
==== Front
BMC Biol
BMC Biol
BMC Biology
1741-7007
BioMed Central London

39256779
1999
10.1186/s12915-024-01999-7
Research Article
GhPME36 aggravates susceptibility to Liriomyza sativae by affecting cell wall biosynthesis in cotton leaves
Yang Zheng 13
Wang Menglei 1
Fan Senmiao 26
Zhang Zhen 2
Zhang Doudou 1
He Jie 1
Li Tongyi 1
Wei Renhui 2
Wang Panpan 1
Dawood Muhammad 4
Li Weijie 2
Wang Lin 2
Wang Shaogan 2
Yuan Youlu yuanyoulu@caas.cn

12
http://orcid.org/0000-0002-7080-005X
Shang Haihong shanghaihong@caas.cn

125
1 https://ror.org/04ypx8c21 grid.207374.5 0000 0001 2189 3846 Zhengzhou Research Base, National Key Laboratory of Cotton Bio-breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, 450001 China
2 grid.410727.7 0000 0001 0526 1937 National Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, 455000 China
3 Hainan Seed Industry Laboratory, Sanya, 572000 China
4 https://ror.org/05x817c41 grid.411501.0 0000 0001 0228 333X Department of Environmental Sciences, Bahauddin Zakariya University, Multan, Pakistan
5 Henan Grain and Cotton Crops Research Institute, Zhengzhou, China
6 Shennong Laboratory, Zhengzhou, 450002 China
11 9 2024
11 9 2024
2024
22 1975 3 2024
29 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Cotton is an important economic crop and a host of Liriomyza sativae. Pectin methylesterase (PME)-mediated pectin metabolism plays an indispensable role in multiple biological processes in planta. However, the pleiotropic functions of PME often lead to unpredictable effects on crop resistance to pests. Additionally, whether and how PME affects susceptibility to Liriomyza sativae remain unclear.

Results

Here, we isolated GhPME36, which is located in the cell wall, from upland cotton (Gossypium hirsutum L.). Interestingly, the overexpression of GhPME36 in cotton caused severe susceptibility to Liriomyza sativae but increased leaf biomass in Arabidopsis. Cytological observations revealed that the cell wall was thinner with more demethylesterified pectins in GhPME36-OE cotton leaves than in WT leaves, whereas the soluble sugar content of GhPME36-OE cotton leaf cell walls was accordingly higher; both factors attracted Liriomyza sativae to feed on GhPME36-OE cotton leaves. Metabolomic analysis demonstrated that glucose was significantly differentially accumulated. Transcriptomic analysis further revealed DEGs enriched in glucose metabolic pathways when GhPME36 was overexpressed, suggesting that GhPME36 aggravates susceptibility to Liriomyza sativae by affecting both the structure and components of cell wall biosynthesis. Moreover, GhPME36 interacts with another pectin-modifying enzyme, GhC/VIF1, to maintain the dynamic stability of pectin methyl esterification.

Conclusions

Taken together, our results reveal the cytological and molecular mechanisms by which GhPME36 aggravates susceptibility to Liriomyza sativae. This study broadens the knowledge of PME function and provides new insights into plant resistance to pests and the safety of genetically modified plants.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12915-024-01999-7.

Keywords

PME
Cotton
Liriomyza sativae
Cell wall biosynthesis
Glucose metabolism
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Cotton is an important source of natural fiber and is planted worldwide [1]. There is a long history and solid foundation in the transgenic technology of insect-resistant cotton varieties [2]. Liriomyza sativae (leaf miner), a member of Agromyzidae, is a widely distributed herbivorous insect that infects more than 60 host plants belonging to 18 different families [3]. Larvae of the leaf miner burrow into the leaf matter and feed on mesophyll tissue, gradually causing the leaves to yellow and ultimately wither away. In this process, chlorophyll and sugars are degraded in mesophyll cells, causing the shedding of leaves [4], which significantly reduces the production of vegetables and food crops worldwide [5]. New damage areas and new leaf miner host plants have been reported continuously over recent years [6–8]. It has been listed as a quarantine object in Europe, China, and other countries and regions [3, 9]. As a member of the Malvaceae family, cotton is a potential leaf miner host, which qualifies it as a suitable receptor material for studying the mechanism of susceptibility to leaf miners. Currently, the common control methods for leaf miner include space isolation, insecticide use, breeding of resistant plants, and biological control. However, most insecticides have gradually become less effective. After the release of parasitic bees, the natural enemies of leaf miner, other organisms of plants were also attacked [3]. Owing to the fast propagation capability of leaf miners, strict quarantine examination is still regarded as a necessary means to prevent their spread and outbreak.

The function of plant cells depends on their morphological characteristics and components [10]. The cell wall is the extracellular matrix of plants, whose chemical structure and mechanical properties play important roles in determining cell shape and development. Cell wall loosening and rigidification are important factors that determine the anisotropic growth mode and shape of plant cells [11]. Additionally, the cell wall is a medium for interactions between cells and the external environment [12–14]. The role of the cell wall in coping with biological stress [15, 16] and abiotic stress [17, 18] has received increasing attention. Pectin, an important cell wall polysaccharide, is the most abundant biomolecule in the primary wall, accounting for approximately one third of its dry weight [19]. It is involved in cell adhesion and separation [20] and helps maintain cell integrity [21]. Pectin is synthesized in the Golgi apparatus in a state of high methyl esterification [22] and is then secreted from cells [23]. It forms a crosslinking network with cellulose and hemicellulose [24], which constitutes the main component of the cell wall.

Pectin is modified by pectin methylesterase (PME, EC 3.1.1.11), causing a decrease in pectin methylesterification [25]. Pectin demethylesterification leads the cell wall to two contrasting fates, harder or softer, depending on the environment of the early developmental stage: in an environment where divalent cations such as Ca2+ are present, pectin methylated at low levels forms a harder structure with other homogalacturonan (HG) molecules; in an environment containing polygalacturonase, pectin methylated at low levels disintegrates as a target, and the cell wall become softer [26]. The changes in cell wall hardness caused by pectin demethylesterification have already been verified in pollen tubes and onion epidermis [27, 28]. The results of an in vitro study also confirmed the role of pectin demethylesterification in stabilizing the cellulose network [29]. Moreover, the presence of cellulose also has a positive effect on pectin demethylesterification [30].

PME is a key enzyme of pectin metabolism that is widely found in higher plants and is encoded by a polygene family [31, 32]. PME can be divided into two types according to protein structure: type I contains pectin methylesterase inhibitor (PMEI) and PME domains, whereas type II possesses only PME domains [33]. PME is involved in important physiological processes related to the vegetative growth and reproductive development of plants through the metabolism of cell wall pectin, such as fruit ripening and softening [34], stomatal opening and closing [35], seed mucus secretion [36], and pollen tube growth [37]. Previous studies indicate that the modification of pectin by PME plays an important role in plant growth and development. The knockout, overexpression, and heterologous expression of PME genes in Arabidopsis lead to significant changes in the plant phenotype, such as decreased stem mechanical strength [38], an altered number of adventitious roots [39], improved salt tolerance [40], decreased plant height [41], and decreased photosynthetic efficiency [42].

The effect of the PMEI on PME activity has been extensively analyzed [43]. PMEI and PME combine into a nonspecific complex in a 1:1 ratio [44], which prevents pectin from being demethylated by inhibiting the combination of PME and its target. The interaction between the PME and PMEI influences the degree of pectin methylesterification and subsequently affects in plant seed germination, pollen tube development, root development, and stress responses [45]. Additionally, pectin methylesterification plays important role in plant resistance to diseases [46, 47] and pests [15]. For example, constitutive overexpression of AtPMEI-1 and AtPMEI-2 in Arabidopsis increases the degree of pectin methylesterification to restrict fungal infection by Botrytis cinerea [48]. Pectin methyl esterase 1 reduces the degree of esterification of pectin-derived oligogalacturonides to elicit defense responses in strawberry [49]. Methanol (MeOH), a byproduct of HG demethylesterification, is regarded as a signal of plant immunity [50]. And the PME activity of host plants is positively correlated with the feeding preference of aphids [15].

To explore the function of pectin methylesterification in upland cotton, we previously explored the phylogeny and expression of the PME gene family [33]. Here, GhPME36 was used as the research subject. By knocking out and overexpressing GhPME36, we surprisingly revealed the relationship between pectin methylesterification and the susceptibility of upland cotton to leaf miners. Cytological, transcriptomic, and metabolomic analyses revealed that the increased glucose level and looser cell wall structure of GhPME36-overexpressing (GhPME36-OE) cotton leaves resulted in greater susceptibility to leaf miners. This study lays a foundation for the breeding of insect-resistant cotton genotypes by providing a new idea for resistance to Liriomyza sativae.

Results

Expression pattern and subcellular localization of GhPME36

Compared with that in other organs and tissues, the expression of GhPME36 was relatively low in the leaves, as indicated by the published transcriptome data (Additional file 1: Fig. S1). To understand the role of GhPME36 in cotton leaves, the expression of GhPME36 was determined in leaves at 7, 14, 21, 28, and 35 days after leaf spreading (D). The highest expression level of GhPME36 was observed at 7 D. With the development of cotton leaves, the expression of GhPME36 decreased tenfold-fold until 28 D and then increased sharply at 35 D, when the leaves had almost matured (Fig. 1A).Fig. 1 Expression pattern of GhPME36. A Expression level of GhPME36 during the developmental stages of upland cotton (CCRI24) leaves. The data are presented as the means ± SDs (n = 3 biological replicates). Different letters indicate significant differences (P < 0.05; Duncan’s multiple range test). B Subcellular localization of GhPME36 in onion epidermis. The arrow indicates the cell wall; open triangle indicates the plasma membrane. Scale bar, 100 μm. C Histochemical analysis of GUS activity in the flowers, pods, leaves, stems, and roots and root hairs of proGhPME36:GUS transgenic Arabidopsis. Scale bar, 1 mm

A subcellular localization experiment conducted on tobacco leaves revealed that GhPME36 was localized in the cell wall and/or membrane (Additional file 1: Fig. S2). For clearer research, onion inner epidermis was used as the transformation receptor. GhPME36 was verified to be located in the cell wall rather than the cell membrane by plasmolysis (Fig. 1B). GUS staining in Arabidopsis further demonstrated the expression of the GhPME36 promoter in the calyx, pod, leaf vein, stems, and root epidermis (Fig. 1C). These results indicate the potential role of GhPME36 in the initiation and maturation of cotton leaves and that GhPME36 might be involved in cell wall biosynthesis.

Overexpression of GhPME36 in Arabidopsis increased leaf biomass

To preliminarily understand the function of GhPME36 in planta, seven Arabidopsis transgenic lines overexpressing GhPME36 were generated, in which the expression level of GhPME36 increased by nine to 125 times (Additional file 1: Fig. S3A). Compared with the wild type (WT), the overexpression of GhPME36 clearly increased plant size (Fig. 2A) and larger rosette leaves (Fig. 2B) in three randomly selected lines.Fig. 2 Morphology and leaf weight of GhPME36-OE Arabidopsis. A Phenotypes of three-week-old WT and GhPME36-OE Arabidopsis plants. Scale bar, 1 cm. B Phenotypes of fifth to eighth rosette leaves of WT and GhPME36-OE Arabidopsis plants. Scale bar, 1 cm. C–F Plant size (C), rosette leaf length (D), fresh weight (E), and dry weight (F) of WT and GhPME36-OE three-week-old Arabidopsis. The data are presented as the means ± SDs (n = 5 biological replicates). Different letters indicate significant differences (P < 0.05; Duncan’s multiple range test)

Three weeks after sowing, the diameter of the plants was 28–46% greater when GhPME36 was overexpressed than in the WT (Fig. 2C). Moreover, the leaf lengths of the three GhPME36-OE lines were also 28%, 48%, and 32% greater, respectively (Fig. 2D). To determine the reason for the larger transgenic leaves, the rosette leaf weight was determined. The fresh weight was 60%, 111%, and 70% higher (Fig. 2E), and the dry weight was 59%, 104%, and 65% greater in the GhPME36-OE lines compared with the WT (Fig. 2F). Notably, for each GhPME36-OE line, the increasing proportion of fresh weight and dry weight was almost the same, which indicated that GhPME36 generally increased the leaf biomass by producing more dry materials.

Overexpression of GhPME36 increased leaf miner susceptibility in cotton

To further explore the function of GhPME36 in cotton leaves, eight GhPME36-OE and seven GhPME36-knockout (GhPME36-KO) cotton plants were obtained. Three lines from each transgenic event were randomly selected for the following experiments. The expression level of GhPME36 in three selected GhPME36-OE cotton lines increased by 3.2–5.9 times (Additional file 1: Fig. S3B). To evaluate the efficiency of the overexpression and silencing of GhPME36, the total PME activity in cotton leaves was determined. Compared with that in WT cotton leaves, the PME activity was significantly (16–18%) higher in GhPME36-OE cotton leaves (Fig. 3A) and 11–27% lower in GhPME36-KO cotton leaves (Fig. 3B). The effect of GhPME36 expression on PME activity demonstrated that GhPME36 had PME enzyme activity.Fig. 3 PME activity and leaf miner susceptibility of GhPME36-OE and GhPME36-KO cotton. A PME activity in three GhPME36-OE cotton lines, with CCRI24 as the WT. B PME activity in three GhPME36-KO cotton lines, with Jin668 as the WT. C Pest indices of the GhPME36-OE and GhPME36-KO lines. The data are presented as the means ± SDs (n = 3 biological replicates). Asterisks indicate significant differences compared with WT (*P < 0.05, **P < 0.01; t-test). D Leaf miner damage of WT and GhPME36-OE cotton leaves in the field. Scale bar, 6 cm

When cultivated in the field, the pest index of the GhPME36-OE lines was significantly (2750%) higher than that of the WT, whereas the GhPME36-KO lines presented distinct resistance (Fig. 3C) according to the indexing grade shown in Additional file 2: Table S1. The mature leaves of GhPME36-OE plants were severely attacked by the leaf miner and withered over time (Fig. 3D). These results showed that GhPME36 distinctly increased the susceptibility of cotton leaves to leaf miners. Additionally, among these transgenic lines, GhPME36-OE line 3 and GhPME36-KO line 3 presented the most striking differences in PME activity and were selected for further research.

Overexpression of GhPME36 decreased pectin methylesterification and epidermal cell wall thickness in cotton leaves

In the GhPME36-OE cotton leaves, the cell walls of both the upper and lower epidermis were thinner than those of the WT plants (Fig. 4A). The most significant changes occurred in 14 D and 28 D leaves. Specifically, the cell wall thickness of the upper epidermis was 11–32% smaller (Fig. 4B), whereas that of the lower epidermis was 13–25% smaller (Fig. 4C) than that of the WT. As for GhPME36-KO cotton leaves, the cell wall thickness of upper epidermis significantly increased by 8.9% compared with that of the WT. However, the lower epidermal cell wall thickness of WT and GhPME36-KO cotton leaves showed no obvious difference (Additional file 1: Fig. S4).Fig. 4 Pectin methylesterification and morphology of epidermal cells in GhPME36-OE line 3 cotton leaves. A TEM observation of longitudinal sections of WT and GhPME36-OE cotton leaves. Scale bar, 5 nm. B, C Thickness of the cell walls of the upper (B) and lower (C) epidermis of WT and GhPME36-OE cotton leaves. The data are presented as the means ± SDs (n = 5 biological replicates). Asterisks indicate significant differences compared with WT (*P < 0.05, **P < 0.01; t-test). D Pectin methylesterification of the leaf epidermis indicated by LM19 and LM20 antibodies in WT and GhPME36-OE cotton leaves. Scale bar, 200 μm

Considering that GhPME36 encodes a pectin methylesterase, the construction of leaf cell pectin might be responsible for the increased susceptibility of the GhPME36-OE cotton plants to leaf miners. Pectin methylesterification was then determined by immunofluorescence using two monoclonal antibodies, namely, LM19 and LM20, which label low-level methylesterified pectin and highly methylesterified pectin, respectively. In the epidermal cells of GhPME36-OE cotton leaves, the amount of highly methylesterified pectin was significantly lower than that in the WT plants. However, there were few differences between them in the amount of pectin methylesterified at a low level (Fig. 4D). Analysis of mesophyll cell morphology distinctly revealed that the palisade tissue of the GhPME36-OE cotton leaves was looser than that of the WT leaves (Fig. 4A), which made it more conducive to leaf miner feeding.

The transcriptomes of cotton leaves from the GhPME36-OE and WT plants were sequenced to explore the underlying mechanism further. The quality control of the sequencing data is shown in Additional file 2: Table S2. In total, 1948 differentially expressed genes (DEGs) were identified, of which 798 DEGs were upregulated and 1150 DEGs were downregulated (Additional file 1: Fig. S5). Among them, multiple genes encoding enzymes associated with cell wall polysaccharide synthesis were identified. For example, six polygalacturonase (PG) genes were upregulated 2- to fourfold, one pectinesterase (PE) gene was upregulated 2.5-fold, and two xylanase (Xyl) genes were upregulated 3.5- and fivefold. Moreover, the expression levels of two PE genes, two β-galactosidase (β-Gal) genes, and five Xyl genes were reduced by at least 53% (Additional file 2: Table S3). These genes have been reported to depolymerize and secrete cell wall polysaccharides to the plant surface in the form of gum during MeJA-induced gummosis in peach [51]. Thus, it was speculated that the alteration of these genes also facilitated the conversion of cell wall polysaccharides to a form more accessible to leaf miners.

Glucose synthesis was affected in GhPME36-OE cotton leaves

To further explore the cell wall components of the GhPME36-OE cotton leaves, the CWM was extracted and evaluated. Compared with that of the WT, the cell wall material (CWM) content was significantly (5–10%) lower in the three GhPME36-OE lines (Additional file 1: Fig. S6A) but 6–13% higher in the three GhPME36-KO lines (Additional file 1: Fig. S6B).

Previous studies have reported that changes in sugar content can effectively affect the feeding behavior of insects [52, 53]. To explore the influence of the sugar content of cotton leaves on their susceptibility to leaf miners, the soluble sugar content was measured during seven developmental stages. The results revealed that the most significant difference between the GhPME36-OE and WT plants occurred in the middle and late stages of leaf development (Additional file 1: Fig. S7). During the late developmental stage, the soluble sugar content in the leaves of the three GhPME36-OE cotton lines was 20–30% higher than that of the WT (Fig. 5A), and that of the three GhPME36-KO cotton lines was 12–20% lower (Fig. 5B).Fig. 5 Differentially accumulated metabolites and DEGs between WT and GhPME36-OE cotton leaves. A, B Soluble sugar content of cotton leaves from three GhPME36-OE lines (A) and three GhPME36-KO lines (B). The data are presented as the means ± SDs (n = 5 biological replicates). Asterisks indicate significant differences compared with WT (*P < 0.05, **P < 0.01; t-test). C Conjoint analysis of metabolites and genes in nine quadrants. Quadrant 1: The tendencies of genes and metabolites are opposite. Quadrant 3: The tendencies of genes and metabolites are consistent. D Correlation network of metabolites and genes. Metabolites are represented by green dots, while genes are represented by red dots. The solid lines indicate positive correlations, whereas the dotted lines indicate negative correlations. PCCs > 0.80, P value < 0.05. E qPCR analysis of DEGs involved in the Ko00010 pathway

Targeted metabolome analysis was conducted to explore the key metabolites among the 13 monosaccharides/disaccharides in the GhPME36-OE cotton leaves. The results revealed higher contents of most commonly detected sugars, especially D-fructose (94%) and glucose (96%) (Additional file 1: Fig. S8). The KEGG annotation and enrichment analyses revealed that the identified metabolites were enriched mainly in glycolysis/gluconeogenesis, the pentose phosphate pathway, and starch and sucrose metabolism (Additional file 1: Fig. S9). The DEGs identified via transcriptome sequencing were enriched mainly in the biosynthesis of secondary metabolites, metabolic pathways, and starch and sucrose metabolism (Additional file 1: Fig. S9). Moreover, conjoint metabolome and transcriptome analysis revealed that 1761 DEGs were related to the identified metabolites. Among them, 715 DEGs were upregulated, and 1046 were downregulated (Fig. 5C). Glucose was determined to be the key differentially accumulated metabolite, given that multiple glucose-related metabolic pathways and 242 DEGs were affected (Fig. 5D).

The KEGG pathway Ko00010 was selected for further research because of its low P value (Additional file 2: Table S4) and its important role in glucose metabolism. Nine of the 13 DEGs enriched in the Ko00010 pathway were selected for further analysis according to their FPKM (fragments per kilobase of transcript per million fragments mapped) values (Additional file 2: Table S5). The FPKM values of four genes was 2- to 3.5-fold higher and those of the other five genes were at least 53% lower than those of the WT (Additional file 2: Table S5). The relative expression levels of these genes were verified via qPCR, and the results were essentially consistent with the transcriptome data (Fig. 5E). Among them, GH_A10G1251 and GH_A06G0364, annotated as pyruvate kinase and alcohol dehydrogenase, respectively, are regarded as two key genes because of their severe down regulation of expression. The significant reduction in their expression levels might have decreased the metabolic rate of phosphorylated pyruvate and acetaldehyde, thereby leading to an excessive accumulation of D-glucose. The results above indicated that the expression of numerous genes was differentially influenced in the leaves of the GhPME36-OE cotton plants, and 242 of these DEGs further affected glucose metabolism through multiple pathways, such as glycolysis and gluconeogenesis, ultimately leading to a significant increase in glucose content. The increase in glucose content might increase the attraction of leaf miners to the leaves and ultimately increase the susceptibility of GhPME36-OE cotton to leaf miners.

Responses of GhPME36-OE to leaf miner attack

When plants are subjected to damage caused by insects, a biotic stress response occurs that includes the initiation of defense signaling pathways and the activation of the expression of related genes. According to the KEGG enrichment of DEGs, 38 DEGs were enriched in the flavonoid and phenylpropanoid biosynthesis pathways. Flavonoid biosynthesis is associated with oxidative stress and mechanical damage [54, 55], whereas phenylpropanoid metabolic biosynthesis plays a coordinated role in plant–environment interactions [56]. A total of 27 out of 38 DEGs were upregulated 2- to sixfold (Additional file 2: Table S6). The relative expression levels of the 12 most abundant DEGs encoding ascorbate-dependent oxidoreductase (ANS), bifunctional dihydroflavonol 4-reductase flavanone (DFR), peroxidase (POD), anthocyanidin reductase (ANR), and 4-coumarate-CoA ligase (4CL3) were determined and found to be consistent with the transcriptome data (Additional file 1: Fig. S10-S11).

The jasmonic acid (JA) signal transduction pathway also plays a role in plant defense signal transduction [57]. Among the 798 upregulated DEGs, two encoding lipoxygenase (LOX) and five encoding jasmonate ZIM-domain (JAZ) proteins were upregulated 2–fivefold in GhPME36-OE cotton leaves (Additional file 2: Table S7). The relative expression levels of the four candidate DEGs were consistent with their FPKM values (Additional file 1: Fig. S12).

GhC/VIF1 interacted with GhPME36

As stated previously, the regulatory interaction between PMEI and PME has been reported in a few plant species. To explore whether GhPME36 functions through interactions with some PMEIs in cotton leaves, all potential PMEIs in cotton leaves were screened, and their evolutionary relationships are displayed in a phylogenetic tree (Additional file 1: Fig. S13). All the GhPMEIs were ranked in descending order according to their expression levels in the leaves, among which five PMEI genes were noted because of their high expression (Additional file 2: Table S8). Considering that both GhPME36 (GH_D11G0862) and GhC/VIF1 (GH_D10G1994) were located in D genome, GhC/VIF1 was further selected as the candidate gene.

The PRO region of type I PMEs, including the PMEI domain, is often considered to inhibit the maturation of PME domains [58, 59]. To avoid this inhibition, GhPME36 without a signal peptide (GhPME36-X1) and without a PRO region (GhPME36-X2) were separately amplified (Fig. 6A). Y2H assays demonstrated that different fragments of the GhPME36 protein could interact with GhC/VIF1 (Fig. 6B). BiFC was carried out for further validation, which revealed that GhPME36 interacted with GhC/VIF1 in the cell wall (Fig. 6C), which was consistent with the subcellular localization of GhPME36. These results suggested that GhPME36 interacted with GhC/VIF1 through the combination of the PMEI and PME domains and that the presence of the PRO region did not affect the interaction between GhPME36 and GhC/VIF1.Fig. 6 Protein interaction between GhPME36 and GhC/VIF1. A Vector construction for the Y2H assay. GhPME36-X1 lacked the signal peptide, whereas GhPME36-X2 lacked the signal peptide and the PMEI domain. B, C Y2H (B) and BiFC (C) assays for GhPME36 and GhC/VIF1. Scale bar, 40 μm

Discussion

PMEs in higher plants are encoded by a polygene family. It has been reported that members of the PME family play a role in various plant tissues and organs, such as the seed coat [36], pollen tube [37], stem [38], and fruit [34]. In this study, a member of the cotton PME family, namely, GhPME36, was identified. According to published transcriptome data [60], GhPME36 is widely expressed in multiple organs/tissues, including roots, stems, leaves and flowers (Additional file 1: Fig. S1A). During fiber development, the high expression of GhPME36 decreased during the late stage (Additional file 1: Fig. S1B), with a significant change in the morphology of the cell wall [61]. The expression patterns of GhPME36 during different leaf developmental stages were analyzed via qPCR. Its expression level decreased during early developmental stages but increased during the late developmental stages (Fig. 1A). In addition, a GUS staining assay revealed that the promoter of GhPME36 was active in root hairs, young stems, leaf veins, calyxes, and both pod ends in Arabidopsis (Fig. 1C). The expression pattern of GhPME36 was consistent with that of other reported PME genes, which are widely expressed during most developmental stages of various organs and tissues.

PME family proteins can be classified as type I and type II. GhPME36 contains both PME and PMEI domains (Fig. 6A) and thus belongs to the type I category. Most reported type I PMEs are located in the cell wall [35, 62]. This study revealed through subcellular localization experiments in tobacco leaves (Additional file 1: Fig. S2) and onion epidermal cells (Fig. 1B) that GhPME36 was also located in the cell wall.

A previous study reported that the interaction between PMEs and PMEIs was strongly affected by pH, and their dissociation constant in acidic solution was 10 times lower than that in neutral solution [44]. Moreover, the process of pectin demethylesterification can affect the environmental pH [63]. Thus, there are several obstacles to directly verifying interactions between PMEs and PMEIs. Researchers have demonstrated their interaction by determining the inhibition efficiency of PMEIs on PMEs [64]. In this study, the interaction between GhPME36 and GhC/VIF1, a PMEI, was verified through Y2H and BiFC assays (Fig. 6B, C). However, whether GhC/VIF1 has inhibitory efficiency on the enzymatic activity of GhPME36 requires chemical evidence to confirm. The PMEI gene family has been explored in a variety of plants and has been found to have approximately the same number of members as the PME gene family [65]. However, the corresponding relationships between PMEs and PMEIs are not "monogamous" as might be expected. Some PMEIs have extensive inhibitory effects on multiple PMEs, even PMEs from different species [66, 67]. Whether GhPME36 has other interacting proteins and whether GhPME36 interacts with other PMEIs require further exploration.

It has been reported that the N-terminal PRO region is an inhibitor of PME activity [58, 59], which prevents premature demethylesterification of pectins before their secretion by binding the PME domain [43]. Though the changes of GhPME36 expression affected PME activity (Fig. 3A, Additional file 1: Fig. S3B), whether GhPME36 had PME enzyme activity would be confirmed by heterologously expressing it in Pichia pastoris or E. coli without its pro region. In this study, Y2H experiments demonstrated that GhPME36 can interact with GhC/VIF1, albeit weakly, regardless of the presence of a PRO region (Fig. 6A, B).

Cell wall softening and hardening are determined by two subsequent fates of demethylated pectin, i.e., crosslinking with divalent cations and degradation [68]. High methylesterification of pectin in Arabidopsis stems causes a reduction in cell wall thickness and overall mechanical strength [38]. Pectin demethylesterification in pollen tubes increases cell wall hardness [69], but several studies have shown that increased PME activity plays a positive role in fruit softening [34].

The content of highly methylesterified pectin decreased significantly, whereas that of pectin methylesterified at low levels did not change substantially in the GhPME36-OE cotton leaves (Fig. 4A). The pectin of Arabidopsis with heterologous expression of PME was found to be more easily degraded by polygalacturonase [41]. We speculated that unplanned demethylesterification initiated pectin degradation, and thus, no additional pectin methylesterified at low levels was detected. Demethylesterification is the first step in the degradation of pectin, and PMEs may act as the “first cause” in the process of pectin degradation. In this study, pectin demethylesterification in the epidermis of leaves by GhPME36 led to softening rather than hardening of the cell wall, in contrast to the findings of previous studies. Thus, pectin demethylesterification has two different effects on the cell wall: hardening during elongation development and softening during expansion development.

PME is related to biotic and abiotic stresses, such as that caused by aphids [15], fungi [64], bacteria [70], nematodes [71, 72], salt [40], and drought [35]. In this study, GhPME36-OE cotton was highly susceptible to leaf miners (Fig. 3C, D), which revealed the relationship between PME and leaf miner resistance in cotton for the first time. To explore the material foundation and molecular mechanism behind this phenomenon, we carried out a series of experiments. The contents of most sugars in the leaves, with the exception of pectin, was higher in the GhPME36-OE cotton leaves (Additional file 1: Fig. S7). Transcriptome analysis revealed that most DEGs affected by GhPME36 were annotated in the biosynthesis of secondary metabolites, metabolic pathways, and starch and sucrose metabolic pathways. These findings are consistent with the metabolome results (Additional file 1: Fig. S8). The Ko00010 metabolic pathway and nine key DEGs in this pathway (Additional file 2: Table S5) were screened based on the P value of the differentially accumulated metabolites. The results of the qPCR verification of these nine genes were consistent with the transcriptome data (Fig. 5E). It has been reported that plant water-soluble substances affect host selection in Liriomyza sativae [73]. Additionally, the stage with obvious differences in sugar content coincided with the leaf miner breakout stage (Fig. 3D, Additional file 1: Fig. S6).

It has been reported that mutations that affect cell wall biosynthesis can cause knock-on effects on carbohydrate metabolism [26]. Taken together, our results revealed that the overexpression of GhPME36 reduced the content of highly methylesterified pectin in cotton leaves (Fig. 4A) and hindered the thickening of cell walls (Fig. 4B–D). These defects may influence multiple pathways, such as starch and sucrose metabolism, glycolysis/gluconeogenesis, and the pentose phosphate pathway, to increase the glucose content (Fig. 5D), ultimately affecting the host selection of Liriomyza sativae. The mechanism by which GhPME36 aggravates the susceptibility of cotton leaves to Liriomyza sativae is shown in Fig. 7. The plant–insect interaction revealed by these findings may also be applicable to phytophagous insects such as aphids and ants, which are sensitive to sugar.Fig. 7 Mechanism by which GhPME36 aggravates the susceptibility of cotton leaves to Liriomyza sativae. The upregulated genes are represented in red, whereas the downregulated genes are represented in blue

Conclusions

In conclusion, by observing the cell wall structure and identifying DEGs and differentially accumulated metabolites in GhPME36-OE cotton leaves, this study comprehensively elucidates the cytological and molecular mechanisms by which GhPME36 exacerbates the susceptibility of cotton leaves to Liriomyza sativae. A new strategy for Liriomyza sativae resistance is proposed to reallocate glucose inside crop leaves. These findings shed considerable light on PME function and provide an environmentally friendly approach for crop genetic improvement.

Methods

Plant materials and growth conditions

The upland cotton cultivars CCRI24 and Jin668 were obtained from the Institute of Cotton Research of the Chinese Academy of Agricultural Sciences (CAAS) and were used as WT. Tobacco (Nicotiana benthamiana) and Arabidopsis Col-0 plants were preserved in our laboratory.

Cotton seeds were sown in the experimental plots on April 23, 2021, and April 20, 2022 (Zhengzhou, China), in a greenhouse at 28 ± 2 °C under an external natural light intensity of 40–60%. Arabidopsis and tobacco were grown in a culture room under continuous light (70 to 80 μmol m−2 s−1) at 28 ± 2 °C and 23 ± 2 °C, respectively. All the plants were grown on a mixture of nutritive soil and vermiculite (2:1).

qPCR analysis

Expression data for GhPME36 in various cotton organs and tissues was retrieved from Gossypium hirsutum cultivar TM-1 transcriptome data [60]. Total RNA was isolated from GhPME36-OE and WT cotton leaves at 7, 14, 21, 28, and 35 days after leaf spreading (D) with TRIzol-A+ Reagent (TaKaRa, Japan) and used to synthesize cDNA with Recombinant NovoScript Plus All-in-one 1st Strand cDNA Synthesis SuperMix (Novoprotein, China). The qPCR experiment was performed with PerfectStart Green qPCR Super Mix (TransGen, China) in an optical 384-well plate using an ABI PRISM 7500 real-time PCR system (Applied Biosystems). A 20-μL reaction consisted of 1 μg of cDNA, 0.2 μM forward and reverse primers, and 10 μL of TransStart Green qRT–PCR Super Mix. Relative expression data were calculated via the Livak method (2−ΔΔCt) [74]. Each result was composed of three biological and three technical replicates. Primers used for qPCR were listed in Additional file 2: Table S9.

Vector construction and plant transformation

The GhPME36 coding sequence (CDS, 1.56 kb) was amplified using KOD OneTM PCR Master Mix (Toyobo, Japan). The amplicon was subsequently cloned and inserted into a pBI121 Plant Expression Vector (Solarbio, China) under the control of the 35S promoter with a ClonExpress Ultra One Step Cloning Kit (Vazyme, China). Two CRISPR target sites (ATGATGTGAGATCATGGTGC; GTGCGGCACGCTCTAGAGCG) were designed according to the mRNA and corresponding genomic DNA sequence information of GhPME36 as well as its homologs. The fragment containing the target sites was amplified and then cloned and inserted into the CRISPR expression vector pCAS9/gRNA3 via the ClonExpress Ultra One Step Cloning Kit.

Constructed vectors 35S:GhPME36:pBI121 and pCAS9/gRNA3 were transformed into cotton plants via Agrobacterium-mediated transformation [75]. Primers used for transgenic cotton identification were listed in Additional file 2: Table S9. Transgenic Arabidopsis was obtained via infection of Arabidopsis Col-0 via the floral dip method [76], followed by screening on MS agar media supplemented with 50 mg/L kanamycin.

GUS staining

The 1500-bp sequence upstream of GhPME36 was amplified from upland cotton genomic DNA to construct a proGhPME36:GUS expression vector, which was transformed into Agrobacterium tumefaciens GV3101 and subsequently used to infect Arabidopsis Col-0 via the floral dip method [76]. Harvested seeds were screened with MS agar media supplemented with 50 mg/L kanamycin until homozygous lines were obtained. Roots, stems, leaves, flowers, and pods were cultured in GUS staining solution containing 1 mM 5-bromo-4-chloro-3-indolyl-glucuronide for 24 h at 37 °C and then decolorized in 70% ethanol for 24–48 h. Images were recorded via a research-grade photographic stereomicroscope (Leica M165C).

Subcellular localization

The pCAMBIA2300-35S-GhPME36-eGFP vector was constructed using the GhPME36 CDS and transferred into tobacco leaves and onion inner epidermis via Agrobacterium tumefaciens GV3101. After 2 days of culture (25 °C, 24 h dark/24 h light), tobacco leaves were treated with 0.4 g/ml sucrose solution for plasmolysis. GFP images were then obtained with a laser scanning confocal microscope (OLYMPUS FV1200).

The onion inner epidermis was spread on MS agar media supplemented with 100 mg/l ampicillin and precultured for 4 h (in the dark at 25 °C). A total of 3 mg of gold powder (Bio-Rad, America) in a 1.5-mL centrifuge tube was sterilized with 75% alcohol for 15 min, washed with ddH2O three times, and resuspended in 50 μL of 50% glycerin. A mixture containing 5 μL of plasmid (1 μg/μL), 50 μL of CaCl2 (2.5 M/L), and 20 μL of spermidine (0.1 M/L) was added to the tubes, which were mixed for 2–3 s after each addition, and the suspension–precipitation method was conducted 10 times to enhance the binding between the plasmid and gold powder. The gold powder with the plasmid was washed, resuspended in ethanol, and then injected into the onion inner epidermis by Gene Gun (PDS-1000). The instrument parameters were as follows: split film, 1350 psi; vacuum degree, 26–28 in Hg; and bombardment distance, 6 cm. After being cultured for 24–48 h (25 °C in the dark), GFP images were obtained with a laser scanning confocal microscope (OLYMPUS FV1200) before and after the onion inner epidermis was treated with 0.3 g/ml sucrose solution for plasmolysis.

PME activity assay

PME activity was determined via Hagerman's method [77] and adjusted accordingly in 40-day-old cotton leaves. One gram of ground fresh cotton leaves was placed into 5 ml of 8.8% NaCl (4 °C), mixed and centrifuged (8000 rpm) for 10 min to collect the supernatant, and the pH was adjusted to 7.5. The reaction system contained 4 ml of 0.5% pectin solution, 0.3 ml of 0.01% bromophenol blue, and 0.3 ml of supernatant. The absorbance value was measured after 2 min. The enzyme activity was represented as ΔA620/min·g.

Pest index statistics

The level of leaf miner damage was examined via a five-point sampling method. The pest index was determined according to the methods of Luo et al. [78], with slight modifications. Three-month-old cotton plants grown in the field were used for investigation. Ten plants were used at each point, and three leaves per plant were sampled. Pest index = 100 × Σ (number of affected leaves × victim grade)/(total number of leaves examined × highest grade of victimization).

Transmission electron microscopy observation

Slices (5 mm × 20 mm) from the middle right side of the leaf vein were collected from cotton leaves at different stages (7, 14, 21 and 28 D) and fixed with a 2.5% glutaraldehyde solution in 0.2 M PBS buffer (pH 7.4) for 1 h under vacuum and for 24 h at room temperature. The sections were washed in 0.2 M PBS buffer (pH 7.4) three times and postfixed with 1% osmium tetroxide for 1 h. After being washed in 0.2 M PBS buffer (pH 7.4) three times, the sections were dehydrated in a gradient of 50–100% acetone and embedded in EPON 812 resin. Ultrathin sections were cut with an ultramicrotome, collected on Formvar-coated copper grids, and stained with 2% uranyl acetate. The samples were observed with an HT7800 transmission electron microscope (HITACHI) at 80 kV and measured with Image-Pro Plus 6.0.

Determination of soluble sugar content

Forty-day-old cotton leaves were used for determination of CWM. The extraction of cotton leaf cell walls was performed according to Jia et al. [18]. The soluble sugar content was determined via a plant soluble sugar assay kit (Solarbio). A total of 0.1 g of leaves at different stages (7, 14, 21, 28, and 35 D) from the transgenic cotton and WT plants were harvested. After being ground in liquid nitrogen, the samples were boiled in a water bath for 10 min with 1 mL of ddH2O and centrifuged at 8000 rpm for 10 min at room temperature after cooling to collect the supernatant as the sample mixture. The experimental system contained 40 μL of sample mixture, 40 μL of ddH2O, 20 μL of 2% anthrone (dissolved in ethyl acetate) and 200 μL of concentrated sulfuric acid. After 10 min in a 95 °C water bath, the absorbance value at 620 nm was measured after cooling. A standard curve was established, and ΔA620 was converted to the soluble sugar content. Each sample was conducted in triplicate.

Immunofluorescence localization

Slices (10 mm × 40 mm) from the middle right side of the leaf vein were collected from mature cotton leaves and fixed with a 4% paraformaldehyde solution in 0.2 M PBS buffer (pH 7.4) for 12–24 h at room temperature. The methods of embedding, sectioning, and immunofluorescence labeling for the samples were previously described by Vitha and Osteryoung [79]. The antibodies LM19 and LM20 (Kerafast, United States) used in this study were diluted 1:50. Images were acquired with a digital slide scanner (Leica SCN400) and analyzed with the Aperio ImageScope software.

Omics analysis

Mature cotton leaves were collected from the GhPME36-OE and WT plants and stored at − 80 °C after they were frozen in liquid nitrogen.

The samples used for transcriptome analysis were ground and used to isolate total RNA. The purity of the RNA was determined via Nanodrop and agarose gel electrophoresis. The constructed library was sequenced on an Illumina HiSeq™ 2000 platform (Berry Genomics, China). The raw reads were filtered via quality control (QC). Clean reads were aligned to the upland cotton reference genome (http://cotton.zju.edu.cn/) via HISAT2 (https://daehwankimlab.github.io/hisat2/). Read counts were recorded with StringTie [80]. The DEGs were identified with the DESeq2 R package [81]. KEGG annotation and enrichment were achieved using Kobas (kobas.cbi.pku.edu.cn) and kofamKOALA (https://www.genome.jp/tools/kofamkoala/).

Samples for targeted metabolome analysis were ground (30 Hz, 1.5 min) to powder after vacuum freeze-drying. A total of 20 mg of powder was added to 500 μL of extraction solution (methanol: isopropanol: water = 3:3:2, V/V/V). The mixture was swirled for 3 min and ultrasonicated in ice water for 30 min. Fifty microliters of the supernatant was removed after centrifugation (4 °C, 14,000 r/min) for 3 min, 20 μL of internal standard solution (1000 μg/mL) was added, and the mixture was concentrated with nitrogen and freeze-dried. Then, 100 μL of ammonium methoxide pyridine (15 mg/mL) was added to the solution and incubated at 37 °C for 2 h. Then, 100 μL of BSTFA was added to the solution and incubated at 37 °C for 30 min to obtain the derivatization solution. The solution was diluted to 1 mL with n-hexane for GC–MS (8890-5977B, Agilent) analysis, and the scanning mode used was selective ion monitoring mode. The content of the substance in the sample was calculated by substituting the integration of the peak areas into the standard curve linear equation.

Protein–protein interactions

To screen potential interacting PMEIs, Gossypium hirsutum protein data [60] were downloaded from the State Key Laboratory of Crop Genetics and Germplasm Enhancement (https://mascotton.njau.edu.cn/info/1054/1118.htm). A hidden Markov model of the conserved PMEI domain (PF04043) was obtained from the Pfam database (http://pfam.xfam.org/). An HMM search in HMMER 3.0 software was used to analyze protein sequences (the e value was set to be less than 1 × 10−10). A total of 260 possible PMEI genes were predicted. Batch CD-Search (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi) was subsequently used to analyze the PMEI domains, and sequences containing incomplete domains were deleted. Smart online analysis software (http://smart.embl-heidelberg.de/) was used to analyze candidate sequences. Protein sequences containing both PME and PMEI domains (type I PMEs) were deleted. Finally, 130 PMEI family proteins were identified.

For yeast two-hybrid assay (Y2H), the protein domains of GhPME36 analyzed via SMART online tools (https://smart.embl.de/), and pGBKT7-GhPME36 and pGADT7-GhC/VIF1 were constructed and cotransformed into the Y2H Gold Yeast strain (Weidi, China). Transformed colonies were first grown on SD/-Leu/-Trp agar media for 2 days and then transferred into SD/-Ade/-His/-Leu/-Trp agar media supplemented with X-α-Gal. After growing for 2 days at 30 °C in the dark, colonies that grew and appeared blue were considered positive.

For bimolecular fluorescence complementation (BiFC), the CDS of GhPME36 was fused to the C-terminus of the pXY104-cYFP vector, while GhC/VIF1 was fused to the N-terminus of the pXY106-nYFP vector. pXY104-GhPME36-cYFP and pXY106-GhC/VIF1-nYFP were separately transformed into Agrobacterium tumefaciens GV3101 (Weidi, China) and expressed in tobacco leaves (25 °C, 4 weeks) via coinjection. After 2 days (25 °C, 24 h dark/24 h light), YFP images were obtained with a laser scanning confocal microscope (OLYMPUS FV1200) with an ultraviolet spectrum excitation of 488 nm.

Statistical analysis

Two-tailed unpaired Student’s t-test was performed for comparing two groups of data. Duncan’s multiple range tests were used for multiple groups of data. The confidence coefficient was set at 0.01 < *P < 0.05, **P < 0.01.

Supplementary Information

Additional file 1. Fig. S1. Expression of GhPME36 in various cotton organs and tissues. Fig. S2. Subcellular localization of GhPME36 in tobacco leaves. Fig. S3. Relative expression of GhPME36 in WT and GhPME36-OE Arabidopsis (A) and cotton (B) plants. Fig. S4. Morphology and cell wall thickness of WT and GhPME36-KO line 3 cotton leaves. Fig. S5. DEGs identified via RNA-seq. Fig. S6. Extraction yield of CWM from the cotton leaves of three GhPME36-OE lines. Fig. S7. Soluble sugar content during different cotton leaf developmental stages. Fig. S8. Contents of monosaccharides and disaccharides in cotton leaves. Fig. S9. KEGG enrichment analysis of differentially accumulated metabolites and DEGs. Fig. S10. qPCR analysis of DEGs involved in flavonoid biosynthesis. Fig. S12. qPCR analysis of DEGs involved in phenylpropanoid biosynthesis. Fig. S12. qPCR analysis of DEGs involved in JA signal transduction. Fig. S13. Evolutionary tree of PMEIs created via the maximum likelihood method.

Additional file 2. Table S1. Indexing grade of cotton leaf damage following leaf miner infestation. Table S2. QC of transcriptome data. Table S3. DEGs encoding enzymes associated with cell wall polysaccharides. Table S4. KEGG enrichment of DEGs and metabolites. Table S5. Correlation between DEGs and metabolites (Ko00010). Table S6. DEGs related to flavonoid and phenylpropanoid biosynthesis. Table S7. Key DEGs related to JA signal transduction. Table S8. FPKM and pI values of five highly expressed GhPMEIs in cotton leaves. Table S9. Primers used in this study. Table S10. The individual data values for Fig. 1A, Fig. 2C-F, Fig. 3A-C, Fig. 4B-C, Fig. 5A, B, E, Fig. S1, Fig. S3A-B, Fig. S6-8, Fig. S10-12.

Abbreviations

PME Pectin methylesterase

HG Homogalacturonan

PMEI Pectin methylesterase inhibitor

MeOH Methanol

DEG Differentially expressed gene

PG Polygalacturonase

PE Pectinesterase

Xyl Xylanase

β-Gal β-galactosidase

FPKM Fragments per kilobase of transcript per million fragments mapped

ANS Ascorbate-dependent oxidoreductase

DFR Dihydroflavonol 4-reductase flavanone

POD Peroxidase

ANR Anthocyanidin reductase

4CL3 4-coumarate-CoA ligase

JA Jasmonic acid

LOX Lipoxygenase

JAZ Jasmonate ZIM-domain

CWM Cell wall material

Acknowledgements

We thank Prof. Zhi Wang (Institute of Cotton Research, Chinese Academy of Agricultural Sciences) for critical reading and editing of the manuscript and constructive suggestions. We are grateful for the computational resources supported by National Supercomputing Center in Zhengzhou and the guidance on sequencing analysis provided by Dr. Xu Gao (National Supercomputing Center, Zhengzhou). We also wish to thank the anonymous peer reviewers for their valuable suggestions to improve the presentation of this research; we appreciate their comments and helpful suggestions.

Authors’ contributions

Z.Y., H.S., Y.Y., and M.W. conceived the project and designed the procedures. W.L., L.W., and S.W. created the transgenic plants. M.W., Z.Y., S.F., D.Z., T.L., J.H., and P.W. performed the experiments and analyzed the data. Z.Y. and M.W. wrote the manuscript. Z.Z., R.W., and M.D. provided technical assistance. All the authors read and approved the final manuscript.

Funding

This work was funded by the Biological Breeding-Major Projects (2023ZD04062), the National Natural Science Foundation of China (32201828), Central Public-interest Scientific Institution Basal Research Fund (1610162023002), the National Agricultural Science and Technology Innovation Project for CAAS (CAAS-ASTIP-2016-ICR), the Science and Technologies R & D Program of Henan Province (232102111077), China Postdoctoral Science Foundation (2022M722899), and the State Key Laboratory of Cotton Biology Open Fund (CB2022A05).

Availability of data and materials

Sequence information for GhPME36 is deposited in the GenBank database under the accession number OP440573. The RNA-seq datasets generated from this study are deposited in the NCBI SRA under the accession number PRJNA884533. The individual data values of all experiments are presented in Additional file 2: Table S10.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Zheng Yang and Menglei Wang contributed equally to this work.
==== Refs
References

1. Xu L Zhu L Tu L Liu L Yuan D Jin L Lignin metabolism has a central role in the resistance of cotton to the wilt fungus Verticillium dahliae as revealed by RNA-Seq-dependent transcriptional analysis and histochemistry J Exp Bot 2011 62 15 5607 5621 10.1093/jxb/err245 21862479
Xu L, Zhu L, Tu L, Liu L, Yuan D, Jin L, et al. Lignin metabolism has a central role in the resistance of cotton to the wilt fungus Verticillium dahliae as revealed by RNA-Seq-dependent transcriptional analysis and histochemistry. J Exp Bot. 2011;62(15):5607–21.21862479 10.1093/jxb/err245
2. Perlak FJ Deaton RW Armstrong TA Fuchs RL Sims SR Greenplate JT Insect resistant cotton plants Biotechnology (N Y) 1990 8 10 939 943 1366777
Perlak FJ, Deaton RW, Armstrong TA, Fuchs RL, Sims SR, Greenplate JT, et al. Insect resistant cotton plants. Biotechnology (N Y). 1990;8(10):939–43.1366777
3. Bragard C Dehnen-Schmutz K Di Serio F Gonthier P Jacques MA Jaques Miret JA Pest categorisation of Liriomyza sativae Efsa j 2020 18 3 e06037 32874253
Bragard C, Dehnen-Schmutz K, Di Serio F, Gonthier P, Jacques MA, Jaques Miret JA, et al. Pest categorisation of Liriomyza sativae. Efsa j. 2020;18(3): e06037.32874253
4. Oliveira JM Araújo JL Melo JWS Dias-Pini NS Melon genotypes with resistance to Liriomyza sativae Blanchard (Diptera: Agromyzidae) An Acad Bras Cienc 2022 94 2 e20191244 10.1590/0001-3765202220191244 35544843
Oliveira JM, Araújo JL, Melo JWS, Dias-Pini NS. Melon genotypes with resistance to Liriomyza sativae Blanchard (Diptera: Agromyzidae). An Acad Bras Cienc. 2022;94(2): e20191244.35544843 10.1590/0001-3765202220191244
5. Nawaz R Abbasi NA Hafiz IA Khan MF Khalid A Environmental variables influence the developmental stages of the citrus leafminer, infestation level and mined leaves physiological response of Kinnow mandarin Sci Rep 2021 11 1 7720 10.1038/s41598-021-87160-8 33833311
Nawaz R, Abbasi NA, Hafiz IA, Khan MF, Khalid A. Environmental variables influence the developmental stages of the citrus leafminer, infestation level and mined leaves physiological response of Kinnow mandarin. Sci Rep. 2021;11(1):7720.33833311 10.1038/s41598-021-87160-8
6. Chang YW Chen JY Zheng SZ Gao Y Chen Y Deng Y Revalidation of morphological characteristics and multiplex PCR for the identification of three congener invasive Liriomyza species (Diptera: Agromyzidae) in China PeerJ 2020 8 e10138 10.7717/peerj.10138 33194390
Chang YW, Chen JY, Zheng SZ, Gao Y, Chen Y, Deng Y, et al. Revalidation of morphological characteristics and multiplex PCR for the identification of three congener invasive Liriomyza species (Diptera: Agromyzidae) in China. PeerJ. 2020;8: e10138.33194390 10.7717/peerj.10138
7. Xu X Coquilleau MP Ridland PM Umina PA Yang Q Hoffmann AA Molecular identification of leafmining flies from Australia including new Liriomyza outbreaks J Econ Entomol 2021 114 5 1983 1990 10.1093/jee/toab143 34279655
Xu X, Coquilleau MP, Ridland PM, Umina PA, Yang Q, Hoffmann AA. Molecular identification of leafmining flies from Australia including new Liriomyza outbreaks. J Econ Entomol. 2021;114(5):1983–90.34279655 10.1093/jee/toab143
8. Yule S Htain NN Oo AK Sotelo-Cardona P Srinivasan R Occurrence of the South American tomato leaf miner, Tuta absoluta (Meyrick) in Southern Shan, Myanmar Insects 2021 12 11 962 10.3390/insects12110962 34821763
Yule S, Htain NN, Oo AK, Sotelo-Cardona P, Srinivasan R. Occurrence of the South American tomato leaf miner, Tuta absoluta (Meyrick) in Southern Shan, Myanmar. Insects. 2021;12(11):962.34821763 10.3390/insects12110962
9. Pirtle EI van Rooyen AR Maino J Weeks AR Umina PA A molecular method for biomonitoring of an exotic plant-pest: leafmining for environmental DNA Mol Ecol 2021 30 19 4913 4925 10.1111/mec.16092 34309946
Pirtle EI, van Rooyen AR, Maino J, Weeks AR, Umina PA. A molecular method for biomonitoring of an exotic plant-pest: leafmining for environmental DNA. Mol Ecol. 2021;30(19):4913–25.34309946 10.1111/mec.16092
10. Dauphin BG Ranocha P Dunand C Burlat V Cell-wall microdomain remodeling controls crucial developmental processes Trends Plant Sci 2022 27 10 1033 1048 10.1016/j.tplants.2022.05.010 35710764
Dauphin BG, Ranocha P, Dunand C, Burlat V. Cell-wall microdomain remodeling controls crucial developmental processes. Trends Plant Sci. 2022;27(10):1033–48.35710764 10.1016/j.tplants.2022.05.010
11. Chebli Y Geitmann A Cellular growth in plants requires regulation of cell wall biochemistry Curr Opin Cell Biol 2017 44 28 35 10.1016/j.ceb.2017.01.002 28131101
Chebli Y, Geitmann A. Cellular growth in plants requires regulation of cell wall biochemistry. Curr Opin Cell Biol. 2017;44:28–35.28131101 10.1016/j.ceb.2017.01.002
12. Swaminathan S Lionetti V Zabotina OA Plant cell wall integrity perturbations and priming for defense Plants (Basel) 2022 11 24 3539 36559656
Swaminathan S, Lionetti V, Zabotina OA. Plant cell wall integrity perturbations and priming for defense. Plants (Basel). 2022;11(24):3539.36559656
13. Bellincampi D Cervone F Lionetti V Plant cell wall dynamics and wall-related susceptibility in plant-pathogen interactions Front Plant Sci 2014 5 228 10.3389/fpls.2014.00228 24904623
Bellincampi D, Cervone F, Lionetti V. Plant cell wall dynamics and wall-related susceptibility in plant-pathogen interactions. Front Plant Sci. 2014;5:228.24904623 10.3389/fpls.2014.00228
14. Vicré M, Lionetti V. Editorial: Plant cell wall in pathogenesis, parasitism and symbiosis, Volume II. Front Plant Sci. 2023;14:1230438.
15. Silva-Sanzana C Celiz-Balboa J Garzo E Marcus SE Parra-Rojas JP Rojas B Pectin methylesterases modulate plant homogalacturonan status in defenses against the aphid Myzus persicae Plant Cell 2019 31 8 1913 1929 10.1105/tpc.19.00136 31126981
Silva-Sanzana C, Celiz-Balboa J, Garzo E, Marcus SE, Parra-Rojas JP, Rojas B, et al. Pectin methylesterases modulate plant homogalacturonan status in defenses against the aphid Myzus persicae. Plant Cell. 2019;31(8):1913–29.31126981 10.1105/tpc.19.00136
16. Gesteiro N Butrón A Estévez S Santiago R Unraveling the role of maize (Zea mays L.) cell-wall phenylpropanoids in stem-borer resistance Phytochemistry. 2021 185 112683 10.1016/j.phytochem.2021.112683 33582589
Gesteiro N, Butrón A, Estévez S, Santiago R. Unraveling the role of maize (Zea mays L.) cell-wall phenylpropanoids in stem-borer resistance. Phytochemistry. 2021;185:112683.33582589 10.1016/j.phytochem.2021.112683
17. Wu HC Huang YC Stracovsky L Jinn TL Pectin methylesterase is required for guard cell function in response to heat Plant Signal Behav 2017 12 6 e1338227 10.1080/15592324.2017.1338227 28617153
Wu HC, Huang YC, Stracovsky L, Jinn TL. Pectin methylesterase is required for guard cell function in response to heat. Plant Signal Behav. 2017;12(6): e1338227.28617153 10.1080/15592324.2017.1338227
18. Jia H Wang X Wei T Wang M Liu X Hua L Exogenous salicylic acid regulates cell wall polysaccharides synthesis and pectin methylation to reduce Cd accumulation of tomato Ecotoxicol Environ Saf 2021 207 111550 10.1016/j.ecoenv.2020.111550 33254408
Jia H, Wang X, Wei T, Wang M, Liu X, Hua L, et al. Exogenous salicylic acid regulates cell wall polysaccharides synthesis and pectin methylation to reduce Cd accumulation of tomato. Ecotoxicol Environ Saf. 2021;207: 111550.33254408 10.1016/j.ecoenv.2020.111550
19. Somerville C Bauer S Brininstool G Facette M Hamann T Milne J Toward a systems approach to understanding plant cell walls Science 2004 306 5705 2206 2211 10.1126/science.1102765 15618507
Somerville C, Bauer S, Brininstool G, Facette M, Hamann T, Milne J, et al. Toward a systems approach to understanding plant cell walls. Science. 2004;306(5705):2206–11.15618507 10.1126/science.1102765
20. Daher FB Braybrook SA How to let go: pectin and plant cell adhesion Front Plant Sci 2015 6 523 10.3389/fpls.2015.00523 26236321
Daher FB, Braybrook SA. How to let go: pectin and plant cell adhesion. Front Plant Sci. 2015;6:523.26236321 10.3389/fpls.2015.00523
21. Lionetti V Fabri E De Caroli M Hansen AR Willats WG Piro G Three pectin methylesterase inhibitors protect cell wall integrity for Arabidopsis immunity to Botrytis Plant Physiol 2017 173 3 1844 1863 10.1104/pp.16.01185 28082716
Lionetti V, Fabri E, De Caroli M, Hansen AR, Willats WG, Piro G, et al. Three pectin methylesterase inhibitors protect cell wall integrity for Arabidopsis immunity to Botrytis. Plant Physiol. 2017;173(3):1844–63.28082716 10.1104/pp.16.01185
22. Mohnen D Pectin structure and biosynthesis Curr Opin Plant Biol 2008 11 3 266 277 10.1016/j.pbi.2008.03.006 18486536
Mohnen D. Pectin structure and biosynthesis. Curr Opin Plant Biol. 2008;11(3):266–77.18486536 10.1016/j.pbi.2008.03.006
23. Anderson CT We be jammin': an update on pectin biosynthesis, trafficking and dynamics J Exp Bot 2016 67 2 495 502 10.1093/jxb/erv501 26590862
Anderson CT. We be jammin’: an update on pectin biosynthesis, trafficking and dynamics. J Exp Bot. 2016;67(2):495–502.26590862 10.1093/jxb/erv501
24. Wang T Hong M Solid-state NMR investigations of cellulose structure and interactions with matrix polysaccharides in plant primary cell walls J Exp Bot 2016 67 2 503 514 10.1093/jxb/erv416 26355148
Wang T, Hong M. Solid-state NMR investigations of cellulose structure and interactions with matrix polysaccharides in plant primary cell walls. J Exp Bot. 2016;67(2):503–14.26355148 10.1093/jxb/erv416
25. Micheli F Pectin methylesterases: cell wall enzymes with important roles in plant physiology Trends Plant Sci 2001 6 9 414 419 10.1016/S1360-1385(01)02045-3 11544130
Micheli F. Pectin methylesterases: cell wall enzymes with important roles in plant physiology. Trends Plant Sci. 2001;6(9):414–9.11544130 10.1016/S1360-1385(01)02045-3
26. Verbančič J Lunn JE Stitt M Persson S Carbon supply and the regulation of cell wall synthesis Mol Plant 2018 11 1 75 94 10.1016/j.molp.2017.10.004 29054565
Verbančič J, Lunn JE, Stitt M, Persson S. Carbon supply and the regulation of cell wall synthesis. Mol Plant. 2018;11(1):75–94.29054565 10.1016/j.molp.2017.10.004
27. Wang X Wilson L Cosgrove DJ Pectin methylesterase selectively softens the onion epidermal wall yet reduces acid-induced creep J Exp Bot 2020 71 9 2629 2640 10.1093/jxb/eraa059 32006044
Wang X, Wilson L, Cosgrove DJ. Pectin methylesterase selectively softens the onion epidermal wall yet reduces acid-induced creep. J Exp Bot. 2020;71(9):2629–40.32006044 10.1093/jxb/eraa059
28. Soujanya PL Sekhar JC Ratnavathi CV Karjagi CG Shobha E Suby SB Induction of cell wall phenolic monomers as part of direct defense response in maize to pink stem borer (Sesamia inferens Walker) and non-insect interactions Sci Rep 2021 11 1 14770 10.1038/s41598-021-93727-2 34285266
Soujanya PL, Sekhar JC, Ratnavathi CV, Karjagi CG, Shobha E, Suby SB, et al. Induction of cell wall phenolic monomers as part of direct defense response in maize to pink stem borer (Sesamia inferens Walker) and non-insect interactions. Sci Rep. 2021;11(1):14770.34285266 10.1038/s41598-021-93727-2
29. Chebli Y Kaneda M Zerzour R Geitmann A The cell wall of the Arabidopsis pollen tube–spatial distribution, recycling, and network formation of polysaccharides Plant Physiol 2012 160 4 1940 1955 10.1104/pp.112.199729 23037507
Chebli Y, Kaneda M, Zerzour R, Geitmann A. The cell wall of the Arabidopsis pollen tube–spatial distribution, recycling, and network formation of polysaccharides. Plant Physiol. 2012;160(4):1940–55.23037507 10.1104/pp.112.199729
30. Bonnin E Alvarado C Crépeau MJ Bouchet B Garnier C Jamme F Mobility of pectin methylesterase in pectin/cellulose gels is enhanced by the presence of cellulose and by its catalytic capacity Sci Rep 2019 9 1 12551 10.1038/s41598-019-49108-x 31467440
Bonnin E, Alvarado C, Crépeau MJ, Bouchet B, Garnier C, Jamme F, et al. Mobility of pectin methylesterase in pectin/cellulose gels is enhanced by the presence of cellulose and by its catalytic capacity. Sci Rep. 2019;9(1):12551.31467440 10.1038/s41598-019-49108-x
31. Huang D Mao Y Guo G Ni D Chen L Genome-wide identification of PME gene family and expression of candidate genes associated with aluminum tolerance in tea plant (Camellia sinensis) BMC Plant Biol 2022 22 1 306 10.1186/s12870-022-03686-7 35751024
Huang D, Mao Y, Guo G, Ni D, Chen L. Genome-wide identification of PME gene family and expression of candidate genes associated with aluminum tolerance in tea plant (Camellia sinensis). BMC Plant Biol. 2022;22(1):306.35751024 10.1186/s12870-022-03686-7
32. Li Z Wu L Wang C Wang Y He L Wang Z Characterization of pectin methylesterase gene family and its possible role in juice sac granulation in navel orange (Citrus sinensis Osbeck) BMC Genomics 2022 23 1 185 10.1186/s12864-022-08411-0 35249536
Li Z, Wu L, Wang C, Wang Y, He L, Wang Z, et al. Characterization of pectin methylesterase gene family and its possible role in juice sac granulation in navel orange (Citrus sinensis Osbeck). BMC Genomics. 2022;23(1):185.35249536 10.1186/s12864-022-08411-0
33. Li W Shang H Ge Q Zou C Cai J Wang D Genome-wide identification, phylogeny, and expression analysis of pectin methylesterases reveal their major role in cotton fiber development BMC Genomics 2016 17 1 1000 10.1186/s12864-016-3365-z 27927181
Li W, Shang H, Ge Q, Zou C, Cai J, Wang D, et al. Genome-wide identification, phylogeny, and expression analysis of pectin methylesterases reveal their major role in cotton fiber development. BMC Genomics. 2016;17(1):1000.27927181 10.1186/s12864-016-3365-z
34. Cai J Mo X Wen C Gao Z Chen X Xue C FvMYB79 positively regulates strawberry fruit softening via transcriptional activation of FvPME38 Int J Mol Sci 2021 23 1 101 10.3390/ijms23010101 35008526
Cai J, Mo X, Wen C, Gao Z, Chen X, Xue C. FvMYB79 positively regulates strawberry fruit softening via transcriptional activation of FvPME38. Int J Mol Sci. 2021;23(1):101.35008526 10.3390/ijms23010101
35. Yang W Ruan M Xiang M Deng A Du J Xiao C Overexpression of a pectin methylesterase gene PtoPME35 from Populus tomentosa influences stomatal function and drought tolerance in Arabidopsis thaliana Biochem Biophys Res Commun 2020 523 2 416 422 10.1016/j.bbrc.2019.12.073 31870548
Yang W, Ruan M, Xiang M, Deng A, Du J, Xiao C. Overexpression of a pectin methylesterase gene PtoPME35 from Populus tomentosa influences stomatal function and drought tolerance in Arabidopsis thaliana. Biochem Biophys Res Commun. 2020;523(2):416–22.31870548 10.1016/j.bbrc.2019.12.073
36. Levesque-Tremblay G Müller K Mansfield SD Haughn GW HIGHLY METHYL ESTERIFIED SEEDS is a pectin methyl esterase involved in embryo development Plant Physiol 2015 167 3 725 737 10.1104/pp.114.255604 25572606
Levesque-Tremblay G, Müller K, Mansfield SD, Haughn GW. HIGHLY METHYL ESTERIFIED SEEDS is a pectin methyl esterase involved in embryo development. Plant Physiol. 2015;167(3):725–37.25572606 10.1104/pp.114.255604
37. Yue X Lin S Yu Y Huang L Cao J The putative pectin methylesterase gene, BcMF23a, is required for microspore development and pollen tube growth in Brassica campestris Plant Cell Rep 2018 37 7 1003 1009 10.1007/s00299-018-2285-6 29644403
Yue X, Lin S, Yu Y, Huang L, Cao J. The putative pectin methylesterase gene, BcMF23a, is required for microspore development and pollen tube growth in Brassica campestris. Plant Cell Rep. 2018;37(7):1003–9.29644403 10.1007/s00299-018-2285-6
38. Hongo S Sato K Yokoyama R Nishitani K Demethylesterification of the primary wall by PECTIN METHYLESTERASE35 provides mechanical support to the Arabidopsis stem Plant Cell 2012 24 6 2624 2634 10.1105/tpc.112.099325 22693281
Hongo S, Sato K, Yokoyama R, Nishitani K. Demethylesterification of the primary wall by PECTIN METHYLESTERASE35 provides mechanical support to the Arabidopsis stem. Plant Cell. 2012;24(6):2624–34.22693281 10.1105/tpc.112.099325
39. Guénin S Mareck A Rayon C Lamour R Assoumou Ndong Y Domon JM Identification of pectin methylesterase 3 as a basic pectin methylesterase isoform involved in adventitious rooting in Arabidopsis thaliana New Phytol 2011 192 1 114 126 10.1111/j.1469-8137.2011.03797.x 21692803
Guénin S, Mareck A, Rayon C, Lamour R, Assoumou Ndong Y, Domon JM, et al. Identification of pectin methylesterase 3 as a basic pectin methylesterase isoform involved in adventitious rooting in Arabidopsis thaliana. New Phytol. 2011;192(1):114–26.21692803 10.1111/j.1469-8137.2011.03797.x
40. Yan J He H Fang L Zhang A Pectin methylesterase31 positively regulates salt stress tolerance in Arabidopsis Biochem Biophys Res Commun 2018 496 2 497 501 10.1016/j.bbrc.2018.01.025 29307824
Yan J, He H, Fang L, Zhang A. Pectin methylesterase31 positively regulates salt stress tolerance in Arabidopsis. Biochem Biophys Res Commun. 2018;496(2):497–501.29307824 10.1016/j.bbrc.2018.01.025
41. Reem NT Chambers L Zhang N Abdullah SF Chen Y Feng G Post-synthetic reduction of pectin methylesterification causes morphological abnormalities and alterations to stress response in Arabidopsis thaliana Plants (Basel) 2020 9 11 1558 33198397
Reem NT, Chambers L, Zhang N, Abdullah SF, Chen Y, Feng G, et al. Post-synthetic reduction of pectin methylesterification causes morphological abnormalities and alterations to stress response in Arabidopsis thaliana. Plants (Basel). 2020;9(11):1558.33198397
42. Roig-Oliver M Rayon C Roulard R Fourne F Bota J Flexa J Reduced photosynthesis in Arabidopsis thaliana atpme17.2 and atpae11.1 mutants is associated to altered cell wall composition Physiol Plant. 2021 172 3 1439 51 10.1111/ppl.13186 32770751
Roig-Oliver M, Rayon C, Roulard R, Fourne F, Bota J, Flexa J. Reduced photosynthesis in Arabidopsis thaliana atpme17.2 and atpae11.1 mutants is associated to altered cell wall composition. Physiol Plant. 2021;172(3):1439–51.32770751 10.1111/ppl.13186
43. Coculo D Lionetti V The plant invertase/pectin methylesterase inhibitor superfamily Front Plant Sci 2022 13 863892 10.3389/fpls.2022.863892 35401607
Coculo D, Lionetti V. The plant invertase/pectin methylesterase inhibitor superfamily. Front Plant Sci. 2022;13: 863892.35401607 10.3389/fpls.2022.863892
44. Di Matteo A Giovane A Raiola A Camardella L Bonivento D De Lorenzo G Structural basis for the interaction between pectin methylesterase and a specific inhibitor protein Plant Cell 2005 17 3 849 858 10.1105/tpc.104.028886 15722470
Di Matteo A, Giovane A, Raiola A, Camardella L, Bonivento D, De Lorenzo G, et al. Structural basis for the interaction between pectin methylesterase and a specific inhibitor protein. Plant Cell. 2005;17(3):849–58.15722470 10.1105/tpc.104.028886
45. Wormit A Usadel B The multifaceted role of pectin methylesterase inhibitors (PMEIs) Int J Mol Sci 2018 19 10 2878 10.3390/ijms19102878 30248977
Wormit A, Usadel B. The multifaceted role of pectin methylesterase inhibitors (PMEIs). Int J Mol Sci. 2018;19(10):2878.30248977 10.3390/ijms19102878
46. Lionetti V Cervone F Bellincampi D Methyl esterification of pectin plays a role during plant-pathogen interactions and affects plant resistance to diseases J Plant Physiol 2012 169 16 1623 1630 10.1016/j.jplph.2012.05.006 22717136
Lionetti V, Cervone F, Bellincampi D. Methyl esterification of pectin plays a role during plant-pathogen interactions and affects plant resistance to diseases. J Plant Physiol. 2012;169(16):1623–30.22717136 10.1016/j.jplph.2012.05.006
47. Coculo D Del Corpo D Martínez MO Vera P Piro G De Caroli M Arabidopsis subtilases promote defense-related pectin methylesterase activity and robust immune responses to botrytis infection Plant Physiol Biochem 2023 201 107865 10.1016/j.plaphy.2023.107865 37467533
Coculo D, Del Corpo D, Martínez MO, Vera P, Piro G, De Caroli M, et al. Arabidopsis subtilases promote defense-related pectin methylesterase activity and robust immune responses to botrytis infection. Plant Physiol Biochem. 2023;201: 107865.37467533 10.1016/j.plaphy.2023.107865
48. Lionetti V Raiola A Camardella L Giovane A Obel N Pauly M Overexpression of pectin methylesterase inhibitors in Arabidopsis restricts fungal infection by Botrytis cinerea Plant Physiol 2007 143 4 1871 1880 10.1104/pp.106.090803 17277091
Lionetti V, Raiola A, Camardella L, Giovane A, Obel N, Pauly M, et al. Overexpression of pectin methylesterase inhibitors in Arabidopsis restricts fungal infection by Botrytis cinerea. Plant Physiol. 2007;143(4):1871–80.17277091 10.1104/pp.106.090803
49. Osorio S Castillejo C Quesada MA Medina-Escobar N Brownsey GJ Suau R Partial demethylation of oligogalacturonides by pectin methyl esterase 1 is required for eliciting defence responses in wild strawberry (Fragaria vesca) Plant J 2008 54 1 43 55 10.1111/j.1365-313X.2007.03398.x 18088306
Osorio S, Castillejo C, Quesada MA, Medina-Escobar N, Brownsey GJ, Suau R, et al. Partial demethylation of oligogalacturonides by pectin methyl esterase 1 is required for eliciting defence responses in wild strawberry (Fragaria vesca). Plant J. 2008;54(1):43–55.18088306 10.1111/j.1365-313X.2007.03398.x
50. Komarova TV Sheshukova EV Dorokhov YL Cell wall methanol as a signal in plant immunity Front Plant Sci 2014 5 101 10.3389/fpls.2014.00101 24672536
Komarova TV, Sheshukova EV, Dorokhov YL. Cell wall methanol as a signal in plant immunity. Front Plant Sci. 2014;5:101.24672536 10.3389/fpls.2014.00101
51. Li M Liu M Peng F Fang L Influence factors and gene expression patterns during MeJa-induced gummosis in peach J Plant Physiol 2015 182 49 61 10.1016/j.jplph.2015.03.019 26056992
Li M, Liu M, Peng F, Fang L. Influence factors and gene expression patterns during MeJa-induced gummosis in peach. J Plant Physiol. 2015;182:49–61.26056992 10.1016/j.jplph.2015.03.019
52. Madsen NEL Sørensen PB Offenberg J Sugar and amino acid preference in the black garden ant Lasius niger (L.) J Insect Physiol. 2017 100 140 5 10.1016/j.jinsphys.2017.05.011 28576457
Madsen NEL, Sørensen PB, Offenberg J. Sugar and amino acid preference in the black garden ant Lasius niger (L.). J Insect Physiol. 2017;100:140–5.28576457 10.1016/j.jinsphys.2017.05.011
53. Broadhead GT, Raguso RA. Associative learning of non-sugar nectar components: amino acids modify nectar preference in a hawkmoth. J Exp Biol. 2021;224(12):jeb234633.
54. Koes R Verweij W Quattrocchio F Flavonoids: a colorful model for the regulation and evolution of biochemical pathways Trends Plant Sci 2005 10 5 236 242 10.1016/j.tplants.2005.03.002 15882656
Koes R, Verweij W, Quattrocchio F. Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 2005;10(5):236–42.15882656 10.1016/j.tplants.2005.03.002
55. Shen Y Sun T Pan Q Anupol N Chen H Shi J RrMYB5- and RrMYB10-regulated flavonoid biosynthesis plays a pivotal role in feedback loop responding to wounding and oxidation in Rosa rugosa Plant Biotechnol J 2019 17 11 2078 2095 10.1111/pbi.13123 30951245
Shen Y, Sun T, Pan Q, Anupol N, Chen H, Shi J, et al. RrMYB5- and RrMYB10-regulated flavonoid biosynthesis plays a pivotal role in feedback loop responding to wounding and oxidation in Rosa rugosa. Plant Biotechnol J. 2019;17(11):2078–95.30951245 10.1111/pbi.13123
56. Dong NQ Lin HX Contribution of phenylpropanoid metabolism to plant development and plant-environment interactions J Integr Plant Biol 2021 63 1 180 209 10.1111/jipb.13054 33325112
Dong NQ, Lin HX. Contribution of phenylpropanoid metabolism to plant development and plant-environment interactions. J Integr Plant Biol. 2021;63(1):180–209.33325112 10.1111/jipb.13054
57. Ruan J Zhou Y Zhou M Yan J Khurshid M Weng W Jasmonic acid signaling pathway in plants Int J Mol Sci 2019 20 10 2479 10.3390/ijms20102479 31137463
Ruan J, Zhou Y, Zhou M, Yan J, Khurshid M, Weng W, et al. Jasmonic acid signaling pathway in plants. Int J Mol Sci. 2019;20(10):2479.31137463 10.3390/ijms20102479
58. Del Corpo D Fullone MR Miele R Lafond M Pontiggia D Grisel S AtPME17 is a functional Arabidopsis thaliana pectin methylesterase regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea Mol Plant Pathol 2020 21 12 1620 1633 10.1111/mpp.13002 33029918
Del Corpo D, Fullone MR, Miele R, Lafond M, Pontiggia D, Grisel S, et al. AtPME17 is a functional Arabidopsis thaliana pectin methylesterase regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. Mol Plant Pathol. 2020;21(12):1620–33.33029918 10.1111/mpp.13002
59. Del Corpo D Coculo D Greco M De Lorenzo G Lionetti V Pull the fuzes: Processing protein precursors to generate apoplastic danger signals for triggering plant immunity Plant Commun 2024 5 8 100931 10.1016/j.xplc.2024.100931 38689495
Del Corpo D, Coculo D, Greco M, De Lorenzo G, Lionetti V. Pull the fuzes: Processing protein precursors to generate apoplastic danger signals for triggering plant immunity. Plant Commun. 2024;5(8): 100931.38689495 10.1016/j.xplc.2024.100931
60. Zhang T Hu Y Jiang W Fang L Guan X Chen J Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement Nat Biotechnol. 2015 33 5 531 7 10.1038/nbt.3207 25893781
Zhang T, Hu Y, Jiang W, Fang L, Guan X, Chen J, et al. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement. Nat Biotechnol. 2015;33(5):531–7.25893781 10.1038/nbt.3207
61. Wilkins TA Arpat AB The cotton fiber transcriptome Physiol Plant 2005 124 3 295 300 10.1111/j.1399-3054.2005.00514.x
Wilkins TA, Arpat AB. The cotton fiber transcriptome. Physiol Plant. 2005;124(3):295–300.10.1111/j.1399-3054.2005.00514.x
62. Huang YC Wu HC Wang YD Liu CH Lin CC Luo DL PECTIN METHYLESTERASE34 contributes to heat tolerance through its role in promoting stomatal movement Plant Physiol 2017 174 2 748 763 10.1104/pp.17.00335 28381503
Huang YC, Wu HC, Wang YD, Liu CH, Lin CC, Luo DL, et al. PECTIN METHYLESTERASE34 contributes to heat tolerance through its role in promoting stomatal movement. Plant Physiol. 2017;174(2):748–63.28381503 10.1104/pp.17.00335
63. Wen F Zhu Y Hawes MC Effect of pectin methylesterase gene expression on pea root development Plant Cell 1999 11 6 1129 1140 10.1105/tpc.11.6.1129 10368183
Wen F, Zhu Y, Hawes MC. Effect of pectin methylesterase gene expression on pea root development. Plant Cell. 1999;11(6):1129–40.10368183 10.1105/tpc.11.6.1129
64. Liu N Sun Y Pei Y Zhang X Wang P Li X A pectin methylesterase inhibitor enhances resistance to Verticillium wilt Plant Physiol 2018 176 3 2202 2220 10.1104/pp.17.01399 29363564
Liu N, Sun Y, Pei Y, Zhang X, Wang P, Li X, et al. A pectin methylesterase inhibitor enhances resistance to Verticillium wilt. Plant Physiol. 2018;176(3):2202–20.29363564 10.1104/pp.17.01399
65. Wang M Yuan D Gao W Li Y Tan J Zhang X A comparative genome analysis of PME and PMEI families reveals the evolution of pectin metabolism in plant cell walls PLoS ONE 2013 8 8 e72082 10.1371/journal.pone.0072082 23951288
Wang M, Yuan D, Gao W, Li Y, Tan J, Zhang X. A comparative genome analysis of PME and PMEI families reveals the evolution of pectin metabolism in plant cell walls. PLoS ONE. 2013;8(8): e72082.23951288 10.1371/journal.pone.0072082
66. Hothorn M Wolf S Aloy P Greiner S Scheffzek K Structural insights into the target specificity of plant invertase and pectin methylesterase inhibitory proteins Plant Cell 2004 16 12 3437 3447 10.1105/tpc.104.025684 15528298
Hothorn M, Wolf S, Aloy P, Greiner S, Scheffzek K. Structural insights into the target specificity of plant invertase and pectin methylesterase inhibitory proteins. Plant Cell. 2004;16(12):3437–47.15528298 10.1105/tpc.104.025684
67. An SH Sohn KH Choi HW Hwang IS Lee SC Hwang BK Pepper pectin methylesterase inhibitor protein CaPMEI1 is required for antifungal activity, basal disease resistance and abiotic stress tolerance Planta 2008 228 1 61 78 10.1007/s00425-008-0719-z 18327607
An SH, Sohn KH, Choi HW, Hwang IS, Lee SC, Hwang BK. Pepper pectin methylesterase inhibitor protein CaPMEI1 is required for antifungal activity, basal disease resistance and abiotic stress tolerance. Planta. 2008;228(1):61–78.18327607 10.1007/s00425-008-0719-z
68. Vincent RR Williams MA Microrheological investigations give insights into the microstructure and functionality of pectin gels Carbohydr Res 2009 344 14 1863 1871 10.1016/j.carres.2008.11.021 19138770
Vincent RR, Williams MA. Microrheological investigations give insights into the microstructure and functionality of pectin gels. Carbohydr Res. 2009;344(14):1863–71.19138770 10.1016/j.carres.2008.11.021
69. Parre E Geitmann A Pectin and the role of the physical properties of the cell wall in pollen tube growth of Solanum chacoense Planta 2005 220 4 582 592 10.1007/s00425-004-1368-5 15449057
Parre E, Geitmann A. Pectin and the role of the physical properties of the cell wall in pollen tube growth of Solanum chacoense. Planta. 2005;220(4):582–92.15449057 10.1007/s00425-004-1368-5
70. Bethke G Grundman RE Sreekanta S Truman W Katagiri F Glazebrook J Arabidopsis PECTIN METHYLESTERASEs contribute to immunity against Pseudomonas syringae Plant Physiol 2014 164 2 1093 1107 10.1104/pp.113.227637 24367018
Bethke G, Grundman RE, Sreekanta S, Truman W, Katagiri F, Glazebrook J. Arabidopsis PECTIN METHYLESTERASEs contribute to immunity against Pseudomonas syringae. Plant Physiol. 2014;164(2):1093–107.24367018 10.1104/pp.113.227637
71. Hewezi T Howe P Maier TR Hussey RS Mitchum MG Davis EL Cellulose binding protein from the parasitic nematode Heterodera schachtii interacts with Arabidopsis pectin methylesterase: cooperative cell wall modification during parasitism Plant Cell 2008 20 11 3080 3093 10.1105/tpc.108.063065 19001564
Hewezi T, Howe P, Maier TR, Hussey RS, Mitchum MG, Davis EL, et al. Cellulose binding protein from the parasitic nematode Heterodera schachtii interacts with Arabidopsis pectin methylesterase: cooperative cell wall modification during parasitism. Plant Cell. 2008;20(11):3080–93.19001564 10.1105/tpc.108.063065
72. Raiola A Lionetti V Elmaghraby I Immerzeel P Mellerowicz EJ Salvi G Pectin methylesterase is induced in Arabidopsis upon infection and is necessary for a successful colonization by necrotrophic pathogens Mol Plant Microbe Interact 2011 24 4 432 440 10.1094/MPMI-07-10-0157 21171891
Raiola A, Lionetti V, Elmaghraby I, Immerzeel P, Mellerowicz EJ, Salvi G, et al. Pectin methylesterase is induced in Arabidopsis upon infection and is necessary for a successful colonization by necrotrophic pathogens. Mol Plant Microbe Interact. 2011;24(4):432–40.21171891 10.1094/MPMI-07-10-0157
73. Dai X You M Fu L The influences of water-soluble substances from other plants on the host-selection of Liriomyza sativae Journal of Fujian Agricultural University 2001 30 4 490 492
Dai X, You M, Fu L. The influences of water-soluble substances from other plants on the host-selection of Liriomyza sativae. Journal of Fujian Agricultural University. 2001;30(4):490–2.
74. Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 2001 25 4 402 408 10.1006/meth.2001.1262 11846609
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.11846609 10.1006/meth.2001.1262
75. Zhang B Agrobacterium-mediated genetic transformation of cotton Methods Mol Biol 2019 1902 19 33 10.1007/978-1-4939-8952-2_2 30543058
Zhang B. Agrobacterium-mediated genetic transformation of cotton. Methods Mol Biol. 2019;1902:19–33.30543058 10.1007/978-1-4939-8952-2_2
76. Clough SJ Bent AF Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana Plant J 1998 16 6 735 743 10.1046/j.1365-313x.1998.00343.x 10069079
Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16(6):735–43.10069079 10.1046/j.1365-313x.1998.00343.x
77. Hagerman AE Austin PJ Continuous spectrophotometric assay for plant pectin methyl esterase J Agric Food Chem 1986 34 3 440 444 10.1021/jf00069a015
Hagerman AE, Austin PJ. Continuous spectrophotometric assay for plant pectin methyl esterase. J Agric Food Chem. 1986;34(3):440–4.10.1021/jf00069a015
78. Luo Z-M Wang X-Y Huang Y-K Zhang R-Y Li W-F Shan H-L Field resistance of different sugarcane varieties to sugarcane thrips (Fulmekiola serratus) in China Sugar Tech 2019 21 3 527 531 10.1007/s12355-018-0653-8
Luo Z-M, Wang X-Y, Huang Y-K, Zhang R-Y, Li W-F, Shan H-L, et al. Field resistance of different sugarcane varieties to sugarcane thrips (Fulmekiola serratus) in China. Sugar Tech. 2019;21(3):527–31.10.1007/s12355-018-0653-8
79. Vitha S Osteryoung KW Immunofluorescence microscopy for localization of Arabidopsis chloroplast proteins Methods Mol Biol 2011 774 33 58 10.1007/978-1-61779-234-2_3 21822831
Vitha S, Osteryoung KW. Immunofluorescence microscopy for localization of Arabidopsis chloroplast proteins. Methods Mol Biol. 2011;774:33–58.21822831 10.1007/978-1-61779-234-2_3
80. Pertea M Pertea GM Antonescu CM Chang TC Mendell JT Salzberg SL StringTie enables improved reconstruction of a transcriptome from RNA-seq reads Nat Biotechnol 2015 33 3 290 295 10.1038/nbt.3122 25690850
Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290–5.25690850 10.1038/nbt.3122
81. Love MI Huber W Anders S Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Genome Biol 2014 15 12 550 10.1186/s13059-014-0550-8 25516281
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.25516281 10.1186/s13059-014-0550-8
