
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)12579-0
10.1016/j.heliyon.2024.e36548
e36548
Research Article
The design and development of EcoBiomes: Multi-species synthetic microbial consortia inspired by natural desert microbiome to enhance the resilience of climate-sensitive ecosystems
Mousa Walaa K. walaa.mousa@aau.ac.ae
abc⁎
Ghemrawi Rose ab
Abu-Izneid Tareq d
Al Ramadan Najwa ab
Al Sheebani Fatima ab
a College of Pharmacy, Al Ain University, Abu Dhabi, 64141, United Arab Emirates
b AAU Health and Biomedical Research Center, Al Ain University, Abu Dhabi, 112612, United Arab Emirates
c College of Pharmacy, Mansoura University, Mansoura, 35516, Egypt
d Monash Rural Health, Churchill, School of Rural Health, Faculty of Medicine, Nursing and Health Sciences, Monash University, Victoria, 3844, Australia
⁎ Corresponding author. College of Pharmacy, Al Ain University, Abu Dhabi, 64141, United Arab Emirates. walaa.mousa@aau.ac.ae
19 8 2024
30 8 2024
19 8 2024
10 16 e3654815 6 2024
6 8 2024
19 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Synthetic microbial communities, which simplify the complexity of natural ecosystems while retaining their key features, are gaining momentum in engineering and biotechnology applications. One potential application is the development of bioinoculants, offering an eco-friendly, sustainable solution to promote plant growth and increase resilience to abiotic stresses amidst climate change. A potential source for stress-tolerant microbes is those associated with desert plants, evolved and shaped by selective pressures to promote host health under harsh environmental conditions. In our research, we aim to design and develop synthetic microbial consortia inspired by the natural microbiota of four desert plants native to the Arabian Peninsula, inferred from our previous work identifying the structure and predicting the function of these microbial communities using high throughput eDNA barcoding. To obtain culturable microbes that are manageable and traceable yet still representative of natural microbial communities, we combined multiple experimental protocols coupled with compatibility and synergy assessments, along with in planta testing. We isolated a total of 75 bacteria and conducted detailed biological evaluations, revealing that an overwhelming majority (84 %) of all isolates produced indole acetic acid (IAA), with 73 % capable of solubilizing phosphate, 60 % producing siderophores, 47 % forming biofilms, and 35 % producing ACC deaminase, all contributing to plant growth and stress tolerance. We constructed four synthetic microbial consortia, named EcoBiomes, consisting of synergistic combinations of multiple species that can co-exist without significant antagonism. Our preliminary data indicate that EcoBiomes enhance the resilience of heterologous host plants under simulated environmental stresses, including drought, heat, and salinity. EcoBiomes offer a unique, sustainable, and eco-friendly solution to mitigate the impact of climate change on sensitive ecosystems, ultimately affecting global food security.

Graphical abstract

Illustration of the research protocol aimed to designing and developing EcoBiomes to enhance the resilience of sensitive ecosystems amidst climate change. Microbiota communities were isolated from their native desert hosts using a combined top-down and bottom-up approach to identify isolates with representative taxonomy of the natural community. Detailed biological evaluations were conducted, followed by grouping of isolates based on activity. The EcoBiome was then designed to include members with multiple activities and assessed for synergy and compatibility before testing in planta to verify the ability to protect climate-sensitive crops against abiotic stresses.Image 1

Keywords

Desert microbiota
Synthetic consortia
Climate change
Bioinoculants
Heat tolerance
and Drought tolerance
==== Body
pmc1 Introduction

The climate change poses challenges with more frequent and intense droughts and heat waves which threaten the survival of all ecosystems [1,2]. Global warming is a term for the observed century-scale rise in the average temperature of the Earth's climate system and its related effects [3]. Global warming has many consequences but most important is that world's lands once most productive will be converted to drylands and will not be capable of producing crops [4,5]. Currently drylands occupy 41 % of the earth's terrestrial surface and are home to more than a third of the world's population. Rising global temperatures are causing instances of heat stress, which can have detrimental effects on the growth and output of temperature-sensitive crops [6]. The increase in temperatures negatively impacts crop productivity by affecting various aspects at the biochemical, physiological, molecular, and morphological levels [[7], [8], [9], [10]]. The Intergovernmental Panel on Climate Change (IPCC) emphasized that an anticipated annual temperature rise of 0.20 °C over the next two decades could pose a risk to agricultural development [11]. Furthermore, a temperature increases from 3 to 4 °C could potentially lead to significant declines in crop yields of up to 35 % [12]. This underscores the prevailing trajectory of global warming as a significant challenge to food security and the production of essential foods worldwide.

Mirroring to the mounting interest in the human microbiome, there is a growing focus on the native microbial communities associated with plants [13,14]. These communities are formed of multitude of species whose richness, diversity, and interaction determine the overall benefit to their host plant [15]. These species have co-evolved to share metabolic functional traits to enhance their host plant growth and tolerance to different types of biotic and abiotic stress. For example, rhizobacteria are known for their ability to form biofilm which increases resilience to environmental stress such as heat and UV radiation and ultimately increases the ability of their host plant to survive unfavorable conditions [16]. Although most of the research of plant microbiota is descriptive and focusing on revealing their diversity and functionality, these findings fueled a further interest in application of these microbes as bioinoculants to enhance crop productivities and tolerance to stress with the climate change. Fortune Business Insights forecasts that the bioinoculant market will surpass $16 billion by 2029. Of interest is the microbiota associated with desert plants and their evolved functions to enhance their host resilience to the extremely harsh environment in the arid desert [17]. These functions include desert-specific adaptation such as tolerance to heat, drought, salinity, ionizing radiation, and plant growth promoting activities such as fertilizers and biological control against pathogens. However, one limitation to the development of successful bioinoculant is the ability of these microbial communities to colonize heterologous host and outcompete with existed natural flora given that some species might have develop a metabolic dependence on neighboring microbes within the same community [18].

Designing of multispecies consortia that are inspired by the natural communities of the desert microbiota is a promising approach to develop efficient bioinoculant to enhance tolerance of sensitive crops to environmental stresses such as drought and high temperature. Here, we attempt, for the first time, to design synthetic microbial consortia inspired by natural microbiome of four desert plants native to the Arabian Peninsula. We constructed the consortia based on detailed in vitro assays coupled with synergy and compatibility testing followed by in planta validation. Our preliminary data show that our tested consortia, which we named EcoBiomes, are capable of enhancing resilience to drought, heat, and salinity in plant model and hence provide a sustainable ecofriendly solution to mitigate the consequences of climate changes on sensitive ecosystems.

2 Results and discussion

In the current study, we combined two culturing protocols to construct synthetic microbial consortia, which we named “EcoBiomes” from the desert microbiota with detailed biological evaluations for their effectiveness as bioinoculant to enhance resilience of agriculture crops under normal and simulated environmental stresses including drought, heat, and salinity. EcoBiomes are inspired by the natural composition and function of the native co-existed microbial communities.1 Culturable taxa from desert microbiome

To obtain culturable microbes that are manageable and traceable but still represent the natural microbial communities, we combined the two culturing protocols. First a top-down approach to reduce complexity of the natural microbial communities. Our previous analysis of these microbial communities reveals that carbohydrate breakdown is a core metabolic function that is consistently shared a cross all community [19]. The ability of microbes to degrade complex organic compounds is crucial to survive in the desert habitat which is characterized by a very limited nutrient availability. Based on this knowledge, we cultured each sample on a complex media implemented with chitin and sand/plant extract to obtain subcultures of the entire microbiota composition. Chitin is an abundant complex carbon source that requires microbial cooperation for its breakdown and has been reported to successfully used to isolate multiple microbial taxa including Mycobacterium, Rhizobiales, and Rhodococcus [20]. Second, we used selective and non-selective media to isolate individual bacteria from each subculture. Selective media were chosen based on the functional traits previously predicted by genomic analysis such as heat and drought tolerance. Isolates were taxonomically classified based on similarity of their 16S rRNA to sequences deposited at the GenBank (Supplementary Excel file 1).

This integrated strategy that combines the top down and the bottom-up approaches is designed to construct stable, manageable, and traceable culturable microbial consortia. In the top-down approach, the entire microbiota is cultured on a complex media as a method of dilution to reduce complexity [20]. While the bottom-up approach includes isolation and profiling of individual microbes then design a synthetic community [21]. Although the top-down approach, is more representative of the native community compared to the bottom up but much more complex and contain hundreds of species that are challenging to manage, evaluate, and trace. Thus, a combined protocol will lead to synthetic microbial communities that reduce complexity but retain main features of the natural ecosystem [22].

In total, we purified 75 unique bacterial isolates from 8 subcultures of the rhizosphere and endosphere communities of the four studied plants. The highest number of isolates was obtained from Halocnemum strobilaceum (22 isolates), followed by Haloxylon persicum (21 isolates) and Panicum turgidum (20 isolates), and the lowest number of pure isolates was recovered from Arnebia hispidissima (12 isolates). The diversity of these individual isolates correlates with the composition inferred from high throughput analysis of the 16S rRNA amplicon which revealed that HS and HP are the most enriched in diverse microbial taxa while AH is the lowest (Fig. 1). The most culturable phyla was Proteobacteria and Actinobacteria followed by Pseudomonadota, Firmicutes, and Deinococcota. Representative members of the Proteobacteria includes Pseudomonas, Rhizopium, Sinorhizobium, Pantoea, Azospirillum, Sphingomonas, Kosakonia, Acinetobacter, Cupriavidus. While the isolates from Actinobacteria belong to the genera of Microbacterium, Corynebacterium, Curtobacterium, Streptomyces, Nocardioides, Actinomadura, Rhodococcus, Enteractinococcus, and Kribella. Firmicutes was represented by Bacillus and Lentibacillus. Bacillus species have been isolated from all samples except A. hispidissima. The least cultured genus was Sphingomonas that was isolated from the endosphere of A. hispidissima. Two genera have been isolated from the phylum Pseudomonadota which are Azotobacter, and Agrobacterium. Deinococcota phylum was represented by one isolate from the genus Deinococcus. Overall, the isolated bacterial taxa correlate with the high throughput analysis [19]. For example, bacteria from the orders Actinomycetales, Bacillales, Rhizobiales, were among the most abundant in HP, HS, and PT (Fig. 1. A) and represented the most isolated taxa as well (Fig. 1B).2 Assessment of functional traits of isolated microbes

Fig. 1 Structure of the microbial communities associated with the studied desert plants. A: Most abundant taxa as inferred by the high throughput sequencing of the 16S rRNA amplicon (data was obtained from a previous published study [19] but order level grouping and its visualization is presented here for the first time), B: Diversity and abundance of the isolated bacteria obtained from sequencing of the 16S rRNA gene in each individual isolate and comparing it with NCBI database for taxonomical similarities.

Fig. 1

To identify potential functional traits of the isolates, we conducted a three panel of biological assessments. The first panel aimed to identify plant growth promotion activities such as production of phytohormones, solubilization of rock phosphate, secretion of siderophores, ACC deaminase activity, and biofilm formation. The second panel aimed to assess the ability of these isolated to withstand adverse environmental conditions such as drought, heat, salinity, and UV ionizing radiation. While the third panel aimed to identify if these isolates can antagonize other bacterial and fungal species. Detailed activity of each strain is shown in Fig. 2, Fig. 3, Fig. 4, Fig. 5. Overall, all isolates exhibited multiple plant beneficial traits. An overwhelming majority of 84 % of all isolates produced indole acetic acid (IAA), a hormone recognized for its plant growth-stimulating activity. Additionally, 73 % of culturable strains were able to solubilize phosphate, contributing to nutrient availability for plant growth. While 60 % of isolates showed ability to produce siderophores that sequester irons and increase its bioavailability for the plant. In addition, 47 % of isolates were able to form biofilm that increases tolerance of these microbial communities to both biotic and abiotic stress. Interestingly 35 % of isolates were able to produce ACC deaminase, an enzyme that breaks down plant ethylene thus decreases stress signals and promote the overall growth. For carbohydrate breakdown, although we have originally selected for strains that can grow on complex carbohydrate media, surprisingly more than 25 % of the isolated strains showed no ability to breakdown cellulose, pectin, or chitin. This might be explained in terms of the metabolic dependency theory which states that members of the community might lose some metabolic capacity because they rely on other members to supply the missing function. Out of the 75 isolates, 72 % were able to breakdown cellulose, 44 % breakdown pectin, and 54 % break down chitin. Regarding tolerance to abiotic stress, 60 % of isolates showed tolerance to heat with 57 % were able to survive drought and 40 % able to tolerate salinity. While only 17 % of the isolates showed resistance to ionizing UV radiation, although mostly at a mild level, which might be a technical limitation for culturing these microbes under laboratory conditions. For antagonism activity, 52 % of the isolates exhibited antibacterial activities and 36 % showed antifungal activities.3 Designing and construct of the synthetic microbial consortium from each studied plant

Fig. 2 Functional assessment of individual bacteria isolated from H. strobilaceum (HS). The saturation of color shades indicates increasing activity levels from mild to moderate to strong. Strains written in bold have been originally selected to form a preliminary consortium, which underwent further testing for compatibility and synergy in action.

Fig. 2

Fig. 3 Functional assessment of individual bacteria isolated from P. turgidum (PT). The saturation of color shades indicates increasing activity levels from mild to moderate to strong. Strains written in bold have been originally selected to form a preliminary consortium, which underwent further testing for compatibility and synergy in action.

Fig. 3

Fig. 4 Functional assessment of individual bacteria isolated from H. persicum (HP). The saturation of color shades indicates increasing activity levels from mild to moderate to strong. Strains written in bold have been originally selected to form a preliminary consortium, which underwent further testing for compatibility and synergy in action.

Fig. 4

Fig. 5 Functional assessment of individual bacteria isolated from A. hispidissima (AH). The saturation of color shades indicates increasing activity levels from mild to moderate to strong. Strains written in bold have been originally selected to form a preliminary consortium, which underwent further testing for compatibility and synergy in action.

Fig. 5

Based on the assessed functional traits, we selected isolates with multiple functionalities as a seed to form a synthetic consortium from each plant-associated microbiota as follows.1. EcoBiome-PT: Bacillus sp. PT-22-R1, Bacillus sp. PT-22-R3, Curtobacterium sp. PT-22-R6, Azotobacter sp. PT-22-R12, Kocuria sp. PT-22-R13, Quasibacillus sp. (Bacillus thermophilus) PT-22-R14, and Agrobacterium sp. PT-22-E6.

2. EcoBiome-HS: Rhizopium sp. HS-22-R3, Pantoea sp. HS-22-R4, Azospirillium sp. HS-22-R6, Corynebacterium sp. HS-22-R10, Bacillus sp. HS-22-E3, Mesorhizobium sp. HS-22-E6, Agrobacterium sp. HS-22-E7, Deinococcus sp. HS-22-E11, and Azospirillium HS-22-E12.

3. EcoBiome-HP: Pseudomonas sp. HP-22-R3, HP-22-R5, Corynebacterium sp. HP-22-R10, Bacillus sp. HP-22-R15, Agrobacterium sp. HP-22-E3, Azospirillum sp. HP-22-E6, and Priestia sp. HP-22-E7.

4. EcoBiome-AH: Actinomadura sp. AH-22-R2, Pantoea sp. AH-22-R5, Azotobacter sp. AH-22-E3, and Nocardioides sp. AH-22-E6.

These preliminary consortia were then subjected to further testing to determine their compatibility and absence of any inter-species antagonism in a pair-wise comparison then on a higher rank of order. The co-existence of multiple species without significant antagonism is enabling of niche colonization and add cumulative benefit to the host plant for beneficial traits of each member of the microbial community [23]. Non-antagonists’ consortia were then tested for synergistic growth pattern and finally re-evaluated for their cumulative activity as a consortium. Unfortunately, all members of the EcoBiome-AH showed antagonism activity and were not able to form a compatible synthetic community. The final design of other EcoBiomes with proven synergistic in vitro activity included.1. EcoBiome-PT-4: Bacillus sp. PT-22-R1, Azotobacter sp. PT-22-R12, Quasibacillus sp. (Bacillus thermophilus) PT-22-R14, Agrobacterium sp. PT-22-E6.

2. EcoBiome–HS–5: Rhizopium sp. HS-22-R3, Corynebacterium sp. HS-22-R10, Bacillus sp. HS-22-E3, Agrobacterium sp. HS-22-E7, Deinococcus sp. HS-22-E11,

3. EcoBiome-HP-4: Pseudomonas sp. HP-22-R3, Corynebacterium sp. HP-22-R10, Bacillus sp. HP-22-R15, and Agrobacterium sp. HP-22-E3.

4. In planta assessment of EcoBiomes PT-4, HS-5, and HP-4

To assess the ability of each EcoBiome consortium in enhancing growth of heterologous host plant under regular or adverse environmental conditions, we used Phaseolus vulgaris as an in vivo model. Ecobiomes were applied as seed coat and re-inoculated as suspension to the primary root of the seedling upon transfer to pots. Inoculated and non-inoculated seedlings (control) were exposed to four simulated environmental conditions: 1) Optimum growth conditions, 2) drought stress, and 3) heat stress, and 4) salinity. Colony-PCR was used to confirm stability of the consortium in the soil or colonization of root tissues. We were able to revive all members of Eco-Biome-HS while we were not able to detect Quasibacillus sp. In EcoBiome-PT and Corynebacterium sp. HP-22-R10 in EcoBiome-HP which might be a technical limitation of the used method or inability to colonize the heterogenous host. The impact of each consortium in planta was assessed through measuring: 1) plant biomass (Fig. 6A), 2) root system (Figs. 6B), 3) water content (Figs. 6C), and 4) Reactive Oxygen Species (ROS)-scavenging enzymes including such as Glutathione Peroxidase (GPX), Glutathione Reductase (GR), and Superoxide Dismutase (SOD) (Fig. 6D). Under optimum growth conditions, EcoBiome-HS showed the most promising results in enhancing plant biomass and increasing the length of the primary and lateral roots with up to 100 % increase compared to non-inoculated plants. EcoBiome-HP increases biomass and root length with ∼20–30 %. While EcoBiome-PT showed the least activity in enhancing plant growth. All EcoBiome consortia did not affect water content or level of ROS-scavenging enzymes when compared to non-inoculated plants under optimum growth conditions.Fig. 6 In planta activity of the designed synthetic microbial consortia. A: Effect on the plant biomass in shoot and root, B: Effect of the length of the primary and lateral roots, C: Impact on the water contents in both roots and shoots, D: Effect on ROS-scavenging enzymes. Data are average of 5 replicates. Error bars represent standard error of the mean. Means denoted by a different letter indicate significant differences between treatments (p < 0.05).

Fig. 6

All simulated stress conditions resulted in a dramatic effect on plant biomass, root system, water content, and escalated the level of oxidative enzymes when compared to non-inoculated plant growing at optimum conditions. EcoBiome-HS showed potential to revert the measured parameter to a value that equals or exceeds the optimum growth conditions in particular under drought stress. Of note is that the impact of EcoBiome-PT and EcoBiome-HP were similar regarding their effect on root biomass under drought conditions, and length of lateral roots under heat, drought, and salinity stress. Stress conditions resulted in elevated levels of GR and to a lesser extent GPX while the impact of SOD was not significant compared to plant growing under optimum conditions. EcoBiome-HS resulted in significant increase in GR with ∼3 folds increase under heat and drought stress and ∼5 folds increase under salinity stress. Induction of oxidation enzymes might be a helpful strategy to assist the plant in coping with the high level of ROS generated during stress. EcoBiome-PT and HP again show similar impact on GR under all stress conditions but interestingly showed a significant reduction in SOD level under drought and salinity conditions.

Previous attempts to construct multispecies bioinoculants, typically consisting of 2–3 species, have demonstrated enhanced activities in planta. For example, a combination of Bacillus subtilis, B. megaterium, and B. thuringiensis exhibited increased chlorophyll content, amino acid accumulation, and improved drought tolerance in chickpeas [24]. Similarly, a synthetic community comprising B. subtilis, Ochrobactrum pseudogrignonense, and Pseudomonas sp. Showed elevated auxin production, siderophore secretion, and phosphate solubilization [24]. In another study, a consortium consisting of Microbacterium oxydans, Stenotrophomonas rhizophila, Paenibacillus amylolyticus, and Xanthomonas retroflexus demonstrated activity in enhancing drought tolerance in Arabidopsis [25]. Furthermore, in a trial aimed at enhancing wheat growth, three designed consortia composed of various bacterial combinations, including Ochrobactrum, Enterobacter, Pantoea, Bacillus, and Pseudomonas sp., exhibited increased growth rates and phosphorus content [26]. Other designs incorporated the addition of arbuscular mycorrhizal fungi, such as Claroideoglomus sp., to bacterial species like Kitasatospora and Agrobacterium, resulting in a significant increase in seedling biomass of teak trees (Tectona grandis) compared to individual microbes [27]. Additionally, combinations of Stenotrophomonas, Xanthomonas, and Microbacterium species suppressed downy mildew disease in Arabidopsis [28], while B. paralicheniformis, Brevibacillus fluminis, and B. agri enhanced salinity tolerance in solanaceous crops [29]. Moreover, Serratia sp., B. subtilis, and B. cereus were identified for drought tolerance in cucumber [30], and B. subtilis, Pseudomonas sp., and Ochrobactrum pseudogrignonense were associated with drought tolerance in pulse crops [31]. However, these attempts were based on selection of microbes with beneficial traits and not necessarily based-on a naturally co-existed community.

3 Conclusion

In conclusion, our distinctive design protocol yields manageable, traceable, compatible, and synergistic combinations capable of co-existing. The synthetic microbial consortia we have developed, inspired by the natural microbiota associated with desert plants, present a unique, sustainable, and eco-friendly solution to alleviate the impact of climate change on sensitive ecosystems, thus contributing to global food security.

4 Experimental procedures

1 Plant materials

In a previous study [19], we employed high throughput eDNA sequencing to study the structure and function of the rhizosphere (R) and endosphere (E) microbial communities associated with four desert plants native to the Arabian Peninsula: Halocnemum strobilaceum (HS), Panicum turgidum (PT), Haloxylon persicum (HP), and Arnebia hispidissima (AH). Here we use multiple culturing protocols to isolate individual microbes from these communities, profile their beneficial activity, construct a synthetic microbial consortium and preliminary evaluate their effectiveness as bioinoculants to increase resilience of sensitive crops to environmental stresses. Detailed description of sample collection and storage has been described [19]. Briefly, samples were collected from various locations with diverse soil properties near the UAE. Samples were gathered in October 2022, with an average day temperature of 34–40 °C and minimal precipitation. Each sample consists of plant roots and the surrounding rhizosphere. The rhizosphere is the soil zone around the roots where microbial communities are influenced by root exudates. This area is within a few millimeters of the root. Each sample is an average of 5 pooled plants. These samples were collected in sterile containers, transported on ice boxes, and stored at −80 °C for subsequent experiments. For each plant, the attached sand layer was carefully removed from the root surface and combined with the remaining sand. These fractions were used to isolate rhizosphere bacteria. The roots were then surface sterilized, with the internal root tissue used for isolating endosphere bacteria. Surface sterilization was conducted following a previously described protocol with adjustments [32]. Roots were first sonicated in autoclaved, distilled water for 5 min to remove soil particles, followed by immersion in 95 % ethanol for 3 min and rinsed with sterile water, repeated twice. Next, roots underwent a 5-min wash in a 3 % Sodium hypochlorite (NaOCl) solution and further rinsing with sterile water. The efficacy of sterilization was confirmed by rolling the roots onto tryptic soy agar under aseptic conditions and checking for no bacterial growth after 3 days of incubation at 25 °C and 37 °C. Following successful sterilization, we proceeded with isolation of microbial mixture.2 Generation of natural soil communities with reduced complexity

Our previous high throughput DNA sequencing analysis identified a core metabolic function shared among all samples: active metabolism, particularly enriched in carbohydrate degradation pathways [19]. To develop a microbial consortium with less complexity yet retains representative members of the natural community, we adopted a previously published method with modification [20]. We utilized two distinct types of samples: 1) sand adhered to roots and the surrounding environment which contains the rhizosphere bacteria, and 2) surface-sterilized roots, the source of endosphere bacteria. Three replicates of each sample [sands and homogenized roots in Phosphate Buffered Saline (PBS)] were fermented for one week on sterile sand enriched with 0.01 % chitin and moistened with autoclaved water to a total moisture level of 25 %. Thereafter, 1–2 g of the sand were transferred to a sterile tube containing 9 ml of PBS followed by 10-fold serial dilution. Aliquots from each dilution were plated onto agar plates containing sand extract and 0.01 % chitin for the rhizosphere communities or plant root extracts for the endosphere communities. The sand extract was made by shaking of 500 g of sand with 1 L of deionized water in a sterile container at 160 rpm for two days followed by centrifugation at 6000 rpm for 15 min then filtration to obtain sand-free extract. The root extract was made by mixing the dried powdered roots with methanol for two days then filtration followed by concentration on a rotatory evaporator until dryness then suspension in sterile water (5 g/100 ml). The plates were then incubated for 3–5 days at 28, 30, 35 °C. We then collected the microbial biomass from each plate and resuspend in PBS with OD600 being adjusted to 0.5. For long term storage 1.5 ml of each suspension was centrifuged at 10,000 rpm and the pellet was resuspended in 0.5 ml fresh TSB medium and 0.5 ml of 50 % glycerol then stored at −80 °C. Following this reduction approach, a total of eight consortia were obtained corresponding to 8 microbial communities of the rhizosphere and endosphere of the studied plants.3 Isolation of individual microbes from each microbial consortium and their taxonomical profiling

Our previous data on the structure of these communities reveals prevalence of taxa that are most adaptable to desert conditions such as tolerance to limited nutrients, heat, radiation, drought, and soil salinity. To isolate individual bacteria, selecting for these tolerance traits, each consortium was plated on different selective and non-selective growth media that included: 1) Agar with 0.01–1 % chitin, 2) Agar with 0.01–1 % cellulose, 3) Agar with 5 % sand or root extracts, 4) Nutrient medium supplemented with NaCl (range of concentration from 0.5 % to 7 %) to select for halotolerant isolates, 5) Nutrient medium supplemented with PEG 6000 (with concentrations of 5 %, 10 %, 15 %, and 20 %) to select for drought-tolerant isolates, 6) Nutrient medium followed by incubation at elevated temperature of up to 70 °C to select for heat-tolerant isolates, and 7) Exposure to UV for 1–15 min prior to incubation to select for UV-resistant isolates. Nutrient media used included R2A, TSB, and LB. Distinct bacterial colonies from each plate were chosen based on their visual characteristics. To identify their taxonomy, DNA was extracted from these selected colonies, and the 16S rRNA gene region was amplified through PCR then sequenced (Neoscience, Hong Kong, China). The DNA extraction was conducted following the guidelines provided by the manufacturer of the commercially available kit (E.Z.N.A. Bacterial DNA Kit by Omega BIO-TEK). For amplifying the 16S rRNA region, specific primers designed for 16S rRNA sequencing were utilized, including a 27-forward primer (AGAGTTTGARSMTGGCTCAG) and a 1492 reverse primer (CGGTTACCTTGTTACGACTT) at a concentration range of 10–50 ng. Each 50 μL reaction mixture comprised 40 μL of ready-made PCR master mix, 5 μL of primer mix, and 5 μL of DNA. The PCR master mix contained Taq DNA polymerase (0.05 U/μL), reaction buffer, 4 mM MgCl2, 0.4 mM of each dNTP, and nuclease-free water. The PCR process for 16S rRNA amplification included 1 cycle of 4 min at 94 °C (amplification), followed by 23 cycles of 1 min at 94 °C (melting), 30 s at 48 °C (annealing), and 2 min at 72 °C (extension for full length). Finally, BLAST and NCBI databases were utilized to compare the sequences with existing ones.4 Biological assessment of individual isolates for plant growth promotion traits

Auxin production: To assess the ability of the isolated bacteria to synthesize indole-3-acetic acid (IAA), we employed a colorimetric technique based on a previously established protocol [33]. Bacterial isolates were cultured in Tryptic Soy Broth (TSB) medium for 48 h at 30 °C. To prepare a bacterial lysate, bacterial cultures were subjected to centrifugation (10,000 rpm for 5 min), and the resulting bacterial pellets underwent dual washes and were then reconstituted in a 0.2 mol/L phosphate buffer (pH 8.0). Subsequently, bacterial lysis was achieved via ultrasonication for a duration of 30 min according to previously described protocol [34]. The resulting lysates of bacterial origin were used to examine enzyme activity. To initiate the transamination reaction, we used a reaction mixture that consisted of 0.1 mol/L phosphate buffer (pH 8.0), 10 mmol/L L-tryptophan, 10 μmol/L pyridoxal phosphate. We then added the bacterial lysate to a total volume of 0.5 ml and incubated for 3 min at 35 °C. We then added 2-oxoglutarate to at a concentration of 3 mmol/L. An additional reaction mixture without bacterial lysate was used as a blank control. To serve as a positive control for auxin production, bacterial lysate from Pseudomonas putida ATCC 12633, a known auxin-producer, was used. Termination of reactions was achieved by adding 1 mL of the Salkowski reagent, composed of 10 mmol/L FeCl3 dissolved in 35 % v/v H2SO4. After a 10 min incubation period at room temperature, the absorbance at λ = 530 nm was quantified (FLUOstar Omega spectrophotometer, Germany).

Mineral Phosphate Solubilization: To assess the ability of isolated bacteria to solubilize phosphate, a necessary trait to enhanced plant growth and restrict the consequences of extra use of fertilizers, we cultured the bacteria on tricalcium phosphate as described [35]. Briefly, the bacterial isolates were cultured in Tryptic Soy Broth (TSB) medium for 48 h at 30 °C, then centrifuged, washed twice with autoclaved water, and resuspended in fresh medium to an OD600 of 0.5. A drop of each culture (2 μl) was carefully placed on agar plates composed of 10 g/L glucose, 0.373 g/L NH4NO3, 0.41 g/L MgSO4, 0.295 g/L NaCl, 0.003 FeCl3, 0.7 g/L Ca3HPO4 and 20 g/L Agar. The plates were incubated at 30 °C for 2–3 days. We then measure the clear zones surrounding the colonies which indicates that the bacterium can solubilize the tricalcium phosphate.

Siderophore secretion: to assess the ability of each isolate to secrete siderophores which chelate iron and increase nutrient availability, we used a microplate assay as described [36]. Briefly, each isolate was grown in TSB medium at 28 °C for 24 h followed by centrifugation (10,000 rpm for 5 min) and resuspension in inoculation medium (5 μL inoculum containing 108 CFU per milliliter). Thereafter, a 100 μL of supernatant from each bacterial culture was added to separate wells of a microplate, followed by the addition of 100 μL of CAS reagent and incubated for 30 min. The absorbance was measured at 630 nm using a microplate reader (FLUOstar Omega spectrophotometer, Germany). Each supernatant was replicated three times, and siderophore production was quantified using the following equation, with A representing the absorbance of the reference (CAS solution and uninoculated broth), and S representing the absorbance of the sample (CAS solution and cell-free supernatant of the sample): Percent siderophore unit (PSU) = [(A-S)/A] × 100.

ACC deaminase activity: The assessment of ACC deaminase activity was conducted based on a previously described method with modifications [37]. The assay depends on measuring α-ketobutyrate, a product that is released from the cleavage of ACC substrate by the ACC deaminase enzyme. Thereafter, the measurement is compared to a standard curve of α-ketobutyrate ranging between 0.1 and 1 μmol. Briefly, a cell pellet from an overnight culture of each isolate is re-suspended in 1 mL 0.1 M Tris-HCl (pH 7.6). A volume of 200 mL suspension was supplemented with 20 μL 0.5 M ACC, vortexed, and then incubated at 30 °C for 15 min. Subsequently, 1 mL of 0.56 M HCl was added, followed by vortexing and centrifugation at 16,000 g for 5 min. A volume of 1 mL supernatant was transferred, combined with 800 μL of 0.56 M HCl, and vortexed before mixing with 2,4-dinitrophenylhydrazine reagent (0.2 % 2,4- dinitrophenylhydrazine in 2 M HCl). After vortexing, the mixture was incubated at 30 °C for 30 min, then supplemented with 2 mL 2 N NaOH and re-vortexed. Finally, the absorbance was measured at 540 nm wavelength using a microplate reader (FLUOstar Omega spectrophotometer, Germany).

Biofilm formation: To assess the ability of each isolate to form biofilm, we adopted a previously published spectrophotometric method [38]. Briefly, isolates were grown in 96 well plates containing LB broth for 48 h at 28 °C. Thereafter the planktonic cells were removed by decantation. The formed biofilm was then stained by 0.1 % (w/v) crystal violet (CV) and the absorbance was measured at 595 nm in a microplate reader. Each isolate was tested in triplicates.5 Assessment of isolates tolerance to abiotic environmental stresses

Carbohydrate breakdown: To assess the ability of isolates to breakdown complex carbohydrates we conducted tests to identify pectinase and cellulase activities in each isolate according to a standard protocol [39]. Suspension of freshly grown isolate adjusted to an OD600 of 0.5 were cultured on R2A plates supplemented with 0.2 % (w/v) pectin (to test for pectinase activity) or supplemented with 0.2 % carboxymethylcellulose (to test for cellulase activity). After 3 days of incubation in darkness at 28 °C, pectinase activity was detected by flooding the plate with Gram's iodine. Positive colonies exhibited clear halos surrounding them.

Heat tolerance: Isolates were tested for their ability to tolerate heat stress by culturing on TSB medium and incubate at elevated degrees of temperature of up to 70 °C then check for visible colonies on agar medium or OD600 when inoculated in a broth compared to the same isolate when grown at 28 °C.

Drought tolerance: Isolates were tested for their ability to tolerate heat stress by culturing on LB medium supplemented with PEG 6000 (with concentrations of 5 %, 10 %, 15 %, and 20 %) and incubated at 28 °C for 24 h. The growth rate is compared to isolates grown on LB only.

UV resistance: Isolates were tested for their ability to resist UV ionizing radiation by exposing them (broth culture then plating on solid medium or agar plates) to UV radiation in a dark room for durations of 1–15 min followed by wrapping with aluminum foil to prevent light repair followed by incubation overnight then compare their growth relative to non-UV treated colonies.

Salinity tolerance: To test the ability of isolates to tolerate saline conditions, we cultured each on LB medium containing NaCl with different concentrations of 0.5, 1, 2, 4, 6, and 7 % followed by incubation at 28 °C for 72 h then compare their growth rate compared to isolates grown on R2A only.6 Assessment of isolates resistance to biotic stress

Antibiosis test: To test the antagonistic traits of the isolated bacteria against other microbes we conducted a dual culture assay. To test for antibacterial activity, we used Staphylococcus aureus (ATCC 25923), Pseudomonas aeruginosa (BAA-1744) as representative of Gram positive and negative bacteria, respectively. To test antifungal activity, we used C. albicans (ATCC 18804). Isolates that tested positive against these indicator pathogens were then re-tested against other indicator strains including Bacillus cereus (ATCC 11778), E. coli (ATCC 25922), and Fusarium gramineraum (MYA 4620). Each pathogen was cultured in the recommended medium according to the supplier's instructions. For long-term storage, an aliquot of each culture was maintained in 50 % glycerol and stored at −80 °C. Briefly, indicators strains were incubated overnight in respective media (using TSB for bacteria and Sabouraud dextrose broth medium for yeast) then 10 μl of overnight actively grown culture of each pathogen were plated on the top of agar plates (MHM for bacteria and PDA for yeast), then holes were punctured in the agar using a sterile glass pipette and 50 μl of bacterial culture (at OD600 = 0.5) were applied into the holes. The plates were incubated aerobically at 37 °C for 24–48 h. Thereafter, the plates were screened for any developed zone of inhibition. Control treatments included media only as a negative control and ciprofloxacin at concentrations of 2 μg/ml and amphotericin at concentration of 3 μg/ml as positive controls.7 Design of ecological consortia as bioinoculant

As detailed above, we used a combined top down and bottom-up approaches to design ecology-based consortia with individual members that naturally co-exist together and exhibit desired plant growth promoting and environmental tolerance traits. Members of each consortium are selected based on the following.• Reflect the dominant phyla that have been identified in the natural community by high throughput sequencing.

• Include multiple functional traits that combine plant growth promotion and stress resilience.

• The activity of the consortium is significantly more than each individual isolate alone.

• All members are compatible and can grow with each other in a synergy.

8 Assessment of compatibility and inter-species interactions of co-cultured strainsA) To assess compatibility of isolates in a pairwise comparison, we conducted dual culturing antagonism test [40]. Simply, each isolate is grown overnight in optimized growth medium, centrifuged at 10,000 rpm for 5 min then resuspended in PBS to and OD600 of 0.1. One isolate is plated on top of a nutrient agar plate and the other is applied as 50 μL inside a hole created in the agar plate. The co-culture was incubated overnight then checked for inhibition zones which if observed indicate that the two isolates are incompatible.

B) To assess the presence of inter-species interactions that might affect isolates growth, we followed the method described by McClure et al. [20] with modifications. Individual isolated were grown on R2A agar at 28 °C for 24 h then centrifuged at 10,000 rpm for 5 min. The pellet is re-suspended in a minimal liquid medium to an OD600 of 0.1. Thereafter an equal portion of each isolate is mixed (we started with pair-wise assessment then shifted to higher ranks) and 200 μL of the mixture is placed in a 96-well plate and incubated for 3 days with OD measured every 12 h. Monoculture of each isolate was included as a control. Each isolate or a combination is repeated in triplicates. To evaluate potential positive or negative interactions resulting from co-culturing, we compared the anticipated optical density (OD) of a paired co-culture (Expected) to the actual OD measured in this co-culture. The Expected is calculated by averaging the OD values of each species in monoculture, as each species contributes equally to the volume in the well. If the measured OD in the plate reader exceeded the expected OD calculated from the sum of each species' monoculture ODs, it indicates a positive interaction. Conversely, if the expected OD is greater than the measured OD, it implies a negative interaction.

9 Inoculum preparation and in planta testing protocol

Phaseolus vulgaris was used in this study as a model plant to assess the activity of three designed consortia that have passed the compatibility and synergy testing. The seeds were surface sterilized by washing for 10 min with shaking in the following solutions in order; 1) 0.1 % Triton X-100, 2) 3 % NaOCl, and 3) 95 % ethanol. Each step was followed by double rinsing in autoclaved deionized water. To confirm the effectiveness of the sterilization protocol, the seeds/and final wash were planted onto TSA, and observed for any bacterial growth over 3 days of incubation at both 25 °C and 37 °C.

To prepare the inoculum, each member of the consortium was grown individually at its optimum growth medium conditions for 24 h. Each culture was centrifuged at 10,000 rpm for 5 min then resuspended in a fresh medium to an OD600 of 0.5. For each consortium, corresponding microbial members were combined in equal ratio, centrifuged at 16,000 rpm for 5 min, and resuspended in PBS buffer to an OD600 of 0.5. Thereafter bacterial consortium was mixed with the seed coating agent polyvinyl pyrrolidine (PVP, Catalog # 9003398, Sigma Aldrich, USA) in ratio of 1: 9. The consortium was then mixed with the surface sterilized seeds and incubated on an horizontal shaker for 2 h. Coated seeds were then planted on wetted paper towels and incubated in dark for 5–7 days until germination. Percentages of seed germination were recorded. To ensure efficient inoculation with each consortium, we added 100 μl of each equal-ratio microbial consortium on the primary root of each seedling directly during transfer to the pots, adopted with modifications from Tsolakidou et al. [41]. Seedlings with uniform size were transferred to pots with diameter of 12 cm containing autoclaved soil and kept under controlled environment of 16/8 photoperiods and 50–60 % humidity. Inoculated and non-inoculated seedlings were used for four experiments: 1) Optimum growth conditions, 2) simulated drought conditions, and 3) Simulated heat conditions, and 4) simulated salinity stress. Experimental conditions were adopted from standard protocols with modifications.

Before proceeding with the actual experiment, we determined the maximum temperature to induce heat stress, the maximum concentration of NaCl to induce saline stress, and the maximum duration to induce drought, ensuring that the plant could still survive, based on preliminary small-scale trials.A. Normal/optimum growth conditions: To assess for plant growth promoting activities of each consortium, seedlings were grown under optimum controlled growth conditions with full hydrations. The optimum growth conditions of for the development of Phaseolus vulgaris are temperature range of 15–30 °C with 24 °C being the optimum. The need for irrigation is about 1 inch of water per week. Edible beans are sensitive to salts and they could tolerate salinity of up to 0.5 mmhos/cm [42,43].

B. Simulated heat conditions: To assess for the ability of each consortium to increase resilience of the inoculated plants to elevated temperatures, Seedling were incubated at 45 °C [44].

C. Simulated drought conditions: The seedlings were subjected to 11 days of drought. Plant samples were taken for analysis at the end of the drought periods [45].

D. Simulated saline conditions: The seedling were irrigated with 200 mmol/L NaCl solution for 10 days [46].

Seeds coated with PBS and PVP only were used as a control. For each treatment, there were 12 pots for each treatment for each consortium arranged in a randomized block design, and each pot contains 3 seedlings. The entire experiment with the same setting was repeated. Data was analyzed using PRISM GraphPad version 9, USA.10 Assessment of the activity of each consortium in planta

Root and/or rhizosphere colonization: To confirm if the consortium was successfully colonized roots and/or rhizosphere area. Three replicates from each treatment were collected, cultured on media panels that favors the growth of each member of the consortium. Colonies were selected and profiled using colony PCR (cPCR) method which enables a relatively a higher throughput screening by bypassing the need to isolate and purify DNA for each isolate. PCR was performed using the same conditions and primers described earlier in the taxonomy profiling section except for using a 96-well plate format to conduct the PCR reaction.

Plant growth promotion activities: To assess the ability of each consortium to enhance plant growth and normal growth condition and/or in heat and droughts simulated pots experiments, we measured the following phenotypes: 1) survival rates, 2) plant biomass, 3) water content, 4) root length, and 5) Number of lateral roots.

Assessment of biomass and water content: Plants were washed with deionized water to remove attached soil debris and dried between filter papers then fresh weight of both shoots and roots was recorded before and after drying at 70 °C for 48 h. Fresh weight was recorded before the samples were dried until constant weight was obtained. The difference between fresh and dry weight was used to calculate the water contents. In case of heat stress, plants were first moved to normal growth temperature of 28 °C for 3 days before drying. Data from five replicates were used for analysis.

Production of Reactive oxygen species (ROSs) scavenging enzymes: Stress conditions such as heat and drought are likely to drive activation of cellular antioxidant system in plants which involved upregulation of ROS-scavenging enzymes such as Glutathione Peroxidase (GPX), Glutathione Reductase (GR), and Superoxide Dismutase (SOD) [47,48]. To assess the ability of each consortium to increase the plant resilience against heat stress and drought, we assessed the activity of GPX, GR, and SOD enzymes using commercially available kits: Abcam, ab102530, Abcam, ab83461, and Abcam, ab65354, respectively. Briefly, pooled plant materials were mixed were homogenized in ice-cold extraction buffer then centrifuged for at 4 °C (14,000 g for 10 min). The supernatant was then used to test for each enzyme activity colorimetry using a microplate reader (FLUOstar Omega, BMG Labtech, Germany). A single unit of GPX activity was determined as the quantity of enzyme capable of catalyzing the conversion of 1 μmol of NADPH to NADP + per minute at 25 °C in the given assay conditions. Similarly, one unit of GR activity was characterized as the enzyme amount required to produce 1 μmol of nitrobenzoic acid (TNB) per minute at 25 °C. The quantification of SOD activity involved measuring the inhibition of the reduction of water-soluble tetrazolium salt (WST-1), resulting in the formation of water-soluble formazan dye through the reduction of superoxide anion radicals by xanthine oxidase, with one unit of SOD activity defined as the amount needed to inhibit xanthine oxidation by 50 % under assay conditions.

Funding source

The research is supported by an external grant from Sandooq Al Watan organization, UAE.

Project ID: PRJ-SWARD-711.

Grant NO: SWARD-F23-020.

Data availability statement

All sequencing data generated form this study have been made publicly available and have been deposited into Genbank (accession numbers have been assigned to each sequence within the supplementary table).

CRediT authorship contribution statement

Walaa K. Mousa: Writing – review & editing, Writing – original draft, Supervision, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Rose Ghemrawi: Writing – review & editing, Methodology, Formal analysis. Tareq Abu-Izneid: Writing – review & editing, Methodology. Najwa Al Ramadan: Writing – review & editing, Methodology. Fatima Al Sheebani: Writing – review & editing, Methodology.

Declaration of competing interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:Walaa Mousa reports financial support was provided by Sandooq Al Watan. Walaa Mousa reports a relationship with Sandooq Al Watan that includes: funding grants. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following is the Supplementary data to this article:Multimedia component 1

Multimedia component 1

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e36548.
==== Refs
References

1 Malhi Y. Franklin J. Seddon N. Solan M. Turner M.G. Field C.B. Knowlton N. Climate change and ecosystems: threats, opportunities and solutions Phil. Trans. Biol. Sci. 375 1794 2020 20190104
2 Matthews T.K.R. Wilby R.L. Murphy C. Communicating the deadly consequences of global warming for human heat stress Proc. Natl. Acad. Sci. USA 114 15 2017 3861 3866 28348220
3 Forster P.M. Smith C.J. Walsh T. Lamb W.F. Lamboll R. Hauser M. Ribes A. Rosen D. Gillett N. Palmer M.D. Rogelj J. von Schuckmann K. Seneviratne S.I. Trewin B. Zhang X. Allen M. Andrew R. Birt A. Borger A. Boyer T. Broersma J.A. Cheng L. Dentener F. Friedlingstein P. Gutiérrez J.M. Gütschow J. Hall B. Ishii M. Jenkins S. Lan X. Lee J.Y. Morice C. Kadow C. Kennedy J. Killick R. Minx J.C. Naik V. Peters G.P. Pirani A. Pongratz J. Schleussner C.F. Szopa S. Thorne P. Rohde R. Rojas Corradi M. Schumacher D. Vose R. Zickfeld K. Masson-Delmotte V. Zhai P. Indicators of Global Climate Change 2022: annual update of large-scale indicators of the state of the climate system and human influence Earth Syst. Sci. Data 15 6 2023 2295 2327
4 Ajilogba C.F. Walker S. Modeling climate change impact on dryland wheat production for increased crop yield in the Free State, South Africa, using GCM projections and the DSSAT model Front. Environ. Sci. 11 2023
5 Ahmed M. Hayat R. Ahmad M. Ul-Hassan M. Kheir A.M.S. Ul-Hassan F. Ur-Rehman M.H. Shaheen F.A. Raza M.A. Ahmad S. Impact of climate change on dryland agricultural systems: a review of current status, potentials, and further work need Int. J. Plant Prod. 16 3 2022 341 363 35614974
6 Zhao C. Liu B. Piao S. Wang X. Lobell D.B. Huang Y. Huang M. Yao Y. Bassu S. Ciais P. Durand J.-L. Elliott J. Ewert F. Janssens I.A. Li T. Lin E. Liu Q. Martre P. Müller C. Peng S. Peñuelas J. Ruane A.C. Wallach D. Wang T. Wu D. Liu Z. Zhu Y. Zhu Z. Asseng S. Temperature increase reduces global yields of major crops in four independent estimates Proc. Natl. Acad. Sci. USA 114 35 2017 9326 9331 28811375
7 Bita C.E. Gerats T. Plant tolerance to high temperature in a changing environment: scientific fundamentals and production of heat stress-tolerant crops Front. Plant Sci. 4 2013 273 23914193
8 Goswami M. Suresh D. Plant growth-promoting rhizobacteria—alleviators of abiotic stresses in soil: a review Pedosphere 30 1 2020 40 61
9 Zhao C. Liu B. Piao S. Wang X. Lobell D.B. Huang Y. Huang M. Yao Y. Bassu S. Ciais P. Temperature increase reduces global yields of major crops in four independent estimates Proc. Natl. Acad. Sci. USA 114 35 2017 9326 9331 28811375
10 Kumar P. Singh S. Pranaw K. Kumar S. Singh B. Poria V. Bioinoculants as mitigators of multiple stresses: a ray of hope for agriculture in the darkness of climate change Heliyon 8 11 2022 e11269
11 McCarthy J.J. Climate Change 2001: Impacts, Adaptation, and Vulnerability: Contribution of Working Group II to the Third Assessment Report of the Intergovernmental Panel on Climate Change vol. 2 2001 Cambridge University Press
12 Ortiz R. Sayre K.D. Govaerts B. Gupta R. Subbarao G. Ban T. Hodson D. Dixon J.M. Ortiz-Monasterio J.I. Reynolds M. Climate change: can wheat beat the heat? Agric. Ecosyst. Environ. 126 1–2 2008 46 58
13 Singh A. Mazahar S. Chapadgaonkar S.S. Giri P. Shourie A. Phyto-microbiome to mitigate abiotic stress in crop plants Front. Microbiol. 14 2023 1210890
14 Alsharif W. Saad M.M. Hirt H. Desert microbes for boosting sustainable agriculture in extreme environments Front. Microbiol. 11 2020 496411
15 Compant S. Samad A. Faist H. Sessitsch A. A review on the plant microbiome: ecology, functions, and emerging trends in microbial application J. Adv. Res. 19 2019 29 37 31341667
16 Khan N. Ali S. Shahid M.A. Mustafa A. Sayyed R. Curá J.A. Insights into the interactions among roots, rhizosphere, and rhizobacteria for improving plant growth and tolerance to abiotic stresses: a review Cells 10 6 2021 1551 34205352
17 Coleine C. Delgado-Baquerizo M. DiRuggiero J. Guirado E. Harfouche A.L. Perez-Fernandez C. Singh B.K. Selbmann L. Egidi E. Dryland microbiomes reveal community adaptations to desertification and climate change ISME J. 18 1 2024 wrae056
18 Tracanna V. Ossowicki A. Petrus M. Overduin S. Terlouw B. Lund G. Robinson S. Warris S. Schijlen E. van Wezel G. Dissecting disease-suppressive rhizosphere microbiomes by functional amplicon sequencing and 10× metagenomics mSystems 6 15 2021
19 Mousa W.K. Abu-Izneid T. Salah-Tantawy A. High-throughput sequencing reveals the structure and metabolic resilience of desert microbiome confronting climate change Front. Plant Sci. 15 2024
20 McClure R. Naylor D. Farris Y. Davison M. Fansler S.J. Hofmockel K.S. Jansson J.K. Development and analysis of a stable, reduced complexity model soil microbiome Front. Microbiol. 11 2020 1987 32983014
21 Zengler K. Hofmockel K. Baliga N.S. Behie S.W. Bernstein H.C. Brown J.B. Dinneny J.R. Floge S.A. Forry S.P. Hess M. EcoFABs: advancing microbiome science through standardized fabricated ecosystems Nat. Methods 16 7 2019 567 571 31227812
22 Großkopf T. Soyer O.S. Synthetic microbial communities Curr. Opin. Microbiol. 18 2014 72 77 24632350
23 Wei Z. Yang T. Friman V.-P. Xu Y. Shen Q. Jousset A. Trophic network architecture of root-associated bacterial communities determines pathogen invasion and plant health Nat. Commun. 6 1 2015 8413 26400552
24 Khan N. Bano A. Rahman M.A. Guo J. Kang Z. Babar M.A. Comparative physiological and metabolic analysis reveals a complex mechanism involved in drought tolerance in chickpea (Cicer arietinum L.) induced by PGPR and PGRs Sci. Rep. 9 1 2019 2097 30765803
25 Yang N. Nesme J. Røder H.L. Li X. Zuo Z. Petersen M. Burmølle M. Sørensen S.J. Emergent bacterial community properties induce enhanced drought tolerance in Arabidopsis npj Biofilms and Microbiomes 7 1 2021 82 34795326
26 Bairey E. Kelsic E.D. Kishony R. High-order species interactions shape ecosystem diversity Nat. Commun. 7 1 2016 12285
27 Chaiya L. Gavinlertvatana P. Teaumroong N. Pathom-Aree W. Chaiyasen A. Sungthong R. Lumyong S. Enhancing Teak (Tectona grandis) seedling growth by rhizosphere microbes: a sustainable way to optimize agroforestry Microorganisms 9 9 2021 1990 34576884
28 Berendsen R.L. Vismans G. Yu K. Song Y. de Jonge R. Burgman W.P. Burmølle M. Herschend J. Bakker P.A. Pieterse C.M. Disease-induced assemblage of a plant-beneficial bacterial consortium ISME J. 12 6 2018 1496 1507 29520025
29 Goswami S.K. Kashyap P. Awasthi S. Deciphering rhizosphere microbiome for the development of novel bacterial consortium and its evaluation for salt stress management in solanaceous crops in India Indian Phytopathol. 72 2019 479 488
30 Wang C.-J. Yang W. Wang C. Gu C. Niu D.-D. Liu H.-X. Wang Y.-P. Guo J.-H. Induction of drought tolerance in cucumber plants by a consortium of three plant growth-promoting rhizobacterium strains PLoS One 7 12 2012 e52565
31 Saikia J. Sarma R.K. Dhandia R. Yadav A. Bharali R. Gupta V.K. Saikia R. Alleviation of drought stress in pulse crops with ACC deaminase producing rhizobacteria isolated from acidic soil of Northeast India Sci. Rep. 8 1 2018 3560 29476114
32 Coombs J.T. Franco C.M. Isolation and identification of actinobacteria from surface-sterilized wheat roots Appl. Environ. Microbiol. 69 9 2003 5603 5608 12957950
33 Szkop M. Sikora P. Orzechowski S. A novel, simple, and sensitive colorimetric method to determine aromatic amino acid aminotransferase activity using the Salkowski reagent Folia Microbiol. 57 1 2012 1 4 22130693
34 Fykse E.M. Olsen J.S. Skogan G. Application of sonication to release DNA from Bacillus cereus for quantitative detection by real-time PCR J. Microbiol. Methods 55 1 2003 1 10 14499990
35 Johnston-Monje D. Raizada M.N. Conservation and diversity of seed associated endophytes in Zea across boundaries of evolution, ethnography and ecology PLoS One 6 6 2011 e20396
36 Arora N.K. Verma M. Modified microplate method for rapid and efficient estimation of siderophore produced by bacteria Biotechenology 7 6 2017 381
37 Honma M. Shimomura T. Metabolism of 1-aminocyclopropane-1-carboxylic acid Agric. Biol. Chem. 42 10 1978 1825 1831
38 Allkja J. Bjarnsholt T. Coenye T. Cos P. Fallarero A. Harrison J.J. Lopes S.P. Oliver A. Pereira M.O. Ramage G. Shirtliff M.E. Stoodley P. Webb J.S. Zaat S.A.J. Goeres D.M. Azevedo N.F. Minimum information guideline for spectrophotometric and fluorometric methods to assess biofilm formation in microplates Biofilm 2 2020 100010
39 Manucharova N.A. The microbial destruction of chitin, pectin, and cellulose in soils Eurasian Soil Sci. 42 13 2009 1526 1532
4 Irabor A. Mmbaga M. Evaluation of selected bacterial endophytes for biocontrol potential against phytophthora blight of bell pepper (capsicum annuum L.) J. Plant Pathol. Microbiol. 8 28 2017 424 10.4172/2157-7471.1000424 Page 2 of 7 Volume 8• Issue 10• 1000424 J Plant Pathol Microbiol, an open access journal ISSN: 2157-7471 plant tissues [18, 26, 27] and endophytes may provide valuable natural resources. Endophytes are fungi and/or bacteria which asymptomatically inhabit the internal tissues of plants
41 Tsolakidou M.-D. Stringlis I.A. Fanega-Sleziak N. Papageorgiou S. Tsalakou A. Pantelides I.S. Rhizosphere-enriched microbes as a pool to design synthetic communities for reproducible beneficial outputs FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Ecol. 95 10 2019 fiz138
42 Félix-Valencia P. Fuentes-Dávila G. Torres-Cruz M.M. Ortiz-Enríquez J.E. Padilla-Valenzuela I. Effect of temperature on productivity of common bean (Phaseolus vulgaris L.) sown during the fall in southern Sonora, Mexico World Journal of Advanced Research and Reviews 16 2 2022 1037 1047
43 Kaymakanova M. Effect of salinity on germination and seed physiology in bean (Phaseolus vulgaris L.) Biotechnol. Biotechnol. Equip. 23 sup1 2009 326 329
44 Hakata M. Wada H. Masumoto-Kubo C. Tanaka R. Sato H. Morita S. Development of a new heat tolerance assay system for rice spikelet sterility Plant Methods 13 1 2017 34 28491121
45 Marchin R.M. Ossola A. Leishman M.R. Ellsworth D.S. A simple method for simulating drought effects on plants Front. Plant Sci. 10 2020
46 Nakamura C. Takenaka S. Nitta M. Yamamoto M. Kawazoe T. Ono S. Takenaka M. Inoue K. Takenaka S. Kawai S. High sensitivity of roots to salt stress as revealed by novel tip bioassay in wheat seedlings Biotechnol. Biotechnol. Equip. 35 1 2021 238 246
47 Cruz de Carvalho M.H. Drought stress and reactive oxygen species: production, scavenging and signaling Plant Signal. Behav. 3 3 2008 156 165 19513210
48 Xu W. Miao Y. Kong J. Lindsey K. Zhang X. Min L. ROS signaling and its involvement in abiotic stress with emphasis on heat stress-driven anther sterility in plants Crop and Environment 3 2 2024 65 74
