
==== Front
Stem Cell Res Ther
Stem Cell Res Ther
Stem Cell Research & Therapy
1757-6512
BioMed Central London

39256871
3908
10.1186/s13287-024-03908-9
Research
Connexin 25 maintains self-renewal and functions of airway basal cells for airway regeneration
Zhang Jingyuan 12
Wang Shaoyang 12
Liu Zeyu 1
Zhong Cheng 1
Lei Yuqiong 1
Zheng Qi 1
Xu Yongle 1
Shan Shan 1
He Hao haohe@sjtu.edu.cn

2
Ren Tao liuyuanrentao@sjtu.edu.cn

13
1 https://ror.org/0220qvk04 grid.16821.3c 0000 0004 0368 8293 Department of Respiratory Medicine, Shanghai Sixth People‘s Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, 600 Yishan Road, Shanghai, 200233 China
2 https://ror.org/0220qvk04 grid.16821.3c 0000 0004 0368 8293 School of Biomedical Engineering, Shanghai Jiao Tong University, 1954 Huashan Road, Shanghai, 200030 China
3 Shanghai Key Laboratory of Sleep Disordered Breathing, 600 Yishan Road, Shanghai, 200233 China
11 9 2024
11 9 2024
2024
15 2861 3 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

The formation of stem cell clones enables close contact of stem cells inside. The gap junctions in such clone spheres establish a microenvironment that allows frequent intercellular communication to maintain self-renewal and functions of stem cells. Nevertheless, the essential gap junction protein for molecular signaling in clones is poorly known.

Methods

Primary human airway basal cells (hBCs) were isolated from brushing samples through bronchoscopy and then cultured. A tightly focused femtosecond laser was used to excite the local Ca2+ in an individual cell to initiate an internal Ca2+ wave in a clone to screen gap junction proteins. Immunoflourescence staining and clonogenicity assay were used to evaluate self-renewal and functions. RNA and protein levels were assessed by PCR and Western blot. Air–liquid interface assay was conducted to evaluate the differentiation potential. A Naphthalene injury mouse model was used to assess the regeneration potential.

Results

Herein, we identify Connexin 25 (Cx25) dominates intercellular Ca2+ communications in clones of hBCs in vitro to maintain the self-renewal and pluripotency of them. The self-renewal and in vitro differentiation functions and in vivo regeneration potential of hBCs in an airway damage model are both regulated by Cx25. The abnormal expression of Cx25 is validated in several diseases including IPF, Covid-19 and bronchiectasis.

Conclusion

Cx25 is essential for hBC clones in maintaining self-renewal and functions of hBCs via gap junctions.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13287-024-03908-9.

Keywords

Airway basal cell
Connexin
Calcium
Self-renewal
http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 62022056 81930001 62005160 Wang Shaoyang He Hao Ren Tao http://dx.doi.org/10.13039/501100008750 Shanghai Municipal Hospital Development Center SHDC2020CR3063B Ren Tao issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Stem-cell clones are believed to establish a microenvironment for self-renewal of each member inside during in vitro culture [1, 2]. The morphology of cell clone spheres ensures close contact of stem cells, probably for intercellular molecular signalings. Previous studies report the cell density, space, morphology and physical contact of clones are able to regulate the fate of stem cells [3–6].The size and distance of cell clones greatly influence differentiation and self-renewal of human embryo stem cells [4, 7]. Therefore, the densely packed cells in clones might regulate the internal interactions of each cell to sustain their self-renewal capabilities. Gap junctions, clusters of intercellular channels located on the cell membrane, facilitate the direct passage of ions and small molecules into the cytoplasm of neighboring cells, thereby playing a significant role in mediating intercellular communication [8–10]. It has been reported that gap junctions contribute to the differentiation in various stem cell types including adipose-derived stem cells and human-induced pluripotent stem cells [11, 12]. Specifically, calcium signals traverse gap junctions between cells without decrement [13], which serve as a guidance to many biological processes such as cell fate determination, proliferation and differentiation [14–17]. However, the role of gap junctions in molecular communications inside clones remains poorly understood.

Airway basal cells (BCs), a type of pluripotent stem cells, universally exist in airway epithelium to drive homeostasis of epithelium and hold good potential for tissue regeneration [18–20]. BCs are crucial for therapeutic intervention in lung diseases, encompassing both chronic lung conditions and acute epithelial injuries [21, 22], and thus widely used in medical researches and even in clinic which usually requires significant quantities of human BCs (hBCs) for transplantation [22–24]. For this purpose, hBCs need to be extracted from patients and cultured for tens of days to expand them to a large amount in vitro while maintaining their self-renewal ability. Different signaling pathways, such as the Notch and Rock pathways, as well as proteins like LC3B and GPR87, regulate the differentiation of hBCs [25–28].

Connexins, a big family of gap junction proteins, are expressed in almost all cell types of the human body and essential components of developmental and adult organisms [29]. Connexins primarily facilitate intercellular communication through the exchange of second messengers, thereby playing a crucial role in regulating cell proliferation, differentiation, and the maintenance of tissue homeostasis [30, 31]. Dysfunction of connexins is associated with numerous diseases, including neuropathologies, heart failure, deafness, skin disorders, cancer, cataracts and lung diseases [32–35]. In the lung, connexins are related to airway epithelia repair induced by cystic fibrosis and other lung diseases characterized by extensive tissue injury and chronic P. aeruginosa infection [36, 37]. Connexin 25 (Cx25) is a typical protein to form gap junctions for high-speed molecular communications, which implicates in several types of cancer. Previous studies suggest that Cx25 might be a risk factor for the prognosis of head and neck squamous cell carcinoma and contribute to tumorigenesis by altering the function in gastric and colorectal cancer [38, 39]. So far, whether and how connexins contribute to maintaining the self-renewal and functions of hBCs in clones remains unclear.

In this work, we identify Cx25 as the unique gap junction in hBC clones and a key regulator to maintain hBC self-renewal for airway regeneration. The self-renewal, differentiation and planting function of hBCs in vitro and in vivo are greatly influenced by Cx25. Our results thus suggest the critical role of Cx25 in stem-cell clones for self-renewal maintenance.

Methods

Cell collection and culture

Human airway basal cells were isolated from brushing samples through bronchoscopy and cultured following the protocol described in the previous study [40].

To obtain hBCs without feeders, due to the different dissociation time of hBCs and feeders, hBCs with feeders were dissociated by TrypLE Express (Gibco, 12605010) for 1 min and then the cell suspension was discarded to remove feeders. The remained hBCs were dissociated for another 5 min and cultured under a feeder-free circumstance with the same culture medium.

The protocol of human airway basal cells acquisition and culture was approved by the Ethics Committees of Shanghai Jiao Tong University Affiliated Sixth People's Hospital (Approval number: 2017-090).

Materials

The hBC cells were incubated with Fluo-4/AM (5 μM, Invitrogen, F14201) for 30 min at 37 °C and 5% CO2 for Ca2+ indication.

The primary antibodies included anti-p63 (1:100, Abcam, ab735), and anti-KRT8 (1:1000, Abcam, ab53280), anti-Ki67 (1:100, Abcam, ab15580), anti-GJB7 (1:1000, Sigma, SAB4501629), anti-Connexin 32 (1:1000, Invitrogen, 71-0600), anti-GJA9 (1:1000, Invitrogen, PA5-68748), anti-Connexin 30.2 (1:1000, Invitrogen, 40-7400), anti-β-Catenin (1:1000, Abclonal, A19657), anti-Axin1 (1:1000, Abclonal, A16019), anti-LEF1 (1:1000, Abclonal, A4473), anti-Shh (1:1000, Abclonal, A12503), anti-SMO (1:1000, Abclonal,A3274), anti-Acetylated Tubulin (1:500, Sigma, T7451), anti-Mucin 5AC (1:500, Abcam, ab198294), anti-Human Nucleoli (1:1000, Abcam, ab190710), anti-CC10 (1:500, Abcam, ab213203), GAPDH (1:2000, CST, #2118).

The secondary antibodies included Goat Anti-Rabbit IgG H&L (1:1000, Alexa Fluor® 555, Abcam, ab150078), Goat Anti-Rabbit IgG H&L (1:1000, Alexa Fluor® 488, Abcam, ab150077), Goat Anti-Mouse IgG H&L (1:1000, Alexa Fluor® 555, Abcam, ab150114), Goat Anti-Mouse IgG H&L (1:1000, Alexa Fluor® 488, Abcam, ab150113), Anti-rabbit IgG, HRP-linked (1:5000, CST, #7074).

Thapsigargin (TG, 50 μM, Sigma, T9033), 1-Octanol (Octanol, 1 mM, Sigma, 297887), 2-aminoethyl diphenylborinate (2-APB, 100 μM, Sigma, D9754), pyridoxal phosphate-6-azo (benzene-2,4-disulfonic acid) tetrasodium salt hydrate (PPADS, 500 μM, Sigma, P178), Ca2+-free medium (Gibco, 21068028) were used.

Low calcium medium was composed of normal medium and 0.5 mM EGTA.

Gap junction knockdown, overexpression and sorting

The target sequence for Cx25 shRNA was GGTCTCCACACCTTCACTTCT, for Cx31.9 shRNA was CCCAGGACCTAAGCGAGAAAT, for Cx59 shRNA was GGCCACCCGTGTCCAAATATA, for Cx32 shRNA was GGACAGGTTTGTACACCTTGC. All the above plasmids were bought from GenePharma. Cx25-OE plasmid was bought from HANBIO.

hBCs were transiently transfected with the shRNA plasmids through Lipofectamine™ 3000 (Invitrogen) according to the manufacturer’s instructions. hBCs were seeded on the 35 mm confocal dish (Biosharp) pre-coated with feeders 3 days before the transfection. Lipofectamine™ 3000 Reagent were diluted into 125 μL Opti-MEM™ (Gibco) 0.10 μg plasmids and 20 μL P3000™ Reagent were diluted into 125 μL Opti-MEM medium. The solutions were mixed and incubated for 15 min. The mixed buffer was added into the dish and replaced with fresh culture medium after 24 h.

As to Cx25-KD, Cx25-OE, Vehicle and Vehicle-OE hBCs, the target plasmids, the envelop plasmid (pMD2.G) and the packaging plasmid (psPAX2) were mixed together at a 4:1:3 ratio with a total of 10 μg. 293 T cells seeded in a T75 flask were transfected with the mixed plasmid as described above. The medium was replaced with fresh 293 T culture medium in 18 h. The supernatants at 48 h were collected and centrifuged at 2000RPM for 5 min and then filtered with 0.45-μm strainers to obtain the virus mixture. The virus mixture was added to the hBCs and incubated at 37 °C overnight. The virus mixture was then removed and the hBCs were rinsed 3 times with fresh medium and returned to incubator. After 5 days, The hBCs were disassociated and resuspended in PBS with 1% FBS. The hBCs were analyzed and cells with mCherry or zsgreen were sorted by BD FACSAria™ III.

Microscopy

The cells were fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100 (Sigma) for 15 min, blocked with 5% goat serum (Biosharp) for 45 min and incubated with primary antibody overnight at 4 °C. The cells were then incubated with secondary antibody for 2 h and afterwards DAPI (Sigma) for 10 min at room temperature.

The lungs of the mice were harvested with 4% paraformaldehyde injected intratracheally and fixed with 4% paraformaldehyde for 24 h. The membranes of the inserts were fixed with 4% paraformaldehyde for 24 h. The tissues and the membranes were paraffin embedded and cut into slides. The slides were immersed into citrate buffer at 95 °C for 10 min for antigen retrieval. The samples were permeabilized and blocked by 0.1% Triton X-100, 1% BSA and 5% goat serum for 1 h at room temperature. Then the samples were incubated with primary antibody overnight at 4 °C and with secondary antibody for 1 h at room temperature. Coverslips were mounted with a drop of Antifade Mounting Medium with DAPI (Beyotime) and sealed.

The cells and slides were observed and recorded by confocal microscopy (FV1200, Olympus).

For HE staining, the samples were stained by hematoxylin and observed and recorded by Nikon Eclipse Ts2 inverted microscope.

Single-cell photostimulation

A femtosecond laser (BlueCut, Menlo, 1030 nm, 1 MHz, 220 fs) was coupled with a confocal microscope system (FV1200, Olympus) to induce Ca2+ waves. A 60 × objective (N.A. = 1.2, water immersed, Olympus) was used to focus the femtosecond laser to a diffraction-limit spot. A fast mechanical shutter (GCI-73 M, Daheng) synchronized with the galvo-mirrors that set for 0.2 s open was used to control laser exposure. The power of the femtosecond laser was about 15 mW measured at the specimen. Continous confocal microscopy images were recorded during which the photostimulation was set as a single frame of microscopy and inserted into the continuous confocal microscopy sequence at any predefined time slot. In this study, each target individual hBC was stimulated for a single time for 0.2 s.

RT-qPCR

Total RNA of the cells were extracted using Trizol (Invitrogen) according to the manufacturer’s instructions. The RNA samples were reverse‐transcribed into cDNA using a RevertAid RT Reverse Transcription Kit (Thermo). The cDNA templates were amplified by qRT‐PCR using SYBR Green Mix (Thermo) by a pre-installed protocol on the QuantStudio 5 System (Applied Biosystems). Amplification of human GAPDH was used as an endogenous control. The primers used in this study were showed in Table 1.Table 1 The primers used in this study

	Sequence 5′ → 3′	
Cx23 FWD	ATGTCTCTAAATTACATCAAAAACTTCTATGA	
Cx23 REV	TCATTGTCTGAATGGAAAGTATAATCTTCTAA	
Cx25 FWD	GGCTGTCGTGTTTGTCTTCC	
Cx25 REV	CAACCGGGCTGTCTACTGTT	
Cx26 FWD	CATGTACGACGGCTTCTCCAT	
Cx26 REV	GCAGGATGCAAATTCCAGACAC	
Cx30 FWD	CAAGAGGACTTCGTCTGCAAC	
Cx30 REV	GTGGTTTCGTGCCTGTAGTAG	
Cx30.2 FWD	GCGCCCTCTATATGGGTTTC	
Cx30.2 REV	ACCAAGGCAAGGTTCTCGG	
Cx30.3 FWD	TCCCTGTACGACAACCTGAG	
Cx30.3 REV	CGGTGGAAGATATAGAGGAAGCC	
Cx31 FWD	GGACTGCTACATTGCCCGAC	
Cx31 REV	ATGGTGAGTACGATGCAGACG	
Cx31.1 FWD	GCTGCTCCAACGTCTGCTT	
Cx31.1 REV	CGCTCGCCTTGAACACTAGG	
Cx31.9 FWD	GCTGTTCGTCGTCTACTCCAT	
Cx31.9 REV	ACCGCGAAATAGAAGAGCACG	
Cx32 FWD	GAAGAGGCACAAGGTCCACA	
Cx32 REV	GTAGACGTCGCACTTGACCA	
Cx36 FWD	GGGGCAAACGAGAAGATAAGAA	
Cx36 REV	TGGATAATGTAGAAGCGGGAGA	
Cx37 FWD	ACACCCACCCTGGTCTACC	
Cx37 REV	CACTGGCGACATAGGTGCC	
Cx40 FWD	CGAGCAAGTACGAGGTCAGG	
Cx40 REV	CCTTGCTGCTGGCCTTACTA	
Cx40.1 FWD	GAAGGCGTGGACTTGCTAGG	
Cx40.1 REV	GCAGCATCGTGAGGACGAA	
Cx43 FWD	GGTGACTGGAGCGCCTTAG	
Cx43 REV	GCGCACATGAGAGATTGGGA	
Cx45 FWD	GTCCACCCGTTTTATGTGTGC	
Cx45 REV	AGTGAGTCTCGAATGGTCCCA	
Cx46 FWD	ACGGTGGACTGCTTCATCTC	
Cx46 REV	GCGCATAGTAGGGTGGGAAC	
Cx47 FWD	GAGGTGCGACCGTTCTTTC	
Cx47 REV	CTGACCACGTACATAACCAGC	
Cx50 FWD	GAAGCAGAGAGGCTGACCAC	
Cx50 REV	ACTCCGGGGGTCTCTACTTT	
Cx59 FWD	TGTACCGACTGAGAGTTCTTGA	
Cx59 REV	ACAGAGCGAGTGAAAATGTGTAT	
Cx62 FWD	AAAAAGTCACACCTTAGAGCCC	
Cx62 REV	AAGACATAAGTACGCAGCAGAC	
GAPDH FWD	GAGTCAACGGATTTGGTCGT	
GAPDH REV	TTGATTTTGGAGGGATCTCG	

Western blot

The cells were lysised using RIPA buffer (Beyotime) and centrifuged at 13000 RPM for 20 min. The supernatants were collected and measured using a BCA protein assay kit (Beyotime). The protein extracts were separated using 10% SDS‐PAGE gels, transferred to polyvinylidene fluoride (PVDF) membranes (Millipore), incubated with primary antibody overnight at 4 °C. The membranes were then incubated with secondary antibody for 2 h at room temperature and visualized by enhanced chemiluminescence (ECL) (Millipore) using ChemiDoc Imaging System.

Clonogenicity assays

2000 purified hBCs/cm2 were seeded on feeders. After 4–5 days, colonies with a size of ≥ 10 cells/clone were counted. Clonogenicity was shown as the ratio of colonies to input BCs.

Differentiation assays

hBCs were isolated and seeded in the 0.4-μm TC inserts (SARSTEDT) which were put in 24 well plates. After 2 days of expansion with the previous culture medium, PneumaCult™-ALI Medium (STEMCELL) was put in the basal chamber and changed every 2 days. The membranes of the inserts were fixed after 2 weeks.

Transplantations

Cx25-KD hBCs and Vehicle hBCs transplantation in Naphthalene-injuried mice was conducted following the protocol described in the previous study [41].

Naphthalene (Sigma) dissolved in corn oil (Sigma) was injected intraperitoneally into adult male M-NSG mice (Shanghai Model Organisms) with a dose of 200 mg/kg body weight at Day 0 for model construction. 1 day after Naphthalene injection, mice were anesthetized with 2% isoflurane. Cx25-KD hBCs and Vehicle hBCs with a dose of 1 ×106 cells per mouse were transplanted through intratracheal injection respectively. Mice were anesthetized with 2% isoflurane and then sacrificed by cervical dislocation to harvest the lung tissue at Day 7 and Day 14 (n = 3 per group, at each time point).

The work has been reported in line with the ARRIVE guidelines 2.0. Animal care and experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) and the Ethical Committee of Animal Experiments of School of Biomedical Engineering at Shanghai Jiao Tong University (Approval number: 2019036).

Statistics

Statistical analyses were performed using GraphPad Prism 9. All results were expressed as means ± SD. Two‐tailed T‐test or one-way ANOVA was performed for comparisons between groups. Values of P < 0.05 was considered to be statistically significant.

Results

Intercellular gap junction supports fast Ca2+ propagation in BC clones

The in vitro culture of primary hBCs requires irridated 3T3-J2 (mouse embryonic fibroblasts) as the feeder cells to provide the environment for hBC clone formation. Although hBCs could survive and proliferate without feeders, few clones could be found under such a condition (Fig. 1A). We tested the self-renewal and differentiation potential of hBCs with or without feeders during the long-term in vitro culture. The hBCs cultured with feeders exhibited and maintained high level of p63 + (stemness marker), free of K8 + (differentiation marker) and active in proliferation (Ki67 +) in 4 passages (Fig. 1B). In contrast, without feeders, hBCs gradually differentiated since P2 and lost most of the pluripotency at P4 (Fig. 1B and C). A small part of those hBCs exhibited proliferative but varied greatly at each passage. Those hBCs without feeders dispersed and were individually adherent in the dishes. Few clones could be found. In this regard, we investigated whether intercellular signaling in those hBCs was affected by employing Ca2+ communication as an experimental example. Here Ca2+ serves as a second messenger that is deeply involved in pluripotency regulation through connexins. The role of Ca2+ in hBC culture was at first confirmed by incubating hBCs (with feeders) with low-level calcium medium. Compared to hBCs cultured in normal medium, those cultured in the experimental conditions exhibited distinct morphology and significantly reduced clonogenic ability (Fig. 1D). Hence the Ca2+ signaling was indispensable to form hBC clones. Then the two groups of hBCs with and without feeders were treated with thapsigargin (TG) to activate intracellular Ca2+ release. The Ca2+ propagation in those cells was clearly distinct in hBC clones and feeder-free hBCs. Slow, homogeneous but much stronger Ca2+ waves in hBC clones could be found, while no Ca2+ waves were observed in hBCs without feeders (Fig. 1E and F).Fig. 1 hBC clones maintain self-renewal and pluripotent during long-term in vitro culture. A hBC clones and hBCs cultured without feeders. Right panel: the ratio of clones in BC clones and BCs cultured without feeders on Day 4–5 post-seeding (n = 5 independent experiments). Red dashed lines: the outline of clones. Bar: 100 μm. B Immunofluorescent microscopy images of p63, K8 and Ki67 in hBC clones and hBCs without feeders in 4 continous passengers. Bar: 50 μm. C The quantified ratio of positive hBCs with above markers (n = 13 images from 4 independent experiments). D hBCs cultured with control medium and low calcium medium. Right panel: the ratio of clones in BCs cultures with control medium and low calcium medium on Day 4–5 post-seeding. Red dashed lines: the outline of clones. Bar: 200 μm. E Intercellular Ca2+ waves in hBC clones and hBCs treated with TG. Bar: 100 μm. F The quantified area of Ca2+ waves propagation (n = 4 independent trials). Data information: Data are presented as means ± SD. ****p < 0.0001 (Unpaired T-test for two groups and one-way ANOVA for multiple groups)

To confirm Ca2+ propagates through gap junctions in hBC clones, we took advantage of a tightly-focused femtosecond laser to stimulate a targeted individual hBC for a single short flash to excite local Ca2+ in it and initiate a Ca2+ wave in that clone (Fig. 2A). The femtosecond laser at 1030 nm was focused to a submicron spot in a predefined intracellular location in the target hBC. After the transient photostimulation (0.2 s) to a randomly selected individual hBC (Cell 1 in Fig. 2B), the surrounding hBCs showed Ca2+ responses indicating the propagation of a Ca2+ wave in hBCs with or without feeders (Fig. 2B). Although the propagation area of Ca2+ waves in those two groups of hBCs was similar, the propagation speed of Ca2+ in clones was much faster than it in individual hBCs (Fig. 2C). Considering hBCs in clones contacted with each other closely, we proposed the gap junctions should take the responsibility for this fast Ca2+ propagation. To verify this point, the broad-spectrum inhibitor of gap junctions, Octanol, was used to treat cells. Some other Ca2+ inhibitors, including the P2X receptor antagonist, PPADS and the intracellular Ca2+ inhibitor, 2-APB were also used to screen the mediator of intercellular Ca2+ propagation (Fig. 2D). The Ca2+ waves in BC clones were totally inhibited by Octanol (Fig. 2E). The Ca2+-free buffer and 2-APB also exhibited suppression to Ca2+ waves by decreasing intracellular Ca2+ of hBCs (Fig. 2E). PPADS showed no influence on Ca2+ waves (Fig. 2E). Therefore, the gap junctions probably dominated intercellular Ca2+ communication in hBC clones.Fig. 2 Intercellular Ca2+ waves propagate through gap junction in hBC clones. A The schematic diagram of photostimulation to an invidual target hBC in clones and hBCs without feeders by a tightly-focused femtosecond laser to initiate Ca2+ waves. B Ca2+ waves propagation in hBC clones and hBCs without feeders after photostimulation. C The quantified propagation area and speed of Ca2+ waves (n = 24). D Intercellular Ca2+ waves in hBC clones in presence of octanol, PPADS, 2-APB and Ca2+ free buffer respectively. E The quantified propagation area and speed of Ca2+ waves in groups treated with octanol, PPADS, 2-APB and Ca2+ free buffer respectively (n = 20). Bar: 50 μm. Data information: Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired T-test for two groups and one-way ANOVA for multiple groups)

Cx25 regulates intercellular Ca2+ propagation

We then screened the gap junctions in hBC clones and feeder-free adherent hBCs. It could be found several gap junctions in hBC clones, Cx25, Cx31.9, Cx32, and Cx59, presented significantly higher RNA level (Fig. 3A). We further confirmed the upregulation of Cx25, Cx31.9 and Cx32 in hBC clones at protein level (Fig. 3B). In this regard, we suspected some of them contributed to the fast intercellular Ca2+ communication in hBC clones. To identify the essential gap junction, those connexins were transiently knocked down one by one separately. Those hBCs were cultured with feeders and the internal Ca2+ wave propagation in clones was examined by the laser stimulation to an individual hBC (Fig. 3C). The activation ratio and propagation area of Ca2+ waves in the Cx25-KD group were significantly reduced compared to the control group, while no significant difference in these parameters was observed in the other KD groups (Fig. 3D and E). Hence, Cx25 probably mediated the Ca2+ wave propagation in hBC clones. To further confirm this, we constructed stable Cx25-KD hBCs and tested the Ca2+ wave propagation again (Fig. 3F). Cx32-KD hBCs were constructed and tested as control. In Cx25-KD hBC clones, the intercellular Ca2+ waves were significantly suppressed, resulting in a marked decrease in both the propagation area and speed (Fig. 3G and H). In contrast, Ca2+ waves were not influenced in Cx32-KD or Vehicle hBC clones (Fig. 3G and H). Therefore, Cx25 was essential to intercellular Ca2+ communications in hBC clones.Fig. 3 Cx25 is essential to intercellular Ca2+ propagation in hBC clones. A RNA expression level of connexins in hBC clones and hBCs without feeders. B Protein expression level of Cx31.9, Cx32, Cx59 and Cx25 in hBC clones and hBCs without feeders (n = 3 independent experiments). C Ca2+ waves initiated by photostimulation in BCs with Cx31.9, Cx32, Cx59 and Cx25 transiently KD respectively (n = 20). D,E The quantified amplitude (C) and propagation area (D) of Ca2+ waves in those hBCs. F The protein expression level of Cx25 in stable Cx25-KD and Cx32-KD hBCs (n = 3 independent experiments). G Ca2+ waves in stable Cx25-KD, Cx32-KD, and Vehicle hBCs (n = 22). H The quantified propagation area and speed of Ca2+ waves in Cx25-KD, Cx32-KD, and Vehicle hBCs. Bar: 25 μm. Data information: Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired T-test for two groups and one-way ANOVA for multiple groups)

Cx25 is essential to hBC self-renewal and functions

We finally demonstrated Cx25 maintained the self-renewal and functions of hBCs. At first, we confirmed Cx25 was significantly upregulated inside hBC clones (Fig. 4A). It was located in the intercellular space, suggesting its role in intercellular molecular communications. Consistently, Cx25-KD hBCs showed significat decreased clonogenicity examined by in vitro culture with feeders (Fig. 4B). Those Cx25-KD hBCs displayed diminished self-renewal ability, pluripotency and proliferation capacity indicated by the significantly lower degree of p63, Ki67 positivity and increased degree of K8 positivity than them of the control (Fig. 4C and D). This was probably attributed to the activated pathways including Wnt, Hippo, and Hedgehog in those Cx25-KD hBCs (Fig. 4E). Interestingly, given SARS-CoV-2 in COVID-19 utilizes host Ca2+ signaling for viral entry, replication, and egress [42], the Cx25 level was found significantly down-regulated in Covid-19 patients (Fig. 4F), probably as a compensatory action to prevent lung cells from further or broad viral invasion. We also found the down-regulation of Cx25 in bronchoalveolar lavage fluid (BALF) of idiopathic pulmonary fibrosis (IPF) patients, probably suggesting the dysregulation of arway regeneration governed by hBCs. The up-regulation of Cx25 was found in bronchiectasis patients (Fig. 4F). This might contribute to the inflammatory process and disturbance of Ca2+ homeostasis [43].Fig. 4 Cx25 dominates the self-renewal of in vitro cultured BC clones. A Immunofluorescent microscopy images of Cx25 Vehicle hBCs and Cx25-KD hBCs. Bar: 25 μm. B Clones in Cx25-KD hBCs and Vehicle hBCs. Right panel: the ratio of clones in Cx25-KD hBCs and Vehicle hBCs on Day 4–5 post-seeding. (n = 5 independent experiments). Red dashed lines: the outline of clones. Bar: 50 μm. C Immunofluorescent staining of p63, K8 and Ki67 in Cx25-KD hBCs and Vehicle hBCs. Bar: 100 μm. D The quantified ratio of positive hBCs with above markers (n = 13 images from 4 independent experiments). E Protein level of Wnt, Hippo and Hedgehog pathway in Cx25-KD BCs and Vehicle BCs (n = 3 independent experiments). F Protein level of Cx25 in cultured BCs from normal people, COPD, bronchiectasis and BALF of IPF patients (n = 3 independent experiments). Data information: Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired T-test for two groups)

To further confirm the Cx25 function in the formation of hBC clones, we constructed stable Cx25-OE hBCs for the rescure test of the feeder-free hBCs (Fig. 5A and B). Interestingly, Cx25-OE hBCs were able to form clones despite the absence of feeders while Vehicle-OE hBCs hardly formed any clones (Fig. 5C). The photoactivated Ca2+ waves propageted much faster in the Cx25-OE hBCs, indicating the effective formation of gap junctions for Ca2+ communications (Fig. 5D and E). Cx25-OE hBCs also partially restored self-renewal and proliferation ability compared with Vehicle-OE, indicated by p63, K8 and Ki67 (Fig. 5F).Fig. 5 Cx25 overexpression restores self-renewal and proliferation ability in hBCs. A Immunofluorescent microscopy images of Cx25-OE hBCs and Vehicle-OE hBCs. Bar: 25 μm. B The protein expression level of Cx25 in stable Cx25-OE and Vehciel-OE hBCs (n = 3 independent experiments). C Clones in Cx25-OE hBCs and Vehicle-OE hBCs. Right panel: the ratio of clones in Cx25-OE hBCs and Vehicle-OE hBCs on Day 5-7 post-seeding (n = 5 independent experiments). Red dashed lines: the outline of clones. Bar: 50 μm. D Ca2+ waves in stable Cx25-OE and Vehicle-OE hBCs. E The quantified propagation area and speed of Ca2+ waves (n = 19). F Immunofluorescent staining of p63, K8 and Ki67 in Cx25-OE hBCs and Vehicle-OE hBCs. Bar: 100 μm. G The quantified ratio of positive hBCs with above markers (n = 10 images from 4 independent experiments). Data information: Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired T-test for two groups)

We finally demonstrated Cx25 regulated the hBC functions upon differentiation of Cx25-KD hBCs by air–liquid interface (ALI) test that hBCs were half exposed to air (Fig. 6A). After 21 days of cluture, the differentiated epithelium was acquired for H&E and immunofluorescence imaging. The Vehicle hBCs differentiated to a pseudostratified epithelium with basal, goblet, and ciliated cells while those structures could not be formed by Cx25-KD hBCs. We further confirmed the successful differentiation to goblet and ciliated cells by Muc5AC and Ace-Tubulin immunofluorescence respectively in Vehicle hBCs while Cx25-KD hBCs were not able to differentiate to ciliated cells (Fig. 6B and C). This result indicates a phenotypic change upon Cx25-KD hBCs differentiation.Fig. 6 Cx25 dominates the functions of in vitro cultured hBC clones. A Images of Cx25-KD hBCs and Vehicle hBCs with ALI and the H&E staining after 20-day in vitro culture for differentiation. Red arrows: Ciliated cells. Blue arrows: Goblet cells. Bar: 100 μm. B Immunofluorescent staining of hBC marker P63, ciliated cell marker acetylated tubulin (Ace-Tub) and goblet cell marker Muc5AC of those 20-day cultured hBCs. Bar: 50 μm. C The quantified ratio of hBCs, ciliated cells and goblet cells in those 20-day cultured hBCs (n = 24 images from 5 independent experiments). D The schematic diagram of the test planting ability of Cx25-KD hBCs and Vehicle hBCs in naphthalene-treatment mice. E & F H&E staining and immunofluorescent staining of the airways tissue after transplantation at Day 7 and Day 14 respectively. Right panel: thequantification of cells planted in the lung. (n = 15 images from 3 mice in each group). Bar: 100 μm. Data information: Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired T-test for two groups)

We then examined whether Cx25 contributed to the airway regeneration by maintaining self-renewal of hBCs. To verify this point, the airway of mice was at first damaged by injecting Naphthalene intraperitoneally. After one day, mice were transplanted with Vehicle hBCs or Cx25-KD hBCs intratracheally for therapy. The lung was extracted to check if the transplanted hBCs could plant in the airway epithelium 7 and 14 days later (Fig. 6D). By H&E imaging, there were no significant differences between those groups as the airway showed spontaneous recovery after 14 days (Fig. 6E). The planting of the transplanted hBCs in airway epithelium was further checked out by immunofluorescence of human nucleus (Fig. 6F). The planting of transplanted hBCs could be found in the airway transplanted with Vehicle hBCs group but hardly any was found in Cx25-KD hBCs group. Therefore, the regeneration potential of hBCs also diminished significantly without Cx25.

Discussion

The form of clones guarantees the tight contact of the members, which is vital to their self-renewal capacity. In this study, we identified Cx25 as an essential gap junction in hBC clones for intercellular Ca2+ communications. Ca2+ has long been recognized as a key regulator of stem cell functions and cell fate [44, 45]. The upregulation of Cx25 in hBC clones plays a key role in maintaining their self-renewal ability and prevents them from differentiation during the in vitro culture. Without Cx25, the functions of differentiation and reformation of epithelium in vitro and in vivo are significantly reduced. Abnormal expression of Cx25 is also found in several lung diseases including COVID-19, IPF and bronchiectasis, which further gives a clue to the underlying mechanism of disease pathogenesis and progression. Hence this result is of good potential to improve the in vitro culture of stem cells in practical stem-cell therapy and regenerative medicine.

We take advantage of the noninvasive and precise delivery of photon energy to an individual target cell by a tightly focused femtosecond laser in this study. The method realizes the excitation of the local Ca2+ in any target individual cell without disturbing any other members, to initiate an internal Ca2+ wave in the clone. The propagation of Ca2+ waves in clones could be clearly observed and quantified. This method is thus of good potential in researches on internal molecular communications of cell clones as well as manipulation of Ca2+ signaling.

Stem cell clones are naturally in morphology of compact clusters. This form benefits the cell–cell contact and establishment of effective gap junctions. The role of connexins that form gap junctions in multiple pulmonary diseases has been investigated [43, 46, 47]. Cx43-mediated intercellular communications are found capable of spreading proinflammatory signals, leading to severe acute lung injury [43]. In hypoxaemic lung disease, decrease of Cx43 expression supresses distal pulmoanry arteries remodelling [47]. Another study has found that aberrant expression of Cx26 plays a key role in lung metastasis of colorectal cancer [46]. In our study, Cx25 in hBC clones is upregulated and works as the gap junctions for intercellular Ca2+ communications. It should be noted, with Cx25 knocked down, although the morphology of hBC clones cultured with feeders could partially remain, the clonogenic ability is diminished and the clones partially lose their pluripotency and stem cell functions. Therefore, Cx25 is probably the key to the molecular mechanism and function of in vitro cultured hBCs.

Cx25 is also found down-regulated in Covid-19 patients and BALF of IPF patients, while up-regulated in bronchiectasis patients. The loss of Cx25 is probably related to deminished self-renewal ability and differentiation potential whereas the up-regulation of Cx25 might be related to overactive cell communications and Ca2+ related pathway signalings. To be noticed, the underlying relationship between Cx25 and diesase pathogenesis and development still needs further investigation.

Conclusion

Our findings suggest that Cx25 is an essential gap junction to maintain self-renewal and functions of airway basal cell clones. This is important to the in vitro culture of stem cells in practical stem-cell therapy and regenerative medicine, and understanding the molecular mechanism and function of stem cells.

Supplementary Information

Additional file 1

Abbreviations

ALI Air–liquid interface

BC Basal cell

BALF Bronchoalveolar lavage fluid

COPD Chronic obstructive pulmonary disease

Cx Connexin

IPF Idiopathic pulmonary fibrosis

KD Knock down

PPADS Pyridoxal phosphate-6-azo (benzene-2,4-disulfonic acid) tetrasodium salt hydrate

TG Thapsigargin

2-APB 2-Aminoethyl diphenylborinate

Acknowledgements

Not applicable.

Author contributions

T.R. and H.H. conceived the study and supervised the project. J.Z., Z.L., C.Z. and performed the experiments. J.Z., Y.X., Y.L. prepared the figures. S.W. contributed to experimental design and data analysis. H.H. and J.Z. drafted the manuscript. All authors analyzed the data, discussed the results and revised the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (NSFC 62022056, 81930001 and 62005160) and clinical Research Plan of SHDC (No. SHDC2020CR3063B).

Availability of data and materials

The data that supports the findings of this study is available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

Title of the approved project Clinical exploration of bronchosopic infusion of autologus repairing airway epithelia cells for idiopathic pulmonary fibrosis. Name of the institutional approval committee or unit Ethics Committees of Shanghai Jiao Tong University Affiliated Sixth People’s Hospital. Approved number 2020–152. Date of Approval 25th August 2020. Title of the approved project Research on Femtosecond laser biophotonics. Name of the institutional approval committee or unit the Ethical Committee of Animal Experiments of School of Biomedical Engineering at Shanghai Jiao Tong University. Approved number 2019036. Date of Approval 9th March 2019. For the patients’ samples, the patients or their guardians/legally authorized representatives provided written informed consent for participation in the study and the use of samples.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Hough SR Thornton M Mason E Mar JC Wells CA Pera MF Single-cell gene expression profiles define self-renewing, pluripotent, and lineage primed states of human pluripotent stem cells Stem Cell Rep 2014 2 6 881 895 10.1016/j.stemcr.2014.04.014
Hough SR, Thornton M, Mason E, Mar JC, Wells CA, Pera MF. Single-cell gene expression profiles define self-renewing, pluripotent, and lineage primed states of human pluripotent stem cells. Stem Cell Rep. 2014;2(6):881–95. 10.1016/j.stemcr.2014.04.014.10.1016/j.stemcr.2014.04.014
2. Warmflash A Sorre B Etoc F Siggia ED Brivanlou AH A method to recapitulate early embryonic spatial patterning in human embryonic stem cells Nat Methods 2014 11 8 847 854 10.1038/nmeth.3016 24973948
Warmflash A, Sorre B, Etoc F, Siggia ED, Brivanlou AH. A method to recapitulate early embryonic spatial patterning in human embryonic stem cells. Nat Methods. 2014;11(8):847–54. 10.1038/nmeth.3016.24973948 10.1038/nmeth.3016
3. Yu L Li J Hong J Low cell-matrix adhesion reveals two subtypes of human pluripotent stem cells Stem Cell Rep 2018 11 1 142 156 10.1016/j.stemcr.2018.06.003
Yu L, Li J, Hong J, et al. Low cell-matrix adhesion reveals two subtypes of human pluripotent stem cells. Stem Cell Rep. 2018;11(1):142–56.10.1016/j.stemcr.2018.06.003
4. Joshi R Fuller B Mosadegh B Tavana H Stem cell colony interspacing effect on differentiation to neural cells J Tissue Eng Regen Med 2018 12 10 2041 2054 10.1002/term.2739 30058271
Joshi R, Fuller B, Mosadegh B, Tavana H. Stem cell colony interspacing effect on differentiation to neural cells. J Tissue Eng Regen Med. 2018;12(10):2041–54.30058271 10.1002/term.2739
5. Nallet-Staub F Yin X Gilbert C Cell density sensing alters TGF-β signaling in a cell-type-specific manner, independent from hippo pathway activation Dev Cell 2015 32 5 640 651 10.1016/j.devcel.2015.01.011 25758862
Nallet-Staub F, Yin X, Gilbert C, et al. Cell density sensing alters TGF-β signaling in a cell-type-specific manner, independent from hippo pathway activation. Dev Cell. 2015;32(5):640–51. 10.1016/j.devcel.2015.01.011.25758862 10.1016/j.devcel.2015.01.011
6. Elsafi Mabrouk MH Goetzke R Abagnale G The spatial self-organization within pluripotent stem cell colonies is continued in detaching aggregates Biomaterials 2022 282 121389 10.1016/j.biomaterials.2022.121389 35121357
Elsafi Mabrouk MH, Goetzke R, Abagnale G, et al. The spatial self-organization within pluripotent stem cell colonies is continued in detaching aggregates. Biomaterials. 2022;282: 121389. 10.1016/j.biomaterials.2022.121389.35121357 10.1016/j.biomaterials.2022.121389
7. Joshi R Thakuri PS Buchanan JC Li J Tavana H Microprinted stem cell niches reveal compounding effect of colony size on stromal cells-mediated neural differentiation Adv Healthc Mater 2018 7 5 1700832 10.1002/adhm.201700832
Joshi R, Thakuri PS, Buchanan JC, Li J, Tavana H. Microprinted stem cell niches reveal compounding effect of colony size on stromal cells-mediated neural differentiation. Adv Healthc Mater. 2018;7(5):1700832.10.1002/adhm.201700832
8. Lawrence TS Beers WH Gilula NB Transmission of hormonal stimulation by cell-to-cell communication Nature 1978 272 5653 501 506 10.1038/272501a0 211417
Lawrence TS, Beers WH, Gilula NB. Transmission of hormonal stimulation by cell-to-cell communication. Nature. 1978;272(5653):501–6.211417 10.1038/272501a0
9. Veenstra RD Size and selectivity of gap junction channels formed from different connexins J Bioenerg Biomembr 1996 28 327 337 10.1007/BF02110109 8844330
Veenstra RD. Size and selectivity of gap junction channels formed from different connexins. J Bioenerg Biomembr. 1996;28:327–37.8844330 10.1007/BF02110109
10. Hernandez VH Bortolozzi M Pertegato V Unitary permeability of gap junction channels to second messengers measured by FRET microscopy Nat Methods 2007 4 4 353 358 10.1038/nmeth1031 17351620
Hernandez VH, Bortolozzi M, Pertegato V, et al. Unitary permeability of gap junction channels to second messengers measured by FRET microscopy. Nat Methods. 2007;4(4):353–8.17351620 10.1038/nmeth1031
11. Wiesner M Berberich O Hoefner C Blunk T Bauer-Kreisel P Gap junctional intercellular communication in adipose-derived stromal/stem cells is cell density-dependent and positively impacts adipogenic differentiation J Cell Physiol 2018 233 4 3315 3329 10.1002/jcp.26178 28888046
Wiesner M, Berberich O, Hoefner C, Blunk T, Bauer-Kreisel P. Gap junctional intercellular communication in adipose-derived stromal/stem cells is cell density-dependent and positively impacts adipogenic differentiation. J Cell Physiol. 2018;233(4):3315–29.28888046 10.1002/jcp.26178
12. Ke Q Li L Cai B Connexin 43 is involved in the generation of human-induced pluripotent stem cells Hum Mol Genet 2013 22 11 2221 2233 10.1093/hmg/ddt074 23420013
Ke Q, Li L, Cai B, et al. Connexin 43 is involved in the generation of human-induced pluripotent stem cells. Hum Mol Genet. 2013;22(11):2221–33. 10.1093/hmg/ddt074.23420013 10.1093/hmg/ddt074
13. Braet K Aspeslagh S Vandamme W Pharmacological sensitivity of ATP release triggered by photoliberation of inositol-1, 4, 5-trisphosphate and zero extracellular calcium in brain endothelial cells J Cell Physiol 2003 197 2 205 213 10.1002/jcp.10365 14502560
Braet K, Aspeslagh S, Vandamme W, et al. Pharmacological sensitivity of ATP release triggered by photoliberation of inositol-1, 4, 5-trisphosphate and zero extracellular calcium in brain endothelial cells. J Cell Physiol. 2003;197(2):205–13.14502560 10.1002/jcp.10365
14. Reither G Schaefer M Lipp P PKCα: a versatile key for decoding the cellular calcium toolkit J Cell Biol 2006 174 4 521 533 10.1083/jcb.200604033 16893971
Reither G, Schaefer M, Lipp P. PKCα: a versatile key for decoding the cellular calcium toolkit. J Cell Biol. 2006;174(4):521–33.16893971 10.1083/jcb.200604033
15. Lansley AB Sanderson MJ Regulation of airway ciliary activity by Ca2+: simultaneous measurement of beat frequency and intracellular Ca2+ Biophys J 1999 77 1 629 638 10.1016/S0006-3495(99)76919-5 10388787
Lansley AB, Sanderson MJ. Regulation of airway ciliary activity by Ca2+: simultaneous measurement of beat frequency and intracellular Ca2+. Biophys J. 1999;77(1):629–38.10388787 10.1016/S0006-3495(99)76919-5
16. Yao J Oite T Kitamura M Gap junctional intercellular communication in the juxtaglomerular apparatus Am J Physiol Renal Physiol 2009 296 5 F939 F946 10.1152/ajprenal.90612.2008 19073638
Yao J, Oite T, Kitamura M. Gap junctional intercellular communication in the juxtaglomerular apparatus. Am J Physiol Renal Physiol. 2009;296(5):F939–46.19073638 10.1152/ajprenal.90612.2008
17. Isakson BE Ramos SI Duling BR Ca2+ and inositol 1, 4, 5-trisphosphate–mediated signaling across the myoendothelial junction Circ Res 2007 100 2 246 254 10.1161/01.RES.0000257744.23795.93 17218602
Isakson BE, Ramos SI, Duling BR. Ca2+ and inositol 1, 4, 5-trisphosphate–mediated signaling across the myoendothelial junction. Circ Res. 2007;100(2):246–54.17218602 10.1161/01.RES.0000257744.23795.93
18. McKeon F p63 and the epithelial stem cell: more than status quo? Genes Dev 2004 18 5 465 469 10.1101/gad.1190504 15037544
McKeon F. p63 and the epithelial stem cell: more than status quo? Genes Dev. 2004;18(5):465–9.15037544 10.1101/gad.1190504
19. Montoro DT Haber AL Biton M A revised airway epithelial hierarchy includes CFTR-expressing ionocytes Nature 2018 560 7718 319 324 10.1038/s41586-018-0393-7 30069044
Montoro DT, Haber AL, Biton M, et al. A revised airway epithelial hierarchy includes CFTR-expressing ionocytes. Nature. 2018;560(7718):319–24.30069044 10.1038/s41586-018-0393-7
20. Rock JR Onaitis MW Rawlins EL Basal cells as stem cells of the mouse trachea and human airway epithelium Proc Natl Acad Sci 2009 106 31 12771 12775 10.1073/pnas.0906850106 19625615
Rock JR, Onaitis MW, Rawlins EL, et al. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proc Natl Acad Sci. 2009;106(31):12771–5.19625615 10.1073/pnas.0906850106
21. Hewitt RJ Lloyd CM Regulation of immune responses by the airway epithelial cell landscape Nat Rev Immunol Published online 2021 10.1038/s41577-020-00477-9
Hewitt RJ, Lloyd CM. Regulation of immune responses by the airway epithelial cell landscape. Nat Rev Immunol Published online. 2021. 10.1038/s41577-020-00477-9.10.1038/s41577-020-00477-9
22. Morrisey EE Basal cells in lung development and repair Dev Cell 2018 44 6 653 654 10.1016/j.devcel.2018.03.004 29587138
Morrisey EE. Basal cells in lung development and repair. Dev Cell. 2018;44(6):653–4.29587138 10.1016/j.devcel.2018.03.004
23. Hawkins FJ Derivation of airway basal stem cells from human pluripotent stem cells Cell Stem Cell 2021 28 1 79 95 10.1016/j.stem.2020.09.017 33098807
Hawkins FJ, et al. Derivation of airway basal stem cells from human pluripotent stem cells. Cell Stem Cell. 2021;28(1):79–95.33098807 10.1016/j.stem.2020.09.017
24. Ma Q Ma Y Dai X Regeneration of functional alveoli by adult human SOX9+ airway basal cell transplantation Protein Cell 2018 9 3 267 282 10.1007/s13238-018-0506-y 29344809
Ma Q, Ma Y, Dai X, et al. Regeneration of functional alveoli by adult human SOX9+ airway basal cell transplantation. Protein Cell. 2018;9(3):267–82.29344809 10.1007/s13238-018-0506-y
25. Chen SL Chou HC Lin KC Investigation of the role of the autophagic protein LC3B in the regulation of human airway epithelium cell differentiation in COPD using a biomimetic model Mater Today Bio 2022 13 100182 10.1016/j.mtbio.2021.100182 34917923
Chen SL, Chou HC, Lin KC, et al. Investigation of the role of the autophagic protein LC3B in the regulation of human airway epithelium cell differentiation in COPD using a biomimetic model. Mater Today Bio. 2022;13: 100182.34917923 10.1016/j.mtbio.2021.100182
26. Yugawa T Noncanonical NOTCH signaling limits self-renewal of human epithelial and induced pluripotent stem cells through ROCK activation Mol Cell Biol 2013 33 22 4434 4447 10.1128/MCB.00577-13 24019071
Yugawa T, et al. Noncanonical NOTCH signaling limits self-renewal of human epithelial and induced pluripotent stem cells through ROCK activation. Mol Cell Biol. 2013;33(22):4434–47.24019071 10.1128/MCB.00577-13
27. Rock JR Gao X Xue Y Randell SH Kong YY Hogan BLM Notch-dependent differentiation of adult airway basal stem cells Cell Stem Cell 2011 8 6 639 648 10.1016/j.stem.2011.04.003 21624809
Rock JR, Gao X, Xue Y, Randell SH, Kong YY, Hogan BLM. Notch-dependent differentiation of adult airway basal stem cells. Cell Stem Cell. 2011;8(6):639–48.21624809 10.1016/j.stem.2011.04.003
28. Heinzelmann K et al. Single-cell RNA sequencing identifies G-protein coupled receptor 87 as a basal cell marker expressed in distal honeycomb cysts in idiopathic pulmonary fibrosis. Eur Respirat J. 2022;59(6).
29. Beyer EC, Berthoud VM. Gap junction gene and protein families: connexins, innexins, and pannexins. Biochimica et Biophysica Acta (BBA)-Biomembranes. 2018;1860(1):5–8.
30. Aasen T Connexins: junctional and non-junctional modulators of proliferation Cell Tissue Res 2015 360 3 685 699 10.1007/s00441-014-2078-3 25547217
Aasen T. Connexins: junctional and non-junctional modulators of proliferation. Cell Tissue Res. 2015;360(3):685–99.25547217 10.1007/s00441-014-2078-3
31. Vinken M Introduction: connexins, pannexins and their channels as gatekeepers of organ physiology Cell Mol Life Sci 2015 72 2775 2778 10.1007/s00018-015-1958-3 26084871
Vinken M. Introduction: connexins, pannexins and their channels as gatekeepers of organ physiology. Cell Mol Life Sci. 2015;72:2775–8.26084871 10.1007/s00018-015-1958-3
32. Abraham V Chou ML George P Heterocellular gap junctional communication between alveolar epithelial cells Am J Physiol Lung Cell Mol Physiol 2001 280 6 L1085 L1093 10.1152/ajplung.2001.280.6.L1085 11350787
Abraham V, Chou ML, George P, et al. Heterocellular gap junctional communication between alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol. 2001;280(6):L1085–93.11350787 10.1152/ajplung.2001.280.6.L1085
33. Isakson BE Seedorf GJ Lubman RL Evans WH Boitano S Cell–cell communication in heterocellular cultures of alveolar epithelial cells Am J Respir Cell Mol Biol 2003 29 5 552 561 10.1165/rcmb.2002-0281OC 12748060
Isakson BE, Seedorf GJ, Lubman RL, Evans WH, Boitano S. Cell–cell communication in heterocellular cultures of alveolar epithelial cells. Am J Respir Cell Mol Biol. 2003;29(5):552–61.12748060 10.1165/rcmb.2002-0281OC
34. Delmar M Laird DW Naus CC Nielsen MS Verselis VK White TW Connexins and disease Cold Spring Harb Perspect Biol 2018 10 9 a029348 10.1101/cshperspect.a029348 28778872
Delmar M, Laird DW, Naus CC, Nielsen MS, Verselis VK, White TW. Connexins and disease. Cold Spring Harb Perspect Biol. 2018;10(9): a029348.28778872 10.1101/cshperspect.a029348
35. Aasen T Mesnil M Naus CC Lampe PD Laird DW Gap junctions and cancer: communicating for 50 years Nat Rev Cancer 2016 16 12 775 788 10.1038/nrc.2016.105 27782134
Aasen T, Mesnil M, Naus CC, Lampe PD, Laird DW. Gap junctions and cancer: communicating for 50 years. Nat Rev Cancer. 2016;16(12):775–88.27782134 10.1038/nrc.2016.105
36. Crespin S Bacchetta M Saab JB Cx26 regulates proliferation of repairing basal airway epithelial cells Int J Biochem Cell Biol 2014 52 152 160 10.1016/j.biocel.2014.02.010 24569117
Crespin S, Bacchetta M, Saab JB, et al. Cx26 regulates proliferation of repairing basal airway epithelial cells. Int J Biochem Cell Biol. 2014;52:152–60.24569117 10.1016/j.biocel.2014.02.010
37. Shiner EK Rumbaugh KP Williams SC Interkingdom signaling: deciphering the language of acyl homoserine lactones FEMS Microbiol Rev 2005 29 5 935 947 10.1016/j.femsre.2005.03.001 16219513
Shiner EK, Rumbaugh KP, Williams SC. Interkingdom signaling: deciphering the language of acyl homoserine lactones. FEMS Microbiol Rev. 2005;29(5):935–47.16219513 10.1016/j.femsre.2005.03.001
38. He Y Ji P Li Y Wang R Ma H Yuan H Genetic variants were associated with the prognosis of head and neck squamous carcinoma Front Oncol 2020 10.3389/fonc.2020.00372 33996530
He Y, Ji P, Li Y, Wang R, Ma H, Yuan H. Genetic variants were associated with the prognosis of head and neck squamous carcinoma. Front Oncol. 2020. 10.3389/fonc.2020.00372.33996530 10.3389/fonc.2020.00372
39. Son HJ An CH Yoo NJ Lee SH Tight junction-related CLDN5 and CLDN6 genes, and gap junction-related GJB6 and GJB7 genes are somatically mutated in gastric and colorectal cancers Pathol Oncol Res 2020 26 3 1983 1987 10.1007/s12253-020-00806-2 32170581
Son HJ, An CH, Yoo NJ, Lee SH. Tight junction-related CLDN5 and CLDN6 genes, and gap junction-related GJB6 and GJB7 genes are somatically mutated in gastric and colorectal cancers. Pathol Oncol Res. 2020;26(3):1983–7. 10.1007/s12253-020-00806-2.32170581 10.1007/s12253-020-00806-2
40. Hong Y Shan S Gu Y Malfunction of airway basal stem cells plays a crucial role in pathophysiology of tracheobronchopathia osteoplastica Nat Commun 2022 13 1 1309 10.1038/s41467-022-28903-7 35288560
Hong Y, Shan S, Gu Y, et al. Malfunction of airway basal stem cells plays a crucial role in pathophysiology of tracheobronchopathia osteoplastica. Nat Commun. 2022;13(1):1309.35288560 10.1038/s41467-022-28903-7
41. Wang S Shan S Zhang J Airway epithelium regeneration by photoactivated basal cells J Photochem Photobiol B 2023 245 112732 10.1016/j.jphotobiol.2023.112732 37290293
Wang S, Shan S, Zhang J, et al. Airway epithelium regeneration by photoactivated basal cells. J Photochem Photobiol B. 2023;245: 112732.37290293 10.1016/j.jphotobiol.2023.112732
42. Sultan F Ahuja K Motiani RK Potential of targeting host cell calcium dynamics to curtail SARS-CoV-2 infection and COVID-19 pathogenesis Cell Calcium 2022 106 102637 10.1016/j.ceca.2022.102637 35986958
Sultan F, Ahuja K, Motiani RK. Potential of targeting host cell calcium dynamics to curtail SARS-CoV-2 infection and COVID-19 pathogenesis. Cell Calcium. 2022;106: 102637. 10.1016/j.ceca.2022.102637.35986958 10.1016/j.ceca.2022.102637
43. Parthasarathi K Connexin 43 mediates spread of Ca2+ -dependent proinflammatory responses in lung capillaries J Clin Investig 2006 116 8 2193 2200 10.1172/JCI26605 16878174
Parthasarathi K. Connexin 43 mediates spread of Ca2+ -dependent proinflammatory responses in lung capillaries. J Clin Investig. 2006;116(8):2193–200. 10.1172/JCI26605.16878174 10.1172/JCI26605
44. Gengatharan A Malvaut S Marymonchyk A Adult neural stem cell activation in mice is regulated by the day/night cycle and intracellular calcium dynamics Cell 2021 184 3 709 722 10.1016/j.cell.2020.12.026 33482084
Gengatharan A, Malvaut S, Marymonchyk A, et al. Adult neural stem cell activation in mice is regulated by the day/night cycle and intracellular calcium dynamics. Cell. 2021;184(3):709–22.33482084 10.1016/j.cell.2020.12.026
45. Xie Y Chen D Jiang K Hair shaft miniaturization causes stem cell depletion through mechanosensory signals mediated by a Piezo1-calcium-TNF-α axis Cell Stem Cell 2022 29 1 70 85 10.1016/j.stem.2021.09.009 34624205
Xie Y, Chen D, Jiang K, et al. Hair shaft miniaturization causes stem cell depletion through mechanosensory signals mediated by a Piezo1-calcium-TNF-α axis. Cell Stem Cell. 2022;29(1):70–85.34624205 10.1016/j.stem.2021.09.009
46. Ezumi K Yamamoto H Murata K Aberrant expression of connexin 26 is associated with lung metastasis of colorectal cancer Clin Cancer Res 2008 14 3 677 684 10.1158/1078-0432.CCR-07-1184 18245526
Ezumi K, Yamamoto H, Murata K, et al. Aberrant expression of connexin 26 is associated with lung metastasis of colorectal cancer. Clin Cancer Res. 2008;14(3):677–84.18245526 10.1158/1078-0432.CCR-07-1184
47. Bouvard C et al. Connexin-43 is a promising target for pulmonary hypertension due to hypoxaemic lung disease. Eur Respirat J. 2020;55(3).
