
==== Front
Stem Cell Res Ther
Stem Cell Res Ther
Stem Cell Research & Therapy
1757-6512
BioMed Central London

39256792
3898
10.1186/s13287-024-03898-8
Research
Targeting NPM1 inhibits proliferation and promotes apoptosis of hepatic progenitor cells via suppression of mTOR signalling pathway
http://orcid.org/0000-0002-1395-2014
Wang Ping wangping2009@ccmu.edu.cn

123
Wang Min 123
Liu Lin 123
Li Hongyi 123
Liu Helin 123
Ren Jiangbo 123
Liu Tianhui 123
Cong Min 123
Zhu Zhijun 345
Zhao Xinyan 123
Sun Liying sunxlx@outlook.com

123
Jia Jidong jia_jd@ccmu.edu.cn

123
1 grid.24696.3f 0000 0004 0369 153X Liver Research Center, Beijing Friendship Hospital, Capital Medical University, Beijing, 100050 China
2 Beijing Key Laboratory On Translational Medicine On Liver Cirrhosis, Beijing, 100050 China
3 https://ror.org/00a2x9d51 grid.512752.6 National Clinical Research Center for Digestive Disease, Beijing, 100069 China
4 grid.411610.3 0000 0004 1764 2878 Liver Transplantation Center, Beijing Friendship Hospital, Capital Medical University, Beijing, 100050 China
5 https://ror.org/013xs5b60 grid.24696.3f 0000 0004 0369 153X Clinical Center for Paediatric Liver Transplantation, Capital Medical University, Beijing, 100069 China
11 9 2024
11 9 2024
2024
15 2928 12 2023
26 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Hepatic progenitor cells serve not only as the origin of combined hepatocellular cholangiocarcinoma (cHCC-CCA) but are also responsible for malignancy recurrence after surgical resection. Nucleophosmin 1 (NPM1) has been implicated in cancer metastasis and poor prognosis. This study aimed to determine the expression of NPM1 by hepatic progenitor cells in cHCC-CCA and the effects of targeting NPM1 on hepatic progenitor cells and BEL-7402 cells with characteristics of both progenitor cells and cHCC-CCA.

Methods

First, NPM1 was detected by RT‒PCR, western blotting, and double-immunofluorescence staining in cHCC-CCA tissues. NPM1 expression was subsequently analysed in rat hepatic progenitor cells cultured in vitro and in interleukin 6 (IL6)-treated cells. The effects and mechanism of NPM1 on hepatic progenitor cells were determined by knocking down NPM1 and performing RNA sequencing analysis. Finally, NSC348884, a small-molecule inhibitor that disrupts NPM1 dimer formation, was used to confirm the function of NPM1 in BEL-7402 cells.

Results

Both human hepatic progenitor cells in cHCC-CCA tissues and rat in vitro cultured hepatic progenitor cells highly expressed NPM1. IL6, a cytokine involved in the malignant transformation of hepatic progenitor cells, dose-dependently increased NPM1 and PCNA expression. Knocking down NPM1 reduced IL6R transcription (P < 0.0001) and inhibited the proliferation (P = 0.0065) of hepatic progenitor cells by suppressing the mTOR signalling pathway and activating the apoptosis pathway. Furthermore, knocking down NPM1 in hepatic progenitor cells resulted in more apoptotic cells (7.33 ± 0.09% vs. 3.76 ± 0.13%, P < 0.0001) but fewer apoptotic cells in the presence of NSC348884 (47.57 ± 0.49% vs. 63.40 ± 0.05%, P = 0.0008) than in the control cells, suggesting that low-NPM1-expressing cells are more resistant to NSC348884. In addition, NSC348884 induced the apoptosis of BEL-7402 cells with an IC50 of 2.77 μmol/L via the downregulation of the IL-6R and mTOR signalling pathways and inhibited the growth of BEL-7402 cells in a subcutaneous xenograft tumour model (P = 0.0457).

Conclusions

Targeting NPM1 inhibits proliferation and induces apoptosis in hepatic progenitor cells and BEL-7402 cells, thus serving as a potential therapy for cHCC-CCA.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13287-024-03898-8.

Keywords

Nucleophosmin 1
Liver progenitor cells
mTOR signalling pathway
Apoptosis
http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 82370603 81570548 Wang Ping http://dx.doi.org/10.13039/501100013076 National Major Science and Technology Projects of China 2018ZX09201016 Jia Jidong issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

“Mixed” or “combined” hepatocellular-cholangiocarcinoma (cHCC-CCA) is a rare primary liver malignancy that has more frequent vascular invasion and lymph node metastasis than hepatocellular carcinoma (HCC), thus resulting in a worse prognosis and poor outcomes [1]. Liver resection is the first-line treatment for cHCC-CCA, yet the 5-year overall survival is still lower than 30% [2, 3]. Furthermore, there is no significant anti-tumour efficacy of sorafenib, a first-line treatment for advanced HCC, or gemcitabine and cisplatin, the standard therapy for intrahepatic cholangiocarcinoma, on unresectable cHCC-CCA [4]. Therefore, there is an urgent need to develop new therapeutic strategies for this disease.

cHCC-CCA is defined as a liver tumour with both hepatocytic and cholangiocytic characteristics and is thought to be derived from hepatic progenitor cells [5, 6]. Recent findings confirm that hepatic progenitor cells serve as the origin of cHCC-CCA in the presence of chronic inflammation dependent on IL6 signalling [7]. Even after cHCC-CCA resection, remaining hepatic progenitor cells are involved in malignancy recurrence [8]. Therefore, targeting hepatic progenitor cells may be a therapeutic strategy for cHCC-CCA.

Nucleophosmin 1 (NPM1) is a molecule that is located primarily in the nucleus of cells and is involved in a variety of cellular processes, including ribosome assembly [9, 10], DNA repair [11, 12], the regulation of cell growth and proliferation [13, 14], and the development and progression of certain types of cancer [15–17]. Clinically, NPM1 is among the genes associated with the survival time of HCC patients [18], and upregulation of NPM1 is correlated with the serum α-foetal protein (AFP) level and is significantly associated with advanced liver tumour stage and poor prognosis [19, 20]. However, whether hepatic progenitor cells express NPM1 and whether targeting NPM1 can inhibit their proliferation or induce their apoptosis are questions that need to be answered for cHCC-CCA treatment.

In this study, we found that both human hepatic progenitor cells in cHCC-CCA tissues and rat in vitro cultured hepatic progenitor cells highly express NPM1 and that IL6 could increase NPM1 expression in hepatic progenitor cells. NPM1 shRNA or NSC348884, a small-molecule inhibitor interfering with NPM1 dimer formation [21], can inhibit the proliferation or induce the apoptosis of hepatic progenitor cells and BEL-7402 cells with characteristics of both progenitor cells and cHCC-CAAs, via the downregulation of the IL-6R and mTOR signalling pathways. Thus, NPM1 may serve as a potential therapy for targeting hepatic progenitor cells to treat cHCC-CCA.

Methods

Human specimens

Liver tissues from four cHCC-CCA samples (10 mg) and their paired paracancerous tissues (10 mg) or six HCC samples (10 mg) and their paired paracancerous tissues (10 mg) were used for quantitative reverse transcription polymerase chain reaction (qRT‐PCR) analysis, and the clinical characteristics are included in Table S1. Since poorly-differentiated HCCs also express hepatic stem/progenitor markers, HCC samples with an AFP concentration less than 60 ng/mL were used to avoid possible overlap with cHCC-CCA. One cHCC-CCA sample and one HCC sample with paraffin sections were used for histology analysis, and three cHCC-CCA samples (2 mg) and their paired paracancerous tissues (2 mg) or three HCC samples (2 mg) and their paired paracancerous tissues (2 mg) were used for western blot analysis. All tissues were obtained from the Clinical Data and Biobank Resources of Beijing Friendship Hospital with the approval of the Ethics Committee of Beijing Friendship Hospital, Capital Medical University (No. 2018‐P2‐055‐01; Beijing, China).

Immunofluorescence staining

Paraffin sections of one cHCC-CCA sample and one HCC sample were used for standard haematoxylin and eosin (HE), sirius red, and double immunofluorescence staining by antibodies against EpCAM (Sigma‐Aldrich, Cat No. SAB4200473) and cytokeratin (CK)19 (Abcam, Cat No. ab52625), or EpCAM (Sigma‐Aldrich, Cat No. SAB4200473) and hepatic nuclear factor (HNF) 4α (Cell Signaling, Cat No. #3113), or CK19 (Abcam) and NPM1 (ProteinTech, Cat No. 60096-1-Ig), or NPM1 (ProteinTech, Cat No. 10306-1-AP) and EpCAM (Sigma‐Aldrich, Cat No. SAB4200473), or NPM1 (ProteinTech, Cat No. 10306-1-AP) and AFP (RnD, Cat No. MAB1368), or NPM1 (ProteinTech, Cat No. 10306-1-AP) and αSMA (Abcam, Cat No. ab28052), or NPM1 (ProteinTech, Cat No. 10306-1-AP) and CD3 (Thermo, Cat No. MA1-7630), or phosphorylate mTOR at Ser2488 (pmTOR, Cell Signaling, Cat No. #5536), or Ki-67 (Zhongshan Jinqiao, Cat No. ZM-0166, Beijing, China) as described previously [22]. The cultured cells were fixed with 4% paraformaldehyde and stained with anti-NPM1 antibodies (ProteinTech, Cat No. 60096-1-Ig) using a standard immunofluorescence staining protocol as described previously [22]. The sections were examined under an FV3000 confocal fluorescence microscope (Olympus, Japan).

qRT-PCR

Liver tissues with the clinical characteristics listed in Table S1 or 1 × 106 rat primary hepatocytes, cholangiocytes, hepatic stellate cells, liver endothelial cells or hepatic progenitor cells were used for total RNA extraction, reverse transcription, and polymerase chain reaction, which were performed according to methods described previously [23, 24]. Briefly, reverse transcription was performed using a dT‐primed Script II Reverse Transcriptase Kit (Life Technologies, Carlsbad, CA). qPCR analyses were performed with triplicate complementary DNA (cDNA) from each sample on an ABI7500 Fast Real‐Time PCR System (ABI, Foster City, CA) using PowerUp SYBR Green Master Mix (Life Technologies) with the primers listed in Table S2. Gene expression levels were calculated relative to GAPDH levels using the 2−ΔΔCt method.

Western blot

Tissue protein extracts or cell protein extracts were prepared and analysed by western blotting according to standard protocols as described previously [23] using primary antibodies against EpCAM (Sigma‐Aldrich, Cat. No. SAB4200473), NPM1 (ProteinTech, Cat. No. 60096-1-Ig), PCNA (Cell Signaling, Cat. No. #2586), pmTOR at Ser2488 (Cell Signaling, Cat. No. #5536), mTOR (Cell Signaling, Cat. No. #2983), and GAPDH (ProteinTech, Cat. No. 60004-1-Ig). Bands were detected using the Molecular Imager ChemiDoc XRS + with Image Lab Software version 3.0 (Bio‐Rad, Hercules, CA).

Flow cytometry

For flow cytometry analysis, the cells were detached, fixed with 4% paraformaldehyde, and stained according to methods described previously [23]. Briefly, after permeabilization and blocking with normal mouse/rabbit serum, the cells were incubated with antibodies against NPM1 (ProteinTech, Cat No. 60096-1-Ig), PCNA (Cell Signaling, Cat No. #2586), cleaved caspase 3 (CASP3, Cell Signaling, Cat No. #9664), EpCAM (Sigma‐Aldrich, Cat No. SAB4200473), CD44 (Biolegend, Cat No. 397502), CK19 (Abcam, Cat No. ab52625), AFP (RnD, Cat No. MAB1368), vimentin (Abcam, Cat No. ab92547), or NPM1 (ProteinTech, Cat No. 60096-1-Ig) at 4 °C overnight. The primary antibodies were detected with the corresponding Alexa 488-conjugated anti-IgG (BD Pharmingen, San Diego, CA), and cell fluorescence was analysed with a FACSCalibur flow cytometer (FACS, Becton Dickinson, Franklin Lakes, NJ, USA) using CellQuest software (BD Bioscience).

Cell culture and stable cell line generation

Hepatic progenitor cells were isolated from male Sprague–Dawley rats (130–150 g) fed a choline-deficient diet supplemented with ethionine by collagenase perfusion and discontinuous gradient centrifugation and cultured in vitro as described previously [23]. Hepatic progenitors (3 × 105 per well) were plated in a six‐well plate and transfected with Lipofectamine™ 3000 (Life Technologies) according to the manufacturer's instructions. Briefly, 5 μl of Lipofectamine™ 3000 reagent was diluted and mixed in 125 μl of DMEM/F12 medium. Then, 2.5 μg of retroviral pRFP‐C‐RS plasmids with a noneffective 29‐mer scrambled shRNA cassette (OriGene Technologies, Rockville, MD) or a rat NPM1 shRNA construct (GCACATCGTAGAGGCAGAAGCAATGAACT; OriGene Technologies) were diluted in another 125 μl of DMEM/F12 medium, and 5 μl of P3000™ reagent was added to the diluted plasmids and mixed well. The diluted plasmids were added to each tube of the diluted Lipofectamine™ 3000 reagent and incubated for 10 min at room temperature. The plasmid‒lipid complex was added to a well of a 6-well plate with 0.8 ml of 10% FBS DMEM/F12 medium containing 0.5 U/ml insulin, 1 ng/ml epidermal growth factor (EGF; PeProTech, Rehovot, Israel), 0.5 ng/ml stem cell factor (SCF; PeProTech), and 100 U/ml penicillin and streptomycin [23]. The cells were cultured for 2 days for transfection, and medium containing 2 μg/ml puromycin antibiotics was used for 14-day selection thereafter. Then, the cells transfected with the control plasmids or the shNPM1 plasmids were digested with trypsin and plated into a 96-well plate with one cell per well for clonal expansion. The shCtrl or shNPM1 hepatic progenitor clones were confirmed by RT‒PCR analysis of their NPM1 transcription.

For IL6 incubation, 3 × 105 hepatic progenitor cells were seeded in 60-mm plates and cultured for 6 h. The medium was changed to 1% FBS DMEM/F12 for overnight culture followed by IL6 (0, 20, or 40 μg/mL, Cloud-Clone Corp., Katy, TX) in 1% FBS DMEM for another 48-h culture. To block the effects of IL6, 2.5 μmol/L Stattic (MedChem Express) was added to 1% FBS DMEM containing 40 μg/mL IL6.

For NSC348884 incubation, 3 × 105 nonrelevant shRNA-transfected cells (shCtrl) or shNPM1 hepatic progenitor cells were seeded in 60-mm plates and cultured overnight. The medium was changed to NSC348884 (0, 1, 2, 3, 4, 5, 6, 7, or 8 μmol/L, Aladdin, Shanghai, China), and the cells were cultured for 24 h.

BEL-7402 cells were cultured with DMEM/F12 supplemented with 10% FBS and 100 U/ml penicillin and streptomycin. For NSC348884 or sorafenib incubation, 3 × 105 BEL-7402 cells were seeded in 60-mm plates and cultured overnight. The medium was changed to NSC348884 (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μmol/L, Aladdin) or sorafenib (0, 10, 20, 30, 40, 50, 60, or 70 μmol/L, Macklin Biochemical Technology, Shanghai, China) and cultured for 24 h. To block the effects of NSC348884, MHY1485 (0, 10, 20, 30 μmol/L, Aladdin), an mTOR activator, was added to the medium containing 7 μmol/L NSC348884 and cultured for 24 h.

RNA sequencing

RNA sequencing and library preparation were completed by the Beijing Genomics Institute (http://www.bgitechsolutions.com/) according to methods described previously [24]. The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Genomics, Proteomics & Bioinformatics 2021) of the National Genomics Data Center (Nucleic Acids Res 2022), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA: CRA012821), which is publicly accessible at https://ngdc.cncb.ac.cn/gsa [25, 26]. GSEA was performed using the R/clusterProfiler package by annotating rat gene sets to predefined mouse gene sets from the Molecular Signatures Database [27].

Proliferation analysis

The proliferation of hepatic progenitor cells was analysed via growth curves. A total of 6 × 103 shCtrl or shNPM1 cells were plated in triplicate in antibiotic‐free complete medium in E‐Plate 16 (ACEA Biosciences, San Diego, CA) on a xCELLigence Real-Time Cell Analyzer (RTCA)-MP system (ACEA Biosciences) according to the manufacturer's instructions as described previously [24]. The cell index (CI) was read automatically and continuously recorded every hour as the CI ± SD. Growth stimulation was determined at the time of the maximum cell index, and Student's t test was used to analyse the significant differences in cell growth.

Apoptosis/necrosis analysis

The cells and the supernatant were collected and stained with a PE Annexin V Apoptosis Detection Kit I according to the manufacturer’s instructions (BD Pharmingen, Franklin Lakes, NJ) as described previously [28]. Apoptosis/necrosis was analysed using a FACS Calibur flow cytometer (BD Biosciences) via CellQuest software (BD Biosciences). The concentration of NSC348884 or sorafenib that induced cell apoptosis to 50% (IC50) was determined via the online tool “Quest Graph™ IC50 Calculator” (AAT Bioquest, Inc., https://www.aatbio.com/tools/ic50-calculator). The results are presented as the means of three independent experiments.

Mouse xenograft model

Fifteen five-week-old male nude mice were purchased from Vital River Laboratories (Beijing, China) with the body weight of 18.0 ± 2.0 g. The mice were randomized into three cages with 5 mice per cage and fed at Experimental Animal Department of Capital Medical University. After one-week acclimatisation, 5 × 106 BEL-7402 cells suspended in serum-free DMEM/F12 and Matrigel at a ratio of 1:1 v/v were injected subcutaneously into the right flanks of the nude mice. When the tumour size reached 100–150 mm3, the mice in the three cages were respectively treated with saline (n = 5), or NSC348884 (5 mg/kg B.W., n = 5), or sorafenib (40 mg/kg B.W., n = 5) in saline containing 40% PEG300 and 5% Tween 80 intraperitoneally twice per week for 5 weeks. The tumour volume was measured twice weekly and calculated as follows: larger diameter × (smaller diameter)2/2. The mice were anesthetized intraperitoneally via 40 mg/kg B.W. pentobarbital sodium at the end of the experiments, and the tumours were taken out after cervical dislocation for visualization of the xenograft tumours and analysis of the proliferation gene transcription of PCNA and IL-6R and proliferation related protein Ki-67 expression and mTOR phosphorylation. Mouse sample sizes were chosen based on previous similar experimental outcomes, and the data of the one mouse in NSC348884 group were excluded from the final analysis because it was dead after 3 times of NSC348884 administration. The potential confounders of treatment order, measurements and animal/cage location was not controlled, and the researchers and data analysers were aware of the group allocation at the different stages of the experiments. The experiments and procedures were approved by the Animal Experiments and Experimental Animal Welfare Committee of Capital Medical University (No. AEEI-2024-036; Beijing, China) and the work has been reported in line with the ARRIVE guidelines 2.0.

Statistics

The data are presented as the mean values ± SEMs. The normal distributions of the data were analysed by Shapiro–Wilk tests via SPSS online (https://spssau.com/), and the data variances were estimated using GraphPad Prism 6 software (GraphPad, La Jolla, CA, USA). If the data variances were similar between groups, they were analysed for significance using an unpaired t test with a two-tailed P value with GraphPad Prism 6 software. If the data variances were not similar between groups, they were analysed for significance using an unpaired t test with Welch’s correction via two-tailed P values with GraphPad Prism 6 software. P < 0.05 was considered to indicate a significant difference. The 95% confidential interval (CI) was calculated by GraphPad Prism 6 software.

Results

Hepatic progenitor cells in cHCC-CCA express NPM1

To investigate NPM1 expression in cHCC-CCA and HCC tissues, RT‒PCR and western blotting were used to determine NPM1 transcription and expression. NPM1 transcription in cHCC-CCA tissues was markedly greater than that in paracancerous tissues, whereas NPM1 transcription in HCC tissues was not significantly different from that in paracancerous tissues (Fig. 1A). Western blot analysis further confirmed that the EpCAM- and PCNA-positive cHCC-CCA tissues expressed more NPM1 than did the paracancerous tissues and the HCC tissues (Fig. 1B). HE and sirius red staining revealed more extracellular matrix deposition in cHCC-CCA tissue than in HCC tissue (Fig. 1C), which was accompanied by hepatic progenitor cell expansion [29, 30]. To examine NPM1 expression in hepatic progenitor cells, double immunofluorescence staining revealed that most of the CK19-positive cholangiocytes were EpCAM-expressing hepatic progenitor cells (arrowhead), and some of these EpCAM-expressing cells expressed HNF4α (arrow), further suggesting progenitor cell characteristics, and many of these CK19-positive hepatic progenitor cells expressed NPM1 (arrowhead) (Fig. 1C). However, no EpCAM-positive cells or NPM1-expressing cells were detected among the CK19-positive cholangiocytes in the HCC tissue (Fig. 1C). Double immunofluorescence staining of NPM1 with EpCAM, AFP, αSMA, or CD3 revealed that in addition to EpCAM-positive progenitor cells, CD3-positive T cells expressed Npm1 in cHCC-CCA tissue (Fig. 1D). Therefore, NPM1 is expressed by hepatic progenitor cells in cHCC-CCA tissues.Fig. 1 Hepatic progenitor cells express NPM1 in cHCC-CCA tissues. A RT‒PCR revealed that NPM1 transcription was higher in cHCC-CCA tissues (N = 4) than in their paracancerous tissues, but there was no such difference in HCC tissues (N = 6) or their paracancerous tissues. B Western blot analysis revealed that cHCC-CCA tissues (N = 3) highly expressed EpCAM, PCNA, and NPM1 compared with their paracancerous tissues and HCC tissues (N = 3). C Representative HE, sirius red and double immunofluorescence staining data revealed that cHCC-CCA tissue (N = 1) presented greater extracellular matrix deposition and EpCAM expression than did HCC tissue (N = 1), and many of the CK19-positive hepatic progenitor cells expressed NPM1 in cHCC-CCA tissue. D Representative immunofluorescence staining data showing that hepatic progenitor cells and CD3+ T cells are the major NPM1-expressing cells in cHCC-CCA tissue (N = 1)

IL6, a cytokine involved in progenitor-cell malignant transformation, enhances NPM1 expression in hepatic progenitor cells

Before investigating the function of NPM1 in hepatic progenitor cells, NPM1 expression in different types of rat liver cells was analysed. Hepatic progenitor cells expressed more NPM1 than the other kinds of liver cells, such as hepatocytes, cholangiocytes, hepatic stellate cells, and endothelial cells (Fig. 2A). Immunofluorescence staining revealed that most NPM1 was located in the nucleus (Fig. 2B), and flow cytometry analysis revealed that 99.8 ± 1.39% of hepatic progenitor cells were positive for NPM1 (Fig. 2C). Furthermore, IL6, a cytokine involved in the malignant transformation of progenitor cells into cHCC-CCA [7], dose-dependently increased PCNA and NPM1 transcription from 20 to 40 μg/mL (Fig. 2D). Flow cytometry analysis confirmed the increased expression of PCNA and NPM1 in hepatic progenitor cells in the presence of 40 μg/mL IL6 compared with that in control cells (P < 0.0001, Fig. 2E). Compared with that in the IL-6-treated cells, the expression of NPM1 and PCNA induced by IL6 was blocked by stattic (2.5 μmol/L), an inhibitor of the IL6/STAT3 signalling pathway (Fig. 2F and G). Therefore, IL6 can induce NPM1 expression in hepatic progenitor cells.Fig. 2 IL6 increases NPM1 expression in hepatic progenitor cells. A RT‒PCR results revealed the relative NPM1 transcription levels in different types of rat liver cells. B Immunofluorescence staining revealed that most NPM1 was expressed in the nucleus of hepatic progenitor cells. C Immunofluorescence staining and flow cytometry analysis revealed a positive rate of NPM1 expression in hepatic progenitor cells. D PCNA and NPM1 transcription was increased in hepatic progenitor cells in the presence of 20 and 40 μg/mL IL6. E Immunofluorescence staining and flow cytometry analysis revealed that IL6 (40 μg/mL) induced PCNA and NPM1 expression. F IL-6-enhanced PCNA and NPM1 transcription was reduced by 2.5 mmol/L stattic. G Immunofluorescence staining and flow cytometry analysis revealed that stattic (2.5 mmol/L) blocked the ability of IL6 (40 μg/mL) to promote NPM1 expression

NPM1 knockdown suppresses the proliferation of hepatic progenitor cells

To study the function of NPM1 in hepatic progenitor cells, NPM1 was knocked down by transfection with a retroviral vector encoding an shRNA that targets NPM1 (Fig. 3A). After puromycin selection, stable NPM1‐knockdown cells (shNPM1) presented approximately 80% suppression of NPM1 transcription and approximately 90% suppression of IL6R transcription, as determined by qRT‐PCR, compared with the expression in nonrelevant shRNA-transfected shCtrl cells (Fig. 3B). To reveal the mechanism underlying NPM1 function, RNA sequencing was performed in shNPM1 cells and shCtrl cells. After data normalization, the expression values of 17,977 transcripts were analysed for differential expression between the shNPM1 and the shCtrl cells. Knocking down NPM1 reduced the transcription of proliferation-related genes (Ki-67, PCNA, and CDK2) and stem cell-related genes (EpCAM and Gata4) (Fig. 3C). For differentiation gene transcription, knocking down NPM1 increased the transcription of cholangiocyte-related genes (HNF1β, CK19, GGT1, and GGT7) and some hepatocyte function-related genes (Serpina1, Cyp11b2, Cyp11b1, Cyp46a1, Cyp2c11, and Cyp26b1) but reduced the transcription of some hepatocyte marker genes, such as HNF4α, HNF1α, C/EBPα and ALB (Fig. 3C). Knockdown of NPM1 inhibited proliferation and induced the differentiation of hepatic progenitor cells; however, the exact direction of differentiation was not evident, and we therefore focused on the proliferation process in this study. Flow cytometry analysis revealed reduced expression of PCNA in shNPM1 cells compared with shCtrl cells (P = 0.0123, Fig. 3D). Compared with shCtrl cells, NPM1 knockdown markedly suppressed cell proliferation, as determined by xCELLigence growth index analysis (P = 0.0065; N = 3; Fig. 3C), suggesting that knockdown of NPM1 inhibits the proliferation of hepatic progenitor cells.Fig. 3 NPM1 knockdown inhibits the proliferation of hepatic progenitor cells. A Experimental strategies for generating NPM1-knockdown cells (shNPM1) and the morphology of shNPM1 cells and control cells (shCtrl). B NPM1 and IL-6R transcription was lower in shNPM1 cells than in shCtrl cells. C RNA sequencing data and the fold changes in proliferation- and differentiation-related genes. D Immunofluorescence staining and flow cytometry analysis revealed that PCNA expression in shNPM1 cells was lower than that in shCtrl cells. E Cell growth was monitored and recorded every 1 h for 110.8 h via an xCELLigence growth curve, which revealed that the growth of shNPM1 cells was inhibited compared with that of shCtrl cells. The normalized cell index was significantly different at 110.8 h (N = 3)

NPM1 knockdown inhibits the mTOR pathway and activates the apoptosis pathway

RNA sequencing and GSEA further revealed that NPM1 knockdown suppressed the mTORC1 pathway and activated the apoptosis pathway (Fig. 4A). The genes involved in the mTOR pathway shown in the heatmap revealed that, compared with those in the shCtrl cells, the transcription of mTOR and the phosphorylation of mTOR-mediated genes in the shNPM1 cells were lower (Fig. 4B). mRNA transcription analysis via RT‒PCR confirmed the reduced transcription of mTOR and PI3K but the increased transcription of PTEN, a negative regulator of PI3K phosphorylation (Fig. 4C). Western blot analysis revealed reduced expression of mTOR and decreased phosphorylation of mTOR at Ser2488 in shNPM1 cells compared with shCtrl cells (Fig. 4D), suggesting that knockdown of NPM1 suppresses the mTOR pathway. A heatmap of apoptosis-related genes revealed the increased transcription of Caspases and the apoptosis mediating genes in shNPM1 cells compared to that in the shCtrl cells (Fig. 4E). mRNA transcription analysis via RT‒PCR confirmed the increased transcription of CASP3, CASP12, Bcl2, and Bax (Fig. 4F), and flow cytometry revealed increased levels of cleaved CASP3 (Fig. 4G), indicating that NPM1 knockdown activated the apoptosis pathway.Fig. 4 NPM1 knockdown suppresses the mTOR signalling pathway and enhances the apoptosis pathway. A RNA sequencing and GSEA revealed inhibition of the mTORC1 signalling pathway and activation of the apoptosis pathway in shNPM1 cells compared with shCtrl cells. B Heatmap showing genes (rows) involved in the mTOR signalling pathway that were differentially expressed between shCtrl and shNPM1 cells according to RNA sequencing. Red: high expression; blue: low expression. C The transcription of mTOR, Akt, and PI3K was reduced, whereas the transcription of PTEN was increased in the shNPM1 cells compared with the shCtrl cells. D mTOR expression and mTOR phosphorylation at Ser 2448 tended to be lower in shNPM1 cells than in shCtrl cells. E Heatmap showing genes (rows) involved in the apoptosis pathway that were differentially expressed between shCtrl and shNPM1 cells according to RNA sequencing. Red: high expression; blue: low expression. F The transcription of CASP3, CASP12, Bcl2, and Bax was increased in shNPM1 cells compared with shCtrl cells. G Immunofluorescence staining and flow cytometry analysis revealed that cleaved CASP3 was increased in shNPM1 cells compared with shCtrl cells

NSC348884, a small molecule NPM1 inhibitor, exerts greater apoptotic effects on NPM1 high-expressing cells

To confirm the apoptosis-inducing effects of NPM1 knockdown on hepatic progenitor cells, a small molecular inhibitor of NPM1, NSC348884, was used to treat NPM1-expressing shCtrl cells and NPM1-knockdown shNPM1 cells. When different doses of NSC348884 (0, 1, 2, 3, 4, 5, 6, 7, and 8 μmol/L) were used to treat these cells, both of the cell types showed a similar IC50 values of approximately 3.5 μmol/L (Fig. 5A). The percentage of apoptotic shNPM1 cells was 7.33 ± 0.09%, which was greater than the 3.76 ± 0.13% of the shCtrl cells (P < 0.0001, Fig. 5B), further supporting that the knockdown of NPM1 activated the apoptosis pathway. However, 7 μmol/L NSC348884 induced 47.57 ± 0.49% apoptosis in shNPM1 cells, which was much lower than the 63.40 ± 0.05% in shCtrl cells (P = 0.0008, Fig. 5B), indicating that NSC348884 exerts greater apoptotic effects on NPM1 high-expressing cells.Fig. 5 NSC348884 induces less apoptosis in NPM1-knockdown cells than in control cells. A Dose‒response curve for NSC348884 (0, 1, 2, 3, 4, 5, 6, 7, and 8 μmol/L) in shCtrl cells and shNPM1 cells determined via an apoptosis assay. B NSC348884 (5 μmol/L) induced greater apoptosis in shCtrl cells than in shNPM1 cells

NSC348884 induces apoptosis in BEL-7402 cells via suppression of the mTOR pathway

To evaluate the effects of NSC348884 on cHCC-CCA, BEL-7402 cells, which highly express characteristic markers of hepatic progenitor cells and cHCC-CCA, including EpCAM, CD44, CK19, AFP, vimentin, and Npm1 (Fig. 6A), were used for the subsequent experiments. NSC348884 induced the apoptosis of BEL-7402 cells with an IC50 of 2.77 μmol/L, and the IC50 of sorafenib, the positive control, was 43.31 μmol/L (Fig. 6B). Furthermore, 5 μmol/L NSC348884 induced 75.95 ± 0.46% apoptotic cells, which was much greater than the percentage of 46.52 ± 0.54% apoptotic cells induced by 40 μmol/L sorafenib (P < 0.0001, Fig. 6C). NSC348884 (5 μmol/L) time-dependently reduced the transcription of IL6R (Fig. 6D) but increased the transcription of CASP3 (Fig. 6E) and the level of cleaved CASP3 (Fig. 6E), suggesting that NSC348884 induces apoptosis in BEL-7402 cells. During this process, mTOR transcription and expression decreased in a time-dependent manner after 2 h of incubation with NSC348884 (5 μmol/L) (Fig. 6G and I). However, PTEN transcription increased at 2 h after NSC348884 (5 μmol/L) treatment (Fig. 6H), and mTOR phosphorylation increased before 4 h of NSC348884 incubation but decreased thereafter (Fig. 6I). In addition, MHY1485, an mTOR activator, dose-dependently reduced the NSC348884-induced apoptotic cell ratio in BEL-7402 cells (Fig. 6J), suggesting that NSC348884 induces apoptosis in BEL-7402 cells via suppression of the mTOR pathway.Fig. 6 NSC348884 induces the apoptosis of BEL-7402 cells by suppressing the mTOR signalling pathway. A Phenotypic characteristics of BEL-7402 cells determined by flow cytometry. B Dose‒response curves of BEL-7402 cells treated with NSC348884 (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μmol/L) and sorafenib (0, 10, 20, 30, 40, 50, 60, or 70 μmol/L) determined via an apoptosis assay. C Representative apoptosis of BEL-7402 cells induced by NSC348884 (5 μmol/L) and sorafenib (40 μmol/L). D IL6R mRNA transcription was induced by NSC348884 (5 μmol/L) at 0 h, 1 h, 2 h, 4 h, and 6 h. E CASP3 mRNA transcription was induced by NSC348884 (5 μmol/L) at 0 h, 1 h, 2 h, 4 h, and 6 h. F Immunofluorescence staining and flow cytometry analysis revealed that cleaved CASP3 was increased in NSC348884-treated BEL-7402 cells compared with untreated control cells. G mTOR mRNA transcription in NSC348884 (5 μmol/L)-treated BEL-7402 cells at 0 h, 1 h, 2 h, 4 h, and 6 h. H PTEN mRNA transcription in NSC348884 (5 μmol/L)-treated BEL-7402 cells at 0 h, 1 h, 2 h, 4 h, and 6 h. I mTOR expression and its phosphorylation in NSC348884 (5 μmol/L)-treated BEL-7402 cells at 0 h, 1 h, 2 h, 4 h, and 6 h. J Representative apoptosis of BEL-7402 cells in the presence of NSC348884 (5 μmol/L) and different doses of MHY1485 (0, 10, 20, or 30 μmol/L)

NSC348884 inhibits the growth of BEL-7402 xenograft tumours by suppressing the mTOR pathway

The BEL-7402 xenograft tumour model was used to validate the growth-suppressive effects of NSC348884 on cHCC-CCA in vivo (Fig. 7A). Although one mouse in the NSC348884 group died after 3 times of NSC348884 administration, the tumour growth curve revealed that NSC348884 (5 mg/kg B.W.) suppressed BEL-7402 xenograft tumour growth (n = 4; P = 0.0457; 95% CI − 1477 to − 16.53), whereas sorafenib (40 mg/kg B.W.) did not effectively inhibit BEL-7402 xenograft tumour growth (n = 5; P = 0.1214; 95% CI − 268.2 to 612.5) compared with the saline-treated xenograft tumour growth (n = 5, Fig. 7B). RT‒PCR analysis revealed that NSC3438884 markedly reduced the relative transcription of PCNA and IL-6R in BEL-7402 xenograft tumours (Fig. 7C). Furthermore, NSC348884 reduced the number of Ki-67- and pmTOR-positive BEL-7402 xenograft tumours (Fig. 7D). Therefore, targeting NPM1 inhibits the growth and promotes the apoptosis via suppressing the mTOR signalling pathway (Fig. 7E).Fig. 7 NSC348884 inhibits the growth of BEL-7402 xenograft tumours. A Experimental design strategy and xenograft tumours in each group. B NSC348884 (5 mg/kg B.W.) markedly suppressed the growth of BEL-7402 xenograft tumours. C NSC348884 (5 mg/kg B.W.) significantly reduced the mRNA transcription of PCNA and IL-6R in xenograft tumours. D NSC348884 (5 mg/kg B.W.) significantly reduced the expression of Ki-67 and the phosphorylation of mTOR in xenograft tumours. E Schematic representation of the mechanism by which targeting NPM1 inhibits proliferation and promotes apoptosis via the mTOR signalling pathway

Discussion

Considering the clinical need for cHCC-CCA treatment, this study provides three new findings for understanding the effects and mechanism of targeting NPM1 on hepatic progenitor cells and BEL-7402 cells. First, we found that NPM1 is expressed by hepatic progenitor cells both in cHCC-CCA tissues and in normal rat hepatic progenitor cells and that the cytokine IL6, which is responsible for the malignant transformation of hepatic progenitor cells into cHCC-CCA cells, can increase NPM1 expression. Second, NPM1 has growth stimulatory effects on hepatic progenitor cells and contributes to their IL6 response by increasing IL6R transcription. Third, NSC348884, a small molecule inhibitor that blocks NPM1 dimer formation, induces the apoptosis of hepatic progenitor cells and BEL-7402 cells and suppresses BEL-7402 xenograft tumour growth by downregulating the mTOR signalling pathway, thus serving as a promising cHCC-CCA therapeutic strategy by targeting hepatic progenitor cells.

Previously, NPM1 was reported to be overexpressed in approximately 40% of HCC tissues [19]; however, we found that NPM1 is not highly expressed in AFP-low expressing HCC tissues, possibly because NPM1 expression is associated with proliferation capacity and is correlated with AFP expression [20]. Interestingly, we found that cHCC-CCA tissues highly expressed NPM1 compared with their corresponding peri-cancer tissues, and the hepatic progenitor cells among these cHCC-CCA tissues were positive for NPM1. NPM1 is a downstream molecule of STAT3 signalling in response to interferon α in Jurkat cells [31]. Similarly, we found that NPM1 expression in hepatic progenitor cells is upregulated by STAT3 in the presence of IL6, a cytokine for hepatic progenitor cell malignant transformation, suggesting that NPM1 may be an essential molecule involved in hepatic progenitor cell-derived cHCC-CCA.

Overexpression of NPM1 has been shown to have oncogenic effects by increasing cell proliferation and inhibiting apoptosis via the activation of ribosome biogenesis and interference with p53 activation [15, 17]. We observed the oncogenic effects of NPM1 in hepatic progenitor cells via the activation of the mTOR signalling pathway and the suppression of the apoptosis pathway. Since mTOR is considered a key pathway for cancer metastasis and drug resistance [32, 33], NPM1, as a mediator of this pathway, may be a new target for cancer therapy. In addition, we found that NPM1 can increase IL6R transcription in hepatic progenitor cells, thus increasing their response to IL6 and further accelerating this oncogenic process in hepatic progenitor cells.

NSC348884 is a small molecule that disrupts NPM1 oligomerization to interfere with its function, and it has been shown to have apoptosis-inducing effects in many kinds of cancers, with IC50 values ranging from 1.7 to 4.0 μmol/L [21], including HCC [34]. We found that the IC50 of NSC348884 in hepatic progenitor cells was approximately 3.57 μmol/L and that NPM1-low-expressing hepatic progenitor cells were more resistant to NSC348884 than control cells were, indicating that targeting NPM1 may have fewer apoptotic-inducing effects on NPM1-low-expressing cells, thus may result in fewer side effects. We also observed that the IC50 of NSC348884 in BEL-7402 cells was 2.77 μmol/L, whereas the IC50 of sorafenib was 43.31 μmol/L, revealing that a much lower dose of NSC348884 than that of sorafenib can induce apoptosis. Furthermore, NSC348884 inhibited the growth of BEL-7402 xenograft tumours by reducing the transcription of IL6R and suppressing the mTOR signalling pathway, thus serving as a potential therapy for cHCC-CCA.

In this study, we used BEL-7402 cells, a cell line with characteristics of both hepatic progenitor cells and cHCC-CCA, to study the effects of targeting NPM1 for cHCC-CCA therapy. Future studies could isolate and compare hepatic progenitor cells from normal liver tissues and cHCC-CCA tissues to examine the maltransformation mechanism of progenitor cells, and test the direct antitumour effects of targeting NPM1 on the progenitor cells of cHCC-CCA.

Conclusions

In summary, NPM1 is highly expressed by hepatic progenitor cells in cHCC-CCA. Targeting NPM1 can induce the apoptosis of hepatic progenitor cells and BEL-7402 cells and restrict BEL-7402 xenograft tumour growth by reducing the IL6 response and suppressing the mTOR signalling pathway, thus serving as a therapeutic target for cHCC-CCA.

Supplementary Information

Additional file 1.

Additional file 2.

Abbreviations

cHCC-CCA Combined hepatocellular-cholangiocarcinoma

HCC Hepatocellular carcinoma

NPM1 Nucleophosmin 1

AFP α-Foetal protein

CK Cytokeratin

HNF Hepatic nuclear factor

CASP Caspase

IL6 Interleukin 6

IL6R Interleukin 6 receptor

CI Confidential interval

Acknowledgements

We would like to thank the Clinical Data and Biobank Resource of Beijing Friendship Hospital for storing the liver samples. We would also like to thank Mr. Junying Jia from the Protein Science Core Facility Center, Institute of Biophysics, Chinese Academy of Sciences, for his help in flow cytometry analysis and Ms. Duo Duo and Ms. Xing Jia from the Center for Biological Imaging (CBI), Institute of Biophysics, Chinese Academy of Sciences, for their help in obtaining the Olympus FV3000 images.

Author contributions

PW, LS, and JJ contributed to the conception and design of the experiments. PW and JJ obtained funding for the project. MW, LL, HL (Hongyi Li), HL (Helin Liu), and JR contributed to the acquisition and analysis of the data. TL, MC, XZ, and ZZ participated in the technical and material support. PW wrote the manuscript, and all the authors participated in discussing and revising the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (82370603 and 81570548) and the National Science and Technology Major Special Project for New Drug Development (2018ZX09201016).

Availability of data and materials

The RNA sequencing data that support the findings of this study are available at https://ngdc.cncb.ac.cn/gsa with the accession number CRA012821.

Declarations

Ethics approval and consent to participate

Liver tissues were obtained from the Clinical Data and Biobank Resource of Beijing Friendship Hospital with the approval of the Ethics Committee of Beijing Friendship Hospital, Capital Medical University. Title of the approved project: Exploration of the new markers for liver stem/progenitor cells in liver fibrotic tissues and tumors. Name of the institutional approval committee: the Ethics Committee of Beijing Friendship Hospital, Capital Medical University. Approval number: 2018‐P2‐055‐01. Date of approval: 8/3/2018. The animal experiments and procedures were approved by the Animal Experiments and Experimental Animal Welfare Committee of Capital Medical University. Title of the approved project: The safety and efficacy of targeting NPM1to treat liver tumours by promoting apoptosis of progenitor cells. Name of the institutional approval committee: Animal Experiments and Experimental Animal Welfare Committee of Capital Medical University. Approval number: AEEI-2024-036. Date of approval: 1/31/2024.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Beaufrere A Calderaro J Paradis V Combined hepatocellular-cholangiocarcinoma: an update J Hepatol 2021 74 1212 1224 10.1016/j.jhep.2021.01.035 33545267
Beaufrere A, Calderaro J, Paradis V. Combined hepatocellular-cholangiocarcinoma: an update. J Hepatol. 2021;74:1212–24.33545267 10.1016/j.jhep.2021.01.035
2. Yang JD Roberts LR Management of combined hepatocellular carcinoma-cholangiocarcinoma Curr Hepatol Rep 2018 17 385 391 10.1007/s11901-018-0431-9 35990187
Yang JD, Roberts LR. Management of combined hepatocellular carcinoma-cholangiocarcinoma. Curr Hepatol Rep. 2018;17:385–91.35990187 10.1007/s11901-018-0431-9
3. Claasen M Ivanics T Beumer BR de Wilde RF Polak WG Sapisochin G An international multicentre evaluation of treatment strategies for combined hepatocellular-cholangiocarcinoma JHEP Rep 2023 5 100745 10.1016/j.jhepr.2023.100745 37234277
Claasen M, Ivanics T, Beumer BR, de Wilde RF, Polak WG, Sapisochin G, et al. An international multicentre evaluation of treatment strategies for combined hepatocellular-cholangiocarcinoma. JHEP Rep. 2023;5: 100745.37234277 10.1016/j.jhepr.2023.100745
4. Rogers JE Bolonesi RM Rashid A Elsayes KM Elbanan MG Law L Systemic therapy for unresectable, mixed hepatocellular-cholangiocarcinoma: treatment of a rare malignancy J Gastrointest Oncol 2017 8 347 351 10.21037/jgo.2017.03.03 28480073
Rogers JE, Bolonesi RM, Rashid A, Elsayes KM, Elbanan MG, Law L, et al. Systemic therapy for unresectable, mixed hepatocellular-cholangiocarcinoma: treatment of a rare malignancy. J Gastrointest Oncol. 2017;8:347–51.28480073 10.21037/jgo.2017.03.03
5. Moeini A Sia D Zhang Z Camprecios G Stueck A Dong H Mixed hepatocellular cholangiocarcinoma tumors: cholangiolocellular carcinoma is a distinct molecular entity J Hepatol 2017 66 952 961 10.1016/j.jhep.2017.01.010 28126467
Moeini A, Sia D, Zhang Z, Camprecios G, Stueck A, Dong H, et al. Mixed hepatocellular cholangiocarcinoma tumors: cholangiolocellular carcinoma is a distinct molecular entity. J Hepatol. 2017;66:952–61.28126467 10.1016/j.jhep.2017.01.010
6. Brunt E Aishima S Clavien PA Fowler K Goodman Z Gores G cHCC-CCA: consensus terminology for primary liver carcinomas with both hepatocytic and cholangiocytic differentation Hepatology 2018 68 113 126 10.1002/hep.29789 29360137
Brunt E, Aishima S, Clavien PA, Fowler K, Goodman Z, Gores G, et al. cHCC-CCA: consensus terminology for primary liver carcinomas with both hepatocytic and cholangiocytic differentation. Hepatology. 2018;68:113–26.29360137 10.1002/hep.29789
7. Rosenberg N Van Haele M Lanton T Brashi N Bromberg Z Adler H Combined hepatocellular-cholangiocarcinoma derives from liver progenitor cells and depends on senescence and IL-6 trans-signaling J Hepatol 2022 77 1631 1641 10.1016/j.jhep.2022.07.029 35988690
Rosenberg N, Van Haele M, Lanton T, Brashi N, Bromberg Z, Adler H, et al. Combined hepatocellular-cholangiocarcinoma derives from liver progenitor cells and depends on senescence and IL-6 trans-signaling. J Hepatol. 2022;77:1631–41.35988690 10.1016/j.jhep.2022.07.029
8. Cai X Zhai J Kaplan DE Zhang Y Zhou L Chen X Background progenitor activation is associated with recurrence after hepatectomy of combined hepatocellular-cholangiocarcinoma Hepatology 2012 56 1804 1816 10.1002/hep.25874 22684921
Cai X, Zhai J, Kaplan DE, Zhang Y, Zhou L, Chen X, et al. Background progenitor activation is associated with recurrence after hepatectomy of combined hepatocellular-cholangiocarcinoma. Hepatology. 2012;56:1804–16.22684921 10.1002/hep.25874
9. Okuwaki M Saito S Hirawake-Mogi H Nagata K The interaction between nucleophosmin/NPM1 and the large ribosomal subunit precursors contribute to maintaining the nucleolar structure Biochim Biophys Acta Mol Cell Res 2021 1868 118879 10.1016/j.bbamcr.2020.118879 33039556
Okuwaki M, Saito S, Hirawake-Mogi H, Nagata K. The interaction between nucleophosmin/NPM1 and the large ribosomal subunit precursors contribute to maintaining the nucleolar structure. Biochim Biophys Acta Mol Cell Res. 2021;1868: 118879.33039556 10.1016/j.bbamcr.2020.118879
10. Ugolini I Bilokapic S Ferrolino M Teague J Yan Y Zhou X Chromatin localization of nucleophosmin organizes ribosome biogenesis Mol Cell 2022 82 4443–4457 e4449
Ugolini I, Bilokapic S, Ferrolino M, Teague J, Yan Y, Zhou X, et al. Chromatin localization of nucleophosmin organizes ribosome biogenesis. Mol Cell. 2022;82(4443–4457): e4449.
11. Lopez DJ Rodriguez JA Banuelos S Nucleophosmin, a multifunctional nucleolar organizer with a role in DNA repair Biochim Biophys Acta Proteins Proteom 2020 1868 140532 10.1016/j.bbapap.2020.140532 32853771
Lopez DJ, Rodriguez JA, Banuelos S. Nucleophosmin, a multifunctional nucleolar organizer with a role in DNA repair. Biochim Biophys Acta Proteins Proteom. 2020;1868: 140532.32853771 10.1016/j.bbapap.2020.140532
12. Sekhar KR Freeman ML Nucleophosmin plays a role in repairing DNA damage and is a target for cancer treatment Cancer Res 2023 83 1573 1580 10.1158/0008-5472.CAN-22-3631 36877156
Sekhar KR, Freeman ML. Nucleophosmin plays a role in repairing DNA damage and is a target for cancer treatment. Cancer Res. 2023;83:1573–80.36877156 10.1158/0008-5472.CAN-22-3631
13. Liu X Liu Z Jang SW Ma Z Shinmura K Kang S Sumoylation of nucleophosmin/B23 regulates its subcellular localization, mediating cell proliferation and survival Proc Natl Acad Sci U S A 2007 104 9679 9684 10.1073/pnas.0701806104 17535915
Liu X, Liu Z, Jang SW, Ma Z, Shinmura K, Kang S, et al. Sumoylation of nucleophosmin/B23 regulates its subcellular localization, mediating cell proliferation and survival. Proc Natl Acad Sci U S A. 2007;104:9679–84.17535915 10.1073/pnas.0701806104
14. Qin FX Shao HY Chen XC Tan S Zhang HJ Miao ZY Knockdown of NPM1 by RNA interference inhibits cells proliferation and induces apoptosis in leukemic cell line Int J Med Sci 2011 8 287 294 10.7150/ijms.8.287 21537492
Qin FX, Shao HY, Chen XC, Tan S, Zhang HJ, Miao ZY, et al. Knockdown of NPM1 by RNA interference inhibits cells proliferation and induces apoptosis in leukemic cell line. Int J Med Sci. 2011;8:287–94.21537492 10.7150/ijms.8.287
15. Grisendi S Mecucci C Falini B Pandolfi pp Nucleophosmin and cancer Nat Rev Cancer 2006 6 493 505 10.1038/nrc1885 16794633
Grisendi S, Mecucci C, Falini B. Pandolfi pp. Nucleophosmin and cancer Nat Rev Cancer. 2006;6:493–505.16794633 10.1038/nrc1885
16. Box JK Paquet N Adams MN Boucher D Bolderson E O'Byrne KJ Nucleophosmin: from structure and function to disease development BMC Mol Biol 2016 17 19 10.1186/s12867-016-0073-9 27553022
Box JK, Paquet N, Adams MN, Boucher D, Bolderson E, O’Byrne KJ, et al. Nucleophosmin: from structure and function to disease development. BMC Mol Biol. 2016;17:19.27553022 10.1186/s12867-016-0073-9
17. Karimi Dermani F Gholamzadeh Khoei S Afshar S Amini R The potential role of nucleophosmin (NPM1) in the development of cancer J Cell Physiol 2021 236 7832 7852 10.1002/jcp.30406 33959979
Karimi Dermani F, Gholamzadeh Khoei S, Afshar S, Amini R. The potential role of nucleophosmin (NPM1) in the development of cancer. J Cell Physiol. 2021;236:7832–52.33959979 10.1002/jcp.30406
18. Yang MR Zhang Y Wu XX Chen W Critical genes of hepatocellular carcinoma revealed by network and module analysis of RNA-seq data Eur Rev Med Pharmacol Sci 2016 20 4248 4256 27831650
Yang MR, Zhang Y, Wu XX, Chen W. Critical genes of hepatocellular carcinoma revealed by network and module analysis of RNA-seq data. Eur Rev Med Pharmacol Sci. 2016;20:4248–56.27831650
19. Lo SJ Fan LC Tsai YF Lin KY Huang HL Wang TH A novel interaction of nucleophosmin with BCL2-associated X protein regulating death evasion and drug sensitivity in human hepatoma cells Hepatology 2013 57 1893 1905 10.1002/hep.26209 23258611
Lo SJ, Fan LC, Tsai YF, Lin KY, Huang HL, Wang TH, et al. A novel interaction of nucleophosmin with BCL2-associated X protein regulating death evasion and drug sensitivity in human hepatoma cells. Hepatology. 2013;57:1893–905.23258611 10.1002/hep.26209
20. Yun JP Miao J Chen GG Tian QH Zhang CQ Xiang J Increased expression of nucleophosmin/B23 in hepatocellular carcinoma and correlation with clinicopathological parameters Br J Cancer 2007 96 477 484 10.1038/sj.bjc.6603574 17245342
Yun JP, Miao J, Chen GG, Tian QH, Zhang CQ, Xiang J, et al. Increased expression of nucleophosmin/B23 in hepatocellular carcinoma and correlation with clinicopathological parameters. Br J Cancer. 2007;96:477–84.17245342 10.1038/sj.bjc.6603574
21. Qi W Shakalya K Stejskal A Goldman A Beeck S Cooke L NSC348884, a nucleophosmin inhibitor disrupts oligomer formation and induces apoptosis in human cancer cells Oncogene 2008 27 4210 4220 10.1038/onc.2008.54 18345031
Qi W, Shakalya K, Stejskal A, Goldman A, Beeck S, Cooke L, et al. NSC348884, a nucleophosmin inhibitor disrupts oligomer formation and induces apoptosis in human cancer cells. Oncogene. 2008;27:4210–20.18345031 10.1038/onc.2008.54
22. Wang P Zhang H Li W Zhao Y An W Promoter-defined isolation and identification of hepatic progenitor cells from the human fetal liver Histochem Cell Biol 2008 130 375 385 10.1007/s00418-008-0439-2 18478249
Wang P, Zhang H, Li W, Zhao Y, An W. Promoter-defined isolation and identification of hepatic progenitor cells from the human fetal liver. Histochem Cell Biol. 2008;130:375–85.18478249 10.1007/s00418-008-0439-2
23. Wang P Cong M Liu TH Yang AT Cong R Wu P Primary isolated hepatic oval cells maintain progenitor cell phenotypes after two-year prolonged cultivation J Hepatol 2010 53 863 871 10.1016/j.jhep.2010.05.014 20739084
Wang P, Cong M, Liu TH, Yang AT, Cong R, Wu P, et al. Primary isolated hepatic oval cells maintain progenitor cell phenotypes after two-year prolonged cultivation. J Hepatol. 2010;53:863–71.20739084 10.1016/j.jhep.2010.05.014
24. Wang P Cong M Liu T Li Y Liu L Sun S FoxA2 inhibits the proliferation of hepatic progenitor cells by reducing PI3K/Akt/HK2-mediated glycolysis J Cell Physiol 2020 235 9524 9537 10.1002/jcp.29759 32495363
Wang P, Cong M, Liu T, Li Y, Liu L, Sun S, et al. FoxA2 inhibits the proliferation of hepatic progenitor cells by reducing PI3K/Akt/HK2-mediated glycolysis. J Cell Physiol. 2020;235:9524–37.32495363 10.1002/jcp.29759
25. Chen T Chen X Zhang S Zhu J Tang B Wang A The genome sequence archive family: toward explosive data growth and diverse data types Genom Proteom Bioinf 2021 19 578 583 10.1016/j.gpb.2021.08.001
Chen T, Chen X, Zhang S, Zhu J, Tang B, Wang A, et al. The genome sequence archive family: toward explosive data growth and diverse data types. Genom Proteom Bioinf. 2021;19:578–83.10.1016/j.gpb.2021.08.001
26. Members CN, Partners. Database resources of the national genomics data center, China National center for bioinformation in 2022. Nucleic Acids Res 2022;50:D27-D38.
27. Yu G Wang LG Han Y He QY clusterProfiler: an R package for comparing biological themes among gene clusters OMICS 2012 16 284 287 10.1089/omi.2011.0118 22455463
Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012;16:284–7.22455463 10.1089/omi.2011.0118
28. Wang P Cui Y Wang J Liu D Tian Y Liu K Mesenchymal stem cells protect against acetaminophen hepatotoxicity by secreting regenerative cytokine hepatocyte growth factor Stem Cell Res Ther 2022 13 94 10.1186/s13287-022-02754-x 35246254
Wang P, Cui Y, Wang J, Liu D, Tian Y, Liu K, et al. Mesenchymal stem cells protect against acetaminophen hepatotoxicity by secreting regenerative cytokine hepatocyte growth factor. Stem Cell Res Ther. 2022;13:94.35246254 10.1186/s13287-022-02754-x
29. Van Hul NK Abarca-Quinones J Sempoux C Horsmans Y Leclercq IA Relation between liver progenitor cell expansion and extracellular matrix deposition in a CDE-induced murine model of chronic liver injury Hepatology 2009 49 1625 1635 10.1002/hep.22820 19296469
Van Hul NK, Abarca-Quinones J, Sempoux C, Horsmans Y, Leclercq IA. Relation between liver progenitor cell expansion and extracellular matrix deposition in a CDE-induced murine model of chronic liver injury. Hepatology. 2009;49:1625–35.19296469 10.1002/hep.22820
30. Williams MJ Clouston AD Forbes SJ Links between hepatic fibrosis, ductular reaction, and progenitor cell expansion Gastroenterology 2014 146 349 356 10.1053/j.gastro.2013.11.034 24315991
Williams MJ, Clouston AD, Forbes SJ. Links between hepatic fibrosis, ductular reaction, and progenitor cell expansion. Gastroenterology. 2014;146:349–56.24315991 10.1053/j.gastro.2013.11.034
31. Ren Z Aerts JL Pen JJ Heirman C Breckpot K De Greve J Phosphorylated STAT3 physically interacts with NPM and transcriptionally enhances its expression in cancer Oncogene 2015 34 1650 1657 10.1038/onc.2014.109 24793791
Ren Z, Aerts JL, Pen JJ, Heirman C, Breckpot K, De Greve J. Phosphorylated STAT3 physically interacts with NPM and transcriptionally enhances its expression in cancer. Oncogene. 2015;34:1650–7.24793791 10.1038/onc.2014.109
32. Hua H Kong Q Zhang H Wang J Luo T Jiang Y Targeting mTOR for cancer therapy J Hematol Oncol 2019 12 71 10.1186/s13045-019-0754-1 31277692
Hua H, Kong Q, Zhang H, Wang J, Luo T, Jiang Y. Targeting mTOR for cancer therapy. J Hematol Oncol. 2019;12:71.31277692 10.1186/s13045-019-0754-1
33. Murugan AK mTOR: role in cancer, metastasis and drug resistance Semin Cancer Biol 2019 59 92 111 10.1016/j.semcancer.2019.07.003 31408724
Murugan AK. mTOR: role in cancer, metastasis and drug resistance. Semin Cancer Biol. 2019;59:92–111.31408724 10.1016/j.semcancer.2019.07.003
34. Zhang J Zhao HL He JF Li HY [Inhibitory effect of NSC348884, a small molecular inhibitor of nucleophosmin, on the growth of hepatocellular carcinoma cell line hepG2] Zhongguo Yi Xue Ke Xue Yuan Xue Bao 2012 34 58 61 22737721
Zhang J, Zhao HL, He JF. Li HY [Inhibitory effect of NSC348884, a small molecular inhibitor of nucleophosmin, on the growth of hepatocellular carcinoma cell line hepG2]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2012;34:58–61.22737721
