
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)12930-1
10.1016/j.heliyon.2024.e36899
e36899
Research Article
SLC8A1, a novel prognostic biomarker and immunotherapy target in RSA and UCEC based on scRNA-seq and pan-cancer analysis
Chu Ji-jun a
Qin Xiu-juan bc
Chen Wenting d
Xu Zhen bc
Xu Xian-jin xianjinxu@163.com
e⁎
a Department of Gynecology, The First Affiliated Hospital of Anhui University of Chinese Medicine, Hefei, 230031, China
b Department of Pharmacy, The First Affiliated Hospital of Anhui University of Chinese Medicine, Hefei, 230031, China
c Anhui Province Key Laboratory of Chinese Medicinal Formula, Hefei, Anhui, 230012, China
d College of Biological and Pharmaceutical Engineering, West Anhui University, Luan, 237012, China
e Hefei Ion Medical Center, The First Affiliated Hospital of USTC, Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei, 230088, China
⁎ Corresponding author. Hefei Ion Medical Center, The First Affiliated Hospital of USTC, Division of Life Sciences and Medicine, University of Science and Technology of China, Intersection of Changning Avenue and Yanzi River Road, Hefei Hi-tech Zone, 230088, China. xianjinxu@163.com
24 8 2024
15 9 2024
24 8 2024
10 17 e3689912 6 2024
7 8 2024
23 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Background

The field of gynaecological immunology has increasingly focused on recurrent spontaneous abortion (RSA). The complex mechanisms underlying the interaction between RSA and cancer are not well understood.

Methods

Weighted gene coexpression network analysis (WGCNA), single-cell RNA sequencing (scRNA-seq), and machine learning algorithms were used for the analysis of RSA decidua samples to identify the hub genes. The expression and distribution of the hub genes were subsequently investigated via the pancancer database TCGA. A prognostic prediction was made to assess the impact of the hub genes on the cancer response, mutation burden, immune microenvironment, immune checkpoint, and chemotherapy. In vitro assays were performed to determine whether SLC8A1 influences HTR-8/SVneo cell proliferation, apoptosis and the concentration of calcium ions.

Results

SLC8A1 was identified as a hub gene within RSA and was highly expressed in uterine corpus endometrial carcinoma (UCEC). The efficacy of SLC8A1 as a predictive marker was substantiated by calibration curves and the concordance index. The mutation rate of SLC8A1 was found to be 6 % on the basis of the waterfall plot. Immune analysis revealed notable differences in the fractions of T cells and macrophages between the high- and low-expression groups. Patients classified in the low-risk group exhibited enhanced responsiveness to osimertinib, dasatinib, and ibrutinib. The results of in vitro experiments revealed that SLC8A1 promotes proliferation and inhibits the apoptosis and concentration of calcium ions in HTR-8/SVneo cells.

Conclusion

These findings suggest that SLC8A1 may serve as a promising prognostic biomarker and potential target for immunotherapy in the context of RSA and UCEC.

Keywords

RSA
UCEC
SLC8A1
TCGA
Immune microenvironment
Prognostic biomarker
==== Body
pmc1 Introduction

Recurrent spontaneous abortion (RSA) refers to the unintentional termination of two or more consecutive pregnancies prior to the 20th week of gestation, thereby posing a significant threat to overall reproductive health [1,2]. The intricate pathogenesis of RSA is influenced primarily by genetic factors, the immune system, the endocrine system, and the presence of a prethrombotic state (PTS). According to its aetiology and pathogenesis, RSA can be divided into nonimmune RSA (chromosomal abnormality type, reproductive tract abnormality type, endocrine abnormality type, and genital tract infection type) and immune RSA (autoimmune type and alloimmune type). Notably, over fifty percent of cases involving repeated miscarriages cannot be attributed to a specific underlying cause, leading to their classification as unexplained recurrent spontaneous abortion (URSA) [3,4].

RSAs remain a significant and complex concern within the field of reproductive health. Despite efforts in genetic research, the identification of specific genes associated with RSA has proven largely inconclusive. Consequently, RSA has garnered considerable attention and has become a focal point of investigation across various medical disciplines in recent years. Notably, several studies have established a noteworthy association between RSA and increased susceptibility to cancer [5,6].

A longitudinal cohort study conducted in Taiwan used 10-year follow-up data to compare women who had abortions with those who did not, specifically investigating the incidence of female cancers such as breast, cervical, uterine, and ovarian cancers [7]. The results of this study revealed a correlation between abortion and a reduced risk of uterine and ovarian cancers. Nevertheless, few studies have explored the molecular mechanisms underlying the association between RSA and cancer, particularly through the utilisation of bioinformatics analysis. The intricate pathogenetic mechanisms through which RSA and cancer interact remain largely unknown. The condition is distinguished by its occult onset, challenging early detection, and unfavourable prognosis in the context of cancer in RSA, resulting in high morbidity and mortality rates. Consequently, timely identification, diagnosis, and treatment of RSA and cancer patients are imperative for their optimal well-being. Identifying novel biomarkers that can accurately predict the prognosis of RSA and cancer patients, as well as elucidating the molecular mechanisms underlying their progression, is essential.

The advancement of next-generation high-throughput RNA sequencing technologies has significantly propelled genomic studies in recent years. Bulk RNA sequencing (RNA-seq) in the field of RSA research facilitates the acquisition of transcriptome data, thereby enabling further advancements in the study of RSA [8,9]. Additionally, the analysis of single cells through scRNA-seq has emerged as a feasible substitute for bulk RNA analysis. The introduction of scRNA-seq has made it feasible to unravel cellular heterogeneity, decipher cell states, and identify subpopulation structures across diverse cell types [[10], [11], [12]]. Zhu et al. conducted a comprehensive analysis of decidual tissue data obtained from individuals who underwent induced abortions and those with RSA. This analysis involved the use of bulk RNA-seq, reduced representation bisulfite sequencing (RRBS), and scRNA-seq [13]. The findings of this study revealed that a thorough understanding of the cellular and molecular mechanisms underlying RSA can be achieved, with a particular focus on the potential impact of IGF2BP1 promoter methylation on pregnancy loss. Furthermore, investigation of the hub genes associated with RSA in a pancancer context is necessary to evaluate their prognostic value for patients and to identify potential therapeutic targets. Several studies have explored potential biomarkers of RSA by integrating bulk RNA-seq analysis with single-cell RNA-seq analysis, aiming to improve the accurate stratification and prediction of RSA outcomes [14]. However, comprehensive analyses of RSA-related biomarkers across various cancer types are lacking.

Therefore, our study represents the first attempt to simultaneously compile RSA data from the scRNA-seq and bulk RNA-seq databases, employing machine learning algorithms to identify candidate hub gene biomarkers. Additionally, we investigated the functional role of these hub genes across cancers. A comprehensive examination of the clinical prognosis of cancer, the tumour microenvironment, immune checkpoints, gene mutations, and drug sensitivity prediction, among other factors, was conducted. The outcomes of this study potentially offer the opportunity to ascertain a prognostic predictor and novel therapeutic targets for patients with RSA.

2 Materials and methods

2.1 Sources and processing of data

The scRNA-seq datasets GSE164449 and GSE214607 and the transcriptome dataset GSE65099 of RSA were downloaded from the GEO (https://www.ncbi.nlm.nih.gov/) database. GSE164449 includes 3 normal patients and 3 RSA patients; GSE214607 includes 10 normal patients and 6 RSA patients; and GSE65099 includes 10 normal patients and 10 RSA patients. The TCGA data portal site (http://tcga-data.nci.nih.gov/tcga/) was used to obtain data on clinical information and SNP mutation sites.

R version 4.2.2 was used to perform differential expression gene (DEG) analysis of GSE65099 via the Limma package. For differential gene selection, P value < 0.05 and |log2FC(log2FoldChange)| >1 were applied. In addition, module analysis was carried out via the R package weighted gene coexpression network analysis (WGCNA) [15]. First, the function 'goodSamplesGenes' in the 'WGCNA' package was used to determine which input samples and genes were eligible for constructing coexpression networks. Additionally, coexpression modules were generated via dynamic tree cutting criteria by limiting the number of genes in a module to 100. The associations of module signature genes (MEs) with RSA were analyzed via Pearson correlation analysis.

A Seurat object was created by converting scRNA-seq data (GSE164449, GSE214607) via the R software “Seurat package”. After postmapping quality control, we filtered cells with fewer than 2500 or more than 200 genes expressed and those expressing fewer than 5 % mitochondrial genes, as well as genes expressed in at least three cells. After normalisation with NormalizeData, on the basis of the scaled data with 2,000 highly variable genes, the top 20 principal components were extracted via principal component analysis (PCA). The cell populations in the 2D maps were visualized in an unbiased manner via uniform manifold approximation and projection (UMAP). Gene expression levels were compared between clusters via the "FindAllMarkers" function. Finally, for each cluster, we used a P value < 0.05 and |log2FC| > 1 [16,17]. Afterwards, marker genes were used to identify cell subpopulations via the "SingleR" package and manual annotation. The common hub genes were defined on the basis of the overlap among DEGs, WGCNA and scRNA-seq hub genes.

2.2 Machine learning analysis of the hub genes

For the purpose of screening disease characteristic genes, we used four machine learning methods, XGBoost, RF, LASSO, and SVM. With the R software survival ROC package, the prognosis was verified by generating a ROC curve based on the GSE65099 dataset.

2.3 Coexpression analysis

The GeneCards database (http://www.genecards.org) was used to search for apoptosis-related and cell proliferation-related genes. The top 50 apoptosis- and cell proliferation-related genes were then sorted from top to bottom on the basis of their relevance score. Coexpression analysis was performed to determine the correlation between SLC8A1 and apoptosis and cell proliferation genes.

2.4 Pancancer analysis

TCGA (http://cancergenome.nih.gov/) contains gene expression information and clinical details on 33 types of cancer [18]. To identify the differentially expressed hub gene (SLC8A1) in each cancer type, we used the pancancer Deseq2 package in R to analyse the expression characteristics of the hub gene (SLC8A1). A receiver operating characteristic (ROC) curve was used to determine diagnostic efficacy.

2.5 Construction of prognostic signatures

In the UCEC TCGA Research Network, RNA-seq data and clinical information for 514 UCEC patients were downloaded. A LASSO regression model was used to construct the clinical prognosis model and compute the clinical prognostic risk score (CP risk score) [19]. To determine whether UCEC patient risk scores and clinical values could be used as independent prognostic factors, we conducted univariate and multivariate Cox regression analyses [20]. A survival curve was derived via the R packages 'survminer' and 'survival' according to high- and low-risk values.

2.6 Mutation analysis

Data on somatic mutations from patients with UCEC were downloaded from the TCGA database. The mutation frequency and exon length were calculated for each tumour sample, and the TMB determination was based on a division of the nonsynonymous mutation sites by the total size of the protein-coding region [21]. Using the R package maftools, we plotted the mutation landscapes of the 6 genes that presented the highest mutation frequencies.

2.7 Immune microenvironment analysis

Immune, stromal, and ESTIMATE scores were calculated for UCEC patients via expression data (ESTIMATE) algorithms to estimate stromal and immune cells [22]. The enrichment levels of 22 immune cell types were calculated via the Estimating Relative Subsets of RNA Transcripts (CIBERSORT) algorithm [23]. The immune activity of each sample was determined accurately via single-sample GSEA (ssGSEA) [24].

2.8 Correlation analysis between SLC8A1 and immune checkpoints

A Wilcoxon test was used to examine the correlation between immune clusters and immune checkpoints (ICPs) and SLC8A1. With the ggplot2 R package, immunological correlation scores and immune checkpoint analyses were plotted [25].

2.9 Drug sensitivity analysis

On the basis of the Genomics of Drug Sensitivity in Cancer (GDSC) database (https://www.cancerrxgene.org), drug sensitivity was evaluated, which predicts the chemotherapeutic response of UCEC patients [26]. Chemotherapeutic agents are calculated via the oncoPredict package.

2.10 Experimental verification in vitro

2.10.1 Cell culture

HTR-8/SVneo human extravillous trophoblast cells were purchased from iCell (Cat No. iCell-h390). The cells were cultured in DMEM at 37 °C in a humidified atmosphere containing 5 % CO2 in DMEM.

2.10.2 Small interfering RNA (siRNA) transfection

siRNAs were designed by Yuanen Biological Technology Co., Ltd. (Hefei) and synthesised by GENERAL BIOL Company Co., Ltd., Anhui, China. HTR-8/SVneo cells were seeded in a 6-well plate, centrifuged at 1000 rpm for 1 min, and then the siRNA was dissolved in 125 μL of DEPC-treated water. The siRNA and NC (5 μL) were dissolved in 250 μL of DMEM without serum, and the GP-transfect-Mate (10 μL) was dissolved in 1000 μL of DMEM without serum, mixed well, and incubated at room temperature for 15 min. The GP-transfect-Mate mixture was divided, added to the siRNA and NC, mixed well, and incubated at room temperature for 20 min. Five hundred microlitres of media were added to each well of a 6-well plate, which was shaken gently, and the cells were placed in the incubator for 4 h. The cells were harvested after 48 h. The efficiency of SLC8A1 knockdown was measured via real-time quantitative PCR (qRT‒PCR), and cell lines with high knockdown efficiency were subsequently used. The sequences of primers used for qRT‒PCR are listed in Table 1.Table 1 Primer sequence.

Table 1Gene	Amplicon Size
(bp)	Forward primer
(5'→3')	Reverse primer
(5'→3')	
β-actin	96	CCCTGGAGAAGAGCTACGAG	GGAAGGAAGGCTGGAAGAGT	
SLC8A1	83	CTGCTTTGTGCTTCCCACAG	GAAAATACGGCGCACTCCCT	
SLC8A1-Homo(NC)		UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT	
SLC8A1-Homo-969(Si1)		GGACCAAGAUGAUGAAGAATT	UUCUUCAUCAUCUUGGUCCTT	
SLC8A1-Homo-1026(Si2)		GCAGAAGCAUCCAGAUAAATT	UUUAUCUGGAUGCUUCUGCTT	
SLC8A1-Homo-1429(Si3)		GGUGAUACCCAGAGGGAAATT	UUUCCUUCUGGGUAUCACCTT	
Note: We used β-actin as an internal control.

2.10.3 Cell cCounting Kit-8 (CCK-8) assays

A CCK-8 (Biosharp, Cat No. BL1055B, 23146974) was used for the cell proliferation assay. Cell transfections were performed for 48 h, after which the cells were incubated at 37 °C for 1 h after 10 μL of CCK-8 solution was added. For each well, the absorbance at 450 nm was measured.

2.10.4 Plate cloning experiment

Cells were seeded in a 6-well plate. A humidified chamber (37 °C, 5 % CO2) was used to maintain the cultures, which were allowed to grow to form colonies for 10–14 days. Afterwards, the cells were fixed at room temperature for 30 min in 4 % paraformaldehyde. The cells were stained for 20 min with 0.5 % crystal violet. The cells were counted after the chamber was gently washed twice with PBS. Three visual fields were randomly selected for cell counting under the microscope, and the results were tallied.

2.10.5 Flow cytometry

Flow cytometry was used to detect cell apoptosis. Adherent cells were digested with trypsin without EDTA. The cells were harvested and centrifuged at 1,500 rpm for 3 min at room temperature, after which the supernatant was discarded. The cells were washed with precooled PBS two times and centrifuged at 1500 rpm for 3 min. The reconstituted cells were suspended in 100 μL of 1*binding buffer, 5 μL of FITC was added, and the mixture was incubated in the dark for 15 min. Then, 5 μL of PI was added, the mixture was mixed well, and the mixture was incubated for 5 min at room temperature in the dark. Data analysis was performed with NovoExpress software.

2.10.6 Live/dead staining

We used a Calcein/PI Live/Dead Viability/Cytotoxicity Assay Kit (Beyotime Biotechnology, Cat. No. C2015S, 091622230407) to perform the live/dead staining assay. Living cells fluoresced green under the microscope, whereas dead cells fluoresced red.

2.10.7 Calcium concentration analysis

The intracellular calcium concentration in HTR-8/SVneo cells was measured via flow cytometry. This calcium assay was conducted via a Fluo-4 Direct Calcium Assay Kit (Beyotime Biotechnology, Cat No. S1061, 040423230428). NovoExpress software was used to analyse the data.

2.10.8 Western bblot (WB) analysis

We determined the expression levels of proliferation and apoptosis proteins, including Caspase-3, PCNA, Bax, and Bcl-2, via Western blotting. Total protein extraction was performed after siRNA transfection of HTR-8/SVneo cells. Protein loading buffer for SDS‒PAGE was then used to separate the proteins (80 V for 3 h). Each membrane was blocked with 5 % BSA in TBS for 120 min at room temperature. The primary antibodies used were anti-β-actin (1:1000), anti-PCNA (1:500), anti-Bcl-2 (1:1000), anti-Bax (1:500), and anti-Caspase-3 (1:500) antibodies. The samples were incubated with primary antibodies overnight at 4 °C, followed by incubation with secondary antibodies (1:10000) at room temperature for 2.5 h. Finally, the membranes were washed twice in TBST (10 min each) and detected by electrochemiluminescence (ECL). A flow chart of the experimental design is shown in Fig. 1.Fig. 1 A flow chart of the experimental design.

Fig. 1

2.11 Statistical analysis

For all the statistical analyses, R software (version 4.2.2) was used. Significance was determined by P < 0.05 for all analyses. Statistical analysis was conducted with SPSS version 21.0. The data are expressed as the (‾χ ± s) deviation. Comparisons between unpaired sample groups were performed via two independent sample t tests, whereas several one-way single-factor ANOVAs were applied to compare multiple groups.

3 Results

3.1 Identification of DEGs in GSE65099

The criteria for screening the hub DEGs included a |log2FC > 1| and a P value < 0.05. A total of 395 DEGs were identified, with 256 upregulated and 139 downregulated. The volcano plots in Fig. 2A visually represent these DEGs.Fig. 2 Identification of DEGs in GSE65099 by R and WGCNA analysis. A The volcano plots visually represent DEGs. B An analysis of the fit of the scale-free topology model compared to the candidate soft threshold powers. Soft threshold power = 11 and scale-free topological fit index (R2) = 0.85. C The original and combined modules under the clustering tree. Hierarchical clustering groups genes into different modules, represented by different colors. D Heat map of module-trait correlations. Red represents positive correlations and green represent negative correlations. E Module Membership vs Gene Significance scatter plot of blue module. F Module Membership vs Gene Significance scatter plot of lightgreen module. G Module Membership vs Gene Significance scatter plot of yellow module.

Fig. 2

3.2 WGCNA identification of RSA-related key modules in GSE65099

To construct the WGCNA network, a soft-thresholding power of 11 was employed, resulting in an achieved R2 value of 0.85. The adjacency matrix and topological overlap matrix were then calculated, as shown in Fig. 2B. The module network dendrogram was generated on the basis of clustering module eigengene distances, followed by the correlation heatmaps depicted in Fig. 2C and D. Fig. 2C illustrates the presence of 20 distinct gene expression patterns, referred to as coexpression networks. Among these networks, three modules, namely, the blue module, light green module, and yellow module, exhibited significant correlations with phenotypic traits. A total of 1650 genes were identified, and their correlations with gene significance (GS) and module membership (MM) were examined for the blue, light green, and yellow modules in Fig. 2E, F, and G, respectively.

3.3 Identification of RSA cell subtypes in GSE164449 and GSE214607

The data from GSE164449 were normalised via the LogNormalize method, and high-variability genes in the decidua are identified in Fig. 3A and B. Through the utilisation of PCA and UMAP techniques, an impartial examination of cell composition clustering was conducted, resulting in the identification of 14 distinct clusters. The first eight principal components of the PCA are visually represented in Fig. 3C. Additionally, Fig. 3D presents a heatmap showing the relative expression of marker genes within each cluster. By cross-referencing markers associated with cell types through SingleR annotation and manual annotation, six cell types were accurately annotated: monocytes, NK cells, T cells, dendritic cells, B cells, and tissue stem cells, as depicted in Fig. 3E and F. The bubble plots in Fig. 3G display the percentage expression of marker genes categorised by major cell types. Through analysis, we identified 1922 marker genes that exhibited differential expression, as determined by a |log2FC| > 1 and a P value < 0.05.Fig. 3 Identification of RSA cell subtypes in GSE164449 by scRNA-seq analysis. A Quality control of scRNA-seq data from RSA samples. B The variance plot showed 17256 genes in all cells, red dots represent the top 2000 highly variable genes. C The first eight principal components of the PCA analysis. D The heat map showed the relative expression of genes in 14 clusters. Yellow represents high expressed genes and purple represents low expressed genes. E 14 clusters were visualized based on the UMAP algorithm. F Cell subsets identified by marker genes. G The bubble plots displayed the percentage expression of marker genes, categorised by major cell types. X-axis, mean expression level of marker genes; Y-axis, each cell type.

Fig. 3

The data from GSE214607 were normalised via the LogNormalize method, and the identification of high-variability genes in decidua is depicted in Fig. 4A, B and C. By using PCA and UMAP, an unbiased clustering approach was employed to explore the composition of cells, resulting in the identification of 25 distinct clusters. An analysis was conducted via the first eight principal components of PCA to examine the relative expression of marker genes in each cluster (Fig. 4D). By comparing markers associated with cell types expressed through SingleR annotation and manual annotation, 13 cell names were identified: epithelial cells, NK cells, tissue stem cells, B cells, fibroblasts, macrophages, T cells, monocytes, neutrophils, iPS cells, DCs, endothelial cells, and erythroblasts (Fig. 4E and F). Furthermore, 3791 marker genes were identified as having differential expression on the basis of a |log2FC| > 1 and a P value < 0.05.Fig. 4 Identification of RSA cell subtypes in GSE214607 by scRNA-seq analysis. A Quality control of scRNA-seq data from RSA samples. B Relationship between the Count_RNA and mitochondrial ratio, pearson correlation coefficient = −0.15; relationship between the Count_RNA and Feature, pearson correlation coefficient = 0.89. C The variance plot showed 25069 genes in all cells, red dots represent the top 2000 highly variable genes. D The first eight principal components of the PCA analysis. E 25 clusters were visualized based on the UMAP algorithm. F Cell subsets identified by marker genes.

Fig. 4

The DEGs obtained from the datasets GSE164449 and GSE214607 were combined, resulting in the identification of 4108 DEGs.

3.4 Acquisition of candidate genes

From the combined differential expression genes of GSE65099, WGCNA of GSE65099, scRNA-seq of GSE164449, and GSE214607, 103 candidate genes were obtained. A Venn diagram illustrating the overlap of these genes is presented in Fig. 5A.Fig. 5 Machine learning screening for hub gene. A The Venn diagram of scRNA-seq, WGCNA and DEGs. B, C LASSO analysis. D random forest (RF) analysis. E SVM analysis. F XGBoost analysis.

Fig. 5

3.5 Machine learning screening for hub genes

Through LASSO analysis, 7 DEGs were selected (Fig. 5B and C), whereas random forest (RF) analysis identified 10 DEGs (Fig. 5D). Additionally, SVM analysis identified 97 DEGs (Fig. 5E), and XGBoost analysis identified 14 DEGs (Fig. 5F). By identifying the overlapping DEGs identified by the four machine learning analyses, a central gene, SLC8A1, emerged as a hub gene. A visual representation of this overlap can be observed in Fig. 6A. To assess the diagnostic accuracy of the model, ROC curve analysis was conducted on the GSE65099 data, which resulted in highly accurate predictions. Notably, SLC8A1 demonstrated its significance as a prognostic gene for RSA, as indicated by its impressive AUC value of 0.930, as depicted in Fig. 6B.Fig. 6 Pancancer analysis of SLC8A1. A The Venn diagram of four machine learning analysis. B ROC curve analysis. C The expression levels of SLC8A1 in different cancer types from the TCGA database (*P < 0.05, ***P < 0.001). D ROC curve for UCEC patients to assess the predictive efficacy of SLC8A1.

Fig. 6

3.6 SLC8A1-apoptosis and cell proliferation-related gene coexpression analysis

According to GeneCards, 21868 target genes are associated with apoptosis, and 21330 target genes are associated with cell proliferation. The top 50 apoptosis- and cell proliferation-related genes were then sorted from top to bottom on the basis of their relevance score. SLC8A1 and the top 50 apoptosis- and cell proliferation-related genes were used for coexpression analysis. The results revealed a significant association between SLC8A1 and 28 apoptosis-related genes and 24 cell proliferation-related genes. The partial results are shown in Fig. 7, Fig. 8.Fig. 7 Coexpression analysis of SLC8A1-cell proliferation-related genes. These include VEGFA, BCL2, TNF, STAT3, PIK3CA, MET, JAK3, H19, MYC, TP53, AKT1, PCNA.

Fig. 7

Fig. 8 Coexpression analysis of SLC8A1-apoptosis-related genes. These include BCL2, TNFRSF1A, TNF, STAT3, MAPK14, MAP3K5, FAS, CASP7, CASP3, CASP1, BCL2L11, TP53.

Fig. 8

3.7 Pancancer analysis of SLC8A1

Through an analysis of the TCGA database, we conducted calculations on the expression levels of SLC8A1 in various cancer types. The visualisation outcome, as depicted in Fig. 6C, revealed remarkable findings. Notably, lower expression of SLC8A1 was observed in UCEC tumour tissues, suggesting that SLC8A1 could offer valuable insights into the clinical prognosis of UCEC patients. To validate this hypothesis, we generated an ROC curve for UCEC patients to assess the predictive efficacy of SLC8A1, which yielded an AUC value of 0.871 (Fig. 6D).

3.8 Assessment of the prognostic value of SLC8A1 in UCEC

The UCEC samples were stratified into high-risk and low-risk groups on the basis of the median risk score. A novel risk score model was constructed via univariate Cox, LASSO, and multivariate Cox regression analyses. As depicted in Fig. 9A and B, the risk score and stage were identified as independent prognostic factors. Fig. 9C presents the survival curves for the high-risk and low-risk groups according to their respective risk scores, revealing that patients classified as high risk experienced poorer outcomes than those classified as low risk. Furthermore, in addition to assessing this risk signature, we evaluated the predictive capacity of the model for determining the survival status of UCEC patients at 1, 3, and 5 years via receiver operating characteristic (ROC) curves. As depicted in Fig. 9D, the AUC surpassed 0.85, indicating the robust predictive ability of the risk model.Fig. 9 An assessment of the prognosis of SLC8A1 in UCEC. A Univariate Cox analysis. B Multivariate Cox analysis. C The overall survival (OS) probability of the patients in high-risk and low-risk groups. D The AUC at 1 years, 3 years, and 5 years of prognostic models in the UCEC patients. E Patient distribution of clinical characteristics, including grade, age, weight, height, stage of the high-risk and low-risk groups (***P < 0.001). F Multi-indicator ROC curves of the nomogram (grade, stage, and risk score).

Fig. 9

Additionally, we performed an additional analysis to ascertain the associations between risk scores and clinical characteristics (grade, age, weight, height, and stage) within distinct subgroups categorised by clinical characteristics. The findings revealed significant correlations between risk score and grade, age, and stage. Fig. 9E presents the expression heatmap, which was constructed using clinical factors and risk scores. Multiple indicator ROC curves can be generated for grade, stage, and risk score, as depicted in Fig. 9F. The AUC values surpassing 0.6 indicate a high level of accuracy in predicting overall survival (OS) when these indicators are used. The ranked risk scores and patient survival curves are illustrated in Fig. 10A and B, respectively, and revealed an increasing trend in the mortality rate with increasing risk score. All the significant independent factors were incorporated into the prognostic nomogram, as shown in Fig. 10C. A calibration curve was subsequently generated to assess the predictive ability of SLC8A1 via a nomogram, and the concordance index (C-index) was computed. The calibration curve confirmed the strong predictive value of SLC8A1, as indicated by previous findings (Fig. 10D and E).Fig. 10 An evaluation and construction of the nomogram of patients with UCEC in the TCGA cohort. A Distribution of risk score in UCEC cohort. B Scatter plot of the OS of each patient in the UCEC cohort. C The construction of the nomogram using risk scores and clinical features. D The calibration curves of the nomogram for the 1-year, 3-year, and 5-year OS. E The concordance index (C-index) analysis to verify the nomogram performance.

Fig. 10

3.9 SLC8A1 mutation analysis

Missense single nucleotide polymorphisms (SNPs), particularly C > T mutations, account for the majority of overall mutation events. The comprehensive mutation profile of UCEC is depicted in Fig. 11A and B. The waterfall plot illustrates the somatic mutation rate of 6 NRmRNAs, with SLC8A1 exhibiting a mutation level of 6 % (Fig. 11C).Fig. 11 Somatic mutations analysis. A The overall mutation profile of UCEC. B Base substitution mutations analysis. C The waterfall plots of the 6 mutated genes (SLC8A1, SLC7A2, CTSW, TREM2, TNFSF10, DYNLT3) in the 515 samples.

Fig. 11

3.10 UCEC immune microenvironment estimation of SLC8A1

The ESTIMATE algorithm was employed to estimate the immune score, stromal score, and ESTIMATE score for each patient. The findings revealed that, compared with the low-risk group, the high-risk group presented significantly elevated stromal, immune, and estimated factor scores (P < 0.05) (Fig. 12A).Fig. 12 Tumor immune microenvironment analysis. A Differences expression levels of stromal, immune, and ESTIMATE scores between low-risk and high-risk groups (***P < 0.001). B The stacked bar chart shows the immune infiltration in each UCEC sample. C Difference expression levels of 22 types of tumor-infiltrating immune cells between low-risk and high-risk groups. D Lollipop plot for the correlation between SLC8A1 and immune cells. E Heat map display a correlation between SLC8A1 expression and immune checkpoints. F A scatter plot analysis for the relationship between CD40 and SLC8A1.

Fig. 12

To assess the extent of immune infiltration, ssGSEA was used, and the immune infiltration in each UCEC sample is depicted in Fig. 12B. Furthermore, in addition to gene expression data, CIBERSORT was used to analyse the levels of immune cell infiltration. To examine the correlation between the SLC8A1 signature score and immune infiltration level, CIBERSORT online tools were used to calculate the infiltration level of 22 immune cell types on the basis of the expression data of SLC8A1. The samples were divided into two groups, namely, high and low, on the basis of the median level of SLC8A1 expression. Notably, the fractions of CD8 T cells, resting memory CD4 T cells, regulatory T cells, M0 macrophages, M01 macrophages, and M2 macrophages varied between the high and low groups. Box plots, as depicted in Fig. 12C, were employed to illustrate these differences. Furthermore, the correlation between SLC8A1 and immune cells is shown in Fig. 12D.

3.11 Immune checkpoints and SLC8A1: a correlation analysis

Additional investigations were conducted to examine the associations between SLC8A1 and immune checkpoint-related genes. A comprehensive correlation analysis revealed significant correlations between the SLC8A1 gene and 29 immune checkpoint-related genes, particularly with CD40-positive immune checkpoint genes. This correlation is visually depicted in Fig. 12E. Furthermore, a scatter plot analysis was carried out, specifically focusing on the relationship between CD40 and SLC8A1, as demonstrated in Fig. 12F.

3.12 Indications for sensitivity to chemotherapy drugs

Furthermore, a comparison was conducted between the sensitivity of 198 anticancer drugs and SLC8A1 in the low-risk and high-risk groups, aiming to offer potential treatment recommendations for UCEC patients. Notably, patients in the low-risk group exhibited heightened sensitivity to osimertinib, dasatinib, sepantronium bromide, ibrutinib, JQ1, MN-64, BMS-754807, LY2109761, Navitoclax, PD173074, PFI3, SB216763, UMI-77, WEHI-539, WIKI4, and AZD1208. These findings suggest that SLC8A1 could be employed for screening or developing anticancer medications (Fig. 13).Fig. 13 Drug sensitivity assessment. A lbrutinib. B MN-64. C Dasatinib. D Osimertinib. E WIKI4. F WEHI-539. G SB216763. H UMI-77. I PFI3. J PD173074. K Sepantronium bromid. L LY2109761. M Navitoclax. N AZD1208. O BMS-754807. P JQ1.

Fig. 13

3.13 In vitro model validation

3.13.1 qRT‒PCR analysis of si-SLC8A1

As a result of the increased expression of SLC8A1 in the RSA model group, siRNAs targeting SLC8A1, specifically si-SLC8A1, were developed. The efficacy of si-SLC8A1 in HTR-8/SVneo cells was assessed via qRT‒PCR, which revealed that all three sequences of si-SLC8A1 significantly reduced SLC8A1 mRNA levels (Fig. 14A). Among these sequences, si-SLC8A1-969 (siRNA-SLC8A1-1) demonstrated the most pronounced effect and was therefore chosen for subsequent experiments.Fig. 14 Cell proliferation and apoptosis were investigated by in vitro studies using si-SLC8A1. A qRT-PCR analysis for si-SLC8A1. B Proliferation by CCK8 analysis. C cell cloning analysis (40X). D-G Cell apoptosis by flow cytometric analysis. siRNA-NC vs control; siRNA-SLC8A1 vs siRNA-NC (**P < 0.01).

Fig. 14

3.13.2 Proliferation by CCK8 and cell cloning analysis

Cell proliferation was assessed through CCK-8 experiments and cell cloning techniques. The results of the CCK-8 assay revealed a significant decrease in optical density in the si-SLC8A1 group compared with the control group (P < 0.01) (Fig. 14B). Additionally, the plate cloning assay revealed a significant reduction in HTR-8/SVneo cell colonies in the si-SLC8A1 group compared with those in the control group (Fig. 14C). This study revealed a correlation between cell proliferation and SLC8A1 expression, with upregulation of SLC8A1 leading to increased proliferation and downregulation leading to decreased proliferation. Our hypothesis is that SLC8A1 may play a role in promoting proliferation in the context of RSA.

3.13.3 Cell apoptosis assessment by flow cytometry and live/dead stain analysis

Apoptosis in HTR-8/SVneo cells transfected with si-SLC8A1 was assessed via flow cytometry and live/dead staining. Flow cytometry analysis revealed a significant increase in the rate of apoptosis compared with that in the control group (P < 0.01) (Fig. 14D–G). Confocal fluorescence microscopy was employed to visualise live/dead cell staining, with live cells exhibiting green fluorescence when stained with calcein and dead cells displaying red fluorescence when stained with propidium iodide (PI). The live/dead staining analysis indicated a notable increase in the number of dead cells following si-SLC8A1 treatment compared with that in the control group (Fig. 15A). Both flow cytometric and live/dead staining findings consistently demonstrated a downregulation of SLC8A1 expression, leading to increased apoptotic capacity in cells. SLC8A1 may play a role in inhibiting apoptosis in the context of RSA.Fig. 15 Cell proliferation, apoptosis and calcium concentration levels were investigated by in vitro studies using si-SLC8A1. A live/dead stain analysis (200X). B-E Calcium concentration levels by flow cytometry analysis. F The expression of apoptosis-related and proliferation-related proteins (Caspase-3, PCNA, Bax, Bcl-2) by WB analysis. siRNA-NC vs control; siRNA-SLC8A1 vs siRNA-NC (**P < 0.01).

Fig. 15

3.13.4 Calcium concentration levels by flow cytometry analysis

Flow cytometry analysis was conducted to measure the calcium concentration in HTR‐8/SVneo cells following transfection with si-SLC8A1. The results revealed a significant increase in the calcium concentration compared with that in the control group (P < 0.01) (Fig. 15B–E). SLC8A1 may play a role in regulating calcium levels in RSA.

3.13.5 WB analysis of the expression of apoptosis-related and proliferation-related proteins (caspase-3, PCNA, Bax, and Bcl-2)

The findings indicated that SLC8A1 was downregulated following transfection with siRNA, leading to a significant decrease in the expression of PCNA and Bcl-2 in the SLC8A1 siRNA group compared with the control group (P < 0.01). Conversely, the expression of caspase-3 and Bax was significantly elevated in the si-SLC8A1 group compared with the control group (P < 0.01) (Fig. 15F).

4 Discussion

During pregnancy, RSA is a prevalent complication that piques the interest of expectant couples and their healthcare providers [27]. The primary mechanism underlying RSA remains poorly understood. The literature suggests that repeated miscarriages, pregnancy terminations, diagnostic curettage procedures, and intrauterine infections may result in irreversible harm to the endometrium [28]. Such endometrial damage, along with its thinning, is a significant contributing factor to the development of endometrial carcinoma [29]. Additionally, fluctuations in hormone levels following miscarriages can potentially facilitate the onset of breast cancer [30,31]. The establishment of novel prognostic markers and therapeutic targets for RSA and associated cancer progression is highly important. This study aimed to investigate the characteristics and hub genes of RSA, analyse the underlying relationships between these hub genes and cancers, and predict the response of cancer patients to the immune landscape, immune checkpoints, and targeted therapy.

Initially, a comprehensive approach involving the integration of multiple datasets, differential expression analysis, WGCNA, and single-cell analysis was employed to identify key genes that may have substantial implications in the progression of RSA. Through the application of machine learning techniques such as LASSO, RF, SVM, and XGBoost analysis, our study identified SLC8A1 as a hub gene associated with RSA. The understanding of the relationship between the SLC8A1 gene and cancer prognosis remains limited. However, recent research has acknowledged the increasing importance of genes in the development of cancer. Wang et al. proposed that NCAPG2 could function as a regulatory element and a biomarker for various malignancies [32]. Li et al. demonstrated that EIF4G1 may have the ability to modify the tumour microenvironment and inhibit the metastasis of breast cancer (BRCA), thus potentially serving as a prognostic biomarker and therapeutic target for BRCA [33]. Similarly, Zhao et al. revealed that CYFIP2 could be considered a potential therapeutic target for rheumatoid arthritis (RA) and various types of tumours, offering a new perspective on the treatment of immune-related RA diseases and cancer [34]. Consequently, to further explore the association between SLC8A1 expression and tumours, we conducted a comprehensive analysis across multiple cancer types via the TCGA database. The findings of our study indicate significant expression of SLC8A1 in patients diagnosed with UCEC, which was further validated through the use of ROC curve analysis.

We subsequently conducted an extensive analysis encompassing prognostic evaluation, mutational assessment, tumour microenvironment examination, immune checkpoint investigation, and drug sensitivity prediction of SLC8A1 in UCEC. The purpose of this comprehensive analysis was to ascertain the prognostic relevance of SLC8A1. Our study revealed a correlation between SLC8A1 expression and both clinical outcome and immune cell infiltration in UCEC, suggesting the potential involvement of this biomarker in immunoregulation and prognosis. The endometrium, which possesses glands identical to those of a typical endometrium, serves as the origin of UCEC, an epithelial malignancy. UCEC is the primary contributor to cancer among women globally, with increasing incidence and mortality rates [[35], [36], [37]]. Consequently, reliable biomarkers to address endometrial damage resulting from RSA, predict the progression of RSA to UCEC, and facilitate targeted immunotherapeutic interventions for UCEC are urgently needed.

The calcium extrusion regulatory molecule SLC8A1 encodes a member protein of the NCX1 antiporter that is activated by protein phosphatase 2A. This protein facilitates the transport of calcium out of cells and sodium into cells, thereby regulating calcium homeostasis [38,39]. Numerous studies have reported an association between SLC8A1 and various diseases. For example, deletion of the SLC8A1 gene or the presence of null mutations has been found to result in arrhythmia [40]. Furthermore, SLC8A1 plays a significant role in the pathogenesis of hypertension [41]. Additionally, SLC8A1 has been implicated in the development of diabetes and certain cancers, where it has the opposite function. Long et al. reported that the administration of KB-R7943, a reverse-mode SLC8A1 inhibitor, resulted in a notable increase in cell apoptosis in nude mice with PC3 tumours [42].

Multiple studies have demonstrated the abnormal expression of calcium regulatory molecules in patients with endometriosis, adenomyosis, and UCEC [[43], [44], [45]]. These calcium extrusion regulatory molecules in the endometrium include plasma membrane Ca2+ ATPases (PMCAs) and sodium-calcium exchanger SLC8As, which are secreted into the uterine lumen. In a study conducted by Choi et al. the expression of SLC8A1 in the uterine endometrium of pregnant pigs suggested a potential association between calcium extrusion molecules and pregnancy [46]. In our study, we found that SLC8A1 expression is significantly greater in patients with RSA than in those with a normal endometrium. These findings lead us to speculate that dysregulation of Ca2+ homeostasis may contribute to the occurrence and progression of RSA and UCEC. Notably, SLC8A1 is implicated in sodium‒calcium exchange and alterations in the biological behaviour induced by Ca2+ under these conditions. The results were verified in vitro through experiments. Our experimental results indicated that SLC8A1 may play a role in regulating calcium levels in RSA. Furthermore, the results also indicated that SLC8A1 may play a role in inhibiting apoptosis and promoting proliferation in the context of RSA.

Additionally, our study conducted a comprehensive investigation into the association between SLC8A1 and prognosis through the use of Cox regression, survival curve analysis, and prognostic nomogram analysis. The results of our analysis revealed that SLC8A1 exhibited significant prognostic value. Furthermore, a comparative survival analysis demonstrated that the risk score and stage were independent prognostic factors. In the scope of our research, we also explored the potential correlation between SLC8A1 mutations in the endometrium and the development and progression of UCEC. Notably, an SLC8A1 mutation was identified in 6 % of the low-risk and high-risk groups.

The genetic heterogeneity of tumours contributes to their intricate structure, which uses environmental barriers to enhance their diverse properties and confines the tumour within its microenvironment [47,48]. In addition to tumour cells and immune cells, the tumour microenvironment (TME) comprises stroma and capillaries, forming a complex system that significantly influences the aggressive behaviour of cancerous tumours [49]. Extensive research on the mechanisms driving cancer progression has elucidated the pivotal role played by interactions between genes and immune cells within the TME. Chen et al. conducted a comprehensive analysis to elucidate the expression patterns of TRP family genes and their associations with the TME across different types of cancer [50]. In a separate study, Feng et al. demonstrated a significant positive correlation between CENPT expression and the infiltration of myeloid-derived suppressor cells (MDSCs), whereas a significant negative correlation was observed between CENPT expression and the infiltration of T-cell natural killer (NK) cells in the majority of cancer types [51].

The present investigation aimed to examine the relationship between SLC8A1 and immune cell infiltration, as well as the association between SLC8A1 and the immune microenvironment across cancers. We conducted an investigation to determine whether there were notable disparities in the stromal score, immune score, and ESTIMATE score between immune cell infiltrates categorised as high or low. Intriguingly, our analysis revealed a significant correlation between SLC8A1 and these three scores. Additionally, we proceeded to examine the association between SLC8A1 expression and immune infiltration. Our findings revealed a significant correlation between SLC8A1 expression and resting memory CD4+ T cells, CD8+ T cells, M0 macrophages, and M1 macrophages. These results provide a foundation for further exploration of the underlying mechanisms involved. The strong correlation between SLC8A1 expression and M1 macrophages, as well as its negative correlation with M2 macrophages, is of particular interest. The infiltration of macrophages is widely recognised to be associated with favourable survival outcomes and serves as a prognostic indicator. In addition to the aforementioned survival analysis, the potential utility of SLC8A1 agonists in the treatment of endometrial hyperplasia, endometrial cancer, endometriosis, and abnormal endometrium warrants consideration. Finally, an examination was conducted to determine whether a correlation exists between SLC8A1 expression and drug sensitivity. Low-risk patients exhibit increased sensitivity to osimertinib, dasatinib, sepantronium bromide, ibrutinib, and other drugs. Our study has demonstrated the promising prognostic potential of the SLC8A1-related prognostic signature in guiding clinical therapeutic decisions.

However, it is imperative to acknowledge the existing limitations of this study that necessitate further investigation. Additional experiments are indispensable to authenticate the exact involvement of SLC8A1 in RSA and elucidate its underlying mechanisms. Furthermore, more extensive research is warranted to obtain a comprehensive understanding of how SLC8A1 impacts the microenvironment of UCEC. Nonetheless, the outcomes of our study could aid in risk stratification and guide individual treatment options for RSA and UCEC in clinical settings.

5 Conclusions

In our study, we investigated the expression and function of SLC8A1 in RSA and UCEC while also exploring its associations with clinical characteristics. This analysis was approached from a bioinformatics perspective, marking the first instance of such an examination. Notably, our findings demonstrated the superior ability of SLC8A1 to predict survival, the TME, and the response to immunotherapy, chemotherapy, and targeted therapy in patients with UCEC compared with clinical applications.

Funding

This study was supported by the 10.13039/501100001809 National Natural Science Foundation of China (grant no. 82104613 ); Colleges and Universities Research Project of Anhui Province (grant no. 2023AH050853 ).

Data availability statement

The datasets generated for this study can be found in the GEO dataset: https://www.ncbi.nlm.nih.gov/geo/; http://tcga-data.nci.nih.gov/tcga/. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval

Review and approval by an ethics committee was not needed for this study because [this study involves human data from public databases such as GEO and TCGA].

CRediT authorship contribution statement

Ji-jun Chu: Writing – original draft, Project administration, Funding acquisition. Xiu-juan Qin: Visualization, Methodology, Data curation. Wenting Chen: Validation, Resources. Zhen Xu: Software, Investigation, Formal analysis. Xian-jin Xu: Writing – review & editing, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Abbreviations

RSA recurrent spontaneous abortion

GEO Gene Expression Omnibus database

qRT-PCR quantitative real-time PCR

GO Gene Ontology

KEGG Kyoto Encyclopedia of Genes and Genomes

PPI protein protein interaction

scRNA-seq single-cell RNA sequencing

UCEC Uterine Corpus Endometrial Carcinoma

ssGSEA single-sample gene set enrichment analysis

WGCNA Weighted Gene Co-expression Network Analysis

PTS prethrombotic state

URSA unexplained recurrent spontaneous abortion

RNA-seq RNA sequencing

RRBS reduced representation bisulfite sequencing

ME module signature genes

PCA Principal Component Analysis

DEGs differentially expressed genes

UMAP uniform manifold approximation and projection

ICPs immune checkpoints

GDSC Genomics of Drug Sensitivity in Cancer

CCK-8 Cell Counting Kit-8

WB Western Blot

ECL electrochemiluminescence

GS Gene Significance

MM Module Membership

OS overall survival

C-index concordance index

SNPs single nucleotide polymorphisms

TME tumor microenvironment

MDSCs myeloid-derived suppressor cells

Appendix A Supplementary data

The following are the Supplementary data to this article:figs1 figs1

figs2 figs2

figs3 figs3

figs4 figs4

figs5 figs5

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e36899.
==== Refs
References

1 Zhao Y. Sun J. Jin L. The N6-methyladenosine regulator ALKBH5 mediated stromal cell-macrophage interaction via VEGF signaling to promote recurrent spontaneous abortion: a bioinformatic and in vitro study Int. J. Mol. Sci. 23 2022 15819 10.3390/ijms232415819
2 Zhu P. Song Z. Bi X. Su D. Li X. Chen Y. Wu X. Correlation between methylenetetrahydrofolate reductase gene-specific methylation and recurrent spontaneous abortion Biotechnol. Genet. Eng. Rev. 6 2023 1 10.1080/02648725.2022.2164137
3 Tang M. Li Q. Wan S. Chen Q. Feng S. You J. Wang W. Zhu Y. LncRNA landscape and associated ceRNA network in placental villus of unexplained recurrent spontaneous abortion Reprod. Biol. Endocrinol. 21 2023 57 10.1186/s12958-023-01107-4 37340405
4 Fu Y. Song Y. Zhang J. Wei L. Sun X. Decreased expression and DNA hypermethylation of syncytin-1 in human villus tissues with unexplained recurrent spontaneous abortion J. Reprod. Immunol. 155 2023 103784 10.1016/j.jri.2022.103784
5 Yang X. Su S. Ren Q. Liu L. Li J. Zhang W. Cai K. Xu Z. Pan X. BushenHuoxue recipe for the treatment of prethrombotic state of ACA-positive recurrent miscarriage via the regulation of the PI3K-AKT signaling pathway Evid Based Complement Alternat Med 14 2022 2385534 10.1155/2022/2385534
6 Xu F. Cai H. Li H. Wang D. Benzo(a)pyrene induced adverse pregnancy outcomes by affecting the expression of IL-18 and IL-1RN in placenta Heliyon 8 2022 11767 10.1016/j.heliyon.2022.e11767
7 Shen C. Tai S. Tsao Y. Chen F. Hsieh H.M. Abortion and female cancer risks among women aged 20 to 45 Years: a 10-year longitudinal population-based cohort study in Taiwan Int J Environ Res Public Health 20 2023 3682 10.3390/ijerph20043682 36834377
8 Luo Y. Chen J. Cui Y. Fang F. Zhang Z. Hu L. Chen X. Li Z. Li L. Chen L. Transcriptome-wide high-throughput m6 A sequencing of differential m6A methylation patterns in the decidual tissues from RSA patients FASEB J 37 2023 22802 10.1096/fj.202201232RRRR
9 Du L. Deng W. Zeng S. Xu P. Huang L. Liang Y. Wang Y. Xu H. Tang J. Bi S. Single-cell transcriptome analysis reveals defective decidua stromal niche attributes to recurrent spontaneous abortion Cell Prolif. 54 2021 13125 10.1111/cpr.13125
10 Tan Z. Chen X. Zuo J. Fu S. Wang H. Wang J. Comprehensive analysis of scRNA-Seq and bulk RNA-Seq reveals dynamic changes in the tumor immune microenvironment of bladder cancer and establishes a prognostic model J. Transl. Med. 21 2023 223 10.1186/s12967-023-04056-z 36973787
11 Berest I. Tangherloni A. Integration of scATAC-Seq with scRNA-Seq Data Methods Mol. Biol. 2584 2023 293 10.1007/978-1-0716-2756-3_15 36495457
12 Fan P. Zhang Y. Ding S. Du Z. Zhou C. Du X. Integrating RNA-seq and scRNA-seq to explore the mechanism of macrophage ferroptosis associated with COPD Front. Pharmacol. 14 2023 1139137 10.3389/fphar.2023.1139137
13 Zhu W. Gu Y. Li M. Zhang Z. Liu J. Mao Y. Zhu Q. Zhao L. Shen Y. Chen F. Integrated single-cell RNA-seq and DNA methylation reveal the effects of air pollution in patients with recurrent spontaneous abortion Clin Epigenetics 14 2022 105 10.1186/s13148-022-01327-2 35999615
14 Liu J. Gu Y. Zhu W. Zhang Z. Xin Y. Shen Y. He L. Du J. Expression profiles of circular RNA in human placental villus and decidua and prediction of drugs for recurrent spontaneous abortion Am. J. Reprod. Immunol. 88 2022 3578 10.1111/aji.13578
15 Xu M. Zhou H. Hu P. Pan Y. Wang S. Liu L. Liu X. Identification and validation of immune and oxidative stress-related diagnostic markers for diabetic nephropathy by WGCNA and machine learning Front. Immunol. 14 2023 1084531 10.3389/fimmu.2023.1084531
16 Arlauckas S. Garren S. Garris C. Kohler R. Oh J. Pittet M. Weissleder R. Arg1 expression defines immunosuppressive subsets of tumor-associated macrophages Theranostics 8 2018 5842 10.7150/thno.26888 30613266
17 Su Y. Zhang T. Lu J. Qian L. Fei Y. Zhang L. Fan S. Zhou J. Tang J. Chen H. Identification and validation of the prognostic panel in clear cell renal cell carcinoma based on resting mast cells for prediction of distant metastasis and immunotherapy response Cells 12 2023 180 10.3390/cells12010180 36611973
18 Gao Y. Jia Y. Yu Z. Ji X. Liu X. Han L. Zhang H. Zhu B. Xu M. Analysis of the differential expression and prognostic relationship of DEGs in AML based on TCGA database Eur. J. Med. Res. 28 2023 103 10.1186/s40001-023-01060-3 36850007
19 Juan C. Zhu Y. Zhou Y. Zhu W. Wang X. He W. Chen Y. Exploration of prognostic immune-related genes and lncRNAs biomarkers in kidney renal clear cell carcinoma and its crosstalk with acute kidney injury J Oncol 8 2022 6100187 10.1155/2022/6100187
20 Kong D. Li L. Wang H. Li K. Zheng G. Immunological significance of survival-related alternative splicing in uveal melanoma Aging (Albany NY) 14 2022 811 10.18632/aging.203842 35051904
21 Li Y. Zeng T. Guan Y. Liu J. Liao N. Wang M. Chen K.X. Luo X. Chen C. Quan F. Validation of ESM1 related to ovarian cancer and the biological function and prognostic significance Int. J. Biol. Sci. 19 2023 258 10.7150/ijbs.66839 36594088
22 Yan H. Qu J. Cao W. Liu Y. Zheng G. Zhang E. Cai Z. Identification of prognostic genes in the acute myeloid leukemia immune microenvironment based on TCGA data analysis Cancer Immunol. Immunother. 68 2019 1971 10.1007/s00262-019-02408-7 31650199
23 Wu Z. Lei K. Li H. He J. Shi E. Transcriptome-based network analysis related to M2-like tumor-associated macrophage infiltration identified VARS1 as a potential target for improving melanoma immunotherapy efficacy J. Transl. Med. 20 2022 489 10.1186/s12967-022-03686-z 36303162
24 Xu X. Wang J. Multi-omics analysis reveals focal adhesion characteristic associated tumor immune microenvironment in colon adenocarcinoma Front. Genet. 14 2023 1088091 10.3389/fgene.2023.1088091
25 Shi Y. Xiao Q. Huang S. Pan Q. Jia H. Zhou Q. Wei J. Kang J. Li Z. Hu Y. Poor prognostic biomarker KIAA1522 is associated with immune infiltrates in hepatocellular carcinoma J Oncol 31 2023 3538928 10.1155/2023/3538928
26 Nguyen T. Lee H. Burt B. Wu J. Zhang J. Amos C. Cheng C. A lepidic gene signature predicts patient prognosis and sensitivity to immunotherapy in lung adenocarcinoma Genome Med. 14 2022 5 10.1186/s13073-021-01010-w 35016696
27 Zhao Q. Li Q. Fu Y. Ren C. Jiang A. Meng Y. Decidual macrophages in recurrent spontaneous abortion Front. Immunol. 13 2022 994888 10.3389/fimmu.2022.994888
28 Di X. Duan Z. Ma Y. Song X. Hao Y. Li G. Tan Z. Lou Y. Lin X. Jiawei Shoutai Pill promotes decidualization by regulating the SGK1/ENaC pathway in recurrent spontaneous abortion J. Ethnopharmacol. 318 2023 116939 10.1016/j.jep.2023.116939
29 Li Y. Zhang X. Xu S. Ge J. Liu J. Li L. Fang G. Meng Y. Zhang H. Sun X. Expression and clinical significance of FXYD3 in endometrial cancer Oncol. Lett. 8 2014 517 522 10.3892/ol.2014.2170 25013464
30 Bougen N. Yang T. Chen H. Lobie P. Perry J. Autocrine human growth hormone reduces mammary and endometrial carcinoma cell sensitivity to mitomycin C Oncol. Rep. 26 2011 487 10.3892/or.2011.1305 21567106
31 Gal I. Sadetzki S. Gershoni-Baruch R. Oberman B. Carp H. Papa M. Diestelman-Menachem T. Eisenberg-Barzilai S. Friedman E. Offspring gender ratio and the rate of recurrent spontaneous miscarriages in jewish women at high risk for breast/ovarian cancer Am. J. Hum. Genet. 74 2004 1270 10.1086/421442 15116316
32 Wang Q. Li Z. Zhou S. Li Z. Huang X. He Y. Zhang Y. Zhao X. Tang Y. Xu M. NCAPG2 could be an immunological and prognostic biomarker: from pan-cancer analysis to pancreatic cancer validation Front. Immunol. 14 2023 1097403 10.3389/fimmu.2023.1097403
33 Li K. Tan G. Zhang X. Liu W. Ren J. Si Y. Adu-Gyamfi E. Li F. Wang Y. Xie B. EIF4G1 is a potential prognostic biomarker of breast cancer Biomolecules 12 2022 1756 10.3390/biom12121756 36551184
34 Zhao Z. He S. Yu X. Lai X. Tang S. Mariya M.A. Wang M. Yan H. Huang X. Zeng S. Analysis and experimental validation of rheumatoid arthritis innate immunity gene CYFIP2 and pan-cancer Front. Immunol. 13 2022 954848 10.3389/fimmu.2022.954848
35 Li H. Zhou Q. Wu Z. Lu X. Identification of novel key genes associated with uterine corpus endometrial carcinoma progression and prognosis Ann. Transl. Med. 11 2023 100 10.21037/atm-22-6461 36819577
36 Fang X. Zhang T. Chen Z. Solute carrier family 7 member 11 (SLC7A11) is a potential prognostic biomarker in uterine corpus endometrial carcinoma Int. J. Gen. Med. 16 2023 481 10.2147/IJGM.S398351 36777097
37 Zhang C. Wang R. Li M. Yang Q. Long non-coding RNA BLACAT2/miR-378a-3p/YY1 feedback loop promotes the proliferation, migration and invasion of uterine corpus endometrial carcinoma Oncol. Rep. 49 2023 108 10.3892/or.2023.8544 37052291
38 Lai X. Lu S. Jiang J. Zhang H. Yang Q. Liu Y. Li L. Li S. Dai S. Chen Y. Association of polymorphisms of calcium reabsorption genes SLC12A1, KCNJ1 and SLC8A1 with colorectal adenoma J. Cancer Res. Clin. Oncol. 149 2023 8335 10.1007/s00432-023-04773-4 37074453
39 Yang L. Zhang L. Zhu J. Wang Y. Zou N. Liu Z. Wang Y. Abnormal expression and role of MicroRNA-214-3p/SLC8A1 in neonatal Hypoxic-Ischaemic encephalopathy Int. J. Exp. Pathol. 104 2023 199 10.1111/iep.12475 37032493
40 Antoons G. Willems R. Sipido K. Alternative strategies in arrhythmia therapy: evaluation of Na/Ca exchange as an anti-arrhythmic target Pharmacol. Ther. 134 2012 26 10.1016/j.pharmthera.2011.12.001 22197992
41 Park H. Kim S. Jin H. Genetic polymorphisms of SLC8A1 are associated with hypertension and left ventricular hypertrophy in the Korean population Korean J Clin Lab Sci 51 2019 286 10.15324/kjcls.2019.51.3.286
42 Long Z. Chen B. Liu Q. Zhao J. Yang Z. Dong X. Xia L. Huang S. Hu X. Song B. The reverse-mode NCX1 activity inhibitor KB-R7943 promotes prostate cancer cell death by activating the JNK pathway and blocking autophagic flux Oncotarget 7 2016 42059 10.18632/oncotarget.9806
43 Song J. Ham J. Park S. Park S. Kim H. Song G. Lim W. Alpinumisoflavone activates disruption of calcium homeostasis, mitochondria and autophagosome to suppress development of endometriosis Antioxidants (Basel) 12 2023 1324 10.3390/antiox12071324 37507864
44 Wang S. Duan H. Zhang Y. Wang L. Zhang H. Li G. Mechanism of 17β-estrogen on intracellular free calcium regulation in smooth muscle cells at the endometrial-myometrial interface in uteri with adenomyosis Zhonghua Fu Chan Ke Za Zhi 50 2015 510 26311641
45 Shen B. Hao J. Lin Y. Li X. Yang X. Huang T. Wang J. Jia Y. Zhou J. Wang J. Estrogen-induced extracellular calcium influx promotes endometrial cancer progress by regulating lysosomal activity and mitochondrial ROS Front Med (Lausanne) 9 2022 835700 10.3389/fmed.2022.835700
46 Choi Y. Seo H. Shim J. Yoo I. Ka H. Calcium extrusion regulatory molecules: differential expression during pregnancy in the porcine uterus Domest. Anim. Endocrinol. 47 2014 1 10.1016/j.domaniend.2013.12.005 24472379
47 Luo Q. Hu Z. Zhao H. Fan Y. Tu X. Wang Y. Liu X. The role of TGF-β in the tumor microenvironment of pancreatic cancer Genes Dis 10 2022 1513 10.1016/j.gendis.2022.10.019 37397548
48 Badve S. Gökmen-Polar Y. Targeting the tumor-tumor microenvironment crosstalk Expert Opin. Ther. Targets 27 2023 447 10.1080/14728222.2023.2230362 37395003
49 Rajbhandary S. Dhakal H. Shrestha S. Tumor immune microenvironment (TIME) to enhance antitumor immunity Eur. J. Med. Res. 28 2023 169 10.1186/s40001-023-01125-3 37179365
50 Chen Z. Zhao Y. Tian Y. Cao R. Shang D. Pan-cancer analysis of the TRP family, especially TRPV4 and TRPC4, and its expression correlated with prognosis, tumor microenvironment, and treatment sensitivity Biomolecules 13 2023 282 10.3390/biom13020282 36830651
51 Feng Z. Chen Y. Cai C. Tan J. Liu P. Chen Y. Shen H. Shan Z. Han Y. Pan-cancer and single-cell analysis reveals CENPL as a cancer prognosis and immune infiltration-related biomarker Front. Immunol. 13 2022 916594 10.3389/fimmu.2022.916594
