
==== Front
STAR Protoc
STAR Protoc
STAR Protocols
2666-1667
Elsevier

S2666-1667(24)00349-6
10.1016/j.xpro.2024.103184
103184
Protocol
Protocol for generation of CRISPR-Cas9-mediated specific genomic insertion of P2A-Gal4 to reveal endogenous gene expression in Drosophila
Chen Limin 12218384@zju.edu.cn
23∗
Qiao Benjiang 1
Li Hong 1
Zhang Pumin 12
Li Qiaoran qiaoran.li@zju.edu.cn
14∗∗
1 Zhejiang Provincial Key Laboratory of Pancreatic Diseases, The First Affiliated Hospital of Zhejiang, University School of Medicine, Hangzhou, Zhejiang 310003, China
2 The Institute of Translational Medicine, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310003, China
∗ Corresponding author 12218384@zju.edu.cn
∗∗ Corresponding author qiaoran.li@zju.edu.cn
3 Technical contact

4 Lead contact

22 8 2024
20 9 2024
22 8 2024
5 3 103184© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Summary

Generating a transgene with a reporter inserted into the genome helps us study endogenous gene expression patterns in model organisms. Here, using Drosophila melanogaster, we present a protocol for generating a P2A-Gal4 insertion through CRISPR-Cas9-mediated homology recombination. We describe the design strategy, steps for constructing the injection plasmids, and the fly-cross scheme for screening the transformants from the G0 generation. This protocol can also be applied to introduce mutations or various genetic tools into the fly genome.

For complete details on the use and execution of this protocol, please refer to Li et al.1

Graphical abstract

Highlights

• Strategies for generating P2A-Gal4 insertions into genes of interest

• In-Fusion molecular cloning technique for donor plasmid and pU6 plasmid construction

• Fly crossing scheme for obtaining potential transformants from the G0 generation of flies

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Generating a transgene with a reporter inserted into the genome helps us study endogenous gene expression patterns in model organisms. Here, using Drosophila melanogaster, we present a protocol for generating a P2A-Gal4 insertion through CRISPR-Cas9-mediated homology recombination. We describe the design strategy, steps for constructing the injection plasmids, and the fly cross scheme for screening the transformants from the G0 generation. This protocol can also be applied to introduce mutations or various genetic tools into the fly genome.

Subject areas

Model Organisms
CRISPR
Neuroscience
==== Body
pmcBefore you begin

To explore the biological function of a gene of interest, it usually begins with examining its expression pattern in vivo. This can be done with immunostaining or in situ hybridization, both of which may not be applicable due to various reasons, such as a shortage of specific antibodies or a lack of mutant animals to use as a negative control for more convincing results. Generating a transgenic line with a reporter inserted in the potential genomic locus is a viable alternative. The protocol below describes the specific steps for generating a P2A-Gal4 insertion in flies using the CRISPR-Cas9 mediated homology ends-out recombination method.2,3 The P2A-GAL4 is a self-cleaving Gal4 protein,4 if the fragment is inserted at the C-terminus of the gene of interest, the transgene retains the endogenous gene function, and the synchronized translation of the Gal4 protein will enable the expression of a GAL4/USA-driven fluorescent reporter such as GFP, revealing the expression pattern of the targeted gene.5 This strategy can also be applied to introduce a mutant allele or to insert other genetic tools with modified donor plasmids and Cas9 targeting sequences. In our associated research paper,1 we used this protocol to generate the fa2hPGal4 strain (refer as fa2hP2AGal4 in this paper) to reveal the fa2h gene expression by taking advantage of the augmentation effect of the binary GAL4/UAS system. In addition, by inserting a mini-white marker replacing the fa2h gene coding region, we generated the fa2hw+ strain as a mutant allele. Similar protocols have been used in our previously reported work to generate strains such as tmem63PGal4 to reveal the targeted gene expression at cellular level,6 and the rh5LexA mutant allele.7

Construction strategy for knock-in a reporter fragment in the fly genome

Timing: 1 h

This section describes the outline for construction strategy with the goal to insert a P2AGal4 reporter into the gene locus using the CRISPR-Cas9 mediated ends-out homology recombination mechanism.1. Construction strategy and selection of vector backbones.a. For the donor plasmid, pw35P2AGal4 is used as the backbone vector.Note: To insert the reporter P2A-Gal4 into the C terminus of the gene of interest, we will need to construct a donor plasmid in which P2A-Gal4 is flanked by sequences homologous to the gene of interest (Figure 1).

Note: pw35P2AGal4 contains the P2AGal4 fragment and a mini white cassette as a transgene screening maker; additionally, there are multiple cloning sites at terminal of these two cassettes for molecular cloning manipulation.

Note: pw35P2AGal4 was modified from pw35Gal4 (Addgene: #25901) by inserting the 57 bp P2A sequence before the Gal4 fragment.

Alternatives: Other backbones, for example, the pBPGAL4.2::p65Uw (Addgene: #26229) plasmid can also be used for the same purpose.

Alternatives: The reporter tool to be inserted into the genome can be replaced with driver of other binary systems such as P2A-LexA or P2A-QF, or GPF tag and Flag tag fused with the Open Reading Frame of the gene of interest. The reporter gene for transgene screening can be replaced with other tools, such as the P3-DsRed8 which express red fluorescent protein in fly eye.

Figure 1 Schematic illustration of the strategy for generating a transgene targeting the gene of interest

b. For the expression of single-guide RNA, pU6_3-BbsI-chiRNA is used as the vector, which utilizes the snRNA:U6:96Ab promoter specific to Drosophila.

c. For the expression of Cas9, Cas9-transgenic lines is used as the injection flies.Note: There are several lines available in public, such as the expression of Cas9 driven by a germline promoter: nanos-Cas9 and vas-Cas9. Those strains usually will be offered by the embryo injection services, the details are described below.

2. Select the gene of interest and prepare the SnapGene file.a. Download the extended gene sequence of the gene of interest from the public online database, such as the Flybase (https://flybase.org/) or NCBI (https://www.ncbi.nlm.nih.gov).

b. Search fa2h in Flybase.

c. On the webpage for fa2h, navigate to Genomic location > Sequence > Gene sequence, Select “extended gene region” > then click on “Get sequence” > and download the FASTA file.

d. Create a SnapGene file for the extended fa2h gene sequence.i. Open the software>Click on New DNA File> paste the entire sequence into the blank dialog box>set the file name and click OK.

ii. Manually add features of the 5′UTR, 3′UTR, and exon regions if needed by using the sequence alignment tool.

iii. Go to Tool>align sequences>copy the sequence of UTR etc which can be found from drop down box of the Gene sequence used in step c above (Figure 2A).Figure 2 An example for pre-selecting the CRISPER sites for fa2h gene

(A) SnapGene screenshot of the CRISPR sites found around the C terminal of fa2h. The gene structure of fa2h and the 5 20 nt single guide RNA sequences targeted sites were featured manually using SnapGene software.

(B) Screenshot of evaluation of the potential off-target cleavage sites using the online resources the FLYCRISPR.org.

Note: To design the homology arm effectively, it should be between 0.8 to 1.5 kb in length. Therefore, it is necessary to download the gene sequence extended by 1∼2 kb from the 3′ end to design primers for the homology right arm.

3. Find the single guide RNA (sgRNA) targeting sequences.a. Use online resources to find the Cas9 target sequence, such as (https://shigen.nig.ac.jp/fly/nigfly/cas9/cas9TargetFinder.jsp) and (https://flycrispr.org/target-finder/).

b. Paste the DNA sequence of approximately 200 nt spanning the C terminal of fa2h into the Cas9 target finder. Click “search” and to obtain several sequences that match the 5‘-GNNNNNNNNNNNNNNNNNNNNGG-3’ pattern.Note: In the case of fa2h, there are 5 sgRNA targeting sequences around the C terminal (Figure 2A).

c. Use the flycrisper to evaluate the potential off-target cleavage sites. Use the link (http://targetfinder.flycrispr.neuro.brown.edu) (Figure 2B).Note: The best CRISPR target have no potential off-target matches elsewhere in the genome.

d. Select the 5′ sgRNA target (sgRNA-1) that is closest to the TAG stop codon of fa2h.Note: This may not always be the case for other genes.

e. Select the second sgRNA target (sgRNA-2) around 100–200 bp downstream of the first one (Figure 3A).Note: In order to insert the P2A-GAL4 fragment into the C terminal of fa2h gene, we design to break the DNA by using two Cas9 targets, the sequence between them will be deleted from the genome. The deleted region is 3′ UTR which may not affect the synchronized translation of P2AGAL4, need further check if there is any impact. In addition, one sgRNA may also work.

Note: Choose the 5′ sgRNA targets as close as possible to the locus where the P2A-GAL4 DNA fragment is planned to be inserted. They should be no more than 10 bp apart, or it may lower the efficiency of recombination.

Alternatives: More websites for Cas9 target finder http://crisprflydesign.org.

Figure 3 Primer design strategy for PCR amplifying the homology arms to insert into donor vector

(A) SnapGene screenshot of the two pairs of primers for PCR amplifying the left and right homology arms from genomic DNA. The TAG stop codon is indicated by a red arrow. The reverse primer for the left arm is shown with its end aligned to the base prior to TAG stop codon.

(B) The locus on the donor plasmid of pw35P2AGal4 where the two homology arms are designed to be inserted is shown, pointed by the red arrows.

(C) An example of primer design for PCR amplifying the left arm, the primers consist of the overlapping ends for in-fusion and the sequence for annealing during PCR process.

Primer design

Timing: 30 min

This section describes how to design primers to be used in the following cloning experiments using the In-Fusion cloning method (see https://www.snapgene.com/guides/in-fusion-cloning) which takes one step for the seamless gene fusions. It requires a 15 base pair overlaps between the fragments to create a clone.4. Design the primers for amplifying the homology arms and the pU6 vector.a. Primers for amplifying the homology arms consists of two parts, part I is a 20-24 nt sequence for PCR, part II is a 5′ 15 nt overlapping sequence for in-fusion the PCR fragments into the vectors (Figures 3A–3C).i. The arms are approximately 800 bp to 2 kb in length, design two pairs of primers for right and left arms. They are shown in the fa2h gene map.CRITICAL: The reverse primer of left arm should start from the base before TAG stop codon to ensure the inserted P2A-GAL4 will be translated along with the fa2h gene (Figure 3A).

ii. The two arms are planned to be inserted into the vector pw35P2AGal4 one by one. First linearized the vector with BamHI where the left arm is inserted, the f and r sequences for in-fusion are shown in the map. Next insert right arm at NotI site (Figure 3B).Note: Check if there are additional NotI site in the vector with the left arm fragment inserted, or change to a new restriction site.

iii. Take the primers for PCR left arm as an example. Combine f with left arm F sequences as the forward primers, and combine r sequence with left arm R sequence as the reverse primer (Figure 3C).

b. Primers for amplifying the sgRNA expressing pU6 plasmids consists of two parts, part I is a 24 nt sequence for amplifying the whole circle of the pU6 plasmid and part II is a 20 nt sequence overlapping sequence specific to sgRNA (Figures 4A and 4B).i. Use pU6-f and pU6-r primers shown in the map to PCR amplify the circle of pU6 vector (Figure 4A).

ii. Take the CRISPR site for sgRNA-1 as an example, the f and r sequences are shown. Combine f with pU6-f as the forward primer and r with pU6-r as the reverse primer (Figure 4B).CRITICAL: Ensure that the CRISPR site sequence for the sgRNA in the primer is in the correct 5′-3′ orientation.

Figure 4 Primer design strategy for constructing the sgRNA expressing pU6 plasmids

(A) SnapGene screenshot of the map of the pU6 plasmid with the primer sequences for inverse PCR amplification of the plasmid.

(B) An example of primer design for PCR amplifying the circular DNA of the pU6 vector, CRISPR site sequence for sgRNA-1 is shown, the primers consist of the overlapping ends for in-fusion which is the same sequence as CRISPR site, and the sequence for annealing during the PCR process.

5. Schematic illustration of the strategy for generation of fa2hP2AGal4 is shown (Figure 5A).Figure 5 Schematic illustration of the strategy for generation of fa2hP2AGal4 by homology recombination

Fly culture

Timing: 10 min flip work followed by 10 days of incubation

6. Prepare w1118 flies with mutated white eye color for the following crosses.a. Flip one bottle (contain fly culture medium) of adult w1118 flies to obtain virgin females for the next generation.

b. Culture the flies at incubator with temperature set at 25°C. It takes 10–15 days to complete one generation of flies.

Note: Coordinate the timing of flipping the flies, ensure there are enough virgins to cross with the enclosed G0 flies (the microinjected flies).

Alternatives: Flies with eye color mutated to white color should all work to be used as a background strain, because we use the mini-white to express the red pigment in the fly eye as a screening marker for successful transgene insertion.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Bacterial and virus strains	
	
Trans 5α competent cell	TransGen Biotech	N/A	
	
Chemicals, peptides, and recombinant proteins	
	
Sodium chloride	Sinopharm	Cat # 10019318	
Ethanol	Sinopharm	Cat # 10009218	
Yeast extract	Oxoid	Cat # LP0021B-500g	
Tryptone	Oxoid	Cat # LP0042B-500g	
Agar	Biosharp	Cat # BS195-500g	
p-Hydroxybenzoic acid methyl ester	BBI	Cat # A601186-0100	
Sodium benzoate	BBI	Cat # A600833-0500	
Propanoic acid	BBI	Cat # A601757-0500	
Ampicillin, sodium salt	Solarbio	Cat # A8180	
Proteinase K	Beyotime	Cat # ST532	
PrimeSTAR Max DNA polymerase	Takara	Cat #R045Q	
BamHI	New England Biolabs	Cat #R3136	
pspXI	New England Biolabs	Cat # R0656S	
DNA Maker 10000	Accurate Biology	Cat # AG11909	
DNA Maker 2000	Accurate Biology	Cat # AG11904	
Agarose	Yeasen	Cat # 10208ES60	
GoodView Nucleic acid stain	SBS Genetech Co., Ltd.	Cat # HGV-2	
Aluminum foil	Wohler	N/A	
	
Critical commercial assays	
	
E.Z.N.A Plasmid Mini Kit	Omega	Cat #D6943-02 200 PREPS	
E.Z.N.A Gel Extraction Kit	Omega	Cat #D2500-02 200 PREPS	
E.Z.N.A Insect DNA Kit	Omega	Cat #D0926-01 50 PREPS	
CloneExpress II One Step Cloning Kit	Vazyme	Cat #C112-01	
Embryo injection services	National Drosophila Resource Center of China, NDRCC; http://ndrcc.sibcb.ac.cn/ndrcc/jishu.jsp	N/A	
	
Experimental models: Organisms/strains	
	
w1118	Bloomington Drosophila Stock Center	Cat # BL5905	
nanos-Cas9	Bloomington Drosophila Stock Center	Cat # BL78782	
	
Oligonucleotides	
	
Fa2h P2A_up BamHI f.: TATCCCTAGGGG
ATCCGCCTTCGAGTCTCCCATCACG	This paper	N/A	
Fa2h P2A_up BamHI r.: CGGTACCGGATC
CGGACCAGCGCAGTTGGTATCT	This paper	N/A	
Fa2h 2A_down pspXI f.: CCTAGTACCCTCGA
GAGGCTGAATACTGAGCATTAGGCT	This paper	N/A	
Fa2h P2A_down pspXI r.: CACGTCGCACTC
GAGGGCTTGCAGACGACTGATCCA	This paper	N/A	
Fa2h_gRNA_1 f-1.: GCAGCTAGGACCAGC
GCAGTGTTTTAGAGCTAGAAATAGCAA	This paper	N/A	
Fa2h_gRNA_1 r-1.: ACTGCGCTGGTCCTAGC
TGCCCGACGTTAAATTGAAAATAG	This paper	N/A	
Fa2h_gRNA_2 f-1.: GGTTTTTAGCCTATTTGTG
TGTTTTAGAGCTAGAAATAGCAA	This paper	N/A	
Fa2h_gRNA_2 r-1.: ACACAAATAGGCTA
AAAACCCCGACGTTAAATTGAAAATAG	This paper	N/A	
P1 f.: CTATGCACCTTCCACTTCATGAT	This paper	N/A	
P1 r.: GAGCACTTGAGCTTTTTAAGTCG	This paper	N/A	
P2 f.: CTATGCACCTTCCACTTCATGAT	This paper	N/A	
P2 r.: AGTAGCACTGTATTAGCCATTTATT	This paper	N/A	
pW35-K1: GAGCACTTGAGCTTTTTAAGTCG	This paper	N/A	
pW35-Not: CGTCGGCAAGAGACATCCAC	This paper	N/A	
SK primer: GATCCCCGGGCGAGCTC	This paper	N/A	
KS primer CGAGGTCGACGGTATCG	This paper	N/A	
	
Recombinant DNA	
	
pw35P2AGAL4	Modified from pw35Gal4 (plasmid #25901)	N/A	
pU6_3-BbsI-chiRNA	Addgene (plasmid #45946)	N/A	
pBPLexA_p65Uw (optional donor vector)	Addgene (plasmid #26231)	N/A	
	
Software and algorithms	
	
SnapGene	https://www.snapgene.com	N/A	
	
Other	
	
T100 thermal cycler	Bio-Rad	Cat # 1861096	
Ultra low volume spectrometer-BioDrop Duo	BioDrop	N/A	
CO2 porous polyethylene gas diffuser	Disconovo	Cat # GY2101	
ChemiDoc MP Imaging System	Bio-Rad	Cat # 12003154	
Agarose electrophoresis bath	Liuyi	N/A	
Bistable electrophoresis power supply DYY-6C	Liuyi	N/A	
Benchtop Flowbuddy flow regulator	Genesee Scientific	Cat # 59-122BCU	
Triocular continuous ploidy microscope WYT-AT	Viyee	N/A	
Pipette tips	Thermo Scientific	Cat # 112XL-Q	
Sterile spreader stick (Pasteur pipette)	Biosharp	BS-XG-03L	

Materials and equipment

Fly food preparation

We use standard cornmeal as fly food.

The materials for 4 L of food are as follows.Reagent	Amount	
Yeast	100 g	
Soy flour	36.72 g	
Corn flour	267.3 g	
Agar	24 g	
Syrup	280 mL	
P-Hydroxybenzoic acid methyl ester	1 g	
Sodium benzoate	4 g	
Propionic acid	25 mL	
ddH2O	Up to 4 L	
Prepare fly food in advance and store it at 4°C for maximum of two weeks.

CRITICAL: Pure propionic acid is corrosive to the skin and eyes.

Note: Dissolve 1 g of p-Hydroxybenzoic acid methyl ester in 10 mL of absolute ethanol in advance.

Note: Preservatives and propionic acid need to be added when the food temperature is cooled to 50°C to avoid volatilization of absolute ethanol resulting in preservative precipitation.

Note: Stir the food at all times when heating and adding preservatives.

Luria-Bertani medium

The materials for 1 L of LB liquid medium are as follow.Reagent	Amount	
Tryptone	10 g	
NaCI	10 g	
Yeast extract	5 g	
ddH2O	Up to 1 L	
Autoclave the medium to sterilize it, then store it at 4°C. Add 15 g of agar to the recipe to prepare 1 L of LB solid medium.

Note: Add antibiotics in the medium when its temperature drops to about 50°C–60°C after autoclaving to prepare a selective medium. Shake the media thoroughly, and the final concentration of antibiotic is 100 μg/mL.

Note: Store the solid plate inverted at 4°C, and store the liquid medium in flasks or bottles with the bottleneck wrapped with aluminum foil.

Squishing buffer

Prepare a total volume of 50 mL. The final concentration of materials for a fresh squishing buffer is as follow.Reagent	Final concentration	
Tris (PH 8.0)	10 mM	
NaCI	25 mM	
EDTA	1 mM	
Proteinase K	100 μg/mL	
Prepare the solution by mixing all components except for the Proteinase K, and store at 4°C.

Add Proteinase K to the squishing buffer (SB) to reach a final concentration of 100 μg/mL from the 200× stock solution (20 mg/mL) before use.

Note: Proteinase K stock solution should be stored at −20°C.

Step-by-step method details

Construction of the donor plasmid and pU6 plasmids

Timing: 3 days

This section describes how to perform molecular cloning experiments to obtain the donor plasmids and pU6 plasmids needed for the subsequent fly embryo injection.1. Linearize the vector pw35P2AGal4 by restriction enzyme digestion for inserting the homology left arm.a. Prepare the ice box and place the restriction enzyme BamHI on ice.

b. Add the reagents for the reaction into the tube in the order of from the largest to the smallest volumes (see Table 1: Restriction enzyme digestion mix table below).Note: The BamHI should be the last component added to the reaction mix.

i. Mix thoroughly by pipetting or by gently “flicking” the reaction tube.Note: Do not vortex the reaction.

ii. Briefly centrifuge to make all the liquid stay in the bottom of the tube.

Table 1 Restriction enzyme digestion mix

Reagent	Amount	
Vector pw35P2AGAL4 (500 ng/μL)	1 μg	
Restriction Enzyme	1 μL	
CutSmart Buffer (10×)	5 μL	
ddH2O	Up to 50 μL	

c. Incubate the tube at 37°C for 2–3 h.Note: Keep the restriction enzymes on ice during the experiment.

2. Prepare the fly genomic DNA from 20 w1118 adult flies using the E.Z.N.A Insect DNA Kit.a. See the link for this protocol http://www.omegabiotek.com.cn/vancheerfile/files/2020/10/20201009013829503.pdf.

Note: The genomic DNA can be stored at −20°C for at least half a year.

3. PCR amplifying fragments of arms for donor plasmids and perform inverse PCR to amplify the entire sequence of pU6 plasmids, the PCR reaction master mix and cycling conditions are shown below (see Tables 2, 3, 4, and 5).Table 2 PCR reaction master mix for amplifying arms from fly genome DNA

Reagent	Amount	Final concentration	
Genomic DNA of flies (200 ng/μL)	1 μL	<200 ng	
PrimeSTAR Max Premix (2×)	25 μL	1×	
Fa2h P2A_up BamHI f. (10 μM)	2 μL	0.4 μM	
Fa2h P2A_up BamHI r. (10 μM)	2 μL	0.4 μM	
ddH2O	20 μL	Up to 50 μL	

Table 3 PCR cycling conditions for arms

Steps	Temperature	Time	Cycles	
Initial Denaturation	98°C	3 min	1	
Denaturation	98°C	10 s	35 cycles	
Annealing	55°C	15 s	
Extension	72°C	30 s	
Final extension	72°C	5 min	1	
Hold	4°C	forever	

Table 4 PCR reaction master mix for amplifying circular fragment of pU6 plasmids

Reagent	Amount	Final concentration	
pU6_3-BbsI-chiRNA (200 ng/μL)	1 μL	<200 ng	
PrimeSTAR Max Premix (2×)	25 μL	1×	
Fa2h_gRNA_1 f-1. (10 μM)	2 μL	0.4 μM	
Fa2h_gRNA_1 r-1. (10 μM)	2 μL	0.4 μM	
ddH2O	20 μL	Up to 50 μL	

Table 5 PCR cycling conditions for circular fragment of pU6 plasmids

Steps	Temperature	Time	Cycles	
Initial Denaturation	98°C	3 min	1	
Denaturation	98°C	10 s	35 cycles	
Annealing	55°C	15 s	
Extension	72°C	60 s	
Final extension	72°C	5 min	1	
Hold	4°C	forever	

4. Run a 1% agarose gel electrophoresis for all the DNA products obtained in steps 1-3, including the linearized vector, PCR products of arms and linearized pU6 plasmids.

5. Cut the gel to isolate the specific band, then extract the DNA fragments using the E.Z.N.A Gel Extraction Kit.

6. Perform the In-Fusion Cloning to ligate the homology arm to the linearized vector, and circulate the PCR fragments of pU6 plasmids respectively.a. Calculate the amount of DNA fragments to be used for in-fusion reaction.Note: The optimal molar concentration of vector and insert for the ClonExpress II recombination reaction system is 0.03 pmol and 0.06 pmol respectively (The molar ratio of vector to insert is 1:2).

Note: Take 1 μL of DNA fragments as the example, the optimal mass amount of vector (0.03 pmol) = [0.02 × number of base pairs of vector] ng. Optimal amount of insert (0.06 pmol) = [0.04 × number of base pairs of insert] ng.

b. Dilute the DNA fragments to the optimal concentration or prepare to add more volumes to reach the total amount of DNA needed.

c. Add the reagents in the tube for a total volume of 10 μL (see In-Fusion mix (Table 6) table below).Table 6 In-Fusion mix

Reagent	Amount	
Linearized vector	1–6 μL	
insertion element	1 μL	
5 × CE II Buffer	2 μL	
Exnase II	1 μL	
ddH2O	Up to 10 μL	

d. Place the tube containing the mixtures at 37°C for 30 min for reaction then cool it to 4°C or place it on ice (Follow the instructions in the In-Fusion Cloning manual, https://www.cellagentech.com/clonexpress-ii-one-step-cloning-kit-c112/).Note: The recombinant product can be stored at −20°C for one week.

Note: To ensure the accuracy of cloning, the linearized vector and the insert can be diluted before preparing the recombination reaction system, and the amount of each component should not be less than 1 μL.

Note: In general, the concentration of the purified linearized vector is lower than that of the insert which was obtained from PCR amplification. Therefore, during the operation, we generally adjust the loading amount of the linearized vector according to reach the concentration needed.

7. Plasmids amplification and purification.a. Add 10 μL of recombinant product to 100 μL of competent E. coli DH5α cells, mix gently by pipetting (do not shake), and place the tube on ice for 30 min.

b. Perform a heat shock at 42°C for 30 s. Then immediately transfer the tube on ice for 2–3 min.

c. Add 500 μL of antibiotic-free lysogeny broth (LB) to the competent cells and shake the tube at 37°C for 1 h (at a speed of 200–250 rpm).

d. Centrifuge at 5,000 rpm (2,400 × g) for 5 min and discard 400 μL of the supernatant. Re-suspend the remaining bacterial solution, and gently spread it onto an LB agar plate containing 100 μg/mL ampicillin using a sterile spreader stick.

e. Invert the plate and incubate in an incubator at 37°C for 12–16 h.Note: The above operations (a-d) should be performed in a sterile environment.

Note: Smaller amounts of reagents for the in-fusion reaction are also applicable depending on the actual efficiency, such as adding 2 μL of recombinant product to 50 μL of competent cells.

f. Select and cultivate a singular colony of bacteria.i. Use the pipette tip to touch the colonies on the plate to obtain individual bacterial samples from each colony, place each tip into 50 mL of LB containing 100 μg/mL ampicillin. Select 5 colonies.

ii. Shake the bacterial culture media at 37°C for 16 h.

g. Extract and purified the plasmids using the E.Z.N.A Plasmid Mini Kit (see protocol in http://www.omegabiotek.com.cn/vancheerfile/files/2020/1/2020010301109740.pdf).

8. Identify the correct plasmids through restriction enzyme digestion and sequencing. Troubleshooting 1.a. The primers for sequencing the left and right homology arm inserted in the pw35P2AGal4 vector is pW35-K1: GAGCACTTGAGCTTTTTAAGTCG and pW35-Not: CGTCGGCAAGAGACATCCAC.

b. The primers for sequencing the insert in pU6 plasmid are SK primer: GATCCCCGGGCGAGCTC or KS primer CGAGGTCGACGGTATCG.

Note: It is necessary to run a gel to confirm that the fused plasmid is the correct size.

Embryo injection

Timing: 8 weeks

This section outlines the procedures for using commercial services for embryo injection to obtain the G0 generation of flies.9. Choose local companies or institutes that offer fly CRISPR embryo injection services. For example, BestGene Inc (http://www.thebestgene.com), and National Drosophila Resource Center of China, NDRCC (http://ndrcc.sibcb.ac.cn/ndrcc/jishu.jsp).a. Choose transgenic Cas9 lines with ubiquitous or germline expression for embryo injection, such as nanos-Cas9, Act5C-Cas9 and vas-Cas9 etc.

10. Ship out the plasmids with at least 1 μg per plasmid, in accordance with the company’s quality requirements.

Note: We typically opt for an additional service to re-extract and purify the plasmids before injection.

11. Wait to receive the G0 adults/larvae, usually with at least 30 live flies per 300 embryo injection. Troubleshooting 2.

Fly-crosses strategy for screening the transformant

Timing: 3–4 weeks

This section outlines the steps to obtain the potential transformants from the G0 generation of flies. Here, we show how we start the experiment from using the Bloomington stock 78782 as the injection line, and the target gene fa2h is located on the second chromosome. So far, we have successfully constructed at least 5 different transgenes by following this protocol without any failure.12. Cross male G0 flies with white eye w1118 virgin females and virgin female G0 flies with male w1118 flies respectively, termed cross 1 and cross 2 (Figure 6).Figure 6 Cross scheme for screening the potential transformants from G0 generation determined by fly eye color

13. Screen the red eye males from offspring of cross 1. They are the G1 flies.

Note: The ratio of red eye males can be estimated at 1–50% from over 1000 offspring flies, depending on the location of the microinjection and the efficiency of gene editing. Troubleshooting 3.

Note: For the case of fa2h, 10 male G0 flies were crossed with 20 virgin female w1118 flies, and we allowed the female flies to lay eggs for two days on fresh fly medium in the bottle and flipped them to the new bottles with fly medium and so on. The red-eye male progenies were emerged on the third bottle of flies, it was estimated to obtain 5 G1 flies from 500 progenies, and there was an increased chance of emerging G1 flies afterwards, however we stop to collect more transformants as we confirmed the genotype of G1 flies during that days, in theory, we only need one correct strain and kept it with the following experiments.

14. Cross individual male G1 flies to w1118 virgin female flies separately in vials to retain their transgene. Number the vials and prepare 3-5 strains for the following PCR genotyping.

CRITICAL: Backcross the successful G1 flies to maternal w1118 female flies for 3–4 generations is required to remove the possible CRISPR/Cas9 off-target editing on the genome.

15. (optional) Collect all the male offspring from cross 2 and cross them with w1118 virgin female flies. Repeat steps 13–14. The ratio of red eye males could be significantly decreased.

Note: The BL78782 Cas9 strain is red eye, use the male G0 to cross will screen out the transformants by their red eye offspring, if use the female G0, it is not applicable, so one more generation of cross is needed (Figure 6).

Alternatives: If using the white eye Cas9 strain such as BL51324 (genotype w1118; vas-Cas9), the transformants can be screened out from the progeny of G0 female flies for one generation, the same as the male G0 flies.

Optional: Screen the transformants from male progeny of G0 females, and this will increase the probability of obtaining a successful transgenic line.

Genotyping for the transformant

Timing: 3 h

16. Extract the raw genomic DNA using the Squishing Buffer rapid protocol (squishing buffer).a. Put individual G1 flies in tubes after making sure that they have their offspring alive. And place the tube on ice to anesthesia the fly.

b. Add 60 μL of Squishing Buffer in the tube and homogenize the fly with 1 mL pipette tips thoroughly for 1 min.

c. Incubate the sample at 55°C for 15 min followed by a chill at 4°C for 5 min.

d. Brief centrifugation at 800 × g for 3 min at 4°C to.

e. Use 1 μL supernatant as the template of genomic DNA.

17. Perform PCR using the genomic DNA as template and run the 1% agarose gel electrophoresis, same as step 2 and 3.a. Two pairs of primers were used for genotyping. P1 f.CTATGCACCTTCCACTTCATGAT, P1 r.GAGCACTTGAGCTTTTTAAGTCG and P2 f.CTATGCACCTTCCACTTCATGAT and P2 r.AGTAGCACTGTATTAGCCATTTATT.

Note: P1 specifically targets the transgene but not the sequence of wild type, and P2 specifically targets the wile type sequence but not in the transgene.

18. Image the gel. Troubleshooting 4.

Note: The fruit flies should be mashed slowly and gently to prevent SB solution from splashing or sticking in the pipette Tips head.

Note: Dilute the proteinase K in 1×PBS to make a 20 mg/mL stock solution and store in small aliquots at −20°C. Add 5 μL of the proteinase K stock solution to 1 mL of SB just before use.

Note: The raw genomic DNA is best used within one day, because the DNA was prepared using the Squishing Buffer rapid protocol and was not purified, it may not be stable and is prone to degradation over time. It is recommended to use the DNA freshly for the genotyping experiment. Alternatively, the experiment can be redone by testing the offspring. (optional) For longer storage at −20°C, the insect DNA kit (same as step 2) can be used to obtain purified genomic DNA, which will require at least 20 flies.

Expected outcomes

Obtain the potential correct individual transgene strain during fly work by screening the offspring of the injected G0 flies. Examples of the red eye transgene strains fa2hP2AGal4 and trpA1EGFP are shown (Figure 7A). The maternal fly was w1118 which has white-colored eyes, the injection strain y1,v1;;nanos-cas9 has orange to red eyes, the heterozygous fa2hP2AGal4 has red eyes, while the heterozygous trpA1EGFP has orange to light red eyes. The eye color of transgenes may vary depending on the mini white gene used, and may also be affected by the insertion location of the transgene in the genome. The trpA1EGFP strain was created using a modified pBPLexA_p65Uw as the donor plasmid (unpublished data), the mini white gene in this vector resulted in a light red eye in the adult transgenic fly, for the homozygous, the eye color will deepen (Figure 7A).Figure 7 Identification of the successful fa2hP2AGal4 and trpA1EGFP transgene strain

(A) Images for the representative male flies of indicated genotype. Scale bar represents 1 mm.

(B) Schematic map of fa2hP2AGal4 transgene and the primers for genotyping are shown.

(C) PCR results for genotyping.

Confirm the genotype of the transgene with PCR results using at least two pairs of primers. For example, for the fa2hP2AGal4 transgene strain, design the P1 or P3 primers that specifically target the transgene sequence and P2 or P4 primers that specifically target the wildtype gene region (Figure 7B). Clear bands with the correct size can be observed on the agarose gel. With the P1 primers, the control shows no band while the fa2hP2AGal4 homozygous or heterozygous transgene display a band size of 518 bp. using the P2 primers, the control shows a band size of 404 bp whereas the fa2hP2AGal4 homozygous transgene does not show a band (Figure 7C).

There are several published protocols that describe CRISPR-Cas9 mediated fly genome editing.9,10,11 Our protocol provides a detailed design strategy, taking advantage of the In-fusion cloning method, this allows for more flexible choices when selecting donor plasmids. Additionally, we provide an example of inserting a P2AGal4 fragment precisely at the C-terminal of the gene of interest which can be used to visualize the endogenous gene expression pattern at the cellular level, especially for genes with low expression levels in vivo.

Limitations

Inserting a transgenic tool using the CRISPR-Cas9 method for fly genomic editing is efficient and successful in our experiments. While it typically takes a minimum of three months to obtain a successful line, however if one fails to acquire the correct transformant, the reason could be varied. There may be a need to change the strategy such as redefining the homology arms or the sgRNA targeted sequence, and then redoing the entire procedure.

Troubleshooting

Problem 1

No correct clones when double check the size of the plasmids with restriction enzyme digestions.

Potential solution

In actual laboratory experimental operations, the restriction enzyme maybe expired or contaminated since it is for public use in a lab, try using another restriction enzyme, making sure to use the correct buffer and follow the instructions no matter which brand it is belongs to. Simulate the results for DNA agarose gel electrophoresis using SnapGene software: open the file of the donor plasmid you intended to construct, here is an example of a donor plasmid for fa2hP2AGal4, in which the two homology arms were inserted into the pw35P2AGal4 vector.

Select Tools>Simulated Agarose Gel>type in the box for the restriction enzyme KpnI>check the simulated results, there will be two bands with sizes of 8107 bp and 7129 bp (see Figure 8A).Figure 8 SnapGene screenshot showing the window for a simulated agarose gel of the donor plasmid for fa2hP2AGal4

Selecting the KpnI restriction enzyme to digest the plasmid results in two bands on the gel.

If the rate of successful clone is very low and one cannot get 1 correct clone from 5 picked colonies, this could due to the linearized vector was reconnected, use two restriction enzymes. Use BamHI and Acc65I to digest the vector, see primer design section step 4a and step-by-step method details section step 1.

Problem 2

No alive G0 flies for the first round of injection or less than 5 alive adult flies.

Potential solution

The plasmids used in this paper are not toxic to embryos. Thus repeat the injection. Usually 10 to 20 adults (males) are enough to generate the transformant in the next generation.

Problem 3

No red eye G1 male flies from the bottles.

Potential solution

Flip the bottles to fully expand all the progeny from G0 flies. The transgene may appear later.

Problem 4

No right size of DNA bands for genotyping or no band.

Potential solution

Sometimes, the primers you selected could not anneal to the raw genomic DNA , in this case, re-prepare the purified genomic DNA using a DNA kit (see step-by-step method details section step 2), use their offspring. Another option is to change to a new pair of primers that specifically target the heterozygous transgene. Usually, the red eye transgene stains that were screened out were all correct when inspected with PCR genotyping. Keep 3 to 10 individual strains, and use the one with correct genotyping results.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Qiaoran Li (qiaoran.li@zju.edu.cn).

Technical contact

For any technical details on conducting the experiments, please contact Limin Chen (12218384@zju.edu.cn).

Materials availability

This study did not generate any unique materials or reagents.

Data and code availability

This study did not generate any unique datasets or code.

Acknowledgments

We thank Prof. Craig Montell for sharing the plasmid reagent and the Core Facility of Drosophila Resource and Technology at CEMCS, CAS for provision of fly stocks and embryo injection services. This work was supported by a startup foundation from the First Affiliated Hospital, 10.13039/501100002928 Zhejiang University School of Medicine and a grant to Q.L. from the 10.13039/100014717 National Natural Science Foundation of China (32200809 ).

Author contributions

L.C., H.L., and Q.L. performed all the experiments, L.C., P.Z., and B.Q. assisted with editing the manuscript text, and Q.L. conceived and planned the experiments and wrote the manuscript. All authors discussed the results and contributed to the final manuscript.

Declaration of interests

The authors declare no competing interests.
==== Refs
References

1 Li Q. Chen L. Yang L. Zhang P. FA2H controls cool temperature sensing through modifying membrane sphingolipids in Drosophila Curr. Biol. 34 2024 997 1009.e6 38359821
2 Cong L. Ran F.A. Cox D. Lin S. Barretto R. Habib N. Hsu P.D. Wu X. Jiang W. Marraffini L.A. Zhang F. Multiplex genome engineering using CRISPR/Cas systems Science 339 2013 819 823 23287718
3 Gong W.J. Golic K.G. Ends-out, or replacement, gene targeting in Drosophila Proc. Natl. Acad. Sci. USA 100 2003 2556 2561 12589026
4 Kim J.H. Lee S.R. Li L.H. Park H.J. Park J.H. Lee K.Y. Kim M.K. Shin B.A. Choi S.Y. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice PLoS One 6 2011 e18556
5 McGuire S.E. Roman G. Davis R.L. Gene expression systems in Drosophila: a synthesis of time and space Trends Genet. 20 2004 384 391 15262411
6 Li Q. Montell C. Mechanism for food texture preference based on grittiness Curr. Biol. 31 2021 1850 1861.e6 33657409
7 Li Q. DeBeaubien N.A. Sokabe T. Montell C. Temperature and Sweet Taste Integration in Drosophila Curr. Biol. 30 2020 2207 2209 32516604
8 Chen J. Luo J. Gurav A.S. Chen Z. Wang Y. Montell C. A DREaMR system to simplify combining mutations with rescue transgenes in Aedes aegypti Genetics 219 2021 iyab146
9 Peng P. Wang X. Shen D. Sun J. Jia Y. Xu R.G. Zhu L.F. Ni J.Q. CRISPR-Cas9 Mediated Genome Editing in Drosophila Bio. Protoc. 9 2019 e3141
10 Fritsch C. Sprecher S.G. CRISPR/Cas9 Genome Editing to Study Nervous System Development in Drosophila Methods Mol. Biol. 2047 2020 161 189 31552655
11 Kina H. Yoshitani T. Hanyu-Nakamura K. Nakamura A. Rapid and efficient generation of GFP-knocked-in Drosophila by the CRISPR-Cas9-mediated genome editing Dev. Growth Differ. 61 2019 265 275 31037730
