
==== Front
BMC Genomics
BMC Genomics
BMC Genomics
1471-2164
BioMed Central London

10755
10.1186/s12864-024-10755-8
Research
Effects of the FHL2 gene on the development of subcutaneous and intramuscular adipocytes in goats
Li An 123
Wang Youli 13
Wang Yong 123
Xiong Yan 123
Li Yanyan 123
Liu Wei 13
Zhu Jiangjiang 12
Lin Yaqiu linyq1999@163.com

1
1 https://ror.org/04gaexw88 grid.412723.1 0000 0004 0604 889X Key Laboratory of Qinghai-Tibetan Plateau Animal Genetic Resource Reservation and Utilization of Education Ministry, Southwest Minzu University, Chengdu, China
2 https://ror.org/04gaexw88 grid.412723.1 0000 0004 0604 889X Key Laboratory of Qinghai-Tibetan Plateau Animal Genetic Resource Reservation and Exploitation of Sichuan Province, Southwest Minzu University, Chengdu, China
3 https://ror.org/04gaexw88 grid.412723.1 0000 0004 0604 889X College of Animal & Veterinary Science, Southwest Minzu University, Chengdu, China
11 9 2024
11 9 2024
2024
25 85010 10 2023
2 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Adipose tissue affects not only the meat quality of domestic animals, but also human health. Adipocyte differentiation is regulated by a series of regulatory genes and cyclins. Four and half-LIM protein (FHL2) is positively correlated with the hypertrophy of adipocytes and can cause symptoms such as obesity and diabetes.

Result

In the transcriptome sequencing analysis of intramuscular adipocytes after three days of differentiation, the differentially expressed gene FHL2 was found. To further explore the biological significance of the differentially expressed gene FHL2, which was downregulated in the mature adipocytes. We revealed the function of FHL2 in adipogenesis through the acquisition and loss of function of FHL2. The results showed that the overexpression of FHL2 significantly increased the expression of adipogenic genes (PPARγ, C/EBPβ) and the differentiation of intramuscular and subcutaneous adipocytes. However, silencing FHL2 significantly inhibited adipocyte differentiation. The overexpression of FHL2 increased the number of adipocytes stained with crystal violet and increased the mRNA expression of proliferation marker genes such as CCNE, PCNA, CCND and CDK2. In addition, it significantly increased the rate of EdU positive cells. In terms of apoptosis, overexpression of FHL2 significantly inhibited the expression of P53 and BAX in both intramuscular and subcutaneous adipocytes, which are involved in cell apoptosis. However, overexpression of FHL2 promoted the expression of BCL, but was rescued by the silencing of FHL2.

Conclusions

In summary, FHL2 may be a positive regulator of intramuscular and subcutaneous adipocyte differentiation and proliferation, and acts as a negative regulator of intramuscular and subcutaneous adipocyte apoptosis. These findings provide a theoretical basis for the subsequent elucidation of FHL2 in adipocytes.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12864-024-10755-8.

Keywords

FHL2
Goat
Adipogenesis
Subcutaneous adipocytes
Intramuscular adipocytes
National Natural Sciences Foundation of China32072723 Sichuan Science and Technology Program 2022JDTD00302022JDTD0030 Southwest Minzu University Double World-Class ProjectXM2023011 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Adipose tissue is multifunctional and affects not only the meat quality of domestic animals, but also human health [1–3]. In domestic animals, the distribution of adipose tissue affects meat taste and carcass mass [4–6]. In humans, adipose tissue is closely related to many major diseases such as diabetes and obesity [7–9]. Therefore, elucidating the development of adipose tissue and the molecular mechanisms of their regulation is essential for human life and health. Many studies have reported that the adipocyte differentiation is regulated by a series of regulatory genes, such as peroxisome proliferator activated receptor gamma (PPARγ), CCAT enhancer binding protein (C/EBPα) and cyclin D1 (CCND) [10, 11].

In the transcriptome sequencing analysis of intramuscular adipocytes after three days of differentiation, we focused on FHL2, which was downregulated in the mature intramuscular adipocytes. FHL2 is a member of the LIM-only subclass of the LIM protein superfamily [12], which is widely distributed in different cells (epithelial cells), forms different tissues (ovaries and muscles), and finally forms different organs [13–15]. FHL2 has been shown to play an important role in differentiation, proliferation of skeletal muscle satellite cells and inducing apoptosis in mesangial cell [16–18]. In addition, FHL2 is positively correlated with the hypertrophy of adipocytes and can cause symptoms such as obesity and diabetes [19, 20]. In addition, FHL2 regulates the expression of many transcriptional genes. For example, overexpression of FHL2 leads to downregulated expression of cylin D1 (CCND) and upregulated expression of P21 and P27, thereby inhibiting the cell proliferation of murine fibroblasts [21]. The E4 transcription factor (E4F1) is associated with FHL2 and inhibition of E4F1, which represses cell proliferation [22]. In osteoblasts, FHL2 stimulates osteoblast differentiation and contributes to bone formation [23]. FHL2 may be associated with radiation-induced apoptosis [24], as a marker gene for apoptosis, the presence of FHL2 increases P53 expression, in addition to enhancing P53 expression in turn stimulating FHL2 expression [25]. In addition, transient overexpression of SKI protein (SKI) and FHL2 in ski (-/-) melanocytes synergistically enhanced cell growth [26]. These different studies show that FHL2 performs different functions in nonbiological processes. It remains unclear whether FHL2 regulates the development of the goat subcutaneous and intramuscular adipocytes.

Therefore, the function of FHL2 in regulating the development of adipocytes was revealed by using goat intramuscular and subcutaneous adipocytes in vitro. First, the coding sequence of the goat FHL2 gene was cloned, and its function in intramuscular and subcutaneous adipocytes was explored by silencing and overexpression techniques. Oil Red O, BODIPY and EdU staining were used to determine the effect of FHL2 on the differentiation and proliferation of adipocytes, and MTT was used to detect the effect of FHL2 on the cell proliferation. In addition, flow cytometry was used to detect the effect of FHL2 on adipocyte apoptosis. Finally, real time quantitative polymerase chain reaction (RT-qPCR) was used to detect the expression of differentiation, proliferation, and apoptosis marker genes. FHL2 may be a positive regulator of intramuscular and subcutaneous adipocyte differentiation and proliferation, and acts as a negative regulator of intramuscular and subcutaneous adipocyte apoptosis. These findings provide a theoretical basis for the subsequent elucidation of FHL2 in adipocytes.

Results

Screening of FHL2 gene

Filters for differentially expressed genes between preadipocytes and mature adipocytes can promote further study of fat deposition in goats. Numerous studies have shown that RNA-seq helps reveal transcriptome differences in tissues and cells [27–30]. In this study, the DEG-Seq was used to analyse the DEGs in intramuscular preadipocytes and adipocytes. When the p value < 0.05, we obtained 4749 DEGs, of which 2556 were upregulated and 2193 were downregulated (Fig. 1A). Studies have shown that FHL2 plays an important regulatory role in the development of adipocytes. Therefore, we focused on FHL2, which is downregulated in mature intramuscular adipocytes and validated by RT-qPCR. The expression of FHL2 in mature intramuscular adipocytes was lower than in intramuscular preadipocytes, which was consistent with the RNA-seq trend (Fig. 1B).

Fig. 1 Transcriptome sequencing comparison of mature adipocytes and preadipocytes. A Volcano plot of DEGs. Volcano plot of DEGs in preadipocytes and mature adipocytes, the screening condition is P < 0.01; B Validation of DEGs by PCR. Validation of differential expression gene using RT-qPCR (n = 5). The RT-qPCR data were analyzed using 2−ΔΔCt method, and ubiquitously expressed transcript (UXT) was used as endogenous control. “*” denotes P < 0.05

Cloning of the FHL2 gene in goats, and its tissue and time expression profile

To further explore the biological significance of FHL2, the cDNA of goat triceps tissue was used as template, and the primers FHL2-S and FHL2-A were used. The FHL2 gene was successfully cloned after PCR amplification. The FHL2 gene fragment was cloned with a length of 1353 bp (Fig. 2A), in which the CDS region is 838 bp with the start codon ATG and stop codon TGA, while the 5’ UTR was 779 bp and the 3’UTR was 338 bp (Fig. 2B). RT-qPCR was used to detect the expression level of FHL2 gene in various goat tissues, and the results showed that FHL2 gene was expressed in 8 tissues. FHL2 expression is significantly higher in the heart and kidneys than in other tissues (P < 0.05, Fig. 2C). The results showed that the expression of FHL2 gene was specific in tissues. The results showed that the relative expression level of the gene showed an upwards trend with time during the differentiation of subcutaneous adipocytes, and the expression was highest at 108 h and significantly higher than 0 h (P < 0.05, Fig. 2D). The relative expression level of FHL2 in intramuscular adipocytes showed an upward trend, and the expression level was the highest at 60 h (P < 0.05, Fig. 2E).

Fig. 2 Goat FHL2 gene sequence analysis. A Amplification of FHL2 gene in goat. DL 2000 DNA marker, FHL2 target strip; B Sequence of nucleotide and derived amino acids Jian Zhou Da-er goat FHL2 cDNA; C The expression of FHL2 gene in different goat tissues. “**” indicates that the difference is extremely significant difference between the data (P < 0.01), “*” indicate significant difference (P < 0. 05); D The relative expression of FHL2 during the differentiation of subcutaneous adipocytes. E The relative expression of FHL2 during the differentiation of intramuscular adipocytes

Effect of overexpression and silencing of FHL2 on intramuscular adipocyte differentiation

Two bands matching the lengths of FHL2 and PCDNA3.1 appeared in the gel electropherogram (Supplementary Fig. S2). According to the analysis data, the overexpression of FHL2 was 300-fold compared to the control group (Fig. 3A). This indicates that the FHL2 overexpression vector was successfully constructed. Oil Red O staining and Bodipy staining showed a significant increase in subcutaneous adipocytes lipid aggregation and OD values after FHL2 overexpression (Fig. 3B, C). In summary, FHL2 promotes intramuscular adipocyte differentiation and secretion of lipid droplets. Preadipocytes differentiate into adipocytes and mature adipocytes are regulated by adipocyte markers and genes related to triglyceride synthesis. Therefore, we detected the mRNA levels of these genes through RT‒qPCR. The results showed that FHL2 overexpression significantly promoted the expression levels of C/EBPβ (P < 0.05), PPARγ (P < 0.01) and SREBP (P < 0.05), and inhibited the expression of C/EBPα (P < 0.05), PREF-1 (P < 0.01) and AP2 (P < 0.05, Fig. 3D). However, FHL2 overexpression decreased the mRNA levels of triglyceride synthesis (TG) -related genes (Fig. 3E). Interestingly, FHL2 increased the expression of LPL (P < 0.01) in subcutaneous adipocytes, but decreased LPL (P < 0.05) expression in intramuscular adipocytes.

For explore the mechanism of FHL2 in adipocytes differentiation in more detail, we explored the effects of FHL2 silencing on adipocytes. The results showed that FHL2 silencing inhibited the expression of FHL2 gene expression by approximately 50% (Fig. 3F). Bodipy and Oli Red O staining showed a significant decrease in the number of adipocytes and the degree of lipid droplet secretion after FHL2 silence in intramuscular adipocytes (Fig. 3G). The OD values were reduced by one-third (Fig. 3H). For the adipocyte differentiation marker genes, in the intramuscular adipocytes, the expression of C/EBPα (P < 0.01) and PREF-1 (P < 0.05) significantly increased (Fig. 3I, J), while C/EBPβ (P < 0.05) and PPARγ (P < 0.05) expression decreased significantly. In the intramuscular adipocyte group, the expression of ACC (P < 0.01) and LPL (P < 0.05) in the genes associated with triglyceride synthesis increased significantly.

Fig. 3 The over-expression efficiency analysis of FHL2 gene in intramuscular adipocytes. A The over-expression efficiency of FHL2 was detected in mRNA level, n = 5; B Morphological observation of Bodipy staining and Oil Red O staining; C The OD value at 492 nm was detected by Oil Red O staining, n = 8; D Effects of FHL2 overexpression in intramuscular adipocytes on differentiation marker genes; E Effects of FHL2 overexpression in intramuscular adipocytes on triglyceride synthesis marker genes (n = 6). UXT was the internal reference gene to normalize the expression levels; F siFHL2 efficiency of FHL2 was detected in mRNA level, n = 5; G Morphological observation of Bodipy and Oil Red O staining; H The OD value was detected by Oil Red O staining, n = 8. “*” the difference is significant (P < 0.05); I-J Effect of silencing FHL2 on intramuscular adipocyte differentiation marker genes and triglyceride synthases marker genes in the silencing FHL2 and negative control. n = 6, UXT was the internal reference gene to normalize the expression levels. “**” the difference was extremely significant compared with the control group (P < 0.01), “*” the difference was significantly. Data were shown as Means ± SEM

Effect of overexpression and silencing of FHL2 on subcutaneous adipocyte differentiation

In subcutaneous adipocytes, overexpression of FHL2 was detected with effectiveness as it achieved 400-fold changes compared to the control group (Fig. 4A). Oil Red O and BODIPY staining showed a significant increase in the number of subcutaneous adipocytes and lipid droplet secretion. In addition, the OD value after FHL2 overexpression was also increased significantly (Fig. 4B, C). In summary, the FHL2 gene promotes intramuscular adipocyte differentiation and lipid aggregation. Next, FHL2 overexpression significantly promoted the expression of PPARγ (P < 0.05), C/EBPβ (P < 0.05), and SREBP (P < 0.01), and inhibited the expression of CEBPα (P < 0.01), PREF-1 (P < 0.01), AP2 (P < 0.05, Fig. 4D). However, FHL2 overexpression increased the expression of the TG-related genes ACC (P < 0.05), ADRP (P < 0.05), and LPL (P < 0.05) and decreased the expression of ATGL and GPAM (P < 0.05, Fig. 4E).

In the subcutaneous adipocyte group, the silencing efficiency reached 50% (Fig. 4F), and a significant decrease in the number of subcutaneous adipocytes and the secreted lipid droplets was observed under the microscope (Fig. 4G). In addition, the OD value was reduced by approximately one-third (Fig. 4H). In terms of adipocyte marker genes, the expression of PREF-1 (P < 0.05) increased significantly, and the CEBPβ (P < 0.05) and PPARγ (P < 0.01) expression decreased significantly (Fig. 4I). In lipid marker genes, ATGL and GPAM expression increased significantly (P < 0.01), while the LPL expression decreased significantly (P < 0.05, Fig. 4J).

Fig. 4 The overexpression efficiency analysis of FHL2 gene in subcutaneous adipocytes. A The over-expression efficiency of FHL2 was detected in mRNA level, n = 5; B Morphological observation of Bodipy and Oil Red O staining; C The OD value was detected by Oil Red O staining, n = 8; D Effects of FHL2 overexpression in subcutaneous adipocytes on differentiation marker genes; E Effects of FHL2 overexpression in subcutaneous adipocytes on triglyceride synthesis marker genes; F The efficiency of silencing FHL2 in subcutaneous adipocytes was detected at the mRNA level, n = 5; G Morphological observation of Bodipy and Oil Red O staining; H The OD value was detected by Oil Red O staining, n = 8; I Effects of silence of FHL2 on adipocyte differentiation marker genes in subcutaneous adipocytes (n = 6); J Effects of silencing FHL2 in subcutaneous adipocytes on triglyceride synthesis marker genes. UXT was the internal reference gene to normalize the expression levels. “**” the difference was extremely significant (P < 0.01), “*” the difference was significantly. Data were shown as Means ± SEM

FHL2 promote the proliferation of goat intramuscular adipocytes

To explore the function of FHL2 in the proliferation of intramuscular adipocytes, crystal violet staining, MTT, RT-qPCR and EdU staining were used to detect the proliferation of intramuscular adipocytes. RT-qPCR analysis showed that overexpression of FHL2 was effective, as it achieved 20-fold changes in intramuscular adipocytes compared to the control group (Fig. 5A). After FHL2 transfection for 24, 48, and 72 h, the number of adipocytes was observed by crystal violet staining. The results showed that the number of adipocytes in the FHL2 overexpression group was greater than that in the vector group at any time (Fig. 5B). According to MTT data, the OD value at 490 nm was significantly increased in the FHL2 overexpression group compared to the vector group (Fig. 5B), which was consistent with the trend of adipocyte number at 24, 48 and 72 h (Fig. 5C). The expression levels of PCNA, CCND, CCNE and CDK2 were increased significantly (P < 0.05, Fig. 5D). Consistently, overexpression of FHL2 significantly increased the positive rate of EdU in goat intramuscular adipocytes compared with the adipocytes transfected with vector (P < 0.05, Fig. 5E, F).

In the silencing experiment group, the expression of FHL2 decreased significantly after silencing FHL2 in intramuscular adipocytes (P < 0.05, Fig. 5G). Compared with the overexpression group, Si-FHL2 had the opposite effect on intramuscular adipocyte proliferation activity. The crystal violet staining results showed that Si-FHL2 significantly inhibited the number of goat intramuscular adipocytes at any time (Fig. 5H). In addition, MTT assay data showed that silencing FHL2 significantly reduced the OD value at 490 nm (Fig. 5I), which is proportional to the number of adipocytes at 24, 48 and 72 h. Furthermore, silencing FHL2 significantly reduced the mRNA levels of cell proliferation-positively correlated markers (CCNE, PCNA, CCND and CDK2) (P < 0.05, Fig. 5J). The EdU results were consistent with the above trend, and the proliferation rate of intramuscular adipocytes was significantly reduced after silencing FHL2 (Fig. 5K, L).

Fig. 5 FHL2 promoted the proliferation of intramuscular adipocytes. A Analysis of FHL2 overexpression efficiency; B Intramuscular adipocytes were stained using crystal violet staining to determine the effect of FHL2 on adipocytes number after 0, 24, 48, and 72 h and photographed; C Intramuscular adipocytes proliferation was examined by MTT analysis; D RT-qPCR was used to detect the effects of FHL2 on cell cycle genes, PCNA, CCND, CCNE and CDK2; E The proliferation capacity of the goat intramuscular adipocytes was examined by the EdU assay; F This image represents the results obtained by EdU after transfection overexpression FHL2; G Analysis of silent efficiency of FHL2; H The number of intramuscular adipocytes after transfection silencing FHL2 at 0, 24, 48, and 72 h was determined by crystal violet staining; I Intramuscular adipocytes proliferation was examined by MTT analysis; J RT-qPCR was used to detect cell cycle genes, PCNA, CCND, CCNE and CDK2 after 48 h transfection silencing FHL2; K EdU assay was carried out after transfection silencing FHL2 for 48 h; L This image represents the results obtained by EdU after transfection silencing FHL2. “*” denotes P < 0.05, “**” indicates P < 0.01

FHL2 promotes the proliferation of subcutaneous adipocytes

We used the same method as described in section 2.5 to investigate the effect of FHL2 on the proliferation of subcutaneous adipocytes. RT-qPCR analysis showed that overexpression of FHL2 was detected with effective, as it achieved 80-fold changes in subcutaneous adipocytes compared to the control group (Fig. 6A). The number of subcutaneous adipocytes after FHL2 overexpression was significantly greater than that in the control group at any time (24, 48 and 72 h) by crystal violet staining (Fig. 6B). At the same time, the data obtained by MTT assay showed that the OD value overexpression of FHL2 at OD value was significantly higher than that of the vector group, which was consistent with the trend of adipocytes number change at 24, 48 and 72 h (Fig. 6C). The expression levels of PCNA (P < 0.05), CCNE (P < 0.05) and CDK2 (P < 0.01) increased after overexpression of FHL2 (Fig. 6D). Compared to the intramuscular adipocyte group, the CCND expression did not change after FHL2 overexpression, and the CDK2 expression increased more significantly. Furthermore, the EdU assay was performed to detect proliferation and the proliferation rate of subcutaneous adipocytes was significantly increased after overexpression of FHL2 (Fig. 6E, F).

FHL2 was silenced in goat subcutaneous adipocytes, and the results showed that the expression of FHL2 significantly decreased after silencing FHL2 (P < 0.05, Fig. 6G). Compared with the overexpression group, crystal violet staining results showed that Si-FHL2 significantly reduced the number of subcutaneous adipocytes at any time (Fig. 6H). In addition, MTT assay data showed that silencing FHL2 significantly reduced the OD value at 490 nm, which was proportional to the number of adipocytes at 24, 48 and 72 h (Fig. 6I). Furthermore, silencing FHL2 significantly reduced the mRNA levels of the cell proliferation positive correlated markers PCNA (P < 0.05), CCNE (P < 0.05) and CDK2 (P < 0.01, Fig. 6j). The EdU assay results showed that the proliferation rate of subcutaneous adipocytes was significantly reduced (P < 0.05) compared with that of the control group after silencing FHL2 (Fig. 6K, L).

Fig. 6 FHL2 promoted the proliferation of subcutaneous adipocytes. AFHL2 overexpression efficiency analysis; B Subcutaneous adipocytes were stained using crystal violet staining to determine the effect of FHL2 on adipocytes number after 0, 24, 48, and 72 h and photographed; C Subcutaneous adipocytes proliferation was examined by MTT analysis; D RT-qPCR was used to detect the effects of FHL2 on cell cycle genes, PCNA, CCND, CCNE and CDK2 after overexpression in subcutaneous adipocytes; E The proliferation capacity of the goat subcutaneous adipocytes was examined by the EdU assay; F This image represents the results obtained by EdU after transfection overexpression FHL2; G Analysis of silent efficiency of FHL2; H The number of subcutaneous adipocytes after transfection silencing FHL2 at 0, 24, 48, and 72 h was determined by crystal violet staining; I Subcutaneous adipocytes proliferation was examined by MTT analysis; J RT-qPCR was used to detect cell cycle genes, PCNA, CCND, CCNE and CDK2 after 48 h transfection silencing FHL2; K EdU assay was carried out after transfection silencing FHL2 for 48 h; L This image represents the results obtained by EdU after transfection silencing FHL2. “*” denotes P < 0.05, “**” indicates P < 0.01

FHL2 suppressed the apoptosis of intramuscular adipocytes

To explore the effects of FHL2 on intramuscular adipocyte apoptosis, RT-qPCR was used to detect the mRNA expression levels of genes (BCL2, P53 and BAX) associated with cell survival. The results showed that the expression levels of BCL2 (P < 0.05) were significantly upregulated after overexpression of FHL2 in intramuscular adipocytes (Fig. 7A), while P53 (P < 0.01) and BAX (P < 0.01) were down-regulated. (Figure 7B and C). Finally, we also performed annexin V-FITC/PI staining assy. The apoptosis index in the group transfected with FHL2 over-expression cells decreased significantly (Fig. 7D, E, P < 0.05).

In the FHL2-silenced group, the opposite trend was observed for FHL2 overexpression, and the mRNA expression level of BCL was significantly downregulated (P < 0.01, Fig. 7G). However, the mRNA expression of BAX and P53 was upregulated (P < 0.05, Fig. 7F, H). In addition, the annexin V-FETC/PI staining assay showed that the silencing FHL2-silenced group had a significantly reduced cell survival rate and increased apoptosis (Fig. 7I, J).

Fig. 7 FHL2 suppress intramuscular adipocytes apoptosis. A-C RT-qPCR detects the expression of the apoptosis marker genes expression level after FHL2 overexpression; D Intramuscular adipocytes were transfected by FHL2 overexpression and VECTOR, collected, and stained by Annexin V-FITC/PI. Intramuscular adipocytes apoptosis phase distribution was analyzed by flow cytometry; E Intramuscular adipocytes apoptosis index was analyzed between FHL2 overexpression and VECTOR group; F-H RT-qPCR detects the expression of apoptosis relative genes after silencing FHL2; I Intramuscular adipocytes were transfected by silencing FHL2 and NC, collected and stained by Annexin V-FITC/PI. Intramuscular adipocytes apoptosis phase distribution was analyzed by flow cytometry; J Intramuscular adipocytes apoptosis index was analyzed between silencing FHL2 and NC group

FHL2 suppresses the apoptosis of subcutaneous adipocytes

The effect of FHL2 on the apoptosis of subcutaneous adipocytes is large in the same way as described in section 3.5. After FHL2 overexpression, BAX (P < 0.01, Fig. 8A) and P53 (P < 0.05, Fig. 8B) expression levels decreased, and BCL expression levels increased (P < 0.05, Fig. 8C). The annexin V-FETC/PI staining assay showed that FHL2 overexpression significantly reduced the apoptosis rate and improved the cell survival rate (P < 0.05, Fig. 8D, E).

After silencing FHL2, the expression of BAX (P < 0.05, Fig. 8F) and P53 (P < 0.05, Fig. 8G) increased, and the expression of BCL (P < 0.01) decreased (Fig. 8H). Through an annexin V-FITC/PI staining assay, it was found that the apoptosis rate of adipocytes increased significantly (Fig. 8I, J).

Fig. 8 FHL2 suppress subcutaneous adipocytes apoptosis. A-C RT-qPCR detects the expression of the apoptosis marker genes after silencing FHL2; D Subcutaneous adipocytes were transfected by FHL2 overexpression and VECTOR, collected, and stained by Annexin V-FITC/PI. Subcutaneous adipocytes apoptosis phase distribution was analyzed by flow cytometry; E Subcutaneous adipocytes apoptosis index was analyzed between FHL2 overexpression and VECTOR group; F-H RT-qPCR detects the expression of apoptosis marker genes after silencing FHL2; I Subcutaneous adipocytes were transfected by silencing FHL2 and NC, collected and stained by Annexin V-FITC/PI. Subcutaneous adipocytes apoptosis phase distribution was analyzed by flow cytometry; J Subcutaneous adipocytes apoptosis index was analyzed between silencing FHL2 and NC group

Discussion

The prevalence of obesity is rising globally, a series of diseases associated with obesity represent major public health issue [7–9]. Therefore, it is crucial to improve meat quality and human health by elucidating the molecular mechanisms of adipogenesis.

Previous reports showed that several FHL2 were associated with adipocyte growth and development [19, 20]. In our study, FHL2 was differentially expressed in intramuscular preadipocytes and mature intramuscular adipocytes in transcriptome sequencing analysis of intramuscular adipocytes 3 days after differentiation. FHL2 is found to be downregulated in mature adipocytes. Taken together, these data suggest that FHL2 may be associated with adipogenesis. The aim of this study was to investigate the exact role of FHL2 in the development of subcutaneous adipocytes and intramuscular adipocytes.

In this study, we successfully cloned the FHL2 gene of goats and found that the nucleotides and amino acids of FHL2 were similar between goats and sheep respectively, indicating that goats are highly conserved between different species (Supplementary Fig. 3). Goat FHL2 protein maybe predominantly random coil. To further decipher the function of FHL2, the expression profile of FHL2 in goat tissue, as well as the temporal expression profile of FHL2 in subcutaneous adipocyte differentiation and intramuscular adipocyte differentiation in goats were analyzed. Tissue expression profiles showed that FHL2 was widely expressed in goat tissues and highest in kidneys, and the study of Li Sirui et al. showed that FHL2 has the highest expression in human and mouse kidneys, which was consistent with the results of this study [31]. Temporal expression profiles showed that FHL2 expression changed during intramuscular and subcutaneous adipocyte differentiation, and the time points of the highest expression of FHL2 were different in these two processes.

Previous studies have shown that FHL2 is positively correlated with fat hypertrophy, and loss of FHL2 protects mice from diet-induced obesity [32]. Adipocyte differentiation is a complex biological process that involves changes in cell structure and function [33] and is regulated by many transcription factors. Transcription factors such as AP2, C/EBPα, C/EBPβ, SREBP, PREF-1 and PPARγ, are important in the process of adipocyte differentiation, among which C/EBPβ and SREBP promote the differentiation of adipocytes by activating the expression of PPARγ [34–37]. Bodipy and Oil red O staining revealed a significant increase in the number of adipocytes and lipid droplet secretion after FHL2 overexpression, while the opposite trend occurred after FHL2 silencing. In addition, the results showed that FHL2 overexpression significantly promoted the expression of PPARγ and C/EBPβ in subcutaneous and intramuscular adipocytes, and the expression of PREF-1 decreased after overexpression. At the molecular level, FHL2 overexpression significantly promoted the expression of PPARγ and C/EBPβ in subcutaneous and intramuscular adipocytes, inhibited the expression of PREF-1, and showed a reverse trend after silencing with FHL2. Unlike this study, FHL2 inhibits colon cancer cell line HT-29 cells and neuronal cell growth and differentiation [38, 39]. The results of this study show that FHL2 promotes intramuscular and subcutaneous adipocyte differentiation in goats.

Studies have shown that FHL2 promotes the proliferation of human colon cancer cells and breast cancer cells, and mouse smooth muscle cells and regulates the expression of cyclin CCND [40–42]. Cell proliferation is regulated by gene expression, such as CCNE, PCNA, CCND, and CDK2, which are all positive regulators of cell proliferation [43–46]. At the molecular level, overexpression of FHL2 promotes the expression of CCND, CCNE, CDK2, and PCNA in intramuscular adipocytes and is inhibited after silencing FHL2. In subcutaneous adipocytes, it was found that CCND was not affected after overexpression of FHL2, and the expression of CDK2 was more significant. A study reported that FHL2 inhibits the proliferation of human hepatoma cells by inhibiting the expression of CCND, which is different from this study [47]. The above results indicate that FHL2 promotes the proliferation of intramuscular and subcutaneous adipocytes.

Recent studies have shown that FHL2 inhibited apoptosis in hepatoma cells, and enhancing FHL2 expression promotes bone marrow progenitor cells to enter the cell cycle and increases the frequency of apoptosis in vivo by bone marrow cells. In addition, lncRNA DLX6-AS1 aggravates ovarian apoptosis by regulating miR-195-5p through sponging [48–50]. As a regulator of apoptosis, BAX induces cell damage leading to apoptosis, Bcl-2 encodes the outer mitochondrial membrane protein to inhibit cell apoptosis. As reports, the decrease of Bcl‐2 is related with enhanced Bax signal, and BCL is known to inhibit P53-induced apoptosis [50, 51]. After overexpression of FHL2 and then intramuscular adipocytes and subcutaneous adipocytes, the expression levels of BCL were upregulated, and the expression levels of BAX and P53 were downregulated. In addition, the flow cytometry phenomenon showed that the apoptosis rate of adipocytes after overexpression of FHL2 was significantly lower than that of the control group, and the opposite phenomenon occurred after silencing FHL2. In summary, FHL2 inhibits apoptosis of intramuscular and subcutaneous adipocytes.

Conclusion

This study shows FHL2 may be a positive regulator of intramuscular and subcutaneous adipocyte differentiation and proliferation, and acts as a negative regulator of intramuscular and subcutaneous adipocyte apoptosis (Fig. 9).

Fig. 9 Effects of gene FHL2 on the development of subcutaneous and intramuscular adipocytes in goats

Materials and methods

Cell culture

All experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee, Southwest Minzu University (Chengdu) (Number 20200120). Methods were performed according to the guidelines and regulations. Isolation and culture of goat intramuscular preadipocytes and subcutaneous adipocytes were performed as previously described [52, 53]. Cells stored in liquid nitrogen were thawed in a 37 ℃ water bath. Then add 5 mL of 10% fetal bovine serum (FBS, HyClone, Logan, America) with a total of 7 mL. And moved it to 10 mL tube and centrifuged at 289 g for 5 min. Discard the supernatant, leave the pallet and 5 mL FBS for mix well then cultured in petri dish. When the F3 cells grew to 80% confluence, 50 μmol/L of oleic acid (Sigma, Shanghai, China) was added to the culture medium to induce preadipocyte adipogenic differentiation.

Sequencing and differentially expressed gene screening

Qubit2.0 was used for preliminary quantification after the library was constructed. We diluted the library to 1 ng/ul, and then used Agilent 2100 to detect the insert size of the library. The qPCR was used to accurately quantify the effective concentration of the library (the effective concentration of the library > 2 nM), which can ensure the quality of the library. The constructed library was sequenced using the Illumina HiSeq-technique. The |log2FoldChange|>0 and p value < 0.05 were considered to indicate differential expressed.

Animals

Jian-Zhou Da-er goats (n = 3) were selected as test animal. Tissue samples such as heart, liver, spleen, lung, kidney, subcutaneous, back and periend. The samples were washed with DEPC (diethypyrocarbonate) water quickly loaded into Rase-free compere and stored in liquid nitrogen. First strand of cDNA was synthesized by the Revert Aid First strand cDNA synthesis Kit (Therma, Massachusetts, America).

FHL2 gene cloning

According to the predicted sequences of goat FHl2 mRNA (GenBack accession number XM-018054974.1). The primer pair (Table 1) was designed using Primer Premier 5.0 software. The PCR system contained 1.1 x T3 super PCR mix 22 μL, cDNA (10 μmol/L) 1 μL, FHL2-S (10 μmol/L) 1 μL, and FHL2-A (10 μmol/L) 1 μL. The PCR procedure, included pre-degeneration (98 ℃, 3 min), all of degeneration (98 ℃, 10 s), annealing (60 ℃, 10 s) and extension (72 ℃, 20 s) 35cycles. Final extension (72 ℃, 2 min), preserving at 4 ℃. The destination strand was recycled via recovery kit (Takara, Tokyo, Japan). Strands were ligated into the 007 vs. vector (Tsinke, Beijing, China) and sequenced by Tsingke Biotechnology. Co. Ltd.

Expression patterns of FHL2 gene in goat tissues and subcutaneous and intramuscular adipocyte adipogenesis

Expression patterns of the FHL2 gene in goat tissues

cDNA (heart, liver, spleen, lung, kidney, subcutaneous fat, back, perirenal) from goats was used to perform RT-qPCR to detect gene expression levels. RT-qPCR primers (Table 1) were designed according to the FHL2 gene CDS region obtained from cloning. Detection of FHL2 gene expression levels in different goat tissues. 10 μL PCR mixture: D-FHL2-S (10 μmol/μL) 0.5 μL, D-Fhl2-A (10 μmol/μL) 0.5 μL, TB Green TM premix 2 × 5 μL, ddH2O 3.5 μL and cDNA 0.5 μL. Procedure: Pre-degeneration (95 ℃, 3 s), all of degeneration (95 ℃, 10 s), annealing (58 ℃, 10 s), extension (72 ℃ 15 s), 38 cycles. Four duplicates per tissue.

Expression patterns of the FHL2 gene in goat subcutaneous and intramuscular adipocyte adipogenesis

The expression level of FHL2 in subcutaneous and intramuscular adipocytes at different stages of differentiation (0, 12, 24, 36, 48, 60, 72, 84, 96, 108 and 120 h) was detected in the same way as mentioned in 1.4 above. qPCR was used to detect the expression pattern of the FHL2 gene in the adipocytes that were induced to differentiate from 0 h to 120 h by oleic acid.

Construction of the FHL2 overexpression vector

We used DNAMAN to find the restriction enzyme of FHL2 (NEHI, KPNI two enzymes used to construct an overexpression vector) based on the FHL2 sequence of Jian Zhou Da-er goat, designed the subcloning primers OE-FHL2-S (TAGCATGACCGAGCGCTTTGAC, start codon is ATG, GCTAGC is the restriction site of NEHI) and OE-FHL2 (GGGGTACCTCAGAGATGTCCTTCCCGCA, the restriction site of KPNI is GGTACC AGT is the stop codon). The goat FHL2 plasmid was used as a template to amplify its CDS. Then we used PCDNA3.1 (stored by key of Qinghai Tibetan Plateau Animal Genetic Resource Reservation and Utilization Ministry of Education, Southwest Minzu University) as a vector. The second digestion was performed with the CDS vector by KPNI (Thermo, Massachusetts, America) and NEHI (Thermo, Massachusetts, America) at 37 ℃ for 30 min, followed by purification and ligation with T4 ligase (Takara, Tokyo, Japan) in a 16 ℃ water bath for 16 h. Finally, the recombinant vector was identified by enzyme digestion and detected by gel- electrophoresis, and sequencing.

Oil Red O and BODIPY staining

Cells were washed 3 times with phosphate-buffered saline (PBS), then fixed it in 4% formaldehyde for 30 min, washed 3 times with PBS, and stained with Oil Red O for 1 h (Solarbio, Beijing, China), and then washed three times with polyester PBS and moistened, then photographed with an epifluorescence microscope equipped (Olympus IX-73, Tokyo, Japan). Oil Red O dye was extracted with 100% isopropanol, and the Oil Red O signal was quantified by measuring the absorbance at 490 nm to determine the extent of lipid drop accumulation. Fixed cells were stained with BODIPY solution for 20 min, washed three times and moistened with PBS for imaging by microscope.

MTT assay

MTT assay was used to detect intramuscular and subcutaneous adipocyte proliferation in goats. Intramuscular and subcutaneous preadipocytes were seeded in 96-well plates at a density of 4 × 103cells per well. After 0, 24, 48 and 72 h of adipocyte culture, 10 μL of MTT reagent (Solarbio, Beijing, China) was added to each well, away from light, and then the adipocytes were incubated with 5% CO2 at 37 °C for 3.5 h. Finally, absorbance was measured at a wavelength of 490 nm using an enzyme-labelled instrument (PEI OU, Shanghai, China).

Cell proliferation and apoptosis assay

EdU proliferation assay

The intramuscular and subcutaneous preadipocyte abilities in goats were measured by an EdU incorporation assay (Beyotime, Shanghai, China). First, goat intramuscular and subcutaneous adipocytes were seeded in 24-well plates and then transfected when confluency reached 60%. After 48 h of transfection, goat intramuscular and subcutaneous adipocytes were stained with 50 μmol/μL EdU solution for 2 h, fixed with 4% paraformaldehyde for 30 min, and infiltrated with 0.3% Triton X-100 for 15 min. Cells were then incubated with the click-reaction mix provided with the EdU staining kit for 20 min and stained with DAPI for 20 min. Finally, adipocytes were photographed by a fluorescence microscope (Olympus, Tokyo, Japan).

Cell apoptosis assay

The original culture medium was aspirated and moved to a centrifuge tube, the cells were rinsed with PBS, and the waste solution was discarded. Add 1 mL of EDTA-free pancreatic enzyme for digestion, wait for the cells to be separated, add the original culture medium to terminate the digestion, and collect the cells. Centrifuge at 289 g for 5 min, aspirate the supernatant, wash twice with PBS, collect the cell pellet, resuspend the cells with a 500 μL binding buffer, add 5 μL ANNEXIN V to blow well, and then add 5 μL PI to mix well. The reaction at room temperature is protected from light for 15 min, and the machine is detected and analysed.

RT-qPCR, RNA-seq data verification and data analysis

RT-qPCR

Total RNA (1 μg) was used for reverse transcription and mRNA reverse transcription, and the obtained cDNA was used as a template for qPCR to detect expression levels, which were randomly selected from differentially expressed mRNAs to verify the accuracy of the RNA-Seq results. In addition, we obtained cDNA from goat tissues and cultured cells and detected the expression levels of FHL2. To normalize the level of mRNA in tissues and adipocytes, a ubiquitously expressed gene (UXT) was selected as an internal reference gene. In addition, the expression of differentiation marker genes such as C/EBPα, C/EBPβ, PPARγ, PREF-1, SREBP and AP2 were detected. The sequences of the primers are shown in the Table 1. RT‒qPCR was carried out with a Bio Rad Real-Time PCR system. Data were analysed using the comparative Ct method (2−ΔΔCt).

Table 1 The information of primers

Gene name	sequence	Purpose	Length	Tm	
FHL2	S: AGGCAGAAACAAGACAGGTGA	PCR	1353bp	58℃	
	A: CGACAGGAAGTTACACCGGA			
D-FHL2	S: GCACCCGCAAGATGGAGTA	RT-qPCR	180bp	60℃	
	A: TCGGGATGAAGCTCTTGGTT			
UXT	S: GCAAGTGGATTTGGGCTGTAAC	RT-qPCR	180bp	60℃	
	A: ATGGAGTCCTTGGTGAGGTTGT			
C/EBPα	S: CTCCGGATCTCAAGACTGCC	RT-qPCR	136bp	60℃	
A: CCCCTCATCTTAGACGCACC	
C/EBPβ	S: CAACCTGGAGACGCAGCACAAG	RT-qPCR	204bp	60℃	
A: GCTTGAACAAGTTCCGCAGGGT	
PPARγ	S: AAGCGTCAGGGTTCCACTATG	RT-qPCR	197bp	60℃	
A: GAACCTGATGGCGTTATGAGAC	
PREF-1	S: CCTGAAAATGGATTCTGCGACG	RT-qPCR	255bp	60℃	
A: GACACAGGAGCACTCGTACTG	
SREBP	S: AACATCTGTTGGAGCGAGCA	RT-qPCR	134bp	60℃	
A: TCCAGCCATATCCGAACAGC	
AP2	S: TGAAGTCACTCCAGATGACAG	RT-qPCR	143bp	60℃	
	A: TGACACATTCCAGCACCAG			
ACC	S: GGAGACAAACAGGGACCATT	RT-qPCR	180bp	60℃	
	A: ATCAGGGACTGCCGAAAC			
ADRP	S: TACGATGATACAGATGAATCCCAC	RT-qPCR	170bp	60℃	
	A: CAGCATTGCGAAGCACAGAGT			
ATGL	S: GGTGCCAATATCATCGAGGT	RT-qPCR	125bp	60℃	
	A: CACACCCGTGGCAGTCAG			
GPAM	S: GGAGCAAGCATTGTTGCCAG	RT-qPCR	135bp	60℃	
	A: CAATCAGTCTTCGGCGGGAT			
DGAT1	S: CCACTGGGACCTGAGGTGTC	RT-qPCR	140bp	60℃	
	A: GCATCACCACACACCAATTCA			
LPL	S: TCCTGGAGTGACGGAATCTGT	RT-qPCR	114bp	60℃	
	A: GACAGCCAGTCCACCACGAT			
PCNA	S: TTTGAGGCACGCCTGATCC	RT-qPCR	172bp	60℃	
	A: GGAGACGTGAGACGAGTCCAT			
CCND	S; TAGGCCCTCAGCCTCACTC	RT-qPCR	80bp	60℃	
	A: CCACCCCTGGGATAAAGCAC			
CCNE	S: CTTGCAGTGAGTGACGTAGAC	RT-qPCR	94bp	60	
	A: CCAGTTGTCGGAGATAAGCATAG				
CDK2	S; CAAAGCCAAGCACGTAGAGAC	RT-qPCR	141bp	60	
	A: TGCACCACATATTGACTGTCC				
BAX	S: TGAAGACAGGGGCCTTTTTG	RT-qPCR	140bp	60	
	A: AATTCGCCGGAGACACTCG				
BCL	S: GACTTCTCTCGGCGCTACC	RT-qPCR	198bp	60	
	A: CACATGACCCCTCCGAACTC				
P53	S: CAACAAATGCTGGCTACTAAGGA	RT-qPCR	168bp	60	
	A: CACGAGTTTTCCGTTGCTCA				

Statistical analysis of data

GraphPad 8.0 software was used for significance analysis and multiple comparison. Data are expressed as the mean ± SEM. P < 0.05 was defined as the significance threshold. RT-qPCR data through the 2-ΔΔCt method analysis. “b”, and “*’’ indicate that the difference was significant (P < 0.05), and “a, **” indicate that the difference was extremely significant.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Acknowledgements

Not applicable.

Author contributions

An Li, Youli Wang, and Yaqiu Lin: conceptualization, methodology, and writing of the original draft. Yong Wang, Yan Xiong, and Jiangjiang Zhu: methodology. Yanyan Li and Wei Liu: investigation and analysis. Yaqiu Lin: resources, project administration. Yanyan Li, Yaqiu Lin: review and editing.

Funding

This work was supported by National Natural Sciences Foundation of China (32072723), Sichuan Science and Technology Program (2022JDTD0030), and Southwest Minzu University Double World-Class Project (XM2023011).

Data availability

The raw data supporting the results of this study may be obtained from the corresponding authors upon reasonable request. The name of the database is Open science framework, which can be obtained through this link 10.17605/OSF.IO/N7M2S.

Declarations

Ethics approval and consent to participate

We purchased one year old male Jian-Zhou Da-er goats (n = 3) from Jianyang Tian Di Animal Husbandry Co., Ltd. (Sichuan, China) and we obtained the informed consent from the owner for the use of animals. And the experimental animals were injected barbiturate injection into the intraperitoneal cavity at a dose of 100 mg/kg, then bled to death. The carcasses are temporarily stored in freezer and then handed over to a professional solid waste disposal company for unified disposal. The experiment in this study were complied with the requirements of the directory of the Ethical Treatment of Experimental Animals of China. The animal study was reviewed and approved by Animal Experimental Ethical Inspection Committee of Southwest Minzu University (Chengdu, Sichuan, China), and all the experiment were performed under the requirement No. 2020-1-20. All animal experimental protocol has been carried out in accordance with relevant guidelines and regulations. All methods are reported in accord-ance with ARRIVE guidelines for the reporting of animal experiments.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

ACC Acetyl-CoA carboxylase

ADRP Adipose differentiation-related protein

ANNEXIN V The method to detect the cell apoptosis

AP2 APETALA-2-Like transcription factor gene

ATGL Fat triglyceride lipase

BAX Bcl-2-associated X protein

BCL B-cell lymphoma

C/EBPβ CCAT enhancer binding proteinβ

CCND Cyclin D1

CCNE Cyclin E1

CDK2 Cyclin-Dependent Kinases

DEPC Diethypyrocarbonate

DGAT Diglyceryl acyltransferase

E4F1 E4 transcription factor

EdU The method to detect the cell ability

FHL2 Four and half LIM protein

GPAM Glycerol-3-phosphate acyltransferase

LPL Lipoprotein lipase

MTT The method used in this experiment to detect cell viability

P21 Cyclin-dependent kinase inhibitor 1 A

P27 Tumor suppressor 27

P53 Tumor suppressor 53

PCNA Proliferating cell nuclear antigen

PI The method for stain cell

PPARγ Peroxisome proliferator activated receptorγ

PREF-1 Preadipocyte Factor 1

RT-qPCR Real time quantitative polymerase chain reaction

SKI Protein (SKI)

SREBP-1 Sterol regulating element binding protein isoform 1

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Ottaviani E Malagoli D Franceschi C The evolution of the adipose tissue: a neglected enigma Gen Comp Endocrinol 2011 174 1 1 4 10.1016/j.ygcen.2011.06.018 21781968
Ottaviani E, Malagoli D, Franceschi C. The evolution of the adipose tissue: a neglected enigma. Gen Comp Endocrinol. 2011;174(1):1–4.21781968 10.1016/j.ygcen.2011.06.018
2. Coelho M Oliveira T Fernandes R Biochemistry of adipose tissue: an endocrine organ Arch Med Sci 2013 9 2 191 200 10.5114/aoms.2013.33181 23671428
Coelho M, Oliveira T, Fernandes R. Biochemistry of adipose tissue: an endocrine organ. Arch Med Sci. 2013;9(2):191–200.23671428 10.5114/aoms.2013.33181
3. Halberg N Wernstedt-Asterholm I Scherer PE The adipocyte as an endocrine cell Endocrinol Metab Clin North Am 2008 37 3 753 xi 10.1016/j.ecl.2008.07.002 18775362
Halberg N, Wernstedt-Asterholm I, Scherer PE. The adipocyte as an endocrine cell. Endocrinol Metab Clin North Am. 2008;37(3):753–xi.18775362 10.1016/j.ecl.2008.07.002
4. Liu R Liu X Bai X Xiao C Dong Y A study of the Regulatory mechanism of the CB1/PPARγ2/PLIN1/HSL pathway for Fat metabolism in cattle Front Genet 2021 12 631187 10.3389/fgene.2021.631187 34017353
Liu R, Liu X, Bai X, Xiao C, Dong Y. A study of the regulatory mechanism of the CB1/PPARγ2/PLIN1/HSL pathway for fat metabolism in cattle. Front Genet. 2021;12:631187.34017353 10.3389/fgene.2021.631187
5. Anderson F Pannier L Pethick DW Gardner GE Intramuscular fat in lamb muscle and the impact of selection for improved carcass lean meat yield Animal 2015 9 6 1081 90 10.1017/S1751731114002900 25510326
Anderson F, Pannier L, Pethick DW, Gardner GE. Intramuscular fat in lamb muscle and the impact of selection for improved carcass lean meat yield. Animal. 2015;9(6):1081–90.25510326 10.1017/S1751731114002900
6. Wang Y Zhang Y Su X Wang H Yang W Zan L Cooperative and Independent functions of the miR-23a ∼ 27a ∼ 24–2 cluster in bovine adipocyte adipogenesis Int J Mol Sci 2018 19 12 3957 10.3390/ijms19123957 30544847
Wang Y, Zhang Y, Su X, Wang H, Yang W, Zan L. Cooperative and independent functions of the miR-23a ∼ 27a ∼ 24–2 cluster in bovine adipocyte adipogenesis. Int J Mol Sci. 2018;19(12):3957.30544847 10.3390/ijms19123957
7. Arner P Kulyté A MicroRNA regulatory networks in human adipose tissue and obesity Nat Rev Endocrinol 2015 11 5 276 88 10.1038/nrendo.2015.25 25732520
Arner P, Kulyté A. MicroRNA regulatory networks in human adipose tissue and obesity. Nat Rev Endocrinol. 2015;11(5):276–88.25732520 10.1038/nrendo.2015.25
8. Hausman DB DiGirolamo M Bartness TJ Hausman GJ Martin RJ The biology of white adipocyte proliferation Obes Rev 2001 2 4 239 54 10.1046/j.1467-789X.2001.00042.x 12119995
Hausman DB, DiGirolamo M, Bartness TJ, Hausman GJ, Martin RJ. The biology of white adipocyte proliferation. Obes Rev. 2001;2(4):239–54.12119995 10.1046/j.1467-789X.2001.00042.x
9. Hilton C Neville MJ Karpe F MicroRNAs in adipose tissue: their role in adipogenesis and obesity Int J Obes (Lond) 2013 37 3 325 32 10.1038/ijo.2012.59 22531086
Hilton C, Neville MJ, Karpe F. MicroRNAs in adipose tissue: their role in adipogenesis and obesity. Int J Obes (Lond). 2013;37(3):325–32.22531086 10.1038/ijo.2012.59
10. Li M Sun X Cai H Sun Y Plath M Li C Lan X Lei C Lin F Bai Y Chen H Long non-coding RNA ADNCR suppresses adipogenic differentiation by targeting miR-204 Biochim Biophys Acta 2016 1859 7 871 82 10.1016/j.bbagrm.2016.05.003 27156885
Li M, Sun X, Cai H, Sun Y, Plath M, Li C, Lan X, Lei C, Lin F, Bai Y, Chen H. Long non-coding RNA ADNCR suppresses adipogenic differentiation by targeting miR-204. Biochim Biophys Acta. 2016;1859(7):871–82.27156885 10.1016/j.bbagrm.2016.05.003
11. Park CY Han SN The role of vitamin D in adipose tissue Biology: adipocyte differentiation, Energy Metabolism, and inflammation J Lipid Atheroscler 2021 10 2 130 44 10.12997/jla.2021.10.2.130 34095008
Park CY, Han SN. The role of vitamin D in adipose tissue biology: adipocyte differentiation, energy metabolism, and inflammation. J Lipid Atheroscler. 2021;10(2):130–44.34095008 10.12997/jla.2021.10.2.130
12. Chu PH Ruiz-Lozano P Zhou Q Cai C Chen J Expression patterns of FHL/SLIM family members suggest important functional roles in skeletal muscle and cardiovascular system Mech Dev 2000 95 1–2 259 65 10.1016/S0925-4773(00)00341-5 10906474
Chu PH, Ruiz-Lozano P, Zhou Q, Cai C, Chen J. Expression patterns of FHL/SLIM family members suggest important functional roles in skeletal muscle and cardiovascular system. Mech Dev. 2000;95(1–2):259–65.10906474 10.1016/S0925-4773(00)00341-5
13. Zhou R Li S Liu J Wu H Yao G Sun Y Chen ZJ Li W Du Y Up-regulated FHL2 inhibits ovulation through interacting with androgen receptor and ERK1/2 in polycystic ovary syndrome EBioMedicine 2020 52 102635 10.1016/j.ebiom.2020.102635 32028069
Zhou R, Li S, Liu J, Wu H, Yao G, Sun Y, Chen ZJ, Li W, Du Y. Up-regulated FHL2 inhibits ovulation through interacting with androgen receptor and ERK1/2 in polycystic ovary syndrome. EBioMedicine. 2020;52:102635.32028069 10.1016/j.ebiom.2020.102635
14. van de Pol V Vos M DeRuiter MC Goumans MJ de Vries CJM Kurakula K LIM-only protein FHL2 attenuates inflammation in vascular smooth muscle cells through inhibition of the NFκB pathway Vascul Pharmacol 2020 125–126 106634 31866461
van de Pol V, Vos M, DeRuiter MC, Goumans MJ, de Vries CJM, Kurakula K. LIM-only protein FHL2 attenuates inflammation in vascular smooth muscle cells through inhibition of the NFκB pathway. Vascul Pharmacol. 2020;125–126:106634.31866461
15. Cai T Sun D Duan Y Qiu Y Dai C Yang J He W FHL2 promotes tubular epithelial-to-mesenchymal transition through modulating β-catenin signalling J Cell Mol Med 2018 22 3 1684 95 10.1111/jcmm.13446 29193729
Cai T, Sun D, Duan Y, Qiu Y, Dai C, Yang J, He W. FHL2 promotes tubular epithelial-to-mesenchymal transition through modulating β-catenin signalling. J Cell Mol Med. 2018;22(3):1684–95.29193729 10.1111/jcmm.13446
16. Zhu Y Li P Dan X Kang X Ma Y Shi Y miR-377 inhibits proliferation and differentiation of bovine skeletal muscle Satellite cells by targeting FHL2 Genes (Basel) 2022 13 6 947 10.3390/genes13060947 35741709
Zhu Y, Li P, Dan X, Kang X, Ma Y, Shi Y. miR-377 inhibits proliferation and differentiation of bovine skeletal muscle satellite cells by targeting FHL2. Genes (Basel). 2022;13(6):947.35741709 10.3390/genes13060947
17. Wang GF Niu X Liu H Dong Q Yao Y Wang D Liu X Cao C c-Abl kinase regulates cell proliferation and ionizing radiation-induced G2/M arrest via phosphorylation of FHL2 FEBS Open Bio 2021 11 6 1731 8 10.1002/2211-5463.13177 33932144
Wang GF, Niu X, Liu H, Dong Q, Yao Y, Wang D, Liu X, Cao C. c-Abl kinase regulates cell proliferation and ionizing radiation-induced G2/M arrest via phosphorylation of FHL2. FEBS Open Bio. 2021;11(6):1731–8.33932144 10.1002/2211-5463.13177
18. Lu Y, Cai G, Cui S, Geng W, Chen D, Wen J, Zhang Y, Zhang F, Xie Y, Fu B, Chen X. FHL2-driven molecular network mediated Septin2 knockdown inducing apoptosis in mesangial cell. Proteomics. 2014;14(21–22):2485-97. 10.1002/pmic.201400252. Epub 2014 Sep 22. PMID: 25103794.
19. Habibe JJ Clemente-Olivo MP Scheithauer TPM Rampanelli E Herrema H Vos M Mieremet A Nieuwdorp M van Raalte DH Eringa EC de Vries CJM Glucose-mediated insulin secretion is improved in FHL2-deficient mice and elevated FHL2 expression in humans is associated with type 2 diabetes Diabetologia 2022 65 10 1721 33 10.1007/s00125-022-05750-1 35802167
Habibe JJ, Clemente-Olivo MP, Scheithauer TPM, Rampanelli E, Herrema H, Vos M, Mieremet A, Nieuwdorp M, van Raalte DH, Eringa EC, de Vries CJM. Glucose-mediated insulin secretion is improved in FHL2-deficient mice and elevated FHL2 expression in humans is associated with type 2 diabetes. Diabetologia. 2022;65(10):1721–33.35802167 10.1007/s00125-022-05750-1
20. Clemente-Olivo MP Habibe JJ Vos M Ottenhoff R Jongejan A Herrema H Zelcer N Kooijman S Rensen PCN van Raalte DH Nieuwdorp M Eringa EC de Vries CJ Four-and-a-half LIM domain protein 2 (FHL2) deficiency protects mice from diet-induced obesity and high FHL2 expression marks human obesity Metabolism 2021 121 154815 10.1016/j.metabol.2021.154815 34119536
Clemente-Olivo MP, Habibe JJ, Vos M, Ottenhoff R, Jongejan A, Herrema H, Zelcer N, Kooijman S, Rensen PCN, van Raalte DH, Nieuwdorp M, Eringa EC, de Vries CJ. Four-and-a-half LIM domain protein 2 (FHL2) deficiency protects mice from diet-induced obesity and high FHL2 expression marks human obesity. Metabolism. 2021;121:154815.34119536 10.1016/j.metabol.2021.154815
21. Labalette C Nouët Y Sobczak-Thepot J Armengol C Levillayer F Gendron MC Renard CA Regnault B Chen J Buendia MA Wei Y The LIM-only protein FHL2 regulates cyclin D1 expression and cell proliferation J Biol Chem 2008 283 22 15201 8 10.1074/jbc.M800708200 18378678
Labalette C, Nouët Y, Sobczak-Thepot J, Armengol C, Levillayer F, Gendron MC, Renard CA, Regnault B, Chen J, Buendia MA, Wei Y. The LIM-only protein FHL2 regulates cyclin D1 expression and cell proliferation. J Biol Chem. 2008;283(22):15201–8.18378678 10.1074/jbc.M800708200
22. Paul C Lacroix M Iankova I Julien E Schäfer BW Labalette C Wei Y Le Cam A Le Cam L Sardet C The LIM-only protein FHL2 is a negative regulator of E4F1 Oncogene 2006 25 40 5475 84 10.1038/sj.onc.1209567 16652157
Paul C, Lacroix M, Iankova I, Julien E, Schäfer BW, Labalette C, Wei Y, Le Cam A, Le Cam L, Sardet C. The LIM-only protein FHL2 is a negative regulator of E4F1. Oncogene. 2006;25(40):5475–84.16652157 10.1038/sj.onc.1209567
23. Lai CF Bai S Uthgenannt BA Halstead LR McLoughlin P Schafer BW Chu PH Chen J Otey CA Cao X Cheng SL Four and half lim protein 2 (FHL2) stimulates osteoblast differentiation J Bone Min Res 2006 21 1 17 28 10.1359/JBMR.050915
Lai CF, Bai S, Uthgenannt BA, Halstead LR, McLoughlin P, Schafer BW, Chu PH, Chen J, Otey CA, Cao X, Cheng SL. Four and half lim protein 2 (FHL2) stimulates osteoblast differentiation. J Bone Min Res. 2006;21(1):17–28.10.1359/JBMR.050915
24. Lu Y Cai G Cui S Geng W Chen D Wen J Zhang Y Zhang F Xie Y Fu B Chen X FHL2-driven molecular network mediated Septin2 knockdown inducing apoptosis in mesangial cell Proteomics 2014 14 21–22 2485 97 10.1002/pmic.201400252 25103794
Lu Y, Cai G, Cui S, Geng W, Chen D, Wen J, Zhang Y, Zhang F, Xie Y, Fu B, Chen X. FHL2-driven molecular network mediated Septin2 knockdown inducing apoptosis in mesangial cell. Proteomics. 2014;14(21–22):2485–97.25103794 10.1002/pmic.201400252
25. Scholl FA McLoughlin P Ehler E de Giovanni C Schäfer BW DRAL is a p53-responsive gene whose four and a half LIM domain protein product induces apoptosis J Cell Biol 2000 151 3 495 506 10.1083/jcb.151.3.495 11062252
Scholl FA, McLoughlin P, Ehler E, de Giovanni C, Schäfer BW. DRAL is a p53-responsive gene whose four and a half LIM domain protein product induces apoptosis. J Cell Biol. 2000;151(3):495–506.11062252 10.1083/jcb.151.3.495
26. Chen D Xu W Bales E Colmenares C Conacci-Sorrell M Ishii S Stavnezer E Campisi J Fisher DE Ben-Ze’ev A, Medrano EE. SKI activates Wnt/beta-catenin signaling in human melanoma Cancer Res 2003 63 20 6626 34 14583455
Chen D, Xu W, Bales E, Colmenares C, Conacci-Sorrell M, Ishii S, Stavnezer E, Campisi J, Fisher DE, Ben-Ze’ev A, Medrano EE. SKI activates Wnt/beta-catenin signaling in human melanoma. Cancer Res. 2003;63(20):6626–34.14583455
27. Pareek CS Sachajko M Jaskowski JM Herudzinska M Skowronski M Domagalski K Szczepanek J Czarnik U Sobiech P Wysocka D Pierzchala M Polawska E Stepanow K Ogłuszka M Juszczuk-Kubiak E Feng Y Kumar D Comparative analysis of the liver transcriptome among cattle breeds using RNA-seq Vet Sci 2019 6 2 36 30934933
Pareek CS, Sachajko M, Jaskowski JM, Herudzinska M, Skowronski M, Domagalski K, Szczepanek J, Czarnik U, Sobiech P, Wysocka D, Pierzchala M, Polawska E, Stepanow K, Ogłuszka M, Juszczuk-Kubiak E, Feng Y, Kumar D. Comparative analysis of the liver transcriptome among cattle breeds using RNA-seq. Vet Sci. 2019;6(2):36.30934933
28. Song C Huang Y Yang Z Ma Y Chaogetu B Zhuoma Z Chen H RNA-Seq analysis identifies differentially expressed genes Insubcutaneous Adipose Tissuein Qaidamford cattle, Cattle-Yak, and Angus Cattle Anim (Basel) 2019 9 12 1077
Song C, Huang Y, Yang Z, Ma Y, Chaogetu B, Zhuoma Z, Chen H. RNA-seq analysis identifies differentially expressed genes insubcutaneous adipose tissuein Qaidamford cattle, Cattle-Yak, and Angus cattle. Anim (Basel). 2019;9(12):1077.
29. Liang H Xu L Zhao X Pan K Yi Z Bai J Qi X Xin J Li M Ouyang K Song X Liu C Qu M RNA-Seq analysis reveals the potential molecular mechanisms of daidzein on adipogenesis in subcutaneous adipose tissue of finishing Xianan beef cattle J Anim Physiol Anim Nutr (Berl) 2020 104 1 1 11 10.1111/jpn.13218 31850600
Liang H, Xu L, Zhao X, Pan K, Yi Z, Bai J, Qi X, Xin J, Li M, Ouyang K, Song X, Liu C, Qu M. RNA-seq analysis reveals the potential molecular mechanisms of daidzein on adipogenesis in subcutaneous adipose tissue of finishing Xianan beef cattle. J Anim Physiol Anim Nutr (Berl). 2020;104(1):1–11.31850600 10.1111/jpn.13218
30. Ahn B Choi MK Yum J Cho IC Kim JH Park C Analysis of allele-specific expression using RNA-seq of the Korean native pig and Landrace reciprocal cross Asian-Australas J Anim Sci 2019 32 12 1816 25 10.5713/ajas.19.0097 31208168
Ahn B, Choi MK, Yum J, Cho IC, Kim JH, Park C. Analysis of allele-specific expression using RNA-seq of the Korean native pig and Landrace reciprocal cross. Asian-Australas J Anim Sci. 2019;32(12):1816–25.31208168 10.5713/ajas.19.0097
31. Li SY Huang PH Tarng DC Lin TP Yang WC Chang YH Yang AH Lin CC Yang MH Chen JW Schmid-Schönbein GW Chien S Chu PH Lin SJ Four-and-a-Half LIM domains protein 2 is a coactivator of wnt signaling in Diabetic kidney disease J Am Soc Nephrol 2015 26 12 3072 84 10.1681/ASN.2014100989 25855776
Li SY, Huang PH, Tarng DC, Lin TP, Yang WC, Chang YH, Yang AH, Lin CC, Yang MH, Chen JW, Schmid-Schönbein GW, Chien S, Chu PH, Lin SJ. Four-and-a-half LIM domains protein 2 is a coactivator of wnt signaling in diabetic kidney disease. J Am Soc Nephrol. 2015;26(12):3072–84.25855776 10.1681/ASN.2014100989
32. Kong Y Shelton JM Rothermel B Li X Richardson JA Bassel-Duby R Williams RS Cardiac-specific LIM protein FHL2 modifies the hypertrophic response to beta-adrenergic stimulation Circulation 2001 103 22 2731 8 10.1161/01.CIR.103.22.2731 11390345
Kong Y, Shelton JM, Rothermel B, Li X, Richardson JA, Bassel-Duby R, Williams RS. Cardiac-specific LIM protein FHL2 modifies the hypertrophic response to beta-adrenergic stimulation. Circulation. 2001;103(22):2731–8.11390345 10.1161/01.CIR.103.22.2731
33. Rosen ED MacDougald OA Adipocyte differentiation from the inside out Nat Rev Mol Cell Biol 2006 7 12 885 96 10.1038/nrm2066 17139329
Rosen ED, MacDougald OA. Adipocyte differentiation from the inside out. Nat Rev Mol Cell Biol. 2006;7(12):885–96.17139329 10.1038/nrm2066
34. Furuhashi M Tuncman G Görgün CZ Makowski L Atsumi G Vaillancourt E Kono K Babaev VR Fazio S Linton MF Sulsky R Robl JA Parker RA Hotamisligil GS Treatment of diabetes and atherosclerosis by inhibiting fatty-acid-binding protein aP2 Nature 2007 447 7147 959 65 10.1038/nature05844 17554340
Furuhashi M, Tuncman G, Görgün CZ, Makowski L, Atsumi G, Vaillancourt E, Kono K, Babaev VR, Fazio S, Linton MF, Sulsky R, Robl JA, Parker RA, Hotamisligil GS. Treatment of diabetes and atherosclerosis by inhibiting fatty-acid-binding protein aP2. Nature. 2007;447(7147):959–65.17554340 10.1038/nature05844
35. Satoh A Stein L Imai S The role of mammalian sirtuins in the regulation of metabolism, aging, and longevity Handb Exp Pharmacol 2011 206 125 62 10.1007/978-3-642-21631-2_7 21879449
Satoh A, Stein L, Imai S. The role of mammalian sirtuins in the regulation of metabolism, aging, and longevity. Handb Exp Pharmacol. 2011;206:125–62.21879449 10.1007/978-3-642-21631-2_7
36. Jeon TI Osborne TF SREBPs: metabolic integrators in physiology and metabolism Trends Endocrinol Metab 2012 23 2 65 72 10.1016/j.tem.2011.10.004 22154484
Jeon TI, Osborne TF. SREBPs: metabolic integrators in physiology and metabolism. Trends Endocrinol Metab. 2012;23(2):65–72.22154484 10.1016/j.tem.2011.10.004
37. Wang Y Kim KA Kim JH Sul HS Pref-1, a preadipocyte secreted factor that inhibits adipogenesis J Nutr 2006 136 12 2953 6 10.1093/jn/136.12.2953 17116701
Wang Y, Kim KA, Kim JH, Sul HS. Pref-1, a preadipocyte secreted factor that inhibits adipogenesis. J Nutr. 2006;136(12):2953–6.17116701 10.1093/jn/136.12.2953
38. Amann T Egle Y Bosserhoff AK Hellerbrand C FHL2 suppresses growth and differentiation of the colon cancer cell line HT-29 Oncol Rep 2010 23 6 1669 74 20428824
Amann T, Egle Y, Bosserhoff AK, Hellerbrand C. FHL2 suppresses growth and differentiation of the colon cancer cell line HT-29. Oncol Rep. 2010;23(6):1669–74.20428824
39. Kim SY Völkl S Ludwig S Schneider H Wixler V Park J Deficiency of Fhl2 leads to delayed neuronal cell migration and premature astrocyte differentiation J Cell Sci 2019 132 6 jcs228940 10.1242/jcs.228940 30745335
Kim SY, Völkl S, Ludwig S, Schneider H, Wixler V, Park J. Deficiency of Fhl2 leads to delayed neuronal cell migration and premature astrocyte differentiation. J Cell Sci. 2019;132(6):jcs228940.30745335 10.1242/jcs.228940
40. Chen YH Wu ZQ Zhao YL Si YL Guo MZ Han WD FHL2 inhibits the Id3-promoted proliferation and invasive growth of human MCF-7 breast cancer cells Chin Med J (Engl) 2012 125 13 2329 33 22882857
Chen YH, Wu ZQ, Zhao YL, Si YL, Guo MZ, Han WD. FHL2 inhibits the Id3-promoted proliferation and invasive growth of human MCF-7 breast cancer cells. Chin Med J (Engl). 2012;125(13):2329–33.22882857
41. Wu M Wang J Tang W Zhan X Li Y Peng Y Huang X Bai Y Zhao J Li A Chen C Chen Y Peng H Ren Y Li G Liu S Wang J FOXK1 interaction with FHL2 promotes proliferation, invasion and metastasis in colorectal cancer Oncogenesis 2016 5 11 e271 10.1038/oncsis.2016.68 27892920
Wu M, Wang J, Tang W, Zhan X, Li Y, Peng Y, Huang X, Bai Y, Zhao J, Li A, Chen C, Chen Y, Peng H, Ren Y, Li G, Liu S, Wang J. FOXK1 interaction with FHL2 promotes proliferation, invasion and metastasis in colorectal cancer. Oncogenesis. 2016;5(11):e271. Published 2016 Nov 28.27892920 10.1038/oncsis.2016.68
42. Kurakula K, Vos M, Otermin Rubio I, Marinković G, Buettner R, Heukamp LC, Stap J, de Waard V, van Tiel CM, de Vries CJ. The LIM-only protein FHL2 reduces vascular lesion formation involving inhibition of proliferation and migration of smooth muscle cells. PLoS One. 2014;9(4):e94931. Published 2014 Apr 15.
43. Asghar U Witkiewicz AK Turner NC Knudsen ES The history and future of targeting cyclin-dependent kinases in cancer therapy Nat Rev Drug Discov 2015 14 2 130 46 10.1038/nrd4504 25633797
Asghar U, Witkiewicz AK, Turner NC, Knudsen ES. The history and future of targeting cyclin-dependent kinases in cancer therapy. Nat Rev Drug Discov. 2015;14(2):130–46.25633797 10.1038/nrd4504
44. Kubben FJ Peeters-Haesevoets A Engels LG Proliferating cell nuclear antigen (PCNA): a new marker to study human colonic cell proliferation Gut 1994 35 4 530 5 10.1136/gut.35.4.530 7909785
Kubben FJ, Peeters-Haesevoets A, Engels LG, et al. Proliferating cell nuclear antigen (PCNA): a new marker to study human colonic cell proliferation. Gut. 1994;35(4):530–5.7909785 10.1136/gut.35.4.530
45. Zschemisch NH Liedtke C Dierssen U Nevzorova YA Wüstefeld T Borlak J Manns MP Trautwein C Expression of a cyclin E1 isoform in mice is correlated with the quiescent cell cycle status of hepatocytes in vivo Hepatology 2006 44 1 164 73 10.1002/hep.21224 16799991
Zschemisch NH, Liedtke C, Dierssen U, Nevzorova YA, Wüstefeld T, Borlak J, Manns MP, Trautwein C. Expression of a cyclin E1 isoform in mice is correlated with the quiescent cell cycle status of hepatocytes in vivo. Hepatology. 2006;44(1):164–73.16799991 10.1002/hep.21224
46. Qie S Diehl JA Cyclin D1, cancer progression, and opportunities in cancer treatment J Mol Med (Berl) 2016 94 12 1313 26 10.1007/s00109-016-1475-3 27695879
Qie S, Diehl JA. Cyclin D1, cancer progression, and opportunities in cancer treatment. J Mol Med (Berl). 2016;94(12):1313–26.27695879 10.1007/s00109-016-1475-3
47. Ng CF Ng PK Lui VW Li J Chan JY Fung KP Ng YK Lai PB Tsui SK FHL2 exhibits anti-proliferative and anti-apoptotic activities in liver cancer cells Cancer Lett 2011 304 2 97 106 10.1016/j.canlet.2011.02.001 21377781
Ng CF, Ng PK, Lui VW, Li J, Chan JY, Fung KP, Ng YK, Lai PB, Tsui SK. FHL2 exhibits anti-proliferative and anti-apoptotic activities in liver cancer cells. Cancer Lett. 2011;304(2):97–106.21377781 10.1016/j.canlet.2011.02.001
48. Qian Z Mao L Fernald AA Yu H Luo R Jiang Y Anastasi J Valk PJ Delwel R Le Beau MM Enhanced expression of FHL2 leads to abnormal myelopoiesis in vivo Leukemia 2009 23 9 1650 7 10.1038/leu.2009.78 19369964
Qian Z, Mao L, Fernald AA, Yu H, Luo R, Jiang Y, Anastasi J, Valk PJ, Delwel R, Le Beau MM. Enhanced expression of FHL2 leads to abnormal myelopoiesis in vivo. Leukemia. 2009;23(9):1650–7.19369964 10.1038/leu.2009.78
49. Kong L Zhang C LncRNA DLX6-AS1 aggravates the development of ovarian cancer via modulating FHL2 by sponging miR-195-5p Cancer Cell Int 2020 20 370 10.1186/s12935-020-01452-z 32774164
Kong L, Zhang C. LncRNA DLX6-AS1 aggravates the development of ovarian cancer via modulating FHL2 by sponging miR-195-5p. Cancer Cell Int. 2020;20:370. Published 2020 Aug 5.32774164 10.1186/s12935-020-01452-z
50. Danen-Van Oorschot AA van der Eb AJ Noteborn MH BCL-2 stimulates apoptin-induced apoptosis Adv Exp Med Biol 1999 457 245 9 10.1007/978-1-4615-4811-9_26 10500799
Danen-Van Oorschot AA, van der Eb AJ, Noteborn MH. BCL-2 stimulates apoptin-induced apoptosis. Adv Exp Med Biol. 1999;457:245–9.10500799 10.1007/978-1-4615-4811-9_26
51. Zhao G Zhu Y Eno CO Liu Y Deleeuw L Burlison JA Chaires JB Trent JO Li C Activation of the proapoptotic Bcl-2 protein Bax by a small molecule induces tumor cell apoptosis Mol Cell Biol 2014 34 7 1198 207 10.1128/MCB.00996-13 24421393
Zhao G, Zhu Y, Eno CO, Liu Y, Deleeuw L, Burlison JA, Chaires JB, Trent JO, Li C. Activation of the proapoptotic Bcl-2 protein Bax by a small molecule induces tumor cell apoptosis. Mol Cell Biol. 2014;34(7):1198–207.24421393 10.1128/MCB.00996-13
52. He C Wang Y Xu Q Xiong Y Zhu J Lin Y Overexpression of Krueppel like factor 3 promotes subcutaneous adipocytes differentiation in goat Capra hircus Anim Sci J 2021 92 1 e13514 10.1111/asj.13514 33522088
He C, Wang Y, Xu Q, Xiong Y, Zhu J, Lin Y. Overexpression of Krueppel like factor 3 promotes subcutaneous adipocytes differentiation in goat Capra hircus. Anim Sci J. 2021;92(1):e13514.33522088 10.1111/asj.13514
53. Xu Q Lin Y Wang Y Bai W Zhu J Knockdown of KLF9 promotes the differentiation of both intramuscular and subcutaneous preadipocytes in goat Biosci Biotechnol Biochem 2020 84 8 1594 602 10.1080/09168451.2020.1767497 32434447
Xu Q, Lin Y, Wang Y, Bai W, Zhu J. Knockdown of KLF9 promotes the differentiation of both intramuscular and subcutaneous preadipocytes in goat. Biosci Biotechnol Biochem. 2020;84(8):1594–602.32434447 10.1080/09168451.2020.1767497
