reprogrammed them into iPSCs and assessed their enzymatic activity to confirm the function of lysosomal enzyme α-galactosidase A (α-Gal A).

Results

Clinical examination of the patient demonstrated a classical FD, such as neuropathic pain, gastrointestinal disorders, deficiency of α-Gal A activity and accumulation of Lyso-Gb-3. The novel mutation located on the N-terminal region, leading to a truncation of the protein and remaining only 24 amino acids. The α-Gal A activity of the patient-specific iPSC (iPS-FD) was significantly lower (60%) than that of normal iPSCs derived from healthy donors (iPS-B1).

Conclusion

This work not only elucidated the etiology of novel mutations in affected patients but also highlighted the utility of iPSCs as a valuable tool for clarifying the molecular mechanisms and providing new insights into the therapy of FD.

Key R&D Program of Zhejiang 2023C03027 National Natural Science Foundation of China 10.13039/501100001809 U20A20351 82200784
==== Body
pmcIntroduction

Fabry disease (FD, OMIM #301500) is a rare X-linked inherited lysosomal storage disease that manifests multisystemic damages such as cerebrovascular disease, strokes, cardiomyopathy, arrhythmias, nephropathy, neuropathy, ophthalmological abnormalities and premature death.1,2 FD is caused by mutations in the galactosidase alpha (GLA) gene, resulting in a lack of activity of the lysosomal enzyme α-galactosidase A (α-Gal A).3–6 The heterogeneous clinical manifestations of FD are related to residual activity of α-Gal A. According to the residual enzymic activity of α-Gal A, FD is divided into ‘classical’ and ‘nonclassical’ or ‘atypical’ FD,2 effecting the age of onset, clinical features and clinical course in different patients inter- or intrafamily.7 The incidence of FD ranged from 1 to 40 000–1 in 117 000 live births.8,9 As the diagnostic sensitivity improves, the incidence of FD continues to rise. The recent newborn screening data revealed a higher incidence of 1 in 3100 newborns in Italy and 1 in 1500 newborn males in Taiwan.10,11

The GLA gene is located on Xq22.1,12 encoding a 429 amino acid precursor protein, and a mature protein containing 370 amino acid glycoprotein.13 According to the Human Gene Mutation Database (http://www.hgmd.cfac.uk/ac/index.php), there were presently 941 reported mutations (see Supplementary Figures S1 for more details). The majority of those 657 (∼ 70%) were missense or nonsense mutations. According to previous research, the main pathogenic mechanism underlying FD was the deficiency of α-Gal A, which led to the progressive accumulation of glycolipids, primarily globotriaosylceramide (GL-3) and globotriaosylsphingosine (lyso-Gb3), in plasma of many cell types, including endothelium and cardiomyocytes.14  GLA mutations leading to a complete loss of function result in the classical phenotype, with negligible or very low residual enzyme activity.15 As one of the rare diseases, FD is characterized by low prevalence, a lack of clinical samples, difficulties creating cohorts, difficulties running clinical trials and traditional screening. The current effective strategy for FD includes enzyme replacement therapy (ERT), drug chaperones and multidisciplinary management.16,17 Early and long-term ERT in young patients can help eliminate Gb3 accumulation from endothelial cells in the skin, kidney and heart, potentially slowing or preventing irreversible damage in the cardiac and renal systems.18 However, ERT has been shown to only prevent disease progression when initiated in the early stages and is unable to reverse the disease in advanced cases.19–21 ERT may have limited efficacy in certain cell types, including glomerular podocytes, cardiac myocytes and vascular smooth muscle cells.18,22

In our cohort of FD, we identified multiple mutations in the GLA gene by performing whole-exome sequencing (WES). Some of these mutations have been previously reported and functionally evaluated. In this study, we focused on a unique nonsense mutation (c.72G > A, p. Trp24*) in the GLA gene. We reported a 12 years 9 months boy diagnosed with FD from a three-generation Chinese family. In the proband, WES and Sanger sequencing identified a novel nonsense mutation of the GLA gene. Bioinformatic analysis was carried out to predict the pathogenicity of this mutation. We also generated patient-specific induced pluripotent stem cells (iPSC) lines (iPS-FD) from our proband, which showed a lack of α-Gal A. Our discoveries not only elucidated the etiology of the novel mutation in affected patients but also highlighted the utility of iPSCs as a valuable tool for clarifying the molecular mechanisms and providing new insights into the therapy of FD.

Materials and methods

Proband, pedigree and clinical assessments

In November 2021, a Chinese boy aged 12 years 9 months visited our Department of Nephrology in the Children’s Hospital, Zhejiang University School of Medicine, Hangzhou, China. He suffered from unexplained foot pain, especially in the toes, as well as hypohidrosis, constipation and diarrhea. The boy was evaluated with a detailed history, physical examination, laboratory and imaging studies and genetic testing. Finally, he was diagnosed as FD.

Whole-exome sequencing

Genomic DNA was extracted from peripheral leukocytes using the Trace Blood DNA Extraction Kit (Lifefeng DK801) according to the manufacturer’s instructions. The VAHTS Universal DNA Library Prep Kit for Illumina V3 (Vazyme) and KAPA HyperExome Sequence Capture Kit (Roche, USA) were used to create the whole-exome DNA library. By comparison with the human genome reference (hg19), the Burrows–Wheeler Aligner sequence alignment method was carried out. Using GATK software, the mutation sites in the target sequence were located. The variants were validated by Sanger sequencing analysis by using GoldStar Taq Master Mix with the NovaSeq 6000 (Illumina) platform. The primers were as follows: GGTAGGCGTCCTTGCCAAT (forward) and TAGCGGAACGTCTTACGTGAC (reverse).

Mutation bioinformatics analysis

The FASTA sequence of GLA was downloaded from NCBI, and then the I-TASSER server was used to develop a model to mimic the nonsense mutation.23–25 The structures were displayed by the PyMOL visualization tool (http://www.pymol.org/). We use the magenta sphere to mark the mutation site (p. Trp24*) on the secondary structure. The blue lines represent the remaining structure post mutation, while the translucency indicates the missing part after mutation.

Isolation of PBMCs from patients and generation of iPSC lines

Healthy control iPSCs (iPS-B1) were obtained from the lab of Professor Xiaoling Guo and purchased from Beijing Cellapy Biotechnology Co., LTD. FD iPSCs (iPS-FD) were reprogrammed from peripheral blood mononuclear cells (PBMCs) from the proband.26,27 PBMCs were isolated from the patient venous blood by Ficoll density gradient centrifugation via a PBMC Isolation Kit (Solarbio, Cat. No. P8610). PBMCs (2.5 × 105–5 × 105 cells) were transduced with four reprogramming transcription factors (Klf4, Oct3/4, Sox2 and c-Myc) following the instructions of the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Cat. No. A16517). We cultured the PBMCs with StemSpan-XF (Stemcell Cat. NO. 100-0073) with StemSpan CD34+ Expansion Supplement (Stemcell Cat. NO. 02691) before Day 6. Then, we observed that the PBMCs were reseeded onto LDEV-free hESC-qualified Geltrex (Gibco Cat. No. A1413201)-coated plates from Days 10 to 12. We then switched the culture medium to iPSC culture medium mTeSR (Stemcell Cat. No. 85850). From Days 18 to 20 after transduction, colonies gradually increased in size. By Day 20 post transduction, we picked the iPSC colonies and expanded them in Geltrex-coated plates with mTeSR.

iPSC maintenance and culture

iPSCs were cultured with mTeSR on LDEV-free hESC-qualified Geltrex-coated plates. For routine maintenance, 70–80% confluent iPSCs were treated with Versene (Gibco Cat. No. 15040066) for 1 min at room temperature (RT) and 5–7 min in a 37°C incubator, dissociated into small clumps by mechanical force, and passaged onto Geltrex-coated plates at a ratio of 1:10–1:20. iPSCs were cultured with mTeSR supplemented with 10 µM Rho inhibitor (Y-27632, Stemcell Cat. No.72307) within 24 h. After that, change mTeSR daily until the next passage.

Immunofluorescence staining

iPSCs were fixed in 4% paraformaldehyde for 20 min at 4°C and then permeabilized for 10 min with PBST (PBS containing 0.3% Triton X-100) at RT. Cells were blocked with PBS containing 4% bovine serum albumin at RT for 60 min and incubated with primary antibody (Oct-3/4, sc-5279; Nanog, sc-293121; Sox-2, sc-365823) in 1:100 overnight at 4°C. After incubating with the secondary antibody, immunofluorescence was visualized with a Nikon A1 Ti confocal microscope.

Western blot

iPSCs were lysed in RIPA buffer with protease inhibitors and 1 mM PMSF for 30 min on a rotator at 4°C. Using a 10% polyacrylamide gel, 20 mg of protein was separated by SDS electrophoresis and transferred to an Immobilon PVDF membrane (Millipore). The membrane was blocked with 5% milk in TBST and probed overnight at 4°C with an anti-GLA (Abcam, #ab168341) antibody. After washing the membrane with TBST, it was incubated for 2 h at RT with HRP-conjugated secondary antibody. The membrane was developed using the ECL Detection System (Bio-Rad ChemiDoc Touch).

GLA enzyme activity assay

iPSCs were collected after dissociation from the plates, centrifuged at 300 g, and removed from the supernatant. Every 5 million cells were resuspended in 1 ml extraction buffer followed by sonication. The lysates were cleared by centrifugation at 15 000 × g for 20 min at 4°C. The GLA enzyme activity of the supernatants was measured according to the manufacturer’s instructions (Solarbio, Cat. No. BC2575).

Statistical analysis

All data are presented as the mean ± SD from at least three separate experiments. The P values were determined by a two‐tailed Student’s t test. P < 0.05 was considered significant. Statistical analysis was performed using GraphPad PRISM 9.01 software.

Results

Clinical information and genetic findings

This study reported a Chinese family with three generations and eight members (Figure 1A). The boy aged 12 years 9 months, suffered from unexplained foot pain, particularly in the toes, for 4 years. The ache was worse when he exercised and the weather changed. Furthermore, he frequently suffered from diarrhea or constipation. In addition, his mother also suffered from pain in her hands and feet when she was a teenager. Tables 1 and 2 displays the boy’s and his mother’s primary clinical laboratory results. Routine blood examination, liver function, renal function, routine urine test, as well as hearing and sight tests were all performed. The α-Gal A activity and the concentration of Lyso-GL-3 of the boy and his mother were both abnormal and indicated FD. In terms of imaging, the magnetic resonance imaging (MRI) of the boy’s feet revealed many aberrant tarsal bone signals. The electrocardiogram (ECG) of the boy revealed an incomplete right bundle branch block. The cardiac ultrasound of the boy detected modest tricuspid and pulmonary valve regurgitation. In addition, the mean pure tone audiometry thresholds of his mother showed hearing loss (Figure 1C–G). To confirm their diagnosis, the boy and his mother underwent WES. We identified a novel nonsense variant (c.72 G > A; p. Trp24*) on the GLA gene (Figure 1B). The unique mutation was evaluated as a pathogenic mutation according to ACMG guidelines (Table 3). Based on all the above clinical information and genetic findings, the boy and his mother were diagnosed with FD.

Figure 1. Clinical manifestation of the FD patient’s family. (A) A pedigree diagram of three generations of this family. Squares and circles represent males and females, respectively. Shadowed symbols indicate the FD patient with c.72 G>A mutation. The black arrow indicates the proband. (B) Sanger sequencing at the mutation site with a blood sample. High-throughput sequencing showed a novel de novo nonsense mutation of the GLA gene in the proband (c.72 G>A; p. Trp24*). In all panels, the locations of mutant bases are indicated by arrows. (C) ECG of the proband. (D) MRI of the patient’s both feet. (E) Cardiac ultrasound of the patient. (F and G) Mean pure tone audiometry thresholds of the proband and his mother. Annotations: The red curve of the right ear formed by the circle and the blue curve of the left ear formed by X represent air conduction, while the red curve of the right ear formed by ‘>’ and the blue curve of the left ear formed by ‘>’ represent bone conduction.

Table 1. Basic information and clinical manifestations of the two affected members

Characteristics	Proband	Mother	
Age	12Y9M	34Y	
Sex	Male	Female	
Height (cm)	163	156	
Weight (kg)	47	62	
Neuropathic pain	Y	Y (adolescence)	
Hypohidrosis	Y	N	
Angiokeratoma	N	N	
Corneal opacity	N	N	
Gastrointestinal discomfort	Y (constipation and diarrhea)	Y (constipation)	
Hearing	N	Y (neurogenic deafness of the right ear)	
Y, Yes; N, No.

Table 2. Laboratory tests and image tests of the two affected members

Laboratory findings	Proband	Mother	Reference range	
α-Gal A (μmol/L/h)	0.3	2.1	2.4–11.65	
Lyso-GL-3 (ng/ml)	115.6	5.6	<1.11	
Leukocytes (×109/L)	5.9	8.5	4–12	
Hemoglobin (g/L)	124	131	110–155	
Thrombocytes (×109/L)	331	205	100–400	
CRP (mg/L)	0.3	<0.2	<1	
Alanine aminotransferase (U/L)	9	18	5–50	
Uric acid (μmol/L)	363	266	65–420	
Serum creatinine (μmol/L)	54	53	15–77	
Urea (mmol/L)	5.0	5.9	2.8–7.6	
eGFR (ml/min/1.73 m2)	110.1a	121.7b		
Urinary protein	–	–	Negative	
24H urine protein (mg)	83.4	230.0	<150	
Cardiac ultrasound	Mild regurgitation of the tricuspid valve and pulmonary valve	Mild regurgitation of the tricuspid valve		
LVMI (g/m2.70)	30.8	53.1	<38	
ECG	Incomplete right bundle branch block	High voltage in left ventricle		
Brain MRI	N	Small ischemic focus in the center of the left semiovale		
a Calculated using the Schwartz equation.

b Calculated using the MDRD equation.

Table 3. Variant table for the novel mutation of GLA gene

Gene	Chromosome	Exon	Nucleotide change	Amino acid change	ACMG	
GLA NM_000169.2	Chr X: 100662820	1	c.72G>A	p.Trp24*	pathogenetic	

Bioinformatic analysis

The nonsense variant (c.72 G > A) was located on exon 1 of GLA and made a truncation protein. The three-dimensional structure of α-Gal A protein was obtained by PyMOL visualization tool (Figure 2A). The truncation mutation (p. Trp24*) marked as a magenta sphere caused the loss of the most structure of protein, remaining only the black portion. Sequence conservative analysis indicated that the highly conserved loci of the novel mutation (p. Trp24*) may be involved in essential physiological functions (Figure 2B and C). These findings showed that the new variation could cause α-Gal A activity to malfunction, leading to FD.

Figure 2. Sequence alignments of GLA proteins from various species and the 3D structure of the protein. (A) The domain and 3D structure of GLA. The GLA is represented in the cartoon, and the mutation site (p. Trp24*) is shown as a magenta sphere. The middle is the mutated structure, while the translucency on the right is the missing part after mutation. (B) Conserved amino acid background colors are the same among species. Numbers indicate the positions of the amino acid sequences. (C) The mutation site (c.72 G>A) within the conservative amino acid region. The conservation scale ranges from variable (blue) to average (white) to conserved (red). Annotations: e: An exposed residue according to the neural-network algorithm. b: A buried residue according to the neural-network algorithm. f: A predicted functional residue (highly conserved and exposed).

Establishment of FD-iPSC lines and identification of abnormal enzymatic activity

PBMCs isolated from the proband were reprogrammed to iPSCs following the instructions of the CytoTune™-iPS 2.0 Sendai Reprogramming Kit. The process of transduction is shown in Figure 3A. We observed that the PBMCs gradually transferred into cell clumps on the Geltrex-coated plates approximately 8–10 days after transduction. From Days 12 to 15 after transduction, colonies gradually increased in size. By Day 18–20 post transduction, we picked the iPSC colonies and cultured them in Geltrex-coated plates with mTeSR, which we noted as iPS-FD. The iPS-FD cells exhibited typical iPSC morphology under light microscopy and expressed the pluripotency markers NANOG, OCT3/4 and SOX-2 by immunofluorescence staining (Figure 3B). The pluripotency markers SSEA-4 and TRA-1-81 were confirmed by flow cytometric analysis (Figure 3C). The normal structure and quantity of karyotypes of iPS-FD were measured by karyotype analysis (46, XY) (Figure 3D). Western blotting confirmed the existence of nonsense mutations at the target site and the absence of the corresponding full-length proteins (Figure 3E). These data indicated that the somatic cells (PBMCs) from FD patients were successfully reprogrammed into iPSCs and maintained their self-renewal capacity and pluripotency. Finally, we tested the α-Gal A enzyme activity of iPS-FD to confirm whether the new mutation had an effect on enzyme activity. The enzyme activity of patient-specific GLA gene mutant iPSCs (iPS-FD) was 65% lower than that of control iPSCs (iPS-B1) (Figure 3F). These iPSC lines (iPS-FD) undoubtedly provide valuable cell models for clarifying the molecular mechanisms underlying α-Gal A enzyme activity abnormalities and drug screening with FD.

Figure 3. Generation of patient-specific GLA mutant iPSC lines and estimation of enzyme activity. (A) The milestones of PBMC reprogramming into iPSCs. Magnification 4×, scale bar 100 μm. (B) Representative images of immunofluorescence staining show the pluripotency of iPSCs indicated by Oct-3/4, Nanog, and Sox-2. Magnification 40×, scale bar 100 μm. (C) Flow cytometry (FCM) analysis was performed to verify the multipotent antigen on the surface of iPSCs (PE-A: TRA-1-81 APC-A: SSEA-4). (D) Karyotype analysis and karyotype of iPS-FD (46, XX). (E) Western blot of GLA present in iPS-FD and iPS-B1 cells. (F) Comparison of the enzyme activity of iPS-FD and iPS-B1. Data are presented as the mean ± SD from three independent experiments. Asterisks represent significance (*P < 0.05).

Discussion

FD, also known as Anderson-Fabry disease, is a rare X-linked recessive inherited disorder caused by GLA gene dysfunction.5,6 Mutations in the GLA gene caused α-Gal A activity to be weak or missing, resulting in the progressive accumulation of toxic metabolites Gb3 and LysoGb3 in a variety of cell types, and leading to a series of clinical outcomes.

In this study, we discovered a novel mutation (c.72 G > A; p. Trp24*) in the GLA gene from a Chinese family diagnosed with FD. The boy and his mother both suffered from multi-symptoms of FD, with deficiency of α-Gal A activity and accumulation of Lyso-Gb-3. The cardiac ultrasound and ECG of the boy and his mother both indicated cardiovascular involvement. Furthermore, his mother has already progressed to kidney damage and vestibular disease, as evidenced by microalbuminuria of 230 mg/24 h urine protein (ref. < 150 mg/24 h urine protein) and sensorineural deafness. It is apparent that early diagnosis and effective treatment are critical for the boy, to prevent or slow his progress like his mother. Fortunately, the boy received ERT in our department and achieved partial remission.

According to the bioinformatic analysis, we observed that the mutation occurred in the N-terminal region, leading to a truncation of the protein and leaving only 24 amino acids. This truncation severely affects the function of the protein and destroys its enzyme activity.

Interestingly, the development of iPSCs has permitted the genesis and study of rare diseases in culture dishes. iPSCs carry the patients’ individual genetic information and can undoubtedly serve as a potential and distinct disease model for elucidating molecular mechanisms as well as a high-throughput screening system for screening viable medicines.28,29 Therefore, we generated patient-specific iPSC lines (iPS-FD) from patient’s PBMCs. These iPS-FD lines served as a promising tool to mimic the pathological α-Gal A activity deficiency observed in our proband. As depicted in Figure 3F, the α-Gal A activity of iPS-FD was significantly lower (60%) than that of normal iPSCs derived from healthy donors (iPS-B1). These iPS-FD lines can be stored for extended periods and have the potential to differentiate into various cell types involved in FD, such as endothelial cells, cardiac myocytes and podocytes.19,30,31 The enzymatic activity properties of iPS-FD could be considered a new area for screening therapeutic targets. Additionally, by genetically correcting these cells, they could potentially be utilized for developing patient-specific cell replacement therapies for FD in the future.

Conclusion

This work not only elucidated the etiology of novel mutations in affected patients but also highlighted the utility of iPSCs as a valuable tool for clarifying the molecular mechanisms and new insights into the therapy of FD.

Supplementary Material

hcae038_Supplementary_Data

Author contributions

Langping Gao (Data curation [lead], Formal analysis [lead], Methodology [lead], Writing—original draft [lead], Writing—review & editing [lead]), Zhihong Lu (Conceptualization [equal], Data curation [equal], Formal analysis [equal], Writing—original draft [equal]), Ying Zhang (Data curation [equal], Formal analysis [supporting], Methodology [equal]), Lexin Liu (Formal analysis [equal], Methodology [supporting], Writing—original draft [equal]), Jingmiao Sun (Data curation [equal], Formal analysis [supporting]), Haidong Fu (Conceptualization [supporting], Project administration [supporting], Writing—original draft [supporting]), Jianhua Mao (Conceptualization [lead], Funding acquisition [equal], Writing—review & editing [equal]) and Lidan Hu (Conceptualization [equal], Funding acquisition [equal], Writing—original draft [equal], Writing—review & editing [lead])

Supplementary material

Supplementary material is available at QJMED online.

Conflict of interest: The authors declare no competing financial interests.

Funding

This study was financially supported by the Key R&D Program of Zhejiang (2023C03027 to Lidan Hu) and the National Natural Science Foundation of China (U20A20351 to Jianhua Mao, 82200784 to Lidan Hu).

Data availability

The datasets used or analyzed during the current study are available from the corresponding author upon reasonable request.

Ethics declaration

The studies involving human participants were reviewed and approved by the ethics committee of the Local Research Ethics Committee of the Children’s Hospital, Zhejiang University School of Medicine (2020-IRB-187-A1). Written informed consent was obtained from all participants in this study. All the research was conducted according to the principles of the Declaration of Helsinki (2013).
==== Refs
References

1 Brady RO , GalAE, BradleyRM, MartenssonE, WarshawAL, LasterL.  Enzymatic defect in Fabry’s disease: ceramidetrihexosidase deficiency. N Engl J Med  1967; 276 :1163–7.6023233
2 Schiffmann R.  Fabry disease. Pharmacol Ther  2009; 122 :65–77.19318041
3 Ortiz A , GermainDP, DesnickRJ, PoliteiJ, MauerM, BurlinaA, et al  Fabry disease revisited: management and treatment recommendations for adult patients. Mol Genet Metab  2018; 123 :416–27.29530533
4 El-Abassi R , SinghalD, EnglandJD.  Fabry’s disease. J Neurol Sci  2014; 344 :5–19.25106696
5 Hoffmann B , MayatepekE.  Fabry diseasee—often seen, rarely diagnosed. Dtsch Arztebl Int  2009; 106 : 440–7. https://www.aerzteblatt.de/10.3238/arztebl.2009.0440 (21 November 2022, date last accessed)19623315
6 Meikle PJ , HopwoodJJ, ClagueAE, CareyWF.  Prevalence of lysosomal storage disorders. JAMA  1999; 281 :249–54.9918480
7 Spada M , PagliardiniS, YasudaM, TukelT, ThiagarajanG, SakurabaH, et al  High incidence of Later-Onset Fabry disease revealed by newborn screening. Am J Hum Genet  2006; 79 :31–40.16773563
8 Lin HY , ChongKW, HsuJH, YuHC, ShihCC, HuangCH, et al  High incidence of the cardiac variant of Fabry disease revealed by newborn screening in the Taiwan Chinese population. Circ Cardiovasc Genet  2009; 2 :450–6.20031620
9 Bishop DF , KornreichR, DesnickRJ.  Structural organization of the human alpha-galactosidase a gene: further evidence for the absence of a 3’ untranslated region. Proc Natl Acad Sci U S A  1988; 85 :3903–7.2836863
10 Garman SC , GarbocziDN.  The molecular defect leading to fabry disease: structure of human α-Galactosidase. J Mol Biol  2004; 337 :319–35.15003450
11 Germain DP.  Fabry disease. Orphanet J Rare Dis  2010; 5 :30.21092187
12 Varela P , Mastroianni KirsztajnG, FerrerH, ArandaC, WallbachK, Ferreira da MataG, et al  Functional characterization and pharmacological evaluation of a novel GLA missense mutation found in a severely affected Fabry disease family. Nephron  2020; 144 :147–55.31665721
13 Germain DP , HughesDA, NichollsK, BichetDG, GiuglianiR, WilcoxWR, et al  Treatment of Fabry’s disease with the pharmacologic chaperone migalastat. N Engl J Med  2016; 375 :545–55.27509102
14 Schaefer RM , Tylki-SzymańskaA, HilzMJ.  Enzyme replacement therapy for Fabry disease: a systematic review of available evidence. Drugs  2009; 69 :2179–205.19852524
15 Thurberg BL , RennkeH, ColvinRB, DikmanS, GordonRE, CollinsAB, et al  Globotriaosylceramide accumulation in the fabry kidney is cleared from multiple cell types after enzyme replacement therapy. Kidney Int  2002; 62 :1933–46.12427118
16 Najafian B , TøndelC, SvarstadE, GublerMC, OliveiraJP, MauerM.  Accumulation of globotriaosylceramide in podocytes in Fabry nephropathy is associated with progressive podocyte loss. J Am Soc Nephrol  2020; 31 :865–75.32127409
17 Breiden B , SandhoffK.  Lysosomal glycosphingolipid storage diseases. Annu Rev Biochem  2019; 88 :461–85.31220974
18 Brady RO , SchiffmannR.  Enzyme-replacement therapy for metabolic storage disorders. Lancet Neurol  2004; 3 :752–6.15556808
19 Germain DP , WaldekS, BanikazemiM, BushinskyDA, CharrowJ, DesnickRJ, et al  Sustained, long-term renal stabilization after 54 months of agalsidase β therapy in patients with fabry disease. J Am Soc Nephrol  2007; 18 :1547–57.17409312
20 Yang J , ZhangY.  I-TASSER server: new development for protein structure and function predictions. Nucleic Acids Res  2015; 43 :W174–81.25883148
21 Zheng W , ZhangC, LiY, PearceR, BellEW, ZhangY.  Folding non-homologous proteins by coupling deep-learning contact maps with I-TASSER assembly simulations. Cell Rep Methods  2021; 1 :100014.34355210
22 Zhang C , FreddolinoPL, ZhangY.  COFACTOR: improved protein function prediction by combining structure, sequence and protein–protein interaction information. Nucleic Acids Res  2017; 45 :W291–W299.28472402
23 Takahashi K , YamanakaS.  Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell  2006; 126 :663–76.16904174
24 Takahashi K , TanabeK, OhnukiM, NaritaM, IchisakaT, TomodaK, et al  Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell  2007; 131 :861–72.18035408
25 Fabry J.  Ein beitrag zur kenntniss der purpura haemorrhagica nodularis (purpura papulosa haemorrhagica hebrae). Arch f Dermat  1898; 43 :187–200.
26 Anderson W.  A case of “angeio-keratoma”. Br J Dermatol  1898; 10 :113–7.
27 Yamanaka S.  Pluripotent stem cell-based cell therapy—promise and challenges. Cell Stem Cell  2020; 27 :523–31.33007237
28 Shan Z , DingL, ZhuC, SunR, HongW.  Medical care of rare and undiagnosed diseases: prospects and challenges. Fundam Res  2022; 2 :851–8.38933390
29 Birket MJ , RaibaudS, LettieriM, AdamsonAD, LetangV, CervelloP, et al  A human stem cell model of Fabry disease implicates LIMP-2 accumulation in cardiomyocyte pathology. Stem Cell Rep  2019; 13 :380–93.
30 Kim JW , KimHW, NamSA, LeeJY, ChoHJ, KimTM, et al  Human kidney organoids reveal the role of glutathione in Fabry disease. Exp Mol Med  2021; 53 :1580–91.34654880
31 Cui S , FangX, LeeH, ShinYJ, KohES, ChungS, et al  Modeling of Fabry disease nephropathy using patient derived human induced pluripotent stem cells and kidney organoid system. J Transl Med  2023; 21 :138.36814269
