
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

4259
10.1186/s12917-024-04259-6
Research
Molecular detection of Anaplasma bovis, Candidatus Anaplasma boleense and Rickettsia spp. in ticks infesting small ruminants
Khan Zaibullah 1
Ullah Farman 1
Ullah Shafi 1
Ibrahim Mohammed 2
Khan Momin 3
Rehman Gauhar 1
Tanaka Tetsuya 36
Almutairi Mashal M. 4
Alouffi Abdulaziz 5
Ali Abid uop_ali@yahoo.com

1
1 https://ror.org/03b9y4e65 grid.440522.5 0000 0004 0478 6450 Department of Zoology, Abdul Wali Khan University Mardan, Mardan, 23180 Pakistan
2 https://ror.org/03b9y4e65 grid.440522.5 0000 0004 0478 6450 Department of Chemistry, Abdul Wali Khan University Mardan, Mardan, 23180 Pakistan
3 https://ror.org/03ss88z23 grid.258333.c 0000 0001 1167 1801 Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima, 890-0065 Japan
4 https://ror.org/02f81g417 grid.56302.32 0000 0004 1773 5396 Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh, 11451 Saudi Arabia
5 https://ror.org/05tdz6m39 grid.452562.2 0000 0000 8808 6435 King Abdulaziz City for Science and Technology, Riyadh, 12354 Saudi Arabia
6 https://ror.org/01dq60k83 grid.69566.3a 0000 0001 2248 6943 Laboratory of Animal Microbiology, Graduate School of Agricultural Science/Faculty of Agriculture, Tohoku University, Sendai , 980-8572, Japan
11 9 2024
11 9 2024
2024
20 4087 3 2024
30 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Anaplasma spp. and Rickettsia spp. are intracellular vector-borne pathogens and harbored by a wide range of ticks and vertebrate hosts. Aim of this study was to molecularly characterize Anaplasma spp. and Rickettsia spp. in different ticks collected from livestock hosts in nine districts of Khyber Pakhtunkhwa (KP), Pakistan. In total, 862 ticks were collected from cattle, goats and sheep. Highest tick’s infestation was observed on cattle 56.14% (32/57), followed by goats 45.45% (40/88), and sheep 42.05% (45/107). Rhipicephalus microplus (305/862, 35.38%) was predominant species, followed by Haemaphysalis sulcata (243/862, 28.19%), Hyalomma anatolicum (133/862, 15.42%), Haemaphysalis bispinosa (120/862, 13.92%), and Hyalomma kumari (61/862, 7.07%). A subset of 135 ticks were screened for Anaplasma spp. and Rickettsia spp. based on the amplification of partial 16 S rDNA and outer-membrane protein A (ompA) fragments, respectively. In total, 16 ticks (11.85%) were positive for Anaplasma spp. and Rickettsia spp. Obtained 16 S rDNA sequences for Anaplasma spp. detected in Ha. bispinosa and Ha. sulcata showed 99.98% identity with Anaplasma bovis, while other detected in Rh. microplus showed 99.84% identity with Candidatus Anaplasma boleense. Similarly, detected ompA sequence in Ha. sulcata showed 100% identity with Rickettsia sp. and 97.93% with Rickettsia slovaca, and another sequence detected in Rh. microplus showed 100% identity with Candidatus Rickettsia shennongii. In phylogenetic trees, these sequences clustered with corresponding species from Pakistan, China, Turkey, South Korea, South Africa, and Herzegovina. This is the first study reporting detection of A. bovis in Ha. bispinosa and Ha. sulcata, Ca. A. boleense in Rh. microplus collected from goats, and R. slovaca-like in Ha. sulcata. Our results enforce the need for regular surveillance of Rickettsiales in hard ticks infesting livestock in the region.

Keywords

Hard ticks
Anaplasma bovis
Candidatus Anaplasma boleense
Rickettsia
Ruminants
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Ticks are hematophagous ectoparasites, distributed in different ecoregions [1], where they parasitized terrestrial, semi-terrestrial, domestic and wild animals [2–4]. They are known to serve as reservoir and vector for wide varieties of pathogens such as viruses, protozoans (Babesia, Hepatozoon, and Theileria), and bacteria (Anaplasma, Borrelia, Coxiella, Ehrlichia, and Rickettsia) infecting different vertebrate hosts [5]. Ticks have great public concern and posing threats to economy [3, 6, 7].

Ticks are capable of causing life-threatening infections in animals and humans [8]. Globalization, geographic expansion, and changes in climate patterns have increase the dispersal of the hosts vectors of these Rickettsiales pathogens [9]. Two genera, Anaplasma and Rickettsia, consist of medically and veterinary important pathogens posing significant public and veterinary health burden [7, 10, 11]). Based on reliable genetic markers, there have been significant advancement in our knowledge about the diversity of novel tick-borne Rickettsial pathogens, while previously certain species that were considered non-pathogenic have been linked now with different animal and human infections [12].

Anaplasma is a diverse genus comprised of species with varied pathogenicity [13], and many hard ticks such as Rhipicephalus, Ixodes, Haemaphysalis, Dermacentor, and Amblyomma play a vector role in its transmission [13–16]. Previously, molecular based description revealed the presence of Anaplasma capra, Anaplasma marginale, and Anaplasma platys in Pakistan [3, 17–19]. Among Anaplasma spp., Anaplasma bovis was first described in 1931 [20] that has been detected in Rhipicephalus haemaphysaloides, Ixodes turdus, Haemaphysalis coccina, Haemaphysalis longicornis, Haemaphysalis punctata, Haemaphysalis danieli, and Hyalomma asiaticum, collected from domestic and wild animals [21–24]. The zoonotic potential of A. bovis has been confirmed in a patient blood in China [15]. Candidatus Anaplasma boleense was reported in Hy. asiaticum in China [25], and then in Rhipicephalus microplus feeding on cattle [4], buffaloes and deer [6, 25]. Pathogenicity, vector and non-vector transmission of Ca. A. boleense is still unknown [13].

The genus Rickettsia consists of mostly intracellular bacteria associated with arthropods [26, 27]. The geographic spread of known and novel Rickettsia spp. with an increasing rate to new hosts and regions is alarming [28]. Rickettsia species were classified into the spotted fever group (SFG), typhus group (TG), and ancestral group (AG) [29, 30]. Among these, SFG is the most diverse group having both pathogenic and undetermined Rickettsia spp., in which Rickettsia massiliae, Rickettsia roulti, Rickettsia conorii, Rickettsia hoogstraalii, Rickettsia aeschlimannii, and Candidatus Rickettsia shennongii have been reported in Pakistan [2, 18, 31–33]. Candidatus R. shennongii was detected in ticks including Rhipicephalus turanicus, Rh. haemaphysaloides, Rh. microplus, Rhipicephalus sanguineus [2, 18], and the pathogenic potential of Ca. R. shennongii in humans is still undetermined [15]. Species diversity in genus Rickettsia expand continuously and recently novel species have been identified based on reliable genetic markers [12, 34].

In Pakistan the presence of suitable habitat and landscape varieties support tick infestations on vertebrate hosts that act as reservoir for numerous tick-borne pathogens [31, 35, 36]. Keeping in view the importance of these pathogens, the present study aimed to molecularly examine ticks infesting cattle, goats, and sheep for the detection of Anaplasma and Rickettsia species in selected districts of Khyber Pakhtunkhwa (KP), Pakistan.

Materials and methods

Study area

This study was conducted in nine districts of KP province, Pakistan: Mardan (34.194697° N, 72.050557° E), Peshawar (34.039825° N, 71.566832° E), Nowshera (34.0105° N, 71.9876° E), Abbottabad (34.1688° N, 73.2215° E), Mansehra (34.3313° N, 73.1980° E), Haripur (33.9946° N, 72.9106° E), Dir Lower (34.9161° N, 92 71.8097° E), Dir Upper (35°12′30.06 ° N, 71°5231.22° E), and Swat (34.8065° N, 27.3548° E), from May 2022 to June 2023. This province situated in the northwest of Pakistan has climatic conditions suitable for different ticks and tick-borne pathogens, having arid plains, humid hilly areas with varied altitude and seasons. The geographic coordinates of each collection site in study area were collected from Google Maps using Global Positioning System to design the distribution map through ArcGIS 10.3.1 (Fig. 1).

Fig. 1 Map showing tick’s collection sites in selected district of Khyber Pakhtunkhwa, Pakistan

Ticks collections, preservation and identification

Ticks were collected during May 2022 to June 2023 from cattle, goats, and sheep in 9 districts (Fig. 1). In the survey region, ticks were collected from each infested host once, in pastures, farms, open field, and free roaming animals. To carry further molecular work, after washing with distilled water, ticks were stored in 1.5 ml Eppendorf tubes filled with 100% ethanol. Ticks were morphologically identified, using a stereo zoom microscope (SZ61, Olympus, Tokyo, Japan) with standard taxonomic keys [37–40].

DNA extraction and polymerase chain reaction

Total 135 ticks (one male, one female, and one nymph per species from each district) were selected randomly and subjected individually for DNA extraction, using phenol-chloroform method [41]. Extracted genomic DNA was quantified using NanoDrop (NanoQ, Optizen, Daejeon, Republic of Korea). To amplify the 16 S rDNA fragment of Anaplasma spp. and outer membrane protein A (ompA) of Rickettsia spp., genomic DNA was subjected to conventional PCR (GE-96G, BIOER, Hangzhou, China). The PCR was carried out in Thermal Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA), containing a reaction mixture of 25 µL comprised of 13 µL Dream Taq PCR MasterMix (2×) (Thermo Fisher Scientific, Inc., Waltham, MA, USA); 2 µL of primers (1 µL each forward and reverse) (Table 1), 2 µL (50 ng/µL) genomic DNA, and 8 µL nuclease-free water. The thermo-cycling conditions for 16 S rRNA and ompA genes were used as described previously [6, 34, 42, 43]. Nuclease free water was taken as a negative control, while DNA of A. marginale and R. massiliae were used as a positive control for Anaplasma spp. and Rickettsia spp., respectively. The amplified PCR products were run on agarose gel (1.5%) and observed through gel documentation (BioDoc-It™ Imaging Systems, UVP, LLC, Upland, CA, USA).

Table 1 Primers used for the detection of Anaplasma and Rickettsia DNA in ticks

Genes	Primers	Sequences (5′ − 3′)	Amplicon size	References	
Anaplasma spp./16S rDNA	Eh Out1	TTGAGAGTTTGATCCTGGCTCAGAAG	653 bp	[6]	
Eh Out2	CACCTCTACACTAGGAATTCCGCTATC	
Anaplasma spp./16S rDNA	EHR16SD	GGTACCYACAGAAGAAGTCC	344 bp	[42]	
EHR16SR	TAGCACTCATCGTTTACAGC	
Rickettsia spp./ompA	Rr190.70p

Rr190.701n

	ATGGCGAATATTTCTCCAAAA

GTTCCGTTAATGGCAGCATCT

	631 bp	[44]	

DNA sequencing and phylogenetic analysis

The amplified PCR products of 16 S rDNA and ompA fragments were sent for bidirectional sequencing (Macrogen, Inc., Seoul, Republic of Korea) using Sanger sequencing method. The obtained sequences were trimmed using SeqMan v. 5 (DNASTAR, lnc., Madison/WI, US) to remove poor reading and primer region sequences and subjected to Basic Local Alignment Search Tool (BLAST) [45], at the National Center for Biotechnology Information (NCBI). For subsequent phylogenetic trees construction, homologous sequences and an appropriate outgroup were downloaded from GenBank and aligned with obtained sequences using BioEdit alignment editor v 7.0.5 using ClustalW Multiple alignment [46]. Phylogenetic trees were constructed in Molecular Evolutionary Genetics Analysis (MEGA-X), using Maximum Likelihood method with Tamura-Nei model [47], and 1,000 bootstrap replicates.

Ethical considerations

The permission to execute, an ethical approval for the study was given by the Advance Studies Research Board (ASRB: Dir/A&R/AWKUM/2022/9396), Abdul Wali Khan University, Mardan KP, Pakistan. After explaining the importance of the study verbal consent was obtained from each of the cattle owners.

Statistical analysis

The recorded data such as the number of animals hosts, collected ticks, their different life stages in nine districts, and associated pathogens was organized in spread sheet and analyzed for descriptive statistics (Microsoft Excel v. 2016, Microsoft 365®). Host’s infestation was calculated by dividing infested hosts by total examined hosts. The differences were considered significant at p-value < 0.05 with 95% confidence interval (CI) by applying chi-square test among variable using the GraphPad Prism v. 8 (Inc., San Diego, CA, USA).

Results

Tick and hosts data

Overall, 862 ticks were collected from 117 (46.42%) out of 252 examined hosts. The infested hosts were 32 cattle, 40 goats, and 45 sheep. Highest infestation was observed in district Peshawar (21/32, 65.62%), followed by Mardan (17/30, 56.66%), Nowshera (12/24, 50%), Haripur (14/31, 45.16%), Abbottabad (13/29, 44.82%), Dir Lower (14/34, 41.17%), Dir Upper (9/23, 39.13%), Mansehra (8/22, 36.36%), and Swat (9/27, 33.33%). Based on morphology, ticks belonging to three genera (Haemaphysalis, Rhipicephalus, Hyalomma) were identified in which 235 (27.27%) were nymphs, 348 (40.37%) were females and 279 (32.36%) were males. Among identified ticks, highest infestation was observed for Rh. microplus (305/862, 35.38%), followed by Ha. sulcata (243/862, 28.19%), Hyalomma anatolicum (133/862, 15.42%), Haemaphysalis bispinosa (120/862, 13.92%), and Hyalomma kumari (61/862, 7.07%). Rh. microplus, Ha. sulcata and Hy. anatolicum were found on goats, sheep, and cattle, while Ha. bispinosa and Hy. kumari were found only on goats and sheep (Table 2).

Table 2 Distribution, prevalence and detection rate of Anaplasma spp. and Rickettsia spp. in different ticks collected from different hosts

District	Hosts	Infested/examined host	Identified tick’s species	Collected Ticks	95% CI	p-value	Ticks subjected to PCR	Detected A.bovis	Detected Ca. A. boleense	Detected R. slovaca-like	Detected Ca. R. shennongii	
Nowshera	Goats	5/9	Ha. bispinosa

Ha. sulcata

	2 N, 7 F, 4 M

4 N, 5 F, 5 M

	−1.38–56.68	0.0035	1 N, 1 F, 1 M

0 N, 0 F, 0 M

					
Sheep	4/11	Hy. kumari

Ha. sulcata

Hy. anatolicum

	2 N, 5 F, 2 M

7 N, 10 F, 9 M

2 N 4 F, 1 M,

	1 N, 1 F, 1 M

1 N, 1 F, 1 M

0 N, 0 F, 0 M

					
Cattle	3/4	Rh. microplus

Hy. anatolicum

	21 N, 21 F, 21 M

1 N, 3 F, 2 M

	1 N, 1 F, 1 M

1 N, 1 F, 1 M

					
Total		12/24, 50%		39 N, 55 F, 44 M			5 N, 5 F, 5 M					
Abbottabad	Goats	6/11	Rh. microplus

Ha. bispinosa

Hy. anatolicum

	3 N, 5 F, 4 M

4 N, 7 F, 6 M

1 N, 4 F, 5 M

	8.45–40.33	0.04	1 N, 1 F, 1 M

1 N, 1 F, 1 M

0 N, 0 F, 0 M

		1 F			
Sheep	4/9	Rh. microplus

Ha. sulcata

Hy. kumari

	1 N, 4 F, 3 M

12 N, 13 F, 10 M

2 N, 4 F, 3 M

	0 N, 0 F, 0 M

1 N, 1 F, 1 M

1 N, 1 F, 1 M

					
Cattle	3/9	Rh. microplus

Hy. anatolicum

	4 N, 10 F, 6 M

2 N, 5 F, 4 M

	0 N, 0 F, 0 M

1 N, 1 F, 1 M

					
Total		13/29, 44.8%		29 N, 52 F, 41 M			5 N, 5 F, 5 M					
Peshawar	Goats	8/12	Ha. sulcata

Ha. bispinosa

	21 N, 15 F, 9 M

4 N, 10 F, 8 M

	8.09–56.70	0.07	1 N, 1 F, 1 M

1 N, 1 F, 1 M

					
Sheep	9/14	Rh. microplus

Hy. kumari

Hy. anatolicum

	10 N, 12 F, 8 M

4 N, 4 F, 4 M

2 N, 5 F, 4 M

	1 N, 1 F, 1 M

0 N, 0 F, 0 M

1 N, 1 F, 1 M

				1 N, 1 F	
Cattle	4/6	Rh. microplus

Hy. anatolicum

	11 N, 8 F, 11 M

2 N, 7 F, 3 M

	0 N, 0 F, 0 M

1 N, 1 F, 1 M

					
Total		21/32, 65.62%		54 N, 61 F, 47 M			5 N, 5 F, 5 M					
Mansehra	Goats	2/8	Rh. microplus

Ha. bispinosa

	1 N, 1 F, 1 M

3 N, 5 F, 5 M

	5.68–14.71	0.045	0 N, 0 F, 0 M

1 N, 1 F, 1 M

					
Sheep	3/9	Rh. microplus

Hy. kumari

	1 N, 1 F, 1 M

1 N, 2 F, 1 M

			1 N, 1 F, 1 M

1 N, 1 F, 1 M

				1 N, 1 F	
Cattle	3/5	Rh. microplus

Ha. sulcata

Hy. anatolicum

	1 N, 3 F, 2 M

2 N, 4 F, 6 M

2 N, 4 F, 4 M

	0 N, 0 F, 0 M

1 N, 1 F, 1 M

1 N, 1 F, 1 M

					
Total		8/22, 36.36%		11 N, 20 F, 20 M			5 N, 5 F, 5 M					
Mardan	Goats	6/8	Ha. sulcata

Ha. bispinosa

Rh. microplus

	4 N, 4 F, 4 M

3 N, 5 F, 3 M

6 N, 6 F, 6 M

	1.18–50.81	0.001	1 N, 1 F, 1 M

1 N, 1 F, 1 M

0 N, 0 F, 0 M

	1 N

1 N

				
Sheep	7/13	Rh. microplus

Hy. kumari

	4 N, 4 F, 4 M

2 N, 4 F, 2 M

			1 N, 1 F, 1 M

1 N, 1 F, 1 M

		1 N			
Cattle	4/9	Rh. microplus

Ha. sulcata

Hy. anatolicum

	8 N, 12 F, 8 M

4 N, 8 F, 6 M

4 N, 11 F, 8 M

	0 N, 0 F, 0 M

0 N, 0 F, 0 M

1 N, 1 F, 1 M

					
Total		17/30, 56.66%		35 N, 54 F, 41 M			5 N, 5 F, 5 M					
Haripur	Goats	4/11	Ha. sulcata

Ha. bispinosa

Hy. anatolicum

	2 N, 5 F, 4 M

4 N, 5 F, 10 M

1 N, 3 F, 2 M

	6.92–29.07	0.05	0 N, 0 F, 0 M

1 N, 1 F, 1 M

0 N, 0 F, 0 M

					
Sheep	7/15	Rh. microplus

Hy. kumari

Ha. sulcata

	4 N, 7 F, 4 M

2 N, 3 F, 2 M

1 N, 3 F, 1 M

			1 N, 1 F, 1 M

1 N, 1 F, 1 M

1 N, 1 F, 1 M

			1 N, 1 F	1 N, 1 F	
Cattle	3/5	Rh. microplus

Ha. sulcata

Hy. anatolicum

	6 N, 6 F, 3 M

1 N, 3 F, 2 M

2 N, 3 F, 1 M

	0 N, 0 F, 0 M

0 N, 0 F, 0 M

1 N, 1 F, 1 M

					
Total		14/31, 45%		23 N, 38 F, 29 M			5 N, 5 F, 5 M					
Swat	Goats	3/12	Ha. bispinosa

Ha. sulcata

	2 N, 4 F, 2 M

2 N, 2 F, 2 M

	0.79–23.20	0.05	1 N, 1 F, 1 M

0 N, 0 F, 0 M

					
Sheep	4/10	Ha. sulcata

Hy. kumari

	2 N, 2 F, 2 M

1 N, 1 F, 0 M

			1 N, 1 F, 1 M

1 N, 1 F, 1 M

					
Cattle	2/5	Rh. microplus

Ha. sulcata

Hy. anatolicum

	4 N, 7 F, 6 M

2 N, 4 F, 7 M

1 N, 4 F, 3 M

	1 N, 1 F, 1 M

0 N, 0 F, 0 M

1 N, 1 F, 1 M

					
Total		9/27, 33.33%		14 N, 24 F, 22 M			5 N, 5 F, 5 M					
Dir Upper	Goats	3/8	Ha. bispinosa

Ha. sulcata

Hy. anatolicum

	2 N, 2 F, 2 M

2 N, 2 F, 2 M

3 N, 3 F, 3 M

	1.85–18.54	0.26	1 N, 1 F, 1 M

0 N, 0 F, 0 M

0 N, 0 F, 0 M

					
Sheep	3/11	Rh. microplus

Hy. kumari

Hy. anatolicum

	1 N, 1 F, 1 M

1 N, 1 F, 1 M

3 N, 3 F, 2 M

	1 N, 1 F, 1 M

1 N, 1 F, 1 M

1 N, 1 F, 1 M

				1 N, 1 F	
Cattle	 3/4	Rh. microplus

Ha. sulcata

Hy. anatolicum

	1 N, 4 F, 1 M

3 N, 4 F, 3 M

0 N, 0 F, 0 M

	0 N, 0 F, 0 M

1 N, 1 F, 1 M

0 N, 0 F, 0 M

					
Total		9/23, 39.13%		16 N, 20 F, 15 M			5 N, 5 F, 5 M					
Dir Lower	Goats	5/9	Ha. bispinosa

Ha. sulcata

Hy. anatolicum

	3 N, 5 F, 3 M

4 N, 5 F, 9 M

0 N, 1 F, 1 M

	4.99–18.20	0.04	1 N, 1 F, 1 M

1 N, 1 F, 1 M

0 N, 0 F, 0 M

					
Sheep	5/15	Rh. microplus

Hy. kumari

Hy. anatolicum

	1 N, 3 F, 1 M

2 N, 4 F, 1 M

0 N, OF, 0 M

	1 N, 1 F, 1 M

1 N, 1 F, 1 M,

				1 N, 1 F	
Cattle	4/10	Rh. microplus

Hy. anatolicum

	3 N, 5 F, 3 M

1 N, 1 F, 2 M

	0 N, 0 F, 0 M

1 N, 1 F, 1 M

					
Total		14/34, 41.17%		14 N, 24 F, 20 M			5 N, 5 F, 5 M					
Overall total	117/252, 46.42%		235 N, 348 F, 279 M			45 N, 45 F, 45 M	2/135, (1.48%)	2/135, (1.48%)	2/135, (1.48%)	10/135, (7.40%)	
Note: N: Nymphs, M: Males, F: Females

Detection of Anaplasma spp. and Rickettsia spp

Out of 862 collected ticks (male, female, nymph), 135 were analyzed for the molecular detection of Anaplasma spp. and Rickettsia spp. Overall detection rate for both Anaplasma spp. and Rickettsia spp. was 11.85% (16/135). Among the five screened tick species, highest infection rate was noted for Rh. microplus (12/135, 8.88%) followed by Ha. sulcata (3/135, 2.22%), and Ha. bispinosa (1/135, 0.74%), while no positive case was found in Hy. anatolicum and Hy. kumari. The highest detection rate was found in district Haripur (4/135, 2.96%) followed by Mardan (3/135, 2.22%), Peshawar (2/200, 1.48%), Mansehra (2/200, 1.48%), Dir Upper (2/200, 1.48%), Dir lower (2/200, 1.48%), and Abbottabad (1/135, 0.74%) (Table 2).

Sequencing and phylogenetic analysis

Total 16 DNA sequences (12 for ompA and 4 for 16 S rDNA) were obtained from different ticks. A. bovis was detected in Ha. bispinosa and Ha. sulcata collected from goats, and Ca. A. boleense in Rh. microplus collected from goats and sheep. Based on 16 S rDNA, two fragments were amplified using two set of primers, EHR16SD-EHR16SR and Eh-Out1 forward -Eh-Out2 reverse. In the case of EHR16SF, EHR16SR, a final 280 bp contig was obtained for A. bovis which was unsuccessfully amplified for Ca. A. boleense. In case of Eh-Out1-Eh-Out2, a final 622 bp contig was obtained for Ca. A. boleense which was unsuccessfully amplified for A. bovis. Therefore, two separate phylogenic trees were constructed for Anaplasma spp.

Based on ompA, two Rickettsia spp. were detected, R. slovaca-like and Ca. R. shennongii in Ha. sulcata and Rh. microplus, respectively, collected from sheep (Table 2). Identical sequences for 16 S rDNA and ompA were considered as a single consensus sequence. The BLAST analysis of 16 S rDNA sequences obtained from Ha. bispinosa and Ha. sulcata showed maximum identity 99.98% with A. bovis reported in South Korea (MK028574) and China (MF289479). Another Anaplasma sequence obtained from Rh. microplus showed maximum 99.84% identity with the Ca. A. boleense reported from South Africa (MK814450) and China (KU586169). Similarly, the BLAST analysis of Rickettsia sp. detected in Ha. sulcata showed 100% identity with Rickettsia sp. reported from Pakistan (MN548866) and 97.93% with R. slovaca reported from Turkey (MK726320), China (KX506733), Herzegovina (KT805229), and Iran (MW779484). Another Rickettsia species detected in Rh. microplus showed maximum 100% identity with Ca. R. shennongii reported from Pakistan (OP820485 and OQ632789) and 99.07% from China (OL856104).

In phylogenetic tree, obtained A. bovis sequence clustered with same species reported from South Korea and China (Fig. 2), while that of Ca. A. boleense clustered with same species reported from China and South Africa (Fig. 3). Similarly, the obtained sequences for R. slovaca-like grouped in a sister clade with Rickettsia sp. reported from Pakistan and R. slovaca reported from Turkey, and Herzegovina, while that of Ca. R. shennongii grouped with same species reported from China and Pakistan (Fig. 4). The obtained sequences were deposited to GenBank under the accession number PP177470, PP177468, PP194444, PP194443.

Fig. 2 Phylogenetic tree based on 16 S rDNA sequence for Anaplasma bovis using Maximum likelihood method (Tamura–Nei model). Anaplasma camelii was taken as the outgroup, using supporting values (1000 replicons) at each node. The sequence (PP177470) obtained in the present study are shown by underline fonts

Fig. 3 Phylogenetic tree for Anaplasma spp. based on 16 S rDNA sequences, using Maximum likelihood method (Tamura–Nei model). The Anaplasma camelii, Anaplasma platys and Anaplasma odocoilei was taken as the outgroup. The 1000 bootstraping values were followed. The sequence (PP177468) obtained in the present study are shown by underline fonts

Fig. 4 Phylogenetic tree based on ompA sequences of Rickettsia spp. using Maximum likelihood method (Tamura–Nei model). The Rickettsia akari and Rickettsia tamurae was taken as the outgroup, using supporting values (1000 replicons) at each node. The sequences (PP194443, PP194444) obtained in the present study are shown by underline fonts

Discussion

Ticks are potential vectors of important pathogens, posing threats to public and veterinary health. The geo-climatic conditions of Pakistan are suitable for tick’s survival and propagation of associated pathogens [18, 48, 49]. In Pakistan, studies have been conducted regarding ticks and tick-borne pathogens however, unidentified diversity of Anaplasma spp. and Rickettsia spp. have been often neglected. Therefore, using suitable genetic markers, insights into this knowledge gap is needed to report unidentified tick-borne pathogens. The present study reported the detection of two Anaplasma spp. (A. bovis and Ca. A. boleense) and two SFG Rickettsia spp. (R. slovaca-like and Ca. R. shennongii) in various ticks from different regions.

Cattle were found infested by Rh. microplus, Ha. sulcata, and Hy. anatolicum. In previous studies in the region, Rh. microplus, Hy. anatolicum, Hyalomma dromedarii, Hyalomma scupense, Hyalomma isaaci, Rh. haemaphysaloides, and Haemaphysalis montgomeryi infestation have been reported on cattle [18, 33, 35, 36, 50. The infestation of cattle, goats, and sheep with Rh. microplus may be due to habitat sharing and their abundance in the region, while broad infestation ranges of Ha. sulcata (cattle, goats and sheep) and Hy. kumari (goats and sheep), may be linked to the completion of their lifecycle on three hosts. Goats and sheep have been reported infested by ticks including Rh. microplus, Rh. turanicus, Rh. sanguineus, Rh. haemaphysaloides, Ha. sulcata, Ha. bispinosa, Ha. cornupunctata, Haemaphysalis kashmirensis, Ha. danieli, Ha. montgomeryi, Hy. kumari, Hy. anatolicum, and Hy. dromedarii in different region of Pakistan [32, 35, 36, 49–52]. Hyalomma kumari has been found to infest nearly all domestic animals in the study areas where rainfall is high [32].

This study report first time detection of A. bovis in Ha. sulcata and Ha. bispinosa infesting goats. Previously, A. bovis has also been detected in Rh. sanguineus, Ha. longicornis, Rh. haemaphysaloides, Rh. turanicus, Ha. qinghaiensis, Dermacentor abaensis, and Ha. punctata in China, Israel, Taiwan, Korea, and Spain [21–23, 53, 54], while in cattle blood in Pakistan [55]. Previously, A. bovis has been reported in tick belonging to the genus Haemaphysalis from Asia and America [56]. Herein, the association of A. bovis with two new Haemaphysalis tick species infesting goats, suggest zoonotic threats to livestock holders. The detection of A. bovis in ticks infesting different host emphasized further insight to screen other tick species for this pathogen in the region.

Candidatus Anaplasma boleense was detected for the first time in Rh. microplus infesting goats and sheep in Pakistan. Previously, the detection of this Anaplasma sp. in tick genra such as Haemaphysalis, Rhipicephalus, and Hyalomma, and blood samples from domestic animals [13, 15, 57], indicate the role of these ticks as possible vectors, showing the broad hosts range and geographical distribution of Ca. A. boleense. In the survey region, the detection of new Anaplasma spp. predict their broad diversity than expected and highlight the importance of one-health approach to establish effective surveillance programs particularly about vector, hosts, pathogenicity, and geographical distribution. Ticks infected with Anaplasma spp. may be of significant health concern; for instance, the zoonotic potential of A. phagocytophilium, A. bovis, A. ovis, A. platys, and A. capra has broad medical relevance [24, 58]. Genetic characterization of Anaplasma spp. have been effectively achieved through mitochondrial 16 S rDNA sequences [59]. The obtained sequences of A. bovis and Ca. A. boleense showed maximum identity and in phylogenetic trees clustered with corresponding species. In previous studies Ca. A. boleense was not fully characterized and has been referred as A. phagocytophilium-like 2 and A. phagocytophilium-like clade B in China [60].

Candidatus Rickettsia shennongii was detected in Rh. microplus. This Rickettsia sp. has been reported in Rh. haemaphysaloides in China [15], and recently, in Pakistan in Rh. turanicus, Rh. haemaphysaloides, Rh. sanguineus, and Rh. microplus [2, 18]. The detection of Ca. R. shennongii in expanded geographic range and different tick species infesting livestock provide evidences that the reported ticks have possible role in its spreading thus, further insights are needed to assess its possible zoonotic role. The member of SFG Rickettsia spp., R. slovaca-like was detected for the first time in Pakistan in Ha. sulcata infesting sheep. Further surveillance studies are needed to explore their host and geographic range, and its possible zoonotic outcomes. Phylogenetic analysis of Rickettsia spp. relies on ompA gene that has higher degree of intraspecific variations [61]. Based on ompA gene, to be considered as a valid Rickettsia sp., the obtained sequence similarity should not be less than 98.8% with the most homologous validated species [62]. The obtained ompA sequence of R. slovaca-like showed maximum identity of 97.93% with R. slovaca reported from different countries. The detection of two geno-variants candidate species (Ca. A. boleense and Ca. R. Shennogii) and R. slovaca-like point out the diversity of undescribed Rickettsiales in Pakistan. Thus, regular surveillance is needed to explore emerging rickettsial pathogens, transmission, zoonotic potential, and impacts on hosts.

Conclusion

The effective control management of tick-borne pathogens solely based on understanding their epidemiological surveillance and public awareness. This study reported A. bovis, Ca. A. boleense, and R. slovaca-like for the first time in hard ticks infesting cattle, goat and sheep in Pakistan, posing threats to animal’s and animal-keepers health. The detected pathogens indicate the broad diversity and zoonotic threats associated to tick-borne pathogens in the region. Further attentions should be focused to improve public awareness and assist the policy makers in designing effective control programs to avoid any zoonotic consequences associated with these pathogens.

Acknowledgements

The authors are grateful of Higher Education Commission (HEC) and the Pakistan Science Foundation (PSF), and appreciate their financial support by providing the necessary funding for this research. The researchers supporting project number (RSP2024R494), King Saud University, Riyadh, Saudi Arabia.

Author contributions

The experimental idea was designed by Abid Ali. Zaibullah Khan, Shafi Ullah, and Farman Ullah collected the tick samples and performed the experiments. Abid Ali, Shafi Ullah, Zaibullah Khan, Mashal M. Almutairi, Abdulaziz Alouffi, Mohammed Ibrahim, Momin Khan, Gauhar Rehman, Tetsuya Tanaka, and Farman Ullah performed different analysis. All authors performed interpretation and refinement. All authors have read and agreed to the published version of the manuscript.

Funding

Higher Education Commission (HEC) and the Pakistan Science Foundation (PSF) contributed for financial support by providing the necessary funding for this research. The researchers supporting project number (RSP2024R494), King Saud University, Riyadh, Saudi Arabia.

Data availability

All relevant data is within the manuscript. In this study the obtained sequences have been submitted to GenBank under accession numbers PP177468 for Ca. A. boleense, PP177470 for Anaplasma bovis, PP194443 for Ca. R. shennongii, and PP194444 for R. slovaca-like.

Declarations

Ethical approval

The owners of the form were informed before animals handling for tick’s collection. Animals were handled with care to minimize discomfort. All the employed procedure in this research adhere to the ethical guidelines implemented by the Advance Studies Research Board (ASRB: Dir/A&R/AWKUM/2022/9396), Abdul Wali Khan University, Mardan KP, Pakistan.

Consent for publication

Not applicable.

Consent to participate

Before tick’s collection informed consent was obtained from all cattle owners.

Competing interests

The authors declare no competing interests.

Abbreviations

KP Khyber Pakhtunkhwa

ompA Outer membrane protein A

BLAST Basic Local Alignment Search Tool

SFGR Spotted Fever Group Rickettsia

MEGA Molecular Evolutionary Genetics Analysis

NCBI National Center for Biotechnology Information

PCR Polymerase Chain Reaction

rDNA Ribosomal DNA

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Guglielmone AA Nava S Robbins RG Geographic distribution of the hard ticks (Acari: Ixodida: Ixodidae) of the world by countries and territories Zootaxa 2023 5251 1 274 10.11646/zootaxa.5251.1.1 37044740
Guglielmone AA, Nava S, Robbins RG. Geographic distribution of the hard ticks (Acari: Ixodida: Ixodidae) of the world by countries and territories. Zootaxa. 2023;5251:1–274. 10.11646/zootaxa.5251.1.137044740 10.11646/zootaxa.5251.1.1
2. Shehla S Ullah F Alouffi A Almutairi MM Khan Z Tanaka T Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with different hard ticks infesting livestock hosts Pathogens 2023 12 9 1080 10.3390/pathogens12091080 37764888
Shehla S, Ullah F, Alouffi A, Almutairi MM, Khan Z, Tanaka T, et al. Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with different hard ticks infesting livestock hosts. Pathogens. 2023;12(9):1080. 10.3390/pathogens1209108037764888 10.3390/pathogens12091080
3. Khan Z Shehla S Alouffi A Kashif Obaid M Zeb Khan A Almutairi MM Molecular survey and genetic characterization of Anaplasma marginale in ticks collected from livestock hosts in Pakistan Animals 2022 12 1708 10.3390/ani12131708 35804607
Khan Z, Shehla S, Alouffi A, Kashif Obaid M, Zeb Khan A, Almutairi MM, et al. Molecular survey and genetic characterization of Anaplasma marginale in ticks collected from livestock hosts in Pakistan. Animals. 2022;12:1708. 10.3390/ani1213170835804607 10.3390/ani12131708
4. Xu J Gu XL Jiang ZZ Cao XQ Wang R Peng QM Pathogenic Rickettsia, Anaplasma, and Ehrlichia in Rhipicephalus microplus ticks collected from cattle and laboratory hatched tick larvae Negl Trop Dis 2023 17 11546 10.1371/journal.pntd.0011546
Xu J, Gu XL, Jiang ZZ, Cao XQ, Wang R, Peng QM, et al. Pathogenic Rickettsia, Anaplasma, and Ehrlichia in Rhipicephalus microplus ticks collected from cattle and laboratory hatched tick larvae. Negl Trop Dis. 2023;17:11546. 10.1371/journal.pntd.001154610.1371/journal.pntd.0011546
5. Grassi L Menandro ML Cassini R Mondin A Pasotto D Grillini M High prevalence of tick-borne zoonotic Rickettsia slovaca in ticks from wild boars, northeastern Italy Animals 2022 12 967 10.3390/ani12080967 35454214
Grassi L, Menandro ML, Cassini R, Mondin A, Pasotto D, Grillini M, et al. High prevalence of tick-borne zoonotic Rickettsia slovaca in ticks from wild boars, northeastern Italy. Animals. 2022;12:967. 10.3390/ani1208096735454214 10.3390/ani12080967
6. Guo WP, Tian JH, Lin XD, Ni XB, Chen XP, Liao Y, et al. Extensive genetic diversity of Rickettsiales bacteria in multiple mosquito species. Sci Rep. 2016;6:38770. 10.1038/srep38770
7. Parola P Paddock CD Socolovschi C Labruna MB Mediannikov O Kernif T Update on tick-borne rickettsiosis around the world: a geographic approach Clin Microbiol rev 2013 26 657 702 10.1128/CMR.00032-13 24092850
Parola P, Paddock CD, Socolovschi C, Labruna MB, Mediannikov O, Kernif T, et al. Update on tick-borne rickettsiosis around the world: a geographic approach. Clin Microbiol rev. 2013;26:657–702. 10.1128/CMR.00032-1324092850 10.1128/CMR.00032-13
8. Bui DC Luo T McBride JW Type 1 secretion system and effectors in Rickettsiales Front Cell Infect Microbiol 2023 13 1175688 10.3389/fcimb.2023.1175688 37256108
Bui DC, Luo T, McBride JW. Type 1 secretion system and effectors in Rickettsiales. Front Cell Infect Microbiol. 2023;13:1175688. 10.3389/fcimb.2023.117568837256108 10.3389/fcimb.2023.1175688
9. Matos AL Curto P Simões I Moonlighting in Rickettsiales: expanding virulence landscape Trop Med Infect Dis 2022 7 32 10.3390/tropicalmed7020032 35202227
Matos AL, Curto P, Simões I. Moonlighting in Rickettsiales: expanding virulence landscape. Trop Med Infect Dis. 2022;7:32. 10.3390/tropicalmed702003235202227 10.3390/tropicalmed7020032
10. Rar V Golovljova I Anaplasma, Ehrlichia, and Candidatus Neoehrlichia bacteria: pathogenicity, biodiversity, and molecular genetic characteristics, a review Infect Gen Evol 2011 11 8 1842 61 10.1016/j.meegid.2011.09.019
Rar V, Golovljova I. Anaplasma, Ehrlichia, and Candidatus Neoehrlichia bacteria: pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infect Gen Evol. 2011;11(8):1842–61. 10.1016/j.meegid.2011.09.01910.1016/j.meegid.2011.09.019
11. Zhang YY Sun YQ Chen JJ Teng AY Wang T Li H Mapping the global distribution of spotted fever group Rickettsiae: a systematic review with modelling analysis Lancet Digit Health 2022 5 1 5 15 10.1016/S2589-7500(22)00212-6
Zhang YY, Sun YQ, Chen JJ, Teng AY, Wang T, Li H, et al. Mapping the global distribution of spotted fever group Rickettsiae: a systematic review with modelling analysis. Lancet Digit Health. 2022;5(1):5–15. 10.1016/S2589-7500(22)00212-610.1016/S2589-7500(22)00212-6
12. Jin X Liao J Chen Q Ding J Chang H Lyu Y Diversity of Rickettsiales bacteria in five species of ticks collected from Jinzhai County, Anhui Province, China in 2021–2022 Front Microbiol 2023 14 1141217 10.3389/fmicb.2023.1141217 37187539
Jin X, Liao J, Chen Q, Ding J, Chang H, Lyu Y, et al. Diversity of Rickettsiales bacteria in five species of ticks collected from Jinzhai County, Anhui Province, China in 2021–2022. Front Microbiol. 2023;14:1141217. 10.3389/fmicb.2023.114121737187539 10.3389/fmicb.2023.1141217
13. Sebastian PS Panizza MNM Ríos I.J.M.G, Ríos IJMG Tarragona EL Trova GB Molecular detection and phylogenetic analysis of Anaplasma platys-like and Candidatus Anaplasma boleense strains from Argentina Comp Immunol Microbiol Infect Dis 2023 96 101980 10.1016/j.cimid.2023.101980 37079984
Sebastian PS, Panizza MNM, Ríos I.J.M.G, Ríos IJMG, Tarragona EL, Trova GB, et al. Molecular detection and phylogenetic analysis of Anaplasma platys-like and Candidatus Anaplasma boleense strains from Argentina. Comp Immunol Microbiol Infect Dis. 2023;96:101980. 10.1016/j.cimid.2023.10198037079984 10.1016/j.cimid.2023.101980
14. Fernandes SJ Matos CA Freschi CR de Souza Ramos IA Machado RZ André MR Diversity of Anaplasma species in cattle in Mozambique Ticks Tick Borne Dis 2019 10 651 64 10.1016/j.ttbdis.2019.02.012 30833198
Fernandes SJ, Matos CA, Freschi CR, de Souza Ramos IA, Machado RZ, André MR, et al. Diversity of Anaplasma species in cattle in Mozambique. Ticks Tick Borne Dis. 2019;10:651–64. 10.1016/j.ttbdis.2019.02.01230833198 10.1016/j.ttbdis.2019.02.012
15. Lu M Meng C Gao X Wang L Xu X Li N Diversity of Rickettsiales in Rhipicephalus microplus ticks collected in domestic ruminants in Guizhou Province, China Pathogens 2022 11 1108 10.3390/pathogens11101108 36297165
Lu M, Meng C, Gao X, Wang L, Xu X, Li N, et al. Diversity of Rickettsiales in Rhipicephalus microplus ticks collected in domestic ruminants in Guizhou Province, China. Pathogens. 2022;11:1108. 10.3390/pathogens1110110836297165 10.3390/pathogens11101108
16. De La Fourniere S Guillemi EC Paoletta MS Paoletta MS Pérez A Obregón D Transovarial transmission of Anaplasma marginale in Rhipicephalus microplus ticks results in a bottleneck for strain diversity Pathogens 2023 12 8 1010 10.3390/pathogens12081010 37623970
De La Fourniere S, Guillemi EC, Paoletta MS, Paoletta MS, Pérez A, Obregón D, et al. Transovarial transmission of Anaplasma marginale in Rhipicephalus microplus ticks results in a bottleneck for strain diversity. Pathogens. 2023;12(8):1010. 10.3390/pathogens1208101037623970 10.3390/pathogens12081010
17. Alam S Khan M Alouffi A Almutairi MM Ullah S Numan M Spatio-temporal patterns of ticks and molecular survey of Anaplasma marginale, with notes on their phylogeny Microorganisms 2022 10 8 1663 10.3390/microorganisms10081663 36014081
Alam S, Khan M, Alouffi A, Almutairi MM, Ullah S, Numan M, et al. Spatio-temporal patterns of ticks and molecular survey of Anaplasma marginale, with notes on their phylogeny. Microorganisms. 2022;10(8):1663. 10.3390/microorganisms1008166336014081 10.3390/microorganisms10081663
18. Ali A Ullah S Numan M Almutairi M Alouffi A Tanaka T First report on tick-borne pathogens detected in ticks infesting stray dogs near butcher shops Front Vet Sci 2023 10 1246871 10.3389/fvets.2023.1246871 37799410
Ali A, Ullah S, Numan M, Almutairi M, Alouffi A, Tanaka T. First report on tick-borne pathogens detected in ticks infesting stray dogs near butcher shops. Front Vet Sci. 2023;10:1246871. 10.3389/fvets.2023.124687137799410 10.3389/fvets.2023.1246871
19. Ahmad I Ullah S Alouffi A Almutairi MM Numan M Tanaka T First Molecular-based confirmation of Dermacentor marginatus and associated Rickettsia raoultii and Anaplasma marginale in the Hindu Kush Mountain Range Animals 2023 13 23 3686 10.3390/ani13233686 38067036
Ahmad I, Ullah S, Alouffi A, Almutairi MM, Numan M, Tanaka T, et al. First Molecular-based confirmation of Dermacentor marginatus and associated Rickettsia raoultii and Anaplasma marginale in the Hindu Kush Mountain Range. Animals. 2023;13(23):3686. 10.3390/ani1323368638067036 10.3390/ani13233686
20. Donatien F, Lestoquard F. Rickettsia bovis, nouvelle espece pathogene pour le boeuf. Bull Soc Pathol Exot. 1936;29:1057–61.
21. Palomar AM, Portillo A, Santibáñez P, Mazuelas D, Roncer L, García Álvarez L et al. Detection of tick borne Anaplasma bovis, Anaplasma phagocytophilum and Anaplasma centrale in Spain. Med vet entomol, (2015) 29:349–353. 10.1111/mve.12124
22. Han R Yang JF Mukhtar MU Chen Z Niu L Lin YQ Molecular detection of Anaplasma infections in ixodid ticks from the Qinghai-Tibet Plateau Infect dis Poverty 2019 8 83 90 10.1186/s40249-019-0522-z 31578157
Han R, Yang JF, Mukhtar MU, Chen Z, Niu L, Lin YQ, et al. Molecular detection of Anaplasma infections in ixodid ticks from the Qinghai-Tibet Plateau. Infect dis Poverty. 2019;8:83–90. 10.1186/s40249-019-0522-z31578157 10.1186/s40249-019-0522-z
23. Kuo CC Huang JL Chien CH Shih HC Wang HC First molecular detection of Anaplasma phagocytophilum in the hard tick Rhipicephalus haemaphysaloides in Taiwan Exp Appl Acarol 2018 75 437 43 10.1007/s10493-018-0283-6 30116923
Kuo CC, Huang JL, Chien CH, Shih HC, Wang HC, et al. First molecular detection of Anaplasma phagocytophilum in the hard tick Rhipicephalus haemaphysaloides in Taiwan. Exp Appl Acarol. 2018;75:437–43. 10.1007/s10493-018-0283-630116923 10.1007/s10493-018-0283-6
24. Guo WP Tie WF Meng S Li D Wang JL Du LY Extensive genetic diversity of Anaplasma bovis in ruminants in Xian, China Ticks tick Borne dis 2020 11 5 101477 10.1016/j.ttbdis.2020.101477 32723632
Guo WP, Tie WF, Meng S, Li D, Wang JL, Du LY, et al. Extensive genetic diversity of Anaplasma bovis in ruminants in Xian, China. Ticks tick Borne dis. 2020;11(5):101477. 10.1016/j.ttbdis.2020.10147732723632 10.1016/j.ttbdis.2020.101477
25. Kang YJ Diao XN Zhao GY Chen MH Xiong Y ShiM Extensive diversity of Rickettsiales bacteria in two species of ticks from China and the evolution of the Rickettsiales BMC evol biol 2014 14 1 12 10.1186/s12862-014-0167-2
Kang YJ, Diao XN, Zhao GY, Chen MH, Xiong Y, ShiM, et al. Extensive diversity of Rickettsiales bacteria in two species of ticks from China and the evolution of the Rickettsiales. BMC evol biol. 2014;14:1–12. 10.1186/s12862-014-0167-210.1186/s12862-014-0167-2
26. Blanton LS The rickettsioses: a practical update Infect Dis Clin 2019 33 1 213 29 10.1016/j.idc.2018.10.010
Blanton LS. The rickettsioses: a practical update. Infect Dis Clin. 2019;33(1):213–29. 10.1016/j.idc.2018.10.01010.1016/j.idc.2018.10.010
27. El Karkouri K Ghigo E Raoult D Fournier PE Genomic evolution and adaptation of arthropod-associated Rickettsia Sci Rep 2022 12 380 10.1038/s41598-022-07725-z 35013473
El Karkouri K, Ghigo E, Raoult D, Fournier PE. Genomic evolution and adaptation of arthropod-associated Rickettsia. Sci Rep. 2022;12:380. 10.1038/s41598-022-07725-z35013473 10.1038/s41598-022-07725-z
28. Stewart An update on the laboratory diagnosis of Rickettsia spp. infection Pathogens 2021 10 10 1319 10.3390/pathogens10101319 34684267
Stewart AG. An update on the laboratory diagnosis of Rickettsia spp. infection. Pathogens. 2021;10(10):1319. 10.3390/pathogens1010131934684267 10.3390/pathogens10101319
29. Blanda V Torina A La Russa F Agostino R Randazzo K Scimeca S A retrospective study of the characterization of Rickettsia species in ticks collected from humans Ticks Tick Borne Dis 2017 8 610 4 10.1016/j.ttbdis.2017.04.005 28457821
Blanda V, Torina A, La Russa F, Agostino R, Randazzo K, Scimeca S, et al. A retrospective study of the characterization of Rickettsia species in ticks collected from humans. Ticks Tick Borne Dis. 2017;8:610–4. 10.1016/j.ttbdis.2017.04.00528457821 10.1016/j.ttbdis.2017.04.005
30. Yan P, Qiu Z, Zhang T, Li Y, Wang W, Li M, et al. Microbial diversity in the tick Argas japonicus (Acari: Argasidae) with a focus on Rickettsia pathogens. Med Vet Entomol. 2019;33:327–35. 10.1111/mve.12373
31. Ali A, Zahid H, Zeb I, Tufail M, Khan S, Haroon M et al. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia massiliae detection. Parasit Vectors, (2021) 14:1–12. 10.1186/s13071-021-04836-w
32. Ullah S, Alouffi A, Almutairi MM, Islam N, Rehman G, Ul Islam Z et al. First Report of Rickettsia conorii in Hyalomma kumari Ticks. Animals, (2023) 13:1488. 10.3390/ani13091488
33. Aneela A Almutairi MM Alouffi A Ahmed H Tanaka T Molecular detection of Rickettsia hoogstraalii in Hyalomma anatolicum and Haemaphysalis sulcata: updated knowledge on the epidemiology of tick-borne Rickettsia hoogstraalii Vet Sci 2023 10 10 605 10.3390/vetsci10100605 37888557
Aneela A, Almutairi MM, Alouffi A, Ahmed H, Tanaka T, et al. Molecular detection of Rickettsia hoogstraalii in Hyalomma anatolicum and Haemaphysalis sulcata: updated knowledge on the epidemiology of tick-borne Rickettsia hoogstraalii. Vet Sci. 2023;10(10):605. 10.3390/vetsci1010060537888557 10.3390/vetsci10100605
34. Labruna MB Whitworth T Horta MC Bouyer DH McBride JW Pinter A Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic J clin Microbiol 2004 42 1 90 8 10.1128/JCM.42.1.90-98.2004 14715737
Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. J clin Microbiol. 2004;42(1):90–8. 10.1128/JCM.42.1.90-98.200414715737 10.1128/JCM.42.1.90-98.2004
35. Ali A Khan MA Zahid H Yaseen PM Qayash Khan M Nawab J Seasonal dynamics, record of ticks infesting humans, wild and domestic animals and molecular phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa Pakistan Front Physiol 2019 10 793 10.3389/fphys.2019.00793 31379587
Ali A, Khan MA, Zahid H, Yaseen PM, Qayash Khan M, Nawab J, et al. Seasonal dynamics, record of ticks infesting humans, wild and domestic animals and molecular phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa Pakistan. Front Physiol. 2019;10:793. 10.3389/fphys.2019.0079331379587 10.3389/fphys.2019.00793
36. Ali A Numan M Khan M Aiman O Muñoz-Leal S Chitimia-Dobler L Ornithodoros (Pavlovskyella) ticks associated with a Rickettsia sp. in Pakistan Parasit Vectors 2022 15 138 10.1186/s13071-022-05248-0 35449077
Ali A, Numan M, Khan M, Aiman O, Muñoz-Leal S, Chitimia-Dobler L, et al. Ornithodoros (Pavlovskyella) ticks associated with a Rickettsia sp. in Pakistan. Parasit Vectors. 2022;15:138. 10.1186/s13071-022-05248-035449077 10.1186/s13071-022-05248-0
37. Hoogstraal H, Trapido H. Redescription of the type materials of Haemaphysalis (Kaiseriana) Bispinosa Neumann (India), H.(K.) Neumanni Dönitz (Japan), H.(K.) lagrangei Larrousse (Vietnam), and H.(K.) Yeni Toumanoff (Vietnam) (Ixodoidea, Ixodidae). J Parasitol. 1966;1188–98. 10.2307/3276366
38. Apanaskevich DA Horak IG Geevarghese G The genus Hyalomma Koch, 1844. VIII. Redescription of three Hyalommina Schulze, 1919 species (Acari: Ixodidae) from South Asia with notes on their biology Zootaxa 2009 2050 31 55 10.14411/fp.2010.009
Apanaskevich DA, Horak IG, Geevarghese G. The genus Hyalomma Koch, 1844. VIII. Redescription of three Hyalommina Schulze, 1919 species (Acari: Ixodidae) from South Asia with notes on their biology. Zootaxa. 2009;2050:31–55. 10.14411/fp.2010.00910.14411/fp.2010.009
39. Apanaskevich DA, Filippova NA, Horak IG. The genus Hyalomma Koch, 1844. X. Redescription of all parasitic stages of Hyalomma scupense Schulze, 1919 (Hyalomma. detritum Schulze) (Acari: Ixodidae) and notes on its biology. (2010) 10.14411/fp.2010.009
40. Geevarghese G, Mishra AC. Haemaphysalis ticks of India. Elsevier; 2011.
41. Sambrook J Russell DW Purification of nucleic acids by extraction with phenol: chloroform Cold Spring Harbor Protoc 2006 1 4455 10.1101/pdb.prot4455
Sambrook J, Russell DW. Purification of nucleic acids by extraction with phenol: chloroform. Cold Spring Harbor Protoc. 2006;1:4455. 10.1101/pdb.prot445510.1101/pdb.prot4455
42. Inokuma H Raoult D Brouqui P Detection of Ehrlichiaplatys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan J Clin Microbiol 2000 38 4219 21 10.1128/JCM.38.11.4219-4221.2000 11060094
Inokuma H, Raoult D, Brouqui P. Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J Clin Microbiol. 2000;38:4219–21. 10.1128/JCM.38.11.4219-4221.200011060094 10.1128/JCM.38.11.4219-4221.2000
43. Roux V Raoult D Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein OmpB Int j syst evol Microbiol 2000 50 1449 55 10.1099/00207713-50-4-1449 10939649
Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein OmpB. Int j syst evol Microbiol. 2000;50:1449–55. 10.1099/00207713-50-4-144910939649 10.1099/00207713-50-4-1449
44. Roux V Fournier P Raoult D Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein OmpA J clin Microbiol 1996 34 9 2058 10.1128/jcm.34.9.2058-2065.1996 8862558
Roux V, Fournier P, Raoult D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein OmpA. J clin Microbiol. 1996;34(9):2058. 10.1128/jcm.34.9.2058-2065.19968862558 10.1128/jcm.34.9.2058-2065.1996
45. Altschul SF Gish W Miller W Myers EW Lipman DJ Basic local alignment search tool J Mol Bio 1990 215 403 10 10.1016/S0022-2836(05)80360-2 2231712
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Bio. 1990;215:403–10. 10.1016/S0022-2836(05)80360-22231712 10.1016/S0022-2836(05)80360-2
46. Hall T Biosciences I Carlsbad CJ BioEdit: an important software for molecular biology GERF Bull Biosci 2011 2 60 1
Hall T, Biosciences I, Carlsbad CJ. BioEdit: an important software for molecular biology. GERF Bull Biosci. 2011;2:60–1.
47. Kumar S Stecher G Li M Knyaz C Tamura K MEGA X: molecular evolutionary genetics analysis across computing platforms Mol Biol Evol 2018 35 1547 10.1093/molbev/msy096 29722887
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547. https://doi.org/10.1093/molbev/msy096.29722887 10.1093/molbev/msy096
48. Kamran K Akbar A Naseem M Samad A Achakzai JK Rehman ZU Participatory appraisal for healthcare and welfare management strategies of donkeys (Equus Ascinus) in Balochistan Pakistan Front Vet Sci 2022 9 1005079 10.3389/fvets.2022.1005079 36118345
Kamran K, Akbar A, Naseem M, Samad A, Achakzai JK, Rehman ZU, et al. Participatory appraisal for healthcare and welfare management strategies of donkeys (Equus Ascinus) in Balochistan Pakistan. Front Vet Sci. 2022;9:1005079. 10.3389/fvets.2022.100507936118345 10.3389/fvets.2022.1005079
49. Khan SM Khan M Alouffi A Almutairi MM Numan M Ullah S Phylogenetic position of Haemaphysalis kashmirensis and Haemaphysalis cornupunctata, with notes on Rickettsia spp Genes 2023 14 360 10.3390/genes14020360 36833287
Khan SM, Khan M, Alouffi A, Almutairi MM, Numan M, Ullah S, et al. Phylogenetic position of Haemaphysalis kashmirensis and Haemaphysalis cornupunctata, with notes on Rickettsia spp. Genes. 2023;14:360. 10.3390/genes1402036036833287 10.3390/genes14020360
50. Karim S, Budachetri K, Mukherjee N, Williams J, Kausar A, Hassan MJ, et al. A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS negl trop dis. 2017;11(6). 10.1371/journal.pntd.0005681
51. Numan M Islam N Adnan M Zaman Safi S Chitimia-Dobler L Labruna MB First genetic report of Ixodes kashmiricus and associated Rickettsia Sp Parasit Vect 2022 15 1 2 10.1186/s13071-022-05509-y
Numan M, Islam N, Adnan M, Zaman Safi S, Chitimia-Dobler L, Labruna MB, et al. First genetic report of Ixodes kashmiricus and associated Rickettsia Sp. Parasit Vect. 2022;15:1–2. 10.1186/s13071-022-05509-y10.1186/s13071-022-05509-y
52. Tila H, Khan M, Almutairi MM, Alouffi A, Ahmed H, Tanaka T et al. First report on detection of Hepatozoon ayorgbor in Rhipicephalus haemaphysaloides and Hepatozoon colubri in Haemaphysalis sulcata and Hyalomma anatolicum: risks of spillover of Hepatozoon spp. from wildlife to domestic animals. Front Vet Sci, (2023) 10. 10.3389/fvets.2023.1255482
53. Harrus S Perlman-Avrahami A Mumcuoglu KY Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel Clin Microbiol Infect 2011 17 459 63 10.1111/j.1469-0691.2010.03316.x 20636417
Harrus S, Perlman-Avrahami A, Mumcuoglu KY, et al. Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel. Clin Microbiol Infect. 2011;17:459–63. 10.1111/j.1469-0691.2010.03316.x20636417 10.1111/j.1469-0691.2010.03316.x
54. Lu M, Meng C, Li Y, Zhou G, Wang L, Xu X et al. Rickettsia sp. and Anaplasma spp. in Haemaphysalis longicornis from Shandong province of China, with evidence of a novel species Candidatus Anaplasma Shandongensis. Ticks Tick borne Dis, (2023) 14(1):102082. 10.1016/j.ttbdis.2022.102082
55. Iqbal N Mukhtar MU Yang J Sajid MS Niu Q Guan G First molecular evidence of Anaplasma bovis and Anaplasma phagocytophilum in bovine from central Punjab, Pakistan Pathogens 2019 8 155 10.3390/pathogens8030155 31533303
Iqbal N, Mukhtar MU, Yang J, Sajid MS, Niu Q, Guan G, et al. First molecular evidence of Anaplasma bovis and Anaplasma phagocytophilum in bovine from central Punjab, Pakistan. Pathogens. 2019;8:155. 10.3390/pathogens803015531533303 10.3390/pathogens8030155
56. Hirunkanokpun S Ahantarig A Baimai V Pramual P Trinachartvanit W A new record of Rickettsia japonica in ticks infesting a Burmese ferret-badger in Thailand Trop Biomed 2022 39 1 55 9 10.47665/tb.39.1.007 35507925
Hirunkanokpun S, Ahantarig A, Baimai V, Pramual P, Trinachartvanit W. A new record of Rickettsia japonica in ticks infesting a Burmese ferret-badger in Thailand. Trop Biomed. 2022;39(1):55–9. 10.47665/tb.39.1.00735507925 10.47665/tb.39.1.007
57. Seo MG Kwon OD Kwak D Genotypic analysis of piroplasms and associated pathogens from ticks infesting cattle in Korea Microorganisms 2020 8 728 10.3390/microorganisms8050728 32414173
Seo MG, Kwon OD, Kwak D. Genotypic analysis of piroplasms and associated pathogens from ticks infesting cattle in Korea. Microorganisms. 2020;8:728. 10.3390/microorganisms805072832414173 10.3390/microorganisms8050728
58. Sonenshine DE, Stewart PE. Microbiomes of blood-feeding arthropods: genes coding for essential nutrients and relation to vector fitness and pathogenic infections. A review. Microorganisms. 2021;9(12):2433. 10.3390/microorganisms9122433
59. Battilani M De Arcangeli S Balboni A Dondi F Genetic diversity and molecular epidemiology of Anaplasma Infect Genet Evol 2017 49 195 211 10.1016/j.meegid.2017.01.021 28122249
Battilani M, De Arcangeli S, Balboni A, Dondi F. Genetic diversity and molecular epidemiology of Anaplasma. Infect Genet Evol. 2017;49:195–211. 10.1016/j.meegid.2017.01.02128122249 10.1016/j.meegid.2017.01.021
60. Rar V Tkachev S Tikunova N Genetic diversity of Anaplasma bacteria: twenty years later Infect Gen Evol 2021 91 104833 10.1016/j.meegid.2021.104833
Rar V, Tkachev S, Tikunova N. Genetic diversity of Anaplasma bacteria: twenty years later. Infect Gen Evol. 2021;91:104833. 10.1016/j.meegid.2021.10483310.1016/j.meegid.2021.104833
61. Klein D Beth-Din A Cohen R Lazar S Glinert I Zayyad H New spotted fever group rickettsia isolate, identified by sequence analysis of conserved genomic regions Pathogens 2019 9 1 11 10.3390/pathogens9010011 31861899
Klein D, Beth-Din A, Cohen R, Lazar S, Glinert I, Zayyad H, et al. New spotted fever group rickettsia isolate, identified by sequence analysis of conserved genomic regions. Pathogens. 2019;9(1):11. 10.3390/pathogens901001131861899 10.3390/pathogens9010011
62. Fournier PE Dumler JS Greub G Wu Y Raoult D Gene sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov J Clin Microbiol 2023 41 12 5456 65 10.1128/JCM.41.12.5456-5465.2003
Fournier PE, Dumler JS, Greub G, Wu Y, Raoult D. Gene sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol. 2023;41(12):5456–65. 10.1128/JCM.41.12.5456-5465.200310.1128/JCM.41.12.5456-5465.2003
