
==== Front
Iran J Microbiol
Iran J Microbiol
IJM
Iranian Journal of Microbiology
2008-3289
2008-4447
Tehran University of Medical Sciences

10.18502/ijm.v16i4.16303
IJM-16-450
Original Article
Antibiotic susceptibility and biofilm forming ability of Staphylococcus aureus isolated from Jordanian patients with diabetic foot ulcer
Owais Dima 1
Al-Groom Rania M. 2 3 *
AlRamadneh Tareq Nayef 2
Alsawalha Laila 2
Khan Mohd Sajjad Ahmad 4
Yousef Omar H. 3
Burjaq Shereen Z. 5
1 Department of Allied Medical Sciences, Al-Balqa Applied University, Salt, Jordan
2 Department of Medical Laboratory Science, Faculty of Allied Medical Sciences, Zarqa University, Zarqa, Jordan
3 Department of Allied Medical Sciences, Zarqa University College, Al-Balqa Applied University, Salt, Jordan
4 Department of Basic Sciences, Deanship of Preparatory Year and Supporting Studies, Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia
5 Department of Medical Laboratory Sciences, Faculty of Science, Al-Balqa Applied University, Salt, Jordan
* Corresponding author: Rania M. Al-Groom, Ph.D, Department of Medical Laboratory Science, Faculty of Allied Medical Sciences, Zarqa University, Zarqa, Jordan; Department of Allied Medical Sciences, Zarqa University College, Al-Balqa Applied University, Salt, Jordan., Tel: +96-2795743948, Fax: +96-253532312, Email:raniaalgroom@bau.edu.jo
8 2024
16 4 450458
4 2024
6 2024
Copyright© 2024 The Authors. Published by Tehran University of Medical Sciences.
2024
https://creativecommons.org/licenses/by-nc/4.0/ This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International license (https://creativecommons.org/licenses/by-nc/4.0/). Non-commercial uses of the work are permitted, provided the original work is properly cited.
Background and Objectives:

Microbial biofilm is characterized by the irreversible attachment of planktonic cells to a surface and is usually associated with high antimicrobial resistance with worsening the wound healing. The objective of the study was to determine the prevalence of Staphylococcus aureus in diabetic foot ulcers (DFUs) of diabetic patients and to investigate antibiotic susceptibility patterns of these isolates. In addition to screen biofilm forming ability of isolated S. aureus.

Materials and Methods:

A total of 112 non-healing wound swabs of diabetic foot patients were collected and cultured on different culture media to identify and characterize 98 isolates. The S. aureus isolates were examined for their antibiotic susceptibility to different antimicrobial agents. Furthermore, S. aureus isolates were evaluated for their biofilm production capability using the Tissue Culture Plate Method (TPC). The level of icaA gene expression was determined by RT-PCR.

Results:

The results of this study showed that these non-healing wounds yield positive cultures, with an average of 1.67 organisms per sample. The isolates showed highest resistance against oxacillin (95.2%) and lowest resistance against linezolid (3.7%). All isolates were biofilm producers and a significant association with the icaA gene expression level was recorded.

Conclusion:

This study showed that S. aureus isolates have a great ability to produce biofilms that are associated with the chronicity of wounds in diabetic patients. Routine screening for biofilm formers in chronic wounds and their antibiotic susceptibility testing will help in early treatment and prevent any other complications.

Antimicrobial resistance
Biofilm
Diabetes
Diabetic foot
Staphylococcus aureus
==== Body
pmcINTRODUCTION

Neuropathy and vascular problems are common complications of diabetes mellitus (DM), which may result in diabetic foot infections (1). Unhealed chronic wounds like diabetic foot ulcers, pressure ulcers, and venous leg ulcers, are major worldwide healthcare problems (2, 3). DM is a systemic metabolic disease displaying significant incidence worldwide, and is characterized by increased blood glucose levels (4). Diabetic foot complications have the largest clinical influence of all other medical complications associated with diabetes; 85% of limb amputations are preceded by a nonhealing ulcer (5). Studies estimated that approximately 25% of patients will develop one or more foot ulcers (DFUs) during their lifetime (6, 7). Once the skin protective layer is broken, deep soft tissues will be exposed to bacterial infections due to the bacterial colonization with the involvement of joints or bones; as a result, osteomyelitis will occur (8, 9). Mortality and morbidity are remarkably affected by DFUs (10), and patients’ quality of life is negatively influenced leading to reduced physical, physiological, and social functions (11). In DFUs, the most frequently isolated microorganisms may include Staphylococcus, Streptococcus, Enterococci, Enterobacteriaceae, and Pseudomonas aeruginosa species (12, 13).

Recent studies have shown that one of the most prevalent colonizers among DFUs is S. aureus (14, 15). S. aureus uses virulence factors (VFs) for defense and escape from the immune system. Generally, biofilm production by S. aureus is considered as it’s major defense mechanism leading to wound chronicity with suppressed wound healing (16). Therefore, better management methods and therapy could be developed if the bacterial biofilms and mechanism to eradicate them are understood (17). Naturally, the structure of biofilm is genetically resistant to antimicrobial agents and hard to remove from the infected tissue, since they can be up to ten thousand times less susceptible to antimicrobial agents than free-floating bacteria (18). Poly-intercellular adhesion (PIA) molecules are encoded by a locus called ica, which includes icaABCD genes, among the ica genes icaA and icaD are known to be responsible for biofilm formation in S. epidermidis and S. aureus (19). To manage such infections by using proper antibiotics, appropriate screening of multi-drug resistant organisms (MDROs), their antimicrobial susceptibility patterns and detection of biofilm formation are required (20). DFUs and DFIs are primarily multidrug-resistant, poly-microbial infections caused by the strains of higher ability to form biofilms as a significant virulence factor and hence often leads to treatment failure (21). To our knowledge, few studies in Jordan have demonstrated S. aureus biofilm production and its co-relationship with antimicrobial resistance pattern (22, 23). However, less information is available on corelating level of biofilm genes expression with drug resistance. Therefore, considering this, the present study aimed to investigate incidence of bacterial species especially S. aureus in chronic pus samples of diabetic foot ulcer patients and to establish their occurrence in relation to gender and age. Also, to determine drug susceptibility profile to find out effective antimicrobial drug against muti-drug resistant and strong biofilm forming isolates. We further attempted to correlate multi-drug resistance and biofilm formation with the level of icaA gene expression.

MATERIALS AND METHODS

Bacterial strains and culture conditions. A total of 112 pus samples were collected from patients with unhealed diabetic foot ulcers using sterile cotton swabs, after official approval for samples collection was obtained from the National Centre for Diabetes Endocrinology and Genetics. This study was approved by the Institutional Review Board committee (IRB) at Al-Balqa Applied University. The pus samples were put into a transportation medium to be cultured later. Out of these samples, 98 bacterial isolates were obtained. Using a sterile loop, the pus samples were streaked on different kinds of media (Chocolate agar, MacConkey, Mannitol salt agar, and blood agar), then incubated for 24–48 hours at 37°C. After the incubation period, the isolates were discriminated from each other on the basis of morphological appearance and characteristics such as consistency, size, colony color, texture. The isolates were identified based on Gram staining, morphological and biochemical characterization according to Bergey’s manual (24).

Antimicrobial susceptibility testing. As shown in Table 1, fifteen antimicrobial agents purchased from Bioanalyse (Ankara, Turkey), were used for susceptibility testing of all S. aureus isolates. Disc diffusion assays as recommended by Clinical and Laboratory Standards Institute (CLSI) documents M02-A12 was used with some modifications to assess the sensitivity of the bacterial strains. Briefly, 100 μL of 0.5 Mc-Farland cell suspension was spread onto NA plates. Next, antibiotic drug discs were placed over the agar surface and incubated at 37°C for 24 h. Each experiment was conducted in triplicate and the average diameter of the zone of inhibition around the discs was calculated in mm. The isolates were classified into resistant, intermediate, and sensitive by following the guidelines of CLSI.

Table 1. Antibiotic discs used for antibiotic susceptibility testing for S. aureus isolates.

Antibiotic	Symbol	Concentration	
Norfloxacin	NOR	10 µg	
Oxacillin	OX	1 µg	
Tigecycline	TGC	15 µg	
Teicoplanin	TEC	30 µg	
Erythromycin	E	15 µg	
Amikacin	AK	30 µg	
Linezolid	LZ	30 µg	
Gentamycin	GM	10 µg	
Clindamycin	DA	2 µg	
Rifampin	RF	5 µg	
Levofloxacin	LEV	5 µg	
Chloramphenicol	CL	30 µg	
Ciprofloxacin	CIP	5 µg	
Ampicillin	AM	10 µg	
Cefazolin	CZ	30 µg	

Tissue culture plate method (TCP). TCP as adapted by Hassan et. al. (25) is considered as the most widely used and a standard method for the detection of biofilm formation. In the present study, all the isolates were tested in triplicate using this screening test to evaluate their ability to produce biofilms. A broth without bacterial inoculum served as negative control whereas a standard reference strain S. aureus ATCC25923 (a known biofilms former strain) is used as positive control. OD values represent an indicator of bacteria adhering to the surface and biofilm formation. OD ≤ 0.617 was considered a non-biofilm producer. Whereas 0.617< OD ≤ 1.234 was considered a moderate biofilm producer and OD > 2.4 as strong biofilm producer.

Real-time PCR assay: isolates preparation and RNA extraction from Staphylococcus aureus. The RNA extraction was obtained by using SV total RNA isolation system (Promega, UK) by following the manufacturer’s procedure. Briefly, overnight grown culture, at 37°C, on nutrient agar of 28 isolates with different degrees of ability to form biofilms. Fresh bacterial isolates were inoculated in tubes containing 5 ml of sterile TSB supplemented with 1% glucose, and then it was adjusted to 0.5 McFarland, and incubated for 18 hours at 37°C. Using sterile 96-well tissue culture plates, a volume of 1000 µl of the broth was dispensed into the wells, and then the plates were covered by lids and incubated for 24 hours at 37°C. After incubation, the plates were washed twice with PBS (PH= 7.2), left to dry, then fixed with ethanol for 15 minutes and further processed to obtain RNA extracts as adapted by the authors (18, 26, 27). The elution tubes containing purified RNA were stored at −70°C.

Assessment of isolated RNA quality and quantity. NanoDrop (Thermo Fisher Scientific, USA) was used to quantify the concentration and purity of isolated RNA to evaluate the integrity of samples for further analysis in RT-qPCR. RNA concentration and RNA purity levels were detected at 260/280 nm absorbance ratio. A260 /A280 ratio of approximately 2.0 was suggestive that the RNA sample is pure and accepted for conversion to cDNA.

Complementary DNA (cDNA) synthesis. RNA samples were converted to cDNA following the manufactures instructions of QuantiTect Reverse Transcription Kit (Qiagen, Germany). Genomic DNA elimination reaction was prepared by adding 2 µl of gDNA Wipeout Buffer, 4 µl of templet RNA, and RNase-free water, and incubated for 2 minutes at 42°C, then placed directly on ice. The reverse-transcription master mix was prepared by adding 1 µl RNase inhibitor, 2 µl of MgCl₂, 2 µl dNTPs, RT Primer mix, and 14 µl genomic DNA elimination reaction. Then, 14 µl RNA templets were added to each tube containing a reverse-transcription master mix and incubated for 15 minutes at 42°C, and 3 minutes at 95°C using a thermal cycler (Thermo Fisher Scientific, USA), to inactivate RTase. Samples containing cDNA were preserved at −20°C to be used later (28, 29).

Gene expression profiling by RT-qPCR. The recA reference gene was used as an internal control to calculate the ∆CT value. Primers of target and house-keeping gene that were used in the study are shown in Table 2. RT-qPCR master mix was prepared for each reaction by combining the components taking into consideration the thermal cycling conditions are shown in Tables 2 and 3.

Table 2. Primers of target gene and housekeeping gene used in the study.

Gene name	Amplicon size (bp)	Annealingtemperature (C°)	Primer sequence (5’-3’)	
icaA	188	59°	F: ACACTTGCTGGCGCAGTCAA
R: TCTGGAACCAACATCCAACA (DuKanovic et al. 2022)	
recA (housekeeping gene)	229	55°	F: AAGTACGTCGTGCAGA
R: TGACCCATTCGTTCGC (30)	

Table 3. The program of quantitative PCR for housekeeping gene and icaA gene.

Step	Temperature	Time	Number of cycles	
Initial denaturation	95°C	5 minutes	1	
Denaturation	95°C	15 seconds	40	
Annealing	60°C	1 minute	40	
Extension	72°C	20 seconds	40	

Statistical analysis. Experiments were repeated three times, and the data were analyzed using Statistical Package for Social Sciences (SPSS). Version 22.0 (IBM Corporation, Armonk, NY). Frequencies and percentages were used for categorical variables. Pearson’s correlation test was utilized for the association between the continuous variables. Moreover, for the demographics one-way ANOVA test was used.

RESULTS

Gender and age distribution. A total of 98 clinical isolates of both Gram-positive and Gram-negative bacteria were obtained from ulcers of diabetic patients including both males and females (n= 58) and (n= 40). The male group was the dominant in the study with a percentage of 59.2%, compared with females 40.8%. Out of 98 patients who were enrolled in this study, 13 (13.3%) were 50 years old or less, 19 (19.4%) were between 51 and 60 years old, and 66 (67.3%) were >60 years old.

Bacterial isolates characteristics. Among the ninety-eight isolates, both poly-microbial and mono-microbial growths were observed in the diabetic foot ulcers of the patients. Mono-microbial growth was 57 (58.2%) and was more than poly-microbial growth of 41 (41.8%). Gram-positive isolates were more prevalent than Gram-negative isolates. Out of total isolates, Gram-negative isolates were 39 (39.8%) whereas Gram-positive isolates were 59 (60.2%) with S. aureus being the most prevalent among the Gram-positive isolates 32 (32.7%).

Antimicrobial resistance pattern of isolated S. aureus. Antimicrobial susceptibility testing was performed for 32 different S. aureus isolates to determine their antimicrobial profile against 15 antimicrobials. S. aureus isolates showed high rates of resistance to oxacillin (95.2%), clindamycin (68.7%), erythromycin (65.6%), cefazolin (60.2%), levofloxacin (50.2%), ciprofloxacin (48.1%), gentamycin (46.9%), and ampicillin (45.3%). Whereas antibiotics that are effective and sensitive were linezolid (3.7%), rifampin (5.1%), chloramphenicol (6.7%), norfloxacin (14.1%), teicoplanin (15.6%), amikacin (18.8%), tigecycline (31.2%) (Fig. 1).

Fig. 1 Antimicrobial resistance pattern of isolated S. aureus.

Assessment of biofilm production. Regarding biofilm production assays, the TCP method was performed and identified 10 (31.25%) isolates as strong biofilm-producer isolates, 14 (43.75%) as moderate biofilm-producer isolates, and 8 (25%) as non-biofilm producer isolates (Fig. 2). Out of 32 isolates of S. aureus, 24 (75%) were biofilm producers and 23 (71.9%) were multi-drug resistant. The bivariate analysis showed a significant statically correlation between the capability of the isolate to produce biofilm and their multi-drug resistance (p= 0.015).

Fig. 2 96-well plate for TCP method stained with crystal violet. (A): Negative control (B) Positive control (C) Strong biofilm producer (D) weak biofilm producer (E) Non-biofilm producer (F) Moderate biofilm producer.

RT-PCR results. In this study, the level of icaA gene expression was evaluated using the RT-PCR technique, in which the icaA gene is considered as a major gene that is responsible for polysaccharide production in S. aureus. The expression levels were investigated in 28 isolates selected carefully based on the degree of biofilm production; 7 isolates each from strong, moderate, weak, and non-biofilm producers. The fold change in expression of our target gene among the isolates was calculated using the Livak method (2−ΔΔCT) by calculating the ΔCT which is the difference between the CT value of the gene of interest and the CT value of the reference (housekeeping) gene. These results showed that CT values of the recA housekeeping gene were obtained in all of the S. aureus isolates. CT values of the recA gene ranged between 16.09 and 18.99 with an average of 17.4. In comparison, CT values results of the icaA gene in the strong biofilm producer’s strains ranged between 22.97 and 25.94 with an average of 24.49 by a highly significant fold 4.59–7.4 (P<0.01) when compared with recA. While, in moderate biofilm producer’s strains, CT values results ranged between 25.93 and 27.17 with an average of 26.66 by a 1.58–3.38 fold. Whereas in weak biofilm producer strains, CT values ranged between 28.21 and 29.25 with an average of 28.59 by 1.14–1.46 fold as shown in the (Tables 4–6).

Table 4. Fold changes in expression of the target gene among the strong biofilm producers isolates.

Isolates	After (strong group)	Before	ΔΔCt	2−ΔΔCT	
		
TG (gene)	HK	ΔCt	TG gene	HK	ΔCt	
S1	23.87	16.56	7.31	29.014	19.265	9.749	−2.439	5.42265731	
S2	24.96	17.41	7.55	29.014	19.265	9.749	−2.199	4.59160966	
S3	25.94	18.99	6.95	29.014	19.265	9.749	−2.799	6.95957882	
S4	23.91	16.91	7	29.014	19.265	9.749	−2.749	6.72251002	
S5	23.96	16.44	7.52	29.014	19.265	9.749	−2.229	4.68808913	
S6	22.97	16.11	6.86	29.014	19.265	9.749	−2.889	7.40756818	
S7	25.83	18.39	7.44	29.014	19.265	9.749	−2.309	4.95539479	

Table 5. Fold changes in expression of the target gene among the moderate biofilm producing isolates.

Isolates	After (Moderate group)	Before (control group)	ΔΔCt	2−ΔΔCT	
		
TG (A)	HK	ΔCt	TG (A)	HK	ΔCt	
M1	25.99	16.97	9.02	29.014	19.265	9.749	−0.729	1.65748981	
M2	27.17	18.91	8.26	29.014	19.265	9.749	−1.489	2.80694345	
M3	26.91	18.56	8.35	29.014	19.265	9.749	−1.399	2.63718723	
M4	27.18	18.87	8.31	29.014	19.265	9.749	−1.439	2.71132865	
M5	26.49	18.23	8.26	29.014	19.265	9.749	−1.489	2.80694345	
M6	26.96	18.97	7.99	29.014	19.265	9.749	−1.759	3.38463439	
M7	25.93	16.85	08	29.014	19.265	9.749	−0.669	1.5899705	

Table 6. Fold changes in expression of the target genes among the moderate biofilm producers.

Isolates	After (weak group)	Before (control group)	ΔΔCt	Fold Change	
		
TG (A)	HK	ΔCt	TG (A)	HK	ΔCt	
W1	28.27	18.95	9.32	29.014	19.265	9.749	−0.429	1.34630007	
W2	28.42	18.87	9.55	29.014	19.265	9.749	−0.199	1.14790241	
W3	28.21	18.97	9.24	29.014	19.265	9.749	−0.509	1.42306346	
W4	28.49	19.09	9.4	29.014	19.265	9.749	−0.349	1.27367748	
W5	29.18	19.98	9.2	29.014	19.265	9.749	−0.549	1.46307122	
W6	29.25	19.86	9.39	29.014	19.265	9.749	−0.359	1.2825366	
W7	28.32	18.88	9.44	29.014	19.265	9.749	−0.309	1.2388487	

DISCUSSION

DFUs are most frequent complications among diabetics worldwide, which is considered as the main reason for hospitalization among diabetic patients, with a huge financial burden (31). Bacterial adhesion in chronic wounds is known to be a significant virulence factor contributing to chronic infections. Further, the capability of the pathogens to form biofilms helps them to escape the immune system and is considered as the primary leading cause of chronic infections (21). In fact, the severity of infection is determined by host-related disorders and pathogen-related factors such as microbial load, resistance of the pathogens to antimicrobial agents, and virulence factors used by the pathogen. Considering this we carried out this study to obtain the microbiological profile of 112 wound samples from DFUs patients. Our study highlighted that most of the diabetic people who developed ulcers were elderly people above 60 years. Similar observation was reported by Ponirakis et al. (32). It is claimed that elderly diabetic patients develop progressive diseases, poor vision. Further, aging may result in peripheral circulation disorders, and thereby resulting in gait abnormalities including lower extremity sensory abnormalities, making them a high-risk population for diabetic foot ulcers (33). We observed that males were more prone to develop foot infections than females with a percentage of 59.2% and 40.8%, respectively. Similarly, the findings by Kim and Han (34), reported that out of 131 diabetic patients, 91 were males and 40 were females. Research has recently shown that there is link between testosterone hormone and development of type 2 diabetes in men. Type 2 diabetes has a direct correlation with increased risk of visceral fat deposition due to low testosterone levels in men, leading to increased type 2 diabetes. However, in women this hormone is extremely low and has no effect on metabolism especially after menopause age in elderly women (35, 36).

In this study, we observed that wound samples were dominated by both mono-microbial and poly-microbial infections, and a total of 98 Gram-positive and Gram-negative bacterial isolates were recovered. Out of 98 samples, Gram-positive bacteria accounted for 60.2%, with S. aureus being the most frequent isolate among the Gram-positive isolates, many previous studies have reported similar findings who reported that S. aureus was the most frequent isolated pathogen among the Gram-positive (37). Moreover, Costa et al. (38) showed that the most frequently isolated bacteria among Gram-negative isolates was P. aeruginosa. Whereas contrary to our findings, Jain et al. (39) found that Gram-negative species were more frequent than Gram-positive with the incidence of 51.2% and 32.3%, respectively, and Enterobacteriaceae being the most common isolated pathogen. These differences in the results of wound bacteriology and types of dominant species may be related to geographic differences, variations in the environment, socioeconomic differences, or previous antibiotic therapy (40).

Furthermore, the antibiotic susceptibility profiling suggested that most preferred antibiotics against S. aureus could be in the order of linezolid >chloramphenicol >rifampin >teicoplanin >amikacin >norfloxacin >tigecycline. Thus, linezolid could be proposed as a highly effective antimicrobial agent to treat wound infections for diabetic patients who are infected with S. aureus. This observation finds support from a study conducted in Nepal by Belbase et al. (41) showing higher sensitivity of S. aureus towards linezolid. However, S. aureus isolates in our study were resistant to antibiotics in the order of oxacillin >clindamycin >erythromycin >cefazolin >levofloxacin >ciprofloxacin >gentamycin >ampicillin. Jouhar et al. (42) investigated the microbiological profiles and antibiotic susceptibility pattern for 179 DFIs and found a high resistance rates for oxacillin. In contrast, results by Palomo et al. (43) revealed that S. aureus in DFI was susceptible to oxacillin and ampicillin. These variations and differences in antibiotic susceptibility profiles may be related to the variation in sample size, sample population, hospital care protocols, infection control activities, and the educational level of glycemic control, especially in developed countries.

Considering that infections caused by biofilm-producer strains are difficult to be healed because they show higher resistance towards antimicrobials, which is significantly associated with the chronicity of the wound. We screened our S. aureus isolates on the biofilm formation capability, and the profiling of responsible genes. Moreover, the majority of the bacterial species were MDR. Regarding biofilm formation assessment among the isolates, the vast majority of the isolates were a biofilm producer, which is a major virulence factor that induces chronic infections of S. aureus and prevents antimicrobial agents from penetrating cells, consequently, contributing to the high antimicrobial resistance. Finally, there was a significant association between MDR in biofilm-producing strains. We found that significant number of S. aureus isolates produced biofilm as in agreement with the results of Bose et al. (44). In our study, high incidence (71.9%) of MDROs could be associated with non-healing chronic wounds and ulcers in diabetic patients as also suggested by Murali et al. (45). Moreover, our findings demonstrated the correlation between MDROs and biofilm-producer strains, and there was a high and significant association with biofilm-producer strains compared with non-biofilm producers (P= 0.015). The other reports also support our observation (46, 47). Regarding gene expression results, remarkably, there was a relation between icaA gene expression level and the ability of forming biofilms. The strong biofilm producer strains had a higher level of gene expression when compared with moderate and weak strains. A study conducted by Mohammed and Radif (48), on 57 wound samples, showed that the level of gene expression in the strong biofilm-producing strains, was significantly higher (6.50) when compared with the weak and moderate isolates (1.23) and (1.62), respectively. (49) studied the influence of various biomaterials on staphylococcal adhesion and how icaA gene expression in S. aureus isolates has been affected. They observed that after 3 to 6 hours the expression level of the icaA gene increased and found that strain with weak biofilm formation ability display a low level of icaA expression and could be considered as a planktonic. Therefore, it is suggested that screening for biofilm formation should be a routine procedure in chronic non-healing wounds to choose the suitable and appropriate treatment.

CONCLUSION

DFUs are serious life-threatening complications of diabetes that is associated with a reduction of health-related quality of life and contributes to the high rate of mortality and morbidity among diabetic patients. Considering this our studies has highlighted that non healing wound infections are more frequent in elderly male diabetic patients. Such infections are predominated by the Gram-positive MDROs especially oxacillin resistant S. aureus isolates. This multi drug resistance could be the result of strong biofilm forming ability of isolates exhibiting increased expression of icaA genes. It is considered as a major virulence factor that induces chronic infections of S. aureus and prevents antimicrobial agents from penetrating cells, consequently, contributing to the high antimicrobial resistance. We conclude that such kinds of infections could be better treated by using antibi otics like linezolid, chloramphenicol, and rifampin. Overall, the findings of the current study are expected to assist health workers to manage such infections by offering appropriate antibiotic therapy, which will reduce time, effort, and cost of the treatment.
==== Refs
REFERENCES

1. Halim M Halim A. The effects of inflammation, aging and oxidative stress on the pathogenesis of diabetes mellitus (type 2 diabetes). Diabetes Metab Syndr 2019; 13 : 1165–1172.31336460
2. Bowers S Franco E. Chronic wounds: evaluation and management. Am Fam Physician 2020; 101 : 159–166.32003952
3. James GA Swogger E Wolcott R Pulcini Ed Secor P Sestrich J Biofilms in chronic wounds. Wound Repair Regen 2008; 16 : 37–44.18086294
4. Fekadu G Bula K Bayisa G Turi E Tolossa T Kasaye HK. Challenges and factors associated with poor glycemic control among type 2 diabetes mellitus patients at Nekemte Referral Hospital, Western Ethiopia. J Multidiscip Healthc 2019; 12 : 963–974.31819470
5. Moore Z Avsar P Wilson P Mairghani M O’Connor T Nugent L Diabetic foot ulcers: treatment overview and cost considerations. J Wound Care 2021; 30 : 786–791.34644133
6. Ena J Carretero-Gomez J Arevalo-Lorido JC Sanchez-Ardila C Zapatero-Gaviria A Gomez-Huelgas R. The association between elevated foot skin temperature and the incidence of diabetic foot ulcers: a meta-analysis. Int J Low Extrem Wounds 2021; 20 : 111–1118.32106729
7. Porselvi A Uma Shankar MS Lakshmi KS Sankar V. A retrospective qualitative study on current diabetic foot ulcer management and discussion on extended role of clinical pharmacist. Marmara Pharm J 2017; 21 : 412–418.
8. Giurato L Meloni M Izzo V Uccioli L. Osteomyelitis in diabetic foot: a comprehensive overview. World J Diabetes 2017; 8 : 135–142.28465790
9. Maheswary T Nurul AA Fauzi MB. The insights of microbes’ roles in wound healing: A comprehensive review. Pharmaceutics 2021; 13 : 981.34209654
10. Rubio JA Jiménez S Lázaro-Martínez JL. Mortality in patients with diabetic foot ulcers: causes, risk factors, and their association with evolution and severity of ulcer. J Clin Med 2020; 9 : 3009.32961974
11. Polikandrioti M Vasilopoulos G Koutelekos I Panoutsopoulos G Gerogianni G Babatsikou F Quality of life in diabetic foot ulcer: associated factors and the impact of anxiety/depression and adherence to self-care. Int J Low Extrem Wounds 2020; 19 : 165–179.31973632
12. Alfonsi V Gorgoni M Scarpelli S Zivi P Sdoia S Mari E Changes in sleep pattern and dream activity across and after the COVID‐19 lockdown in Italy: A longitudinal observational study. J Sleep Res 2022; 31 (2 ): e13500.34595786
13. Matta-Gutierrez G Garcia-Morales E Garcia-Alvarez Y Álvaro-Afonso FJ Molines-Barroso RJ Lazaro-Martinez JL. The influence of multidrug-resistant bacteria on clinical outcomes of diabetic foot ulcers: a systematic review. J Clin Med 2021; 10 : 1948.34062775
14. Seo KS Park N Rutter JK Park Y Baker CL Thornton JA Role of Glucose-6-phosphate in metabolic adaptation of Staphylococcus aureus in diabetes. Microbiol Spectr 2021; 9 (2 ): e0085721.34549996
15. Shettigar K Jain S Bhat DV Acharya R Ramachandra L Satyamoorthy K Virulence determinants in clinical Staphylococcus aureus from monomicrobial and polymicrobial infections of diabetic foot ulcers. J Med Microbiol 2016; 65 : 1392–1404.27902390
16. Jneid J Lavigne JP La Scola B Cassir N. The diabetic foot microbiota: A review. Hum Microb J 2017; 5–6 : 1–6.
17. Mendoza RA Hsieh JC Galiano RD (2019). The impact of biofilm formation on wound healing. Wound Healing-Current Perspectives. 10.5772/intechopen.85020
18. Schaumburg F Ngoa UA Köck R Adegnika AA Kremsner PG Lell B Virulence factors and genotypes of Staphylococcus aureus from infection and carriage in Gabon. Clin Microbiol Infect 2011; 17 : 1507–1513.21595798
19. Chopra S Harjai K Chhibber S. Antibiotic susceptibility of ica-positive and ica-negative MRSA in different phases of biofilm growth. J Antibiot (Tokyo) 2015; 68 : 15–22.25074658
20. Goswami S Sarkar R Saha P Maity A Sarkar T Das D Effect of human placental extract in the management of biofilm mediated drug resistance–A focus on wound management. Microb Pathog 2017; 111 : 307–315.28867635
21. Wu Y-K Cheng N-C Cheng C-M. Biofilms in chronic wounds: pathogenesis and diagnosis. Trends Biotechnol 2019; 37 : 505–517.30497871
22. Masadeh MM Mhaidat NM Alzoubi KH Hussein EI Al-Trad EI. In vitro determination of the antibiotic susceptibility of biofilm-forming Pseudomonas aeruginosa and Staphylococcus aureus: possible role of proteolytic activity and membrane lipopolysaccharide. Infect Drug Resist 2013; 6 : 27–32.23493936
23. Ababneh Q Abu Laila S Jaradat Z. Prevalence, genetic diversity, antibiotic resistance and biofilm formation of Acinetobacter baumannii isolated from urban environments. J Appl Microbiol 2022; 133 : 3617–3633.36002793
24. Vos P Garrity GM Jones D Krieg NR Ludwig W Rainey FA (2009). Bergey’s manual of systematic bacteriology: Volume 3: The Firmicutes. Springer Science & Business Media.
25. Hassan A Usman J Kaleem F Omair M Khalid A Iqbal M. Evaluation of different detection methods of biofilm formation in the clinical isolates. Braz J Infect Dis 2011; 15 : 305–311.21860999
26. Mohamed WF Sharaf SA Aboshady HM Sharaf M. Phenotypic and genotypic evaluation of biofilm formation among orthopedic patients showing prosthetic joint infection by molecular techniques. Egypt J Exp Biol (Bot) 2020; 16 : 105–113.
27. Slany M Oppelt J Cincarova L. Formation of Staphylococcus aureus biofilm in the presence of sublethal concentrations of disinfectants studied via a transcriptomic analysis using transcriptome sequencing (RNA-seq). Appl Environ Microbiol 2017; 83 (24 ): e01643–17.29030437
28. Atshan SS Nor Shamsudin M Sekawi Z Lung LT Hamat RA Karunanidhi A Prevalence of adhesion and regulation of biofilm-related genes in different clones of Staphylococcus aureus. J Biomed Biotechnol 2012; 2012 : 976972.22701309
29. Lee S Choi KH Yoon Y. Effect of NaCl on biofilm formation of the isolate from Staphylococcus aureus outbreak linked to ham. Korean J Food Sci Anim Resour 2014; 34 : 257–261.26760947
30. Shakur JA Abd Aburesha R. Gene expression of agr system in Staphylococcus aureus and it is relation with antibiotic resistance. Hist Med 2023; 9 : 1513–1518.
31. Song P Rudan D Zhu Y Fowkes FJI Rahimi K Fowkes FGR Global, regional, and national prevalence and risk factors for peripheral artery disease in 2015: an updated systematic review and analysis. Lancet Glob Health 2019;7 (8 ): e1020–e1030.31303293
32. Ponirakis G Elhadd T Al Ozairi E Brema I Chinnaiyan S Taghadom E Prevalence and risk factors for diabetic peripheral neuropathy, neuropathic pain and foot ulceration in the Arabian Gulf region. J Diabetes Investig 2022; 13 : 1551–1559.
33. Pataky Z Vischer U. Diabetic foot disease in the elderly. Diabetes Metab 2007; 33 Suppl 1 : S56–S65.17702099
34. Kim EJ Han K-S. Factors related to self-care behaviours among patients with diabetic foot ulcers. J Clin Nurs 2020; 29 : 1712–1722.32043712
35. Kautzky-Willer A Leutner M Harreiter J. Sex differences in type 2 diabetes. Diabetologia 2023; 66 : 986–1002.36897358
36. Ciarambino T Crispino P Leto G Mastrolorenzo E Para O Giordano M. Influence of gender in diabetes mellitus and its complication. Int J Mol Sci 2022; 23 : 8850.36012115
37. Banu A Noorul Hassan MM Rajkumar J Srinivasa S. Spectrum of bacteria associated with diabetic foot ulcer and biofilm formation: a prospective study. Australas Med J 2015; 8 : 280–285.26464584
38. Costa D Ielapi N Caprino F Giannotta N Sisinni A Abramo A Social aspects of diabetic foot: a scoping review. Soc Sci 2022; 11 : 149.
39. Jain SK Barman R. Bacteriological profile of diabetic foot ulcer with special reference to drug-resistant strains in a tertiary care center in North-East India. Indian J Endocrinol Metab 2017; 21 : 688–694.28989875
40. Citron DM Goldstein EJ Merriam CV Lipsky BA Abramson MA. Bacteriology of moderate-to-severe diabetic foot infections and in vitro activity of antimicrobial agents. J Clin Microbiol 2007; 45 : 2819–2828.17609322
41. Belbase A Pant ND Nepal K Neupane B Baidhya R Baidya R Antibiotic resistance and biofilm production among the strains of Staphylococcus aureus isolated from pus/wound swab samples in a tertiary care hospital in Nepal. Ann Clin Microbiol Antimicrob 2017; 16 : 15.28330484
42. Jouhar L Jaafar RF Nasreddine R Itani O Haddad F Rizk N Microbiological profile and antimicrobial resistance among diabetic foot infections in Lebanon. Int Wound J 2020; 17 : 1764–1773.32779355
43. Palomo AT Pires APM Matielo MF de Athayde Soares R Pecego C Sacilotto R Microbiology of diabetic foot infections in a tertiary care hospital in Sao Paulo, Brazil. Antibiotics (Basel) 2022; 11 : 1125.36009994
44. Bose JL Lehman MK Fey PD Bayles KW. Contribution of the Staphylococcus aureus atl AM and GL Murein hydrolase activities in cell division, autolysis, and biofilm formation. PLoS One 2012; 7 (7 ): e42244.22860095
45. Murali TS Kavitha S Spoorthi J Bhat DV Prasad ASB Upton Z Characteristics of microbial drug resistance and its correlates in chronic diabetic foot ulcer infections. J Med Microbiol 2014; 63 : 1377–1385.25038136
46. Mahler BJ Schmidt TS Nowell LH Qi SL Van Metre PC Hladik ML Biofilms provide new insight into pesticide occurrence in streams and links to aquatic ecological communities. Environ Sci Technol 2020; 54 : 5509–5519.32309929
47. Di Domenico EG Rimoldi SG Cavallo I D’Agosto G Trento E Cagnoni G Microbial biofilm correlates with an increased antibiotic tolerance and poor therapeutic outcome in infective endocarditis. BMC Microbiol 2019; 19 : 228.31638894
48. Mohammed SW Radif HM. Detection of icaA gene expression in clinical biofilm-producing Staphylococcus aureus isolates. Iraqi J Sci 2020; 61 : 3154–3163.
49. Harapanahalli AK Chen Y Li J Busscher HJ van der Mei HC. Influence of adhesion force on icaA and cidA gene expression and production of matrix components in Staphylococcus aureus biofilms. Appl Environ Microbiol 2015; 81 : 3369–3378.25746995
