
==== Front
Stem Cell Res Ther
Stem Cell Res Ther
Stem Cell Research & Therapy
1757-6512
BioMed Central London

39256801
3921
10.1186/s13287-024-03921-y
Research
Modulation of human induced neural stem cell-derived dopaminergic neurons by DREADD reveals therapeutic effects on a mouse model of Parkinson’s disease
Wang Xueyao 123
Han Deqiang handq@xwhosp.org

123
Zheng Tianqi 1
Ma Jinghong 4
http://orcid.org/0000-0003-1508-510X
Chen Zhiguo chenzhiguo@gmail.com

123
1 https://ror.org/013xs5b60 grid.24696.3f 0000 0004 0369 153X Cell Therapy Center, Beijing Municipal Geriatric Medical Research Center, National Clinical Research Center for Geriatric Diseases, and Key Laboratory of Neurodegenerative Diseases, Ministry of Education, Xuanwu Hospital Capital Medical University, Beijing, 100053 China
2 grid.24696.3f 0000 0004 0369 153X Center of Neural Injury and Repair, Beijing Institute for Brain Disorders, Beijing, 100069 China
3 grid.24696.3f 0000 0004 0369 153X Center of Parkinson’s Disease, Beijing Institute for Brain Disorders, Beijing, 100069 China
4 https://ror.org/013xs5b60 grid.24696.3f 0000 0004 0369 153X Department of Neurology, Xuanwu Hospital Capital Medical University, Beijing, 100053 China
11 9 2024
11 9 2024
2024
15 2974 3 2024
3 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Stem cell-based therapy is a promising strategy for treating Parkinson’s disease (PD) characterized by the loss of dopaminergic neurons. Recently, induced neural stem cell-derived dopaminergic precursor cells (iNSC-DAPs) have been emerged as a promising candidate for PD cell therapy because of a lower tumor-formation ability. Designer receptors exclusively activated by designer drugs (DREADDs) are useful tools for examining functional synaptic connections with host neurons.

Methods

DREADD knock-in human iNSCs to express excitatory hM3Dq and inhibitory hM4Di receptors were engineered by CRISPR. The knock-in iNSCs were differentiated into midbrain dopaminergic precursor cells (DAPs) and transplanted into PD mice. The various behavior test such as the Apomorphine-induced rotation test, Cylinder test, Rotarod test, and Open field test were assessed at 4, 8, or 12 weeks post-transplantation with or without the administration of CNO. Electrophysiology were performed to assess the integrated condition and modulatory function to host neurons.

Results

DREADD expressing iNSCs were constructed with normal neural stem cells characteristics, proliferation ability, and differentiation potential into dopaminergic neuorns. DAPs derived from DREADD expressing iNSC showed matched function upon administration of clozapine N-oxide (CNO) in vitro. The results of electrophysiology and behavioral tests of transplanted PD mouse models revealed that the grafts established synaptic connections with downstream host neurons and exhibited excitatory or inhibitory modulation in response to CNO in vivo.

Conclusion

iNSC-DAPs are a promising candidate for cell replacement therapy for Parkinson’s disease. Remote DREADD-dependent activation of iNSC-DAP neurons significantly enhanced the beneficial effects on transplanted mice with Parkinson’s disease.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13287-024-03921-y.

Keywords

Induced neural stem cell
Designer receptors exclusively activated by designer drug
Parkinson’s disease
Stem cell therapy
Remote modulation
http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 82171250 Chen Zhiguo Beijing Municipal Health Commission FundPXM2020_026283_000005 Chen Zhiguo The Project for Techonology Development of Beijing-affiliated Medical Research Institutes 11000023T000002036310 Chen Zhiguo the Beijing Natural Science Foundation7242068 Han Deqiang Open Project of Key Laboratory of Longevity and Aging-related Diseases (Guangxi Medical University), Ministry of EducationKLLAD202301 Han Deqiang Capital Medical University Research Cultivation FundPYZ23055 Han Deqiang issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackgound

Stem cell-based therapy is a promising approach for treating neurodegenerative diseases, such as Parkinson’s disease (PD), Alzheimer’s disease (AD), spinal cord injury, and stroke [1–6]. Among these diseases, PD is characterized by the loss of dopaminergic neurons [7], and thus, it is an ideal target for cell replacement-based therapies [3]. Induced pluripotent stem cells (iPSCs) and embryonic stem cells (ESCs) are two types of pluripotent stem cells that can differentiate into midbrain dopaminergic neurons (DAs), which are commonly used as donor grafts for treating Parkinson’s disease [3, 8, 9]. Another donor source obtained by the direct reprogramming of somatic cells into induced neural stem cells (iNSCs) that can differentiate into DAs has emerged as a viable option for treating PD. In previous studies, we used non-integrative Sendai vectors to reprogram peripheral blood mononuclear cells (PBMCs) into iNSCs, which were derived from a single cell-formed colony and could differentiate into dopaminergic precursor cells (DAPs). Grafting DAPs into a PD animal model was found to improve their motor function [10, 11].

Although functional improvement was recorded, whether the graft-derived neurons established functional synaptic connections with host neurons needs to be confirmed.

Designer receptors exclusively activated by designer drugs (DREADDs) are useful tools for examining functional connectivity [12–14]. The DREADDs technique enables the selective activation or deactivation of specific brain areas or cells. By incorporating this tool, the activity of human iNSC-derived neurons can be increased or suppressed by adding the designer drug clozapine-N-oxide (CNO) in vitro and in vivo [15]. Additionally, DREADDs can be used to map the projection and synaptic inputs of DA neurons of the human midbrain in the mouse model of Parkinson’s disease [16].

In this study, we engineered human iNSCs to express excitatory hM3Dq [17] and inhibitory hM4Di [18] receptors using clustered regularly interspaced short palindromic repeats (CRISPRs). These iNSCs were then differentiated into midbrain dopaminergic precursor cells (DAPs) and transplanted into PD mice. The engrafted human iNSC-DAPs further differentiated into dopaminergic (DA) neurons, which could be precisely regulated in a drug-dependent manner by administering CNO.

Methods and materials

Construction of donor plasmid and guide RNA

Human AAVS1 site-targeting donor plasmids CAG- hM4Di -T2A-ZsGreen and CAG-hM3Dq-T2A-ZsGreen for knock-in were constructed by inserting the fragment of T2A-ZsGreen into the site downstream of hM4Di in plasmid #80,947 or hM3Dq in plasmid #80,948 [15]. AAVS1-Pur-CAG-EGFP was purchased from Addgene (plasmid #80945) and used as a control. The guide RNA (gRNA) [15] target at AAVS1 was constructed in pX458 [19]. The plasmid sequences were tested by sequence screening.

Generation of DREADD cell lines

To generate cell lines of DREADD knock-in iNSCs, the donor plasmid and gRNA were mixed and used for electroporation. For transfection, the electroporation buffer was prepared as described in another study [20] (with slight modifications). It was used to introduce 2–5 × 106 cells, along with 2 µg of donor plasmid and 2 µg of gRNA plasmid. Electroporation was performed using Amaxa Nucleofector II (Lonza, AAD-1001 S). The cells were then plated in six-well plates coated with poly-D-lysine hydrobromide (PDL, Sigma-Aldrich, P7886) and Laminin (Roche, 11243217001). After 72 h, the cells expressing green fluorescence were sorted by FACS (BD, FACSAria II Cell Sorter) and plated on 96-well plate culture for single-clone formation. Then, the single clone that exhibited green fluorescence was selected for genotyping. Homozygous clones were identified and used for further investigation.

Cell culture and differentiation

The iNSCs were induced from human peripheral blood mononuclear cells (PBMCs) as described in previous study [10]. Briefly, 10 mL of peripheral blood was collected from a healthy donor with written informed consent and then used to prepare the PBMCs. For cell culture, the medium consisted of 48% DMEM/F12 medium (Gibco, 11330-032), 48% Neurobasal-a medium (Gibco, 10888-022), 1% B27 (Gibco, 17504044), 1% N2 (Thermo Fisher, 17502048), 1% NEAA (Gibco, 11140-050), 1% GlutaMax (Gibco, 35050-061), 10 ng/mL hrLIF (Millipore, LIF1010), 3 µM CHIR99021 (Gene Operation, 04–0004), and 2 µM SB431542 (Gene Operation, 04–0010). For differentiating iNSCs into induced dopamine neurons (iDAs), they were dissociated as single cells using accutase (Invitrogen, A11105-01) and plated on PDL and Laminin-coated six-well plates at a density of 200,000 cells per well in the DA differentiation medium Phase 1 for 10 days, followed by the DA differentiation medium Phase 2 for the remaining duration. DA differentiation medium Phase 1 consisted of 96% DMEM/F12 medium (Gibco, 11320-033), 1% B27 (Gibco, 17504044), 1% N2 (Thermo Fisher, 17502048), 1% NEAA (Gibco, 11140-050), 1% GlutaMax (Gibco, 35050-061), 1 µM SAG1 (Enzo, ALX-270-426-M01), and 100 ng/mL FGF8 (Peprotech, 100 − 25). DA differentiation medium Phase 2 consisted of 96% DMEM/F12 medium (Gibco, 11320-033), 1% B27 (Gibco, 17504044), 1% N2 (Thermo Fisher, 17502048), 1% NEAA (Gibco, 11140-050), 1% GlutaMax (Gibco, 35050-061), 10 ng/mL BDNF (Peprotech, 450-02), 10 ng/mL GDNF (Peprotech, 450 − 10), 1 ng/mL TGF-βIII (Peprotech, 100-36E), 10 µM DAPT (Sigma-Aldrich, D5942), 0.2 mM ascorbic acid (Sigma-Aldrich, 1043003), and 0.5 mM cAMP (Sigma-Aldrich, D0627). For natural differentiation, iNSCs were dissociated into single cells using accutase and plated on PDL and Laminin-coated six-well plates at a density of 100,000 cells per well in a natural differentiation medium for 30 days. The natural differentiation medium consisted of 96% DMEM/F12 medium (Gibco, 11320-033), 1% B27 (Gibco, 17504044), 1% N2 (Thermo Fisher, 17502048), 1% NEAA (Gibco, 11140-050), and 1% GlutaMax (Gibco, 35050-061).

Animal models of Parkinson`s disease and cell transplantation

All animal experiments were conducted following the guidelines for the Care and Use of Laboratory Animals established by the Beijing Association for Laboratory Animal Science and approved by the ethics committee of Xuanwu Hospital Capital Medical University. A total of 180 male SCID-Beige mice (6–8 weeks old) underwent unilateral stereotaxic injections of 3 µL of 6-hydroxydopamine (6-OHDA, 5 µg/µL, dissolved in saline with 0.2% ascorbic acid). The injection targeted the right corpus striatum at the coordinates anteroposterior = 0.5 mm, lateral = 2.1 mm, and vertical = − 3.2 mm. All mice were administered an intraperitoneal injection of 5 mg/mL desipramine (10 mg/kg) 30 min before the surgery. Anesthesia was induced using 2% isoflurane. The mice 6-OHDA lesion intolerance were excluded. 4 weeks after surgery, the mice were administered intraperitoneal injections of 0.5 mg/mL apomorphine (the dopamine receptor agonist, 1 mg/kg, dissolved in saline). Lesioned mice that exhibited over 100 contralateral rotations within 30 min were selected for subsequent experiments. A total of 58 mice were successfully modeled, three of which were randomly selected for immunohistochemical stain to observe the modeled situation. The remaining successfully modeled 55 mice were numbered and randomly divided into four groups by Excel: EGFP group (n = 15), hM4Di group (n = 15), hM3Dq group (n = 15), and 6-OHDA group (n = 10). Additionally, there were a sham-operated group (sham, unilateral stereotaxic injection with saline) with 5 mice and a normal group (normal, without stereotaxic surgery) with 5 mice. All six groups underwent baseline evaluations in the cylinder, open field, and rotarod tests. Following baseline collection, cell transplantation were initiated at 5 weeks after unilateral 6-OHDA modeling surgery. The EGFP, hM4Di, and hM3Dq knockin cell lines with differentiation at Day10 and Day13 were mixed at a ratio of 1:7 and suspended in Hank’s Balanced Salt Solution buffer at a cell concentration of 100,000 cells/µL. Each mouse was administered a stereotaxic injection of a 4 µL cell suspension. At the end of the experiments, euthanasia was performed using sodium pentobarbital following the AVMA Guidelines for the Euthanasia of Animals (2020 Edition). The study was reported in line with the ARRIVE guidelines 2.0.

Immunofluorescence and immunochemistry

For immunofluorescence analysis, cells were cultured on poly-D-lysine (PDL) and Laminin-coated coverslips, then fixed with 4% paraformaldehyde (PFA) for 10 min, followed by two washes (5 min each) with phosphate-buffered saline (PBS). Subsequently, the cells were blocked with 3% donkey serum containing 0.3% Triton X-100 in PBS (PBST) for 1 h at room temperature. The cells were incubated with primary antibodies overnight at 4°C in 1% donkey serum with 0.3% PBST. Next, the samples were incubated with secondary antibodies for 1 h in 1% donkey serum with 0.3% PBST, and the samples were stained with 4’,6-diamidino-2-phenylindole (DAPI) for 15 min at room temperature. For immunofluorescence and immunohistochemistry examinations of brain slices, the mice were sacrificed at 12 weeks after transplantation. Briefly, the mice were perfused with saline and 4% PFA and then the brain was dissected and placed in a 30% sucrose solution for dehydration. Frozen Sect. (40 μm) were obtained using a freezing microtome (Leica, SM 2000 R) and stored in TCS buffer (250 mL glycerin, 300 mL ethylene glycol, 450 mL 0.1 M NaPO4, and filled with water to a volume of 1 L) at 4 °C. For immunofluorescence, brain slices were washed with PBS for 5 min twice, blocked with 3% donkey serum containing 0.3% PBST for 2 h at room temperature, and then, incubated with primary antibodies in 1% donkey serum with 0.3% PBST overnight at 4 °C. The following day, the samples were incubated with secondary antibodies for 2 h in 1% donkey serum with 0.3% PBST, and then, stained with DAPI for 15 min at room temperature.

Quantitative PCR

The total RNA was extracted from EGFP-, hM4Di-, and hM3Dq-iNSCs, as well as, during dopamine (DA) differentiation on days 8, 10, 13, 15, 18, 24, and 30, using the RNeasy Plus Mini Kit (Qiagen, 74134), following the manufacturer’s protocol. Next, reverse transcription was performed using the PrimeScript RT Reagent Kit (Takara, RR037A). Quantitative polymerase chain reaction (qPCR) analysis was conducted using LightCycler 480 SYBR Green I Master (Roche, 04707516001) on the Roche LightCycler 480 II instrument. The level of expression of FoxA2, NURR1, TH, and Tuj1 was quantified using the 2-∆∆Ct method, which was replicated thrice. The primer sequences used were as follows: FoxA2 forward primer: GGGGTAGTGCATCACCTGTT and reverse primer: CCGTTCTCCATCAACAACCT; NURR1 forward primer: GCTGGACTCCCCATTGCTTT and reverse primer: CGGAGCTGTATTCTCCCGAA;

TH forward primer: TGTCTGAGGAGCCTGAGATTCG and reverse primer: GCTTGTCCTTGGCGTCACTG; Tuj1 forward primer: GACCCCAGCGGCAACTACGTG and reverse primer: ACGTACTTGTGAGAAGAGGCCTCGT; GAPDH forward primer: AAGAAGGTGGTGAAGCAGG and reverse primer: AGGTGGAGGAGTGGGTGTCG.

Whole-cell patch-clamp analysis

Whole-cell patch-clamp analysis was conducted using iNSCs obtained via dopaminergic (DA) differentiation for 36 days. Brain slices were extracted from mice exactly two months after transplantation. The samples were immersed in artificial cerebrospinal fluid (aCSF) containing NaCl (125 mM), KCl (2.5 mM), CaCl2 (2 mM), NaH2PO4 (1.25 mM), MgSO4 (1 mM), glucose (25 mM), and NaHCO3 (26 mM) for 30 min at 35 °C. Next, the samples were transferred to a chamber filled with aCSF under 95% O2/5% CO2 at 35 °C. Glass pipettes, with resistance ranging from 3 to 5 MΩ, were loaded with iced intracellular fluid composed of NaCl (8 mM), KCl (143 mM), MgCl2 (1 mM), HEPES (10 mM), NaATP (2 mM), NaGTP (0.4 mM), and Biocytin (2%). For collecting data, initially, baseline measurements of spontaneous excitatory postsynaptic currents (sEPSCs) were recorded for 8 min, followed by the addition of 50 µM clozapine-N-oxide (CNO) (Enzo, BML-NS105) for 16 min. Next, the CNO was washed out, and then, the data were recorded for the remaining duration. The spontaneous action potentials (sAPs) elicited involved a stepwise increase in voltage by 5 mV, capturing the entire sequence of evoked action potentials at baseline, after CNO (50 µM) was added, and after CNO was washed out. All data were collected and analyzed using pClamp 10.0.

Behavioral tests

The collection and organization of behavioral data were conducted by individuals who were not involved in the experimental design and animal grouping. All behavioral data included in the study were based on mice that survived through the 12-week observation endpoint across the experimental groups. EGFP group (n = 11), hM4Di group (n = 13), hM3Dq group (n = 12), 6-OHDA group (n = 6),sham-operated (n = 4), and normal groups (n = 5).

Apomorphine-induced rotation test

Apomorphine-induced rotation test was performed before transplantation, and 4, 8, and 12 weeks after transplantation. The mice were injected intraperitoneally with apomorphine (0.5 mg/kg, Sigma Aldrich, PHR2621). The rotational behavior was recorded for 30 min. Total rotations were quantified, and the result was obtained by subtracting ipsilateral rotations from contralateral rotations.

Cylinder test

For analyzing the forelimb use during explorative activity, four weeks after the 6-OHDA lesion developed and 4 and 8 weeks after transplantation, the upper limb movement ability of the mice was assessed in a beaker (18 cm in diameter). The mice were tested under different conditions, including the administration of saline, clozapine-N-oxide (CNO), or no injection. Subsequently, 40 min after the mice were intraperitoneally injected with either saline or CNO (1.2 mg/kg), they were assessed and the data were recorded for 3 min. Forelimb’s contact with the weight-bearing wall on the cylinder was scored. Wall exploration was quantified as the percentage of impaired forelimb wall contacts in relation to the total number of times the mouse touched the wall with one of its forelimbs [21].

Rotarod test

4 weeks after the 6-OHDA lesion developed and 4 and 8 weeks after transplantation, the mice underwent a rotarod test. The data were recorded using the Rota Rod System (Panlab, Harvard Apparatus, 76–0770) under various conditions, including saline injection, clozapine-N-oxide (CNO) injection, and no injection. Before the formal examination, the mice were trained to acclimate to the rotating rod. On Day 1, the mice were placed on the turning rod at incremental speeds from 2 to 20 rpm for 300 s, and the process was repeated thrice. On Day 2, the training included speeds of 3–30 rpm (twice) and then, 4–40 rpm, each within an interval of 300 s. During the formal test, which was conducted 40 min post-injection, the mice were placed on the turning rod at speeds of 4–40 rpm for 300 s, and the process was repeated thrice. The time until the mice fell off the rod was automatically recorded by the equipment, and the data obtained represented the average time from three independent recordings.

Open field test

4 weeks after the 6-OHDA lesion developed and 4 and 8 weeks after transplantation, the mice underwent an open field test under different conditions: injected with saline, injected with clozapine-N-oxide (CNO), or not injected. The mice were placed in the open field apparatus (25.4 cm × 25.4 cm) 40 min after being injected, and data were recorded for the next 30 min.

Statistical analysis

The data were expressed as the mean ± SD and analyzed using GraphPad Prism 9.0. The differences were compared by either a t-test or a one-way analysis of variance (ANOVA), followed by Bonferroni’s multiple comparisons post hoc test. All differences were considered to be statistically significant at p < 0.05.

Results

Establishment of DREADD-expressing induced neural stem cells

To obtain the DREADD-expressing induced neural stem cells, the donor plasmid with a hM4Di-T2A-ZsGreen-expressing or hM3Dq-T2A-ZsGreen-expressing cassette was knocked in the AAVS1 locus of iNSCs by the CRISPR/Cas9 technology (Fig. 1A). Then fluorescence-positive cells were sorted by FACS. The establishment of stable cell lines expressing DREADDs or enhanced green fluorescent protein (EGFP) was confirmed by genotyping PCR. The homozygous clones were selected for further study (Fig. 1B or S1A). To demonstrate the characteristics of the DREADD knock-in or EGFP knock-in iNSCs, human neural stem cells markers NESTIN, PAX6, SOX2, SOX1, and Olig2 were stained for immunofluorescence assays (Fig. 1C and D, and S1B). The expression pattern was the same as that in the wild-type iNSCs [10]. The proliferation state was also evaluated by the staining of Ki67 (Fig. 1C and D, and S1B). Over 80% of knock-in iNSCs expressed human neural stem cell markers (Figures S1D-S1F). Additionally, the knock-in cell lines differentiated into neural cells that expressed mature microtubule-associated protein 2 (MAP2), an astrocyte marker S100 Calcium-Binding Protein B (S100b), and Neuronal Nuclear Antigen (NeuN). These results showed the neural differentiation potential of the knock-in iNSCs (Fig. 1E F, S1C and S2A-S2C). Thus, the DREADDs knock-in cell line was constructed with normal neural stem cell characteristics, proliferation ability, and natural differentiation potential.

Fig. 1 Establishment of DREADD-expressing induced neural stem cells. A: Schematic representation of the experimental design illustrating the establishment of the three cell lines and the transplantation of DAPs into SCID-Beige PD mice. At different time points after transplantation, the mice underwent electrophysiology and behavioral tests. B: Fluorescence images showed that FACS-sorted cell spheres of each cell line expressed homogeneous green fluorescence. Cell lines were in a spheres state. Scale bar: 100 μm. C-D: Immunofluorescent images of hM4Di-iNSCs (C) and hM3Dq-iNSCs (D). Cell lines were in an adherent monolayer state. Scale bar: 200 μm. E-F: Immunofluorescent images of the differentiated mature neurons derived from hM4Di-iNSCs (E) and hM3Dq-iNSCs (F). Scale bar: 200 μm. BF: bright field; FACS: fluorescence-activated cell sorting; iNSCs: induced neural stem cells

DREADD-induced dopaminergic neurons were regulated by CNO

To demonstrate the function of DREADD-induced dopaminergic neurons (DREADD-iDA), the DREADD-iNSCs were differentiated into dopaminergic neurons using previously established protocols [10] (Fig. 2A). By day 15–30 of differentiation, over 90% of the differentiated cells expressed forkhead transcription factor (FoxA2), which acts as a dopamine precursor marker, whereas, over 20% of the differentiated cells expressed tyrosine hydroxylase (TH) (Fig. 2B and C, and S3A-S3D). The proportion of FoxA2 + TH + coexpressing cells among TH + cells was approximately 95% (Fig. 2C, S3B, and S3D). Similarly, nuclear related regulator-1 (NURR1) positive cells exceeded 90%. Additionally, the expression of Tubulin beta 3 class III (Tuj1) was observed in the differentiated cells, indicating that DREADD-iNSCs could be differentiated into dopaminergic progenitors and mature neurons (Fig. 2B and C, and S3A-S3D). The dopaminergic progenitors and mature markers merged with ZsGreen or EGFP (Fig. 2B, S3A, and S3C). The results of the qPCR assays showed that the genes for FoxA2, TH, NURR1 and Tuj1 were expressed during days 8–30 of differentiation, further supporting the robust differentiation of dopaminergic progenitors and mature neurons (Fig. 2D, S3E and S3F).

Fig. 2 Function of differentiation into dopaminergic neurons and electrophysiology test to assess DREADD-cell lines in vitro. A: A conceptual representation of the strategy of iNSCs differentiation into DA neurons. The process involved two consecutive phases of differentiation using various materials. B-C: Immunofluorescent images (B) and the quantification of the expression of the markers (C) of hM4Di-DA at DIV 15 (FoxA2), DIV 18 (FoxA2 and TH), and DIV 30 (NURR1 and Tuj1) during the DA differentiation process. Scale bar: 200 μm. n = 5. D: Quantitative PCR analysis of the relative expression of hM4Di-iDA markers at different time points during the differentiation process. n = 3. E-G: The results of the electrophysiology test on EGFP-, hM4D-, or hM3Dq-iDA. The APs showed the regulated functionality of EGFP-, hM4Di-, or hM4Dq-iDA after CNO was administered (E). The frequency of APs (F) and the membrane potentials (G) for the three cell lines were recorded at baseline, after adding CNO (50 µM), and during the washout phase. Statistical significance to the frequency of APs and the membrane potentials was observed in the hM4Di and hM3Dq groups; n = 3. AA: ascorbic acid; APs: action potentials; CNO: clozapine N-oxide; DA: dopamine; DIV: days in vitro; FoxA2: forkhead transcription factor; HNA: human nuclear antigen; NURR1: nuclear related regulator-1; iDA: induced dopaminergic neurons; TH: tyrosine hydroxylase; Tuj1: neuron-specific class III beta-tubulin. *p < 0.05, ** p < 0.01, and ***p < 0.001

On day 36 of differentiation, the electrophysiological properties of DREADD-iDA and EGFP-iDA were investigated via whole-cell patch-clamp analysis, along with their response to the chemical ligand clozapine-N-oxide (CNO) (Fig. 2E and G). Following electrostimulation, action potentials (APs) were recorded in all three cell lines (Fig. 2E). After treatment with CNO, the frequency of APs decreased in the DREADD-iDA that expressed hM4Di, but the APs were still present. Following the washout of CNO, the frequency of APs recovered to baseline levels (Fig. 2E and F). In contrast, DREADD-iDA expressing the hM3Dq-excitatory cassette showed an increase in the frequency of APs in response to CNO compared to the frequency of APs at baseline. However, the frequency returned to baseline levels after CNO was washed out (Fig. 2E and F). EGFP-iDA exhibited a consistent frequency of APs with or without CNO treatment, compared to the APs at baseline. Additionally, hM4Di-iDA showed hyperpolarization of the membrane potential in response to CNO, whereas hM3Dq-iDA exhibited depolarization (Fig. 2G). In contrast, EGFP-iDA showed no significant changes in the membrane potential. These results indicated that the activity of DREADD-expressing iNSC-DA neurons can be regulated by CNO.

Transplantation of DREADD dopaminergic precursors into the PD mouse model

To determine whether DREADD dopaminergic precursors (DREADD-DAPs) can refine and control the neural activity in vivo, we implanted DREADD- or EGFP-DAPs into the PD mouse model established by unilateral 6-hydroxydopamine (6-OHDA) lesion (Figure S4A). The mice selected for transplantation exhibited more than 100 contralateral rotations per 30 min in the apomorphine-induced rotation test. Specifically, cells at the point of differentiation on days 10 and 13 were mixed at a 1:7 ratio and transplanted into the PD model mice by stereotaxic injection. The mice were sacrificed for subsequent analysis 12 weeks after transplantation. Engrafted cells were identified by their co-expression of tyrosine hydroxylase (TH) and ZsGreen in the lesioned striatum, compared to the intact contralateral region (Fig. 3A). In all three transplanted groups, the expression of ZsGreen or EGFP, FoxA2, NURR1, TH, Tuj1, STEM121, and human nuclear antigen (HNA) was observed, which indicated that the engrafted cells underwent in vivo differentiation into mature dopaminergic cells, highlighting their potential to respond to CNO (Fig. 3B and C, S4B, S4C and S5A-S5C). The proportion of TH + ZsGreen+/ HNA + or TH + EGFP+/ HNA + was approximately 6% (Fig. 3D). Meanwhile, substantial FoxA2 + cells were observed in grafts, with the proportion of FoxA2 + HNA+/ HNA + reaching around 90% (Fig. 3E). Additionally, coexpression of FoxA2 and TH was observed, with the ratio of FoxA2 + TH+/ TH + approximately 95% (Fig. 3F). Furthermore, NURR1 + cells were detected, with the proportion of NURR1+/ HNA + around 7% (Fig. 3G). Coexpression of NURR1 and TH was observed, with the ratio of TH + NURR1+/ HNA + approximately 6% (Fig. 3H). Tuj1 + and STEM121 + cells were present among the engrafted cells, and coexpression of Tuj1 and TH, as well as STEM121 and TH, was observed (Fig. 3B and C, S4B, S4C and S5A-S5C). Additionally, S100b-positive astrocytes were also found among the engrafted cells with the ratio of S100b+/ HNA + around 9% (Fig. 3C, S3C, S3E and S5A-S5C). Whereas, the oligodendrocytes, the GABAergic neurons, serotonergic neurons, and Iba1-positive microglial cells were not detected (Figure S4D and S5A-S5C). This finding indicated that the transplanted cells transformed into dopaminergic neurons in vivo.

Fig. 3 Location and characteristics of grafts from DREADD-iDA in the brain of mice with Parkinson’s Disease. A: The location, survival, and TH expression of grafts derived from hM4Di- iDA at 12 weeks after transplantation. The white box indicates the graft area. Scale bar: 500 μm. B-C: Immunofluorescent images of the differentiated markers FoxA2 (B), NURR1 (B), Tuj1 (B), STEM121 (C), S100b (C), TH (B, C), HNA (B, C) and ZsGreen (B, C) in grafts derived from hM4Di and hM3Dq at 12 weeks after transplantation. Scale bars: left (large), 100 μm; right (small), 250 μm. D: Quantitative analysis of the co-expression of TH and ZsGreen or EGFP for EGFP, hM4Di, and hM3Dq groups relative to the expression of HNA. n = 5. E: Quantitative analysis of the expression of FoxA2 for EGFP, hM4Di, and hM3Dq groups relative to the expression of HNA. n = 5. F: Quantitative analysis of the co-expression of FoxA2 and TH for EGFP, hM4Di, and hM3Dq groups relative to the expression of TH. n = 5. G: Quantitative analysis of the expression of NURR1 for EGFP, hM4Di, and hM3Dq groups relative to the expression of HNA. n = 5. H: Quantitative analysis of the co-expression of NURR1 and TH for EGFP, hM4Di, and hM3Dq groups relative to the expression of HNA. n = 5. FoxA2: forkhead transcription factor; HNA: human nuclear antigen; NURR1: nuclear related regulator-1; TH: tyrosine hydroxylase; Tuj1: neuron-specific class III beta-tubulin

Response of animal brain slice with DREADD cells to CNO treatment through whole-cell patch-clamp recording

The host brain slice was prepared for whole-cell patch-clamp recording 8 weeks after transplantation. In the striatum, medium spiny neurons (MSNs) were the downstream of dopaminergic neurons and received signals from dopaminergic neurons [22]. Thus, we assessed MSNs to verify the integration of the DREADD- or EGFP-cell lines in vivo and their ability to control subordinate neurons after CNO treatment. The results obtained from the EGFP-cell line group showed that the frequency and amplitude of spontaneous excitatory postsynaptic currents (sEPSCs) remained stable during CNO treatment, as well as, during the baseline acquisition and the washout period (Fig. 4A and S6A-S6C). The scatter diagrams and histograms of the hM4Di group indicated a significant increase in the interevent interval following CNO treatment, indicating a prolonged interval between synaptic events, compared to the baseline and washout conditions (Fig. 4C and E). Additionally, the peak amplitude in the hM4Di group decreased significantly (Fig. 4B and D). In contrast, in the hM3Dq group, the interevent interval showed a significant decrease, while the peak amplitude significantly increased (Fig. 4B and E). To summarize, using CNO in the host brain slice showed that the transplanted cells were integrated into the host brain, resulting in their dominance over the host’s subordinate functions.

Fig. 4 Whole-cell patch-clamp recordings of the host brain slices. A: The results of whole-cell patch-clamp recordings of sEPSCs from grafts of the EGFP, hM4Di, or hM3Dq groups 8 weeks after transplantation. The sEPSCs were provided at baseline, after adding CNO (50 µM), and during the washout phase. B-E: The results of the statistical analysis of the peak amplitude (B and D), interevent interval (C), and event frequency (E) for sEPSCs recorded from grafts of EGFP, hM4Di, or hM3Dq groups 8 weeks after transplantation. Significant differences were observed in the hM4Di and hM3Dq groups; n = 3; sEPSCs: spontaneous excitatory postsynaptic currents. *p < 0.05, ** p < 0.01, and ***p < 0.001

Animal model behavior with DREADD grafts was modulated by CNO

4 weeks after the unilateral 6-OHDA lesion developed, we conducted several behavioral tests, including the apomorphine-induced rotation test, cylinder test, rotarod test, and open field test to establish a baseline. 4 and 8 weeks after transplantation, we performed the cylinder test, rotarod test, and open field test; we injected the mice with CNO or saline, or did not inject them with any solution, and assessed the responsiveness of the transplanted cells to CNO. Also, 4, 8, and 12 weeks after transplantation, we evaluated the function of the transplanted cells in vivo using the apomorphine-induced rotation test (Fig. 5A). All behavioral results were presented with EGFP, hM4Di, hM3Dq, 6-OHDA, sham-operated, and normal groups, n = 11, 13, 12, 6, 4, and 5, respectively.

Fig. 5 Modulation of behavioral tests of Parkinson’s Disease model by CNO. A: A flow diagram illustrating the schedule of the establishment of the PD mouse model and behavioral tests. B: Contralateral rotational counting of apomorphine-induced rotations. The test was conducted across the EGFP, hM4Di, hM3Dq, 6-OHDA-lesioned, sham-operated, and normal control groups at baseline and 4, 8, and 12 weeks after transplantation. C: Statistical analysis of the contralateral forelimb movement outcomes in the cylinder test for the EGFP, hM4Di, hM3Dq, 6-OHDA-lesioned, sham-operated, and normal control groups at baseline and 4 and 8 weeks after transplantation. The analysis was performed after administering saline and CNO and after CNO withdrawal. D: Statistical analysis of the latency to fall in the rotarod test for the EGFP, hM4Di, hM3Dq, 6-OHDA-lesioned, sham-operated, and normal control groups at baseline and 4 and 8 weeks after transplantation. The analysis was performed after administering saline and CNO and after CNO withdrawal. E-I: The results of the open field test for the EGFP-, hM4Di-, and hM3Dq groups at baseline and 4 and 8 weeks after transplantation. The analysis was performed after administering saline and CNO and after CNO withdrawal. The total route traces (E) of the three groups were presented after administering saline and CNO 8 weeks after transplantation. The results of the statistical analysis of the total distance (F), average speed (G), the proportion of distance to edge to total distance (H), and edge speed (I) from the three groups were determined after administering saline and CNO, and after CNO withdrawal at baseline and 4 and 8 weeks after transplantation. EGFP, hM4Di, hM3Dq, 6-OHDA, sham-operated, and normal groups, n = 11, 13, 12, 6, 4, and 5, respectively. 6-OHDA: 6-hydroxydopamine; bT: before transplantation; pCNO: post CNO; pT 4 weeks: 4 weeks after transplantation; sham: sham-operated group.*p < 0.05, ** p < 0.01, ***p < 0.001, and ****p < 0.0001

Before transplantation, the unilateral 6-OHDA lesion group exhibited approximately 200 contralateral rotations per 30 min (Fig. 5B). However, the EGFP, hM4Di, and hM3Dq groups showed a decrease in contralateral rotation compared to the 6-OHDA lesion group within 12 weeks of transplantation, indicating similar functional restoration across all transplanted groups (Fig. 5B). After administering CNO, the hM4Di group exhibited a significant reduction in contralateral forelimb movement, as well as, a shorter time to fall from the rotarod compared to the administration with saline and the non-treatment with CNO (Fig. 5C and D). In contrast, the hM3Dq group showed a significant increase in contralateral forelimb movement and higher latency to fall from the rod when treated with CNO relative to the administration with saline and the non-treatment with CNO (Fig. 5C and D). Over time, the EGFP, hM4Di, and hM3Dq groups showed an increase in contralateral forelimb movement and a longer time to fall from the rod compared to the pre-transplantation period (Figures S7A and S7B).

In the open field test, the hM4Di group displayed a significant decrease in total distance, average speed and edge speed and a increase in the proportion of distance to edge to total distance when treated with CNO compared to that when treated with saline and when not treated with CNO (Fig. 5E and I). The hM4Di group also showed a preference for the edge over the center area and displayed more resting behavior than activity (Fig. 5E and I). In contrast, the hM3Dq group exhibited a reversal of performance under CNO treatment compared to the hM4Di group (Fig. 5E and I). The EGFP group showed no significant changes under the same treatment conditions (Fig. 5E and I). The EGFP, hM4Di, and hM3Dq groups showed different performances before transplantation and 4 weeks and 8 weeks after transplantation (Figures S7C-S7G). These findings indicated that the behavioral responses of the mouse model matched the functions of the transplanted cell lines after treatment with CNO.

Discussion

In this study, we performed chemogenetic modulation of induced neural stem cell-derived dopaminergic precursor cells (iNSC-DAPs) and transplanted them into a Parkinson’s disease mouse model. After these cells differentiated into dopaminergic neurons, their functionality could be regulated by CNO (clozapine-N-oxide), which was evaluated based on the behavior of the animals and electrophysiological recordings. The results showed the activity of the graft cells after transplantation.

Researchers have investigated different types of cells for their potential to replace or repair damaged dopaminergic neurons in the brain for treating Parkinson’s disease (PD) [2, 8, 23]. Several factors are of concern regarding the ability of cells to differentiate into dopaminergic (DA) neurons, efficiency of differentiation, in vivo survival rate, clinical safety, availability of donor tissue, and ethical considerations [3]. Fetal brain cells are derived from the brain tissue of aborted fetuses. These cells showed promising results in preclinical and early clinical studies [24]. However, the use of fetal brain cells is limited by ethical concerns and the availability of suitable donor tissue [25]. As ESCs and iPSCs can differentiate into various cell types, including DAPs, they may be used for PD therapy, but their application might increase the risk of tumorigenesis. Compared to these cell types, iNSC-DAPs are directly induced from adult somatic cells, bypassing the pluripotent state. As they have a lower tumor-formation ability, and their application avoids the ethical concerns associated with fetal brain cells, iNSC-DAPs are a promising candidate for PD cell therapy [10, 11]. Therefore, in this study, we investigated whether the motor function of animals with Parkinson’s disease (PD) can be reversibly controlled directly by manipulating the function of the graft cells using drugs and elucidated the underlying mechanism of action.

To achieve stable and reliable expression of DREADDs (Designer Receptors Exclusively Activated by Designer Drugs) in iNSCs with the expression of hM4Di or hM3Dq, we constructed a cell line using hM3Dq-mCherry and hM4Di-mCherry fusion protein-expressing plasmids [15]; however, we could not obtain any mCherry-positive cells (data not shown). We speculated that the fusion protein might have some toxic effects on iNSCs. To address this concern, we set a non-fusion T2A-ZsGreen expression system and generated the desired knock-in cell line.

The DREADD cell lines exhibited the features of induced neural stem cells (iNSCs), effectively differentiating into dopaminergic neurons. Through electrophysiology testing, we found that these cells displayed inhibitory or excitatory responses, which could be modulated by the drug CNO. The results of the analysis of spontaneous excitatory postsynaptic currents (sEPSCs) in the mouse brain slices indicated that the grafts successfully integrated into the host brain and exerted a dominant influence over downsteam neurons. However, we found that 30–40% of host cells exhibited relative responses to CNO modulation (Data not shown). To comprehensively understand this phenomenon, further studies are needed to elucidate the underlying mechanisms in greater detail. The behavioral tests conducted on the transplanted mice revealed distinct regulated effects after CNO was administered. The hM4Di group exhibited suppressed manifestation, whereas, the hM3Dq group displayed excitatory effects. We found that remote DREADD-dependent activation of iNSC-DAP neurons significantly enhanced the beneficial effects on transplanted mice with Parkinson’s disease. Therefore, iNSC-DAPs are a promising candidate for cell replacement therapy for Parkinson’s disease.

Limitations

Firstly, the main limitation of this study was that it was conducted on a Parkinson’s disease mouse model, and further research is needed to determine the efficacy of iNSC-DAP neurons in large animal models such as non-human primates (NHP). Secondly, using immunocompromised mice for PD modelling remains a challenge. The successes rate was relatively low with only 58 PD models established out of the 180 total mice in this study. In addition, each immunodeficient animal needed to go through two surgeries and a series of drug treatments during the 12-week study period, which could further reduce the number of surviving animals. In our future research, a larger cohort of animals may need to be recruited for xenograft transplantation studies using severely immunodeficient mice. Thirdly, the study did not provide information on the long-term survival and circuit integration state of the transplanted iNSC-DAP neurons. These issues need to be addressed to fully realize the potential of this approach.

Conclusions

Here, we demonstrated that the functionality of dopaminergic neurons derived from induced neural stem cell-derived dopaminergic precursor cells (iNSC-DAPs) can be modulated by CNO after transplantation into a Parkinson’s disease mouse model, resulting in enhanced animal behavior and positive electrophysiological outcomes. Therefore, iNSC-DAPs have the potential to serve as a promising candidate for cell replacement therapy in Parkinson’s disease.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Supplementary Material 4

Supplementary Material 5

Supplementary Material 6

Supplementary Material 7

Supplementary Material 8

Supplementary Material 9

Acknowledgements

Not applicable.

Author contributions

Z.C., D.H. and X.W. conceived the study. Z.C. and D.H. supervised the research. X.W., D.H., and T.Z. performed the animal care and behavioral experiments. X.W.and D.H. conducted the molecular bilology experiments, cell culture. D.H., X.W. and J.M. conducted sample collection and data analysis. D.H., X.W. and Z.C. collaborated on drafting and revision of the manuscript. All authors have reviewed the manuscript and approved the submission.

Funding

This work was supported by National Natural Science Foundation of China (82171250), Beijing Municipal Health Commission Fund (PXM2020_026283_000005) and The Project for Techonology Development of Beijing-affiliated Medical Research Institutes (11000023T000002036310), the Beijing Natural Science Foundation (7242068), Capital Medical University Research Cultivation Fund (PYZ23055), and Open Project of Key Laboratory of Longevity and Aging-related Diseases (Guangxi Medical University), Ministry of Education (KLLAD202301).

Data availability

All data are available in the main text or the supplementary materials.

Declarations

Ethics approval and consent to participate

All experimental procedures were conducted in compliance with guidelines for the Care and Use of Laboratory Animals established by the Beijing Association for Laboratory Animal Science and the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The study adhered to the ethical approval provided by the Laboratory Animal Ethics Committee of Xuanwu Hospital, Capital Medical University, under approval number XW-20210423-2. The approval was titled: Cell Therapy for Central Nervous System Diseases. Date of approval: April 23, 2021. Peripheral blood was collected from a healthy donor in accordance with a protocol approved by the Ethics Committee of Xuanwu Hospital, Capital Medical University. The approval was titled ' Early Prediction and Intervention Research for Parkinson’s Disease’ under approval number LYS-2011-012, on May 17, 2011. Informed consent was obtained from the donor prior to the procedure.

Consent for publication

Not applicable.

Competing interests

Authors declared no competing interests.

Abbreviations

iNSCs Induced Neural Stem Cells

iNSC-DAPs Induced Neural Stem Cells-Derived Dopaminergic Precursor Cells

DREADDs Designer Receptors Exclusively Activated By Designer Drugs

CRISPR Clustered Regularly Interspaced Short Palindromic Repeats

DA Dopaminergic Neuron

PD Parkinson’s Disease

hiPSCs Human Induced Pluripotent Stem Cells

ESCs Embryonic Stem Cells

6-OHDA 6-Hydroxydopamine

FGF8 Fibroblast Growth Factor 8

SHH Sonic Hedgehog

BDNF Brain-Derived Neurotrophic Factor

GDNF Glial Cell-Derived Neurotrophic Factor

cAMP Dibutyryladenosine 3′,5′-cyclic Monophosphate Sodium Salt

DAPT 1-Dimethylethyl Ester

SOX2 Sry-Box Transcription Factor 2

TH Tyrosine Hydroxylase

Tuj1 Tubulin Beta 3 Class III

FoxA2 Forkhead Box A2

NURR1 Nuclear Receptor Subfamily 1

HNA Human Cell Nuclei

EGFP Enhanced Green Fluorescent Protein

ZsGreen Zoanthus Green Fluorescent Protein

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xueyao Wang and Deqiang Han contributed equally to this work.
==== Refs
References

1. Hoang DM Pham PT Bach TQ Ngo AT Nguyen QT Phan TT Stem cell-based therapy for human diseases Signal Transduct Target Therapy 2022 7 272 10.1038/s41392-022-01134-4
Hoang DM, Pham PT, Bach TQ, Ngo AT, Nguyen QT, Phan TT, et al. Stem cell-based therapy for human diseases. Signal Transduct Target Therapy. 2022;7:272.10.1038/s41392-022-01134-4
2. Temple S Advancing cell therapy for neurodegenerative diseases Cell Stem Cell 2023 30 512 29 10.1016/j.stem.2023.03.017 37084729
Temple S. Advancing cell therapy for neurodegenerative diseases. Cell Stem Cell. 2023;30:512–29.37084729 10.1016/j.stem.2023.03.017
3. Parmar M Grealish S Henchcliffe C The future of stem cell therapies for Parkinson disease Nat Rev Neurosci 2020 21 103 15 10.1038/s41583-019-0257-7 31907406
Parmar M, Grealish S, Henchcliffe C. The future of stem cell therapies for Parkinson disease. Nat Rev Neurosci. 2020;21:103–15.31907406 10.1038/s41583-019-0257-7
4. Duncan T Valenzuela M Alzheimer’s disease, dementia, and stem cell therapy Stem Cell Res Ther 2017 8 1 9 10.1186/s13287-017-0567-5 28057078
Duncan T, Valenzuela M. Alzheimer’s disease, dementia, and stem cell therapy. Stem Cell Res Ther. 2017;8:1–9.28057078 10.1186/s13287-017-0567-5
5. Huang H Al Zoubi ZM Moviglia G Sharma HS Sarnowska A Sanberg PR Clinical cell therapy guidelines for neurorestoration (IANR/CANR 2022) J Neurorestoratology 2022 10 100015 10.1016/j.jnrt.2022.100015
Huang H, Al Zoubi ZM, Moviglia G, Sharma HS, Sarnowska A, Sanberg PR, et al. Clinical cell therapy guidelines for neurorestoration (IANR/CANR 2022). J Neurorestoratology. 2022;10:100015.10.1016/j.jnrt.2022.100015
6. Huang H Chen L Moviglia G Sharma A Al Zoubi ZM He X Advances and prospects of cell therapy for spinal cord injury patients J Neurorestoratology 2022 10 13 30 10.26599/JNR.2022.9040007
Huang H, Chen L, Moviglia G, Sharma A, Al Zoubi ZM, He X, et al. Advances and prospects of cell therapy for spinal cord injury patients. J Neurorestoratology. 2022;10:13–30.10.26599/JNR.2022.9040007
7. Schneider SA, Obeso JA. Clinical and pathological features of Parkinson’s disease. Behavioral Neurobiology of Huntington’s disease and Parkinson’s disease. 205 – 20; 2015.
8. Kikuchi T Morizane A Doi D Magotani H Onoe H Hayashi T Human iPS cell-derived dopaminergic neurons function in a primate Parkinson’s disease model Nature 2017 548 592 6 10.1038/nature23664 28858313
Kikuchi T, Morizane A, Doi D, Magotani H, Onoe H, Hayashi T, et al. Human iPS cell-derived dopaminergic neurons function in a primate Parkinson’s disease model. Nature. 2017;548:592–6.28858313 10.1038/nature23664
9. Kriks S Shim J-W Piao J Ganat YM Wakeman DR Xie Z Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson’s disease Nature 2011 480 547 51 10.1038/nature10648 22056989
Kriks S, Shim J-W, Piao J, Ganat YM, Wakeman DR, Xie Z, et al. Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson’s disease. Nature. 2011;480:547–51.22056989 10.1038/nature10648
10. Yuan Y Tang X Bai Y-F Wang S An J Wu Y Dopaminergic precursors differentiated from human blood-derived induced neural stem cells improve symptoms of a mouse Parkinson’s disease model Theranostics 2018 8 4679 10.7150/thno.26643 30279731
Yuan Y, Tang X, Bai Y-F, Wang S, An J, Wu Y, et al. Dopaminergic precursors differentiated from human blood-derived induced neural stem cells improve symptoms of a mouse Parkinson’s disease model. Theranostics. 2018;8:4679.30279731 10.7150/thno.26643
11. Chen Z, Zhao G. First-in-human transplantation of autologous induced neural stem cell-derived dopaminergic precursors to treat Parkinson’s disease. Sci Bull. 2023.
12. Roth BL DREADDs Neuroscientists Neuron 2016 89 683 94 10.1016/j.neuron.2016.01.040 26889809
Roth BL. DREADDs Neuroscientists Neuron. 2016;89:683–94.26889809 10.1016/j.neuron.2016.01.040
13. Dell’Anno MT Caiazzo M Leo D Dvoretskova E Medrihan L Colasante G Remote control of induced dopaminergic neurons in parkinsonian rats J Clin Invest 2014 124 3215 29 10.1172/JCI74664 24937431
Dell’Anno MT, Caiazzo M, Leo D, Dvoretskova E, Medrihan L, Colasante G, et al. Remote control of induced dopaminergic neurons in parkinsonian rats. J Clin Invest. 2014;124:3215–29.24937431 10.1172/JCI74664
14. Kitagawa T Nagoshi N Kamata Y Kawai M Ago K Kajikawa K Modulation by DREADD reveals the therapeutic effect of human iPSC-derived neuronal activity on functional recovery after spinal cord injury Stem cell Rep 2022 17 127 42 10.1016/j.stemcr.2021.12.005
Kitagawa T, Nagoshi N, Kamata Y, Kawai M, Ago K, Kajikawa K, et al. Modulation by DREADD reveals the therapeutic effect of human iPSC-derived neuronal activity on functional recovery after spinal cord injury. Stem cell Rep. 2022;17:127–42.10.1016/j.stemcr.2021.12.005
15. Chen Y Xiong M Dong Y Haberman A Cao J Liu H Chemical Control of Grafted Human PSC-Derived neurons in a mouse model of Parkinson’s Disease Cell Stem Cell 2016 18 817 26 10.1016/j.stem.2016.03.014 27133795
Chen Y, Xiong M, Dong Y, Haberman A, Cao J, Liu H, et al. Chemical Control of Grafted Human PSC-Derived neurons in a mouse model of Parkinson’s Disease. Cell Stem Cell. 2016;18:817–26.27133795 10.1016/j.stem.2016.03.014
16. Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y et al. Human stem cell-derived neurons repair circuits and restore neural function. Cell Stem Cell. 2021; 28: 112 – 26.e6.
17. Alexander GM Rogan SC Abbas AI Armbruster BN Pei Y Allen JA Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors Neuron 2009 63 27 39 10.1016/j.neuron.2009.06.014 19607790
Alexander GM, Rogan SC, Abbas AI, Armbruster BN, Pei Y, Allen JA, et al. Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors. Neuron. 2009;63:27–39.19607790 10.1016/j.neuron.2009.06.014
18. Stachniak TJ Ghosh A Sternson SM Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus→ midbrain pathway for feeding behavior Neuron 2014 82 797 808 10.1016/j.neuron.2014.04.008 24768300
Stachniak TJ, Ghosh A, Sternson SM. Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus→ midbrain pathway for feeding behavior. Neuron. 2014;82:797–808.24768300 10.1016/j.neuron.2014.04.008
19. Li M Wang Z Zheng T Huang T Liu B Han D Characterization of Human-Induced neural stem cells and derivatives following transplantation into the Central Nervous System of a Nonhuman Primate and rats Stem Cells Int 2022 2022 1396735 10.1155/2022/1396735 36618021
Li M, Wang Z, Zheng T, Huang T, Liu B, Han D, et al. Characterization of Human-Induced neural stem cells and derivatives following transplantation into the Central Nervous System of a Nonhuman Primate and rats. Stem Cells Int. 2022;2022:1396735.36618021 10.1155/2022/1396735
20. Zhang Y Vanoli F LaRocque JR Krawczyk PM Jasin M Biallelic targeting of expressed genes in mouse embryonic stem cells using the Cas9 system Methods (San Diego Calif) 2014 69 171 8 10.1016/j.ymeth.2014.05.003 24929070
Zhang Y, Vanoli F, LaRocque JR, Krawczyk PM, Jasin M. Biallelic targeting of expressed genes in mouse embryonic stem cells using the Cas9 system. Methods (San Diego Calif). 2014;69:171–8.24929070 10.1016/j.ymeth.2014.05.003
21. Iancu R Mohapel P Brundin P Paul G Behavioral characterization of a unilateral 6-OHDA-lesion model of Parkinson’s disease in mice Behav Brain Res 2005 162 1 10 10.1016/j.bbr.2005.02.023 15922062
Iancu R, Mohapel P, Brundin P, Paul G. Behavioral characterization of a unilateral 6-OHDA-lesion model of Parkinson’s disease in mice. Behav Brain Res. 2005;162:1–10.15922062 10.1016/j.bbr.2005.02.023
22. Xing B Li Y-C Gao W-J Norepinephrine versus dopamine and their interaction in modulating synaptic function in the prefrontal cortex Brain Res 2016 1641 217 33 10.1016/j.brainres.2016.01.005 26790349
Xing B, Li Y-C, Gao W-J. Norepinephrine versus dopamine and their interaction in modulating synaptic function in the prefrontal cortex. Brain Res. 2016;1641:217–33.26790349 10.1016/j.brainres.2016.01.005
23. Schweitzer JS Song B Herrington TM Park T-Y Lee N Ko S Personalized iPSC-Derived dopamine progenitor cells for Parkinson’s Disease N Engl J Med 2020 382 1926 32 10.1056/NEJMoa1915872 32402162
Schweitzer JS, Song B, Herrington TM, Park T-Y, Lee N, Ko S, et al. Personalized iPSC-Derived dopamine progenitor cells for Parkinson’s Disease. N Engl J Med. 2020;382:1926–32.32402162 10.1056/NEJMoa1915872
24. Barker RA Designing stem-cell-based dopamine cell replacement trials for Parkinson’s disease Nat Med 2019 25 1045 53 10.1038/s41591-019-0507-2 31263283
Barker RA. Designing stem-cell-based dopamine cell replacement trials for Parkinson’s disease. Nat Med. 2019;25:1045–53.31263283 10.1038/s41591-019-0507-2
25. Barker RA Barrett J Mason SL Björklund A Fetal dopaminergic transplantation trials and the future of neural grafting in Parkinson’s disease Lancet Neurol 2013 12 84 91 10.1016/S1474-4422(12)70295-8 23237903
Barker RA, Barrett J, Mason SL, Björklund A. Fetal dopaminergic transplantation trials and the future of neural grafting in Parkinson’s disease. Lancet Neurol. 2013;12:84–91.23237903 10.1016/S1474-4422(12)70295-8
