
==== Front
Proc Natl Acad Sci U S A
Proc Natl Acad Sci U S A
PNAS
Proceedings of the National Academy of Sciences of the United States of America
0027-8424
1091-6490
National Academy of Sciences

39190345
202409346
10.1073/pnas.2409346121
research-articleResearch ArticlegeneticsGenetics419
Biological Sciences
Genetics
The deubiquitinase Usp7 in Drosophila melanogaster is required for synaptonemal complex maintenance
Lake Cathleen M. a
Gardner Jennifer a
Briggs Salam a
Yu Zulin a
McKown Grace a
Hawley R. Scott rsh@stowers.org
a b 1
aStowers Institute for Medical Research, Kansas City, MO 64110
bDepartment of Molecular and Integrative Physiology, University of Kansas Medical Center, Kansas City, KS 66160
1To whom correspondence may be addressed. Email: rsh@stowers.org.
Contributed by R. Scott Hawley; received May 10, 2024; accepted July 23, 2024; reviewed by Nicole Crown, Hiroyuki Ohkura, and Ofer Rog

27 8 2024
3 9 2024
27 8 2024
121 36 e240934612110 5 2024
23 7 2024
Copyright © 2024 the Author(s). Published by PNAS.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This open access article is distributed under Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND).

Significance

We provide evidence that the deubiquitinase, Usp7, is required for the maintenance of the synaptonemal complex (SC) in early meiotic prophase I in Drosophila melanogaster. These studies identify a critical time point in prophase I, the transition from early to early/mid-pachytene, that the SC structure is important for the proper disjunction of meiotic chromosomes. In addition, these studies also support previous work from our laboratory in suggesting that the presence of SC throughout early/mid-pachytene is required for the proper number and placement of crossovers, affecting the X chromosome differently than the autosomes.

Meiosis is a form of cell division that is essential to sexually reproducing organisms and is therefore highly regulated. Each event of meiosis must occur at the correct developmental stage to ensure that chromosomes are segregated properly during both meiotic divisions. One unique meiosis-specific structure that is tightly regulated in terms of timing of assembly and disassembly is the synaptonemal complex (SC). While the mechanism(s) for assembly and disassembly of the SC are poorly understood in Drosophila melanogaster, posttranslational modifications, including ubiquitination and phosphorylation, are known to play a role. Here, we identify a role for the deubiquitinase Usp7 in the maintenance of the SC in early prophase and show that its function in SC maintenance is independent of the meiotic recombination process. Using two usp7 shRNA constructs that result in different knockdown levels, we have shown that the presence of SC through early/mid-pachytene is critical for normal levels and placement of crossovers.

meiosis
SC
deubiquitinase
DUB
Usp7
Stowers Institute for Medical Research (SIMR) 100007795 Hawley Lab Cathy LakeJennifer GardnerSalam BriggsZulin YuGrace McKownR. Scott Hawley
==== Body
pmcThe process of chromosome segregation during meiosis is tightly regulated to ensure the proper transmission of chromosomes to the gametes. There are many aspects of meiotic regulation, including transcriptional regulation, regulation of the timing and order of key events, meiotic checkpoints that regulate progression, and entry and exit regulation throughout many stages of meiosis, just to name a few. The failure to properly regulate and execute these processes can lead to chromosome segregation errors. Missegregation of chromosomes at meiosis I and/or II results in aneuploid gametes, which is the leading cause of miscarriages and birth defects in humans (1).

A complex process unique to the meiotic cell cycle is the induction of a large number of preprogrammed double-strand breaks (DSBs) that are repaired by homologous recombination. This process results in chiasmata, the physical manifestation of crossovers, which ensure the segregation of homologous chromosomes during the first meiotic division. Homologous recombination, which occurs in prophase I, is facilitated by a series of events that includes the building a meiosis-specific structure (the synaptonemal complex, SC) which connects the homologs along their entire length, the induction of DSBs, and the repair of those breaks into crossovers and noncrossovers or gene conversions. These events are critical to ensure not only the proper timing of each event but also that none of the events are missed. For example, failure to build or maintain the SC throughout crossover formation results in defects that include chromosome segregation errors, misplacement of crossovers, and/or alterations in crossover number (2–4). There are a number of factors that regulate DSB timing, number, and distribution (5). In some organisms, failure to induce DSBs will cause meiotic arrest (6, 7), while in others, like female flies, the loss of DSBs leads only to elevated levels of chromosome missegregation. In Drosophila melanogaster, where DSB induction occurs after SC formation, the SC is required for wild-type levels of DSBs, and those DSBs that do form in the absence of SC are rarely resolved into crossovers (8–10).

Therefore, in Drosophila, knowledge of both the mechanisms that control the timing of SC formation and the maintenance of SC throughout early stages of prophase I will be required to understand many aspects of meiotic chromosome behavior. Unfortunately, most prior studies of this process have been done using null mutations in genes that encode crucial SC components, and thus, the regulation of SC formation and maintenance is not well understood. However, a few studies have recently shed some light on the regulation of SC assembly and maintenance. These studies have implicated posttranslational modifications as important factors in SC assembly and maintenance. While no direct role for ubiquitin has been identified in Drosophila females, indirect evidence suggests that ubiquitination may play a role in many processes of meiotic prophase. For example, several recent studies have shown that both ubiquitination and phosphorylation are important for controlling SC dynamics. A known E3 ubiquitin ligase, Sina, has been shown to regulate SC formation and disassembly (11). A point mutation in the dimerization domain of sina causes aberrant formation of SC structures known as polycomplexes (PCs), which can persist past the developmental stage when the euchromatic SC has disassembled. On the other hand, another ubiquitin ligase complex, SCF-Fbox42, has been shown to promote SC assembly by downregulating PP2A-B56 (12), showing that there is a cooperation between ubiquitination and phosphorylation for SC assembly and maintenance in Drosophila. Finally, there is a second SCF complex (SCF-Slimb/βTrcp) that, along with SCF-Fbxo42, mediates regulation of the SC (12). Both complexes showed impaired assembly and premature disassembly of the SC, as well as abnormal karyosome morphologies.

Studies in other organisms also support the view that ubiquitination-related processes play important roles in building and dismantling the SC. In budding yeast, studies have identified a direct role for ubiquitin, having both positive and negative roles, in SC formation and limiting the number of DSBs that occur (13). In addition, in mice, the process of ubiquitination is important in assuring the timely degradation of a SC axial element protein, SYCP3, which is necessary to ensure DSB repair at pachytene (14). Ubiquitination, which affects protein localization, stability, interactions, and activity, is often itself regulated by enzymes known as DUBs, or deubiquitinating enzymes. DUBs reverse the ubiquitin marks, and therefore, DUBs could be equally important for maintaining protein stability, localization, or activity. There are 100s of DUBs in the genomes of most organisms; however, the most extensively studied is the ubiquitin-specific protease 7 (Usp7) due to its numerous substrates and the many roles it has in protecting the genome (15–17).

To further investigate the role of ubiquitination on processes relating to the SC in Drosophila, we asked whether the DUB Usp7 had a role in early meiotic prophase. We found that reducing the expression of usp7 in the female germline led to a failure to maintain the SC throughout pachytene. In this study, we demonstrate, using two shRNA constructs to usp7 that differ in their ability to knockdown usp7 expression, that the presence of the SC through early/mid-pachytene is critical for normal levels and placement of crossovers. We also find that an intact SC, specifically at the transition from early to early/mid-pachytene, is critical for the disjunction of even those meiotic chromosomes that have undergone crossing over. We show that the failure to maintain the SC is independent of the meiotic recombination process and that Usp7 may be interacting directly with a component of the SC. These studies identify a unique role for the deubiquitinase Usp7 in maintaining the structure of the SC throughout meiotic prophase I.

Results

The Efficacy of the usp7 Knockdown Constructs in the Female Germline.

Ubiquitination is a process that can affect the localization, stability, interactions, and activity of proteins, and deubiquitination can reverse these effects. Since recent studies have determined that enzymes responsible for ubiquitination affect the SC, we wanted to determine the consequences of impairing the processes that mediate deubiquitination. While there are many deubiquitinases within the genome of most species, Usp7 (also known as Herpesvirus-associated ubiquitin specific protease or HUASP) is the most extensively studied due to its many roles in maintaining genome integrity (17). We investigated whether Usp7 was required during Drosophila female meiosis for events related to meiotic prophase I.

In D. melanogaster, the gene that encodes Usp7 (usp7) is an essential gene located on the X chromosome. A small deletion mutation of this gene, created by CRISPR-Cas9, caused homozygotes to die prematurely at the pupal stage (18), and both a deficiency that uncovers usp7 and an available P-element mutation are male lethal, making it impossible to create homozygous null females (Table 1). Most studies relating to usp7 in Drosophila have been done using a shRNA line targeting the 3’UTR generated by the Transgenic RNAi Project (TRiP) (BL34708) (19) in which expression can be reduced in a specific tissue of interest. Previous studies using this TRiP shRNA line, which is located on Chr3 and denoted as usp7 RNAiIII for this study, showed knockdown of expression levels to approximately 70% and 80% of wildtype levels using a steroid inducible ubiquitous daughterless-geneswitch-Gal4 or neuron specific (D42)-Gal4 driver, respectively (20). Even at this level of reduction within the tissue, effects were seen in the ability of flies to adapt to stress conditions and proteotoxicity in neurons. In addition to this shRNA line, we made a second shRNA line targeting the first exon of usp7 using the same vector (pValium20) and inserted the construct on Chr2 (denoted usp7 RNAiII) (Materials and Methods).

Table 1. usp7 mutant fertility phenotype

Genotype	Vector	Location of hairpin	Fertility of females†	Fertility of males†	
PSUP or Pusp7[KG06814]	n/a*	n/a	n/a	Lethal	
Df(1)ED7161	n/a	n/a	n/a	Lethal	
nanos-Gal4::VP16/+; usp7RNAiII/+	pValium20	1st exon	Semi-fertile	Virtually sterile	
nanos-Gal4::VP16/+;; usp7RNAiIII/+	pValium20	3’UTR	Fertile	Fertile	
PSUP or Pusp7[KG06814] is a transgenic insertion stock created by the Gene Disruption project (Bloomington Stock 14505). Df(1)ED7161 was created by the DrosDel Project and deletes numerous genes, including usp7, between cytological positions 11A1;11B14 (Bloomington Stock 9217).

*Not applicable.

†Refer to SI Appendix, Table S1 for average number of progeny per fly.

We tested both of the shRNA constructs for their ability to reduce usp7 expression in the germarium when combined with the germline-specific nanos-Gal4 driver which is expressed robustly in the stem cells and meiotic cells in both females and males (21, 22). The use of this driver causes the usp7 transcript to be expressed normally in the supporting somatic cells while being reduced only in the meiotic germline. A qPCR analysis indicated that usp7 RNAiII reduced expression of usp7 transcript in the ovary to between 43 and 47% of wildtype levels (a reduction of greater than 50%) and usp7 RNAiIII reduced expression to between 85 and 90% of wildtype levels (a reduction of 10 to 15%) (SI Appendix, Fig. S1). As whole ovaries were used in this assay, the effect of usp7 knockdown within the germline cells was likely greater than observed for the whole ovary. We conclude that usp7 RNAiII was the better tool for reducing usp7 expression in the female germline, and the reduced level of expression of usp7 RNAiIII is similar to what has been reported for other tissue-specific knockdowns.

Since usp7 is an essential gene and even a 20 to 30% reduction driven by tissue-specific knockdown showed phenotypes in other studies, we asked whether or not using usp7 RNAiII and usp7 RNAiIII to reduce the expression of usp7 in the germline would impair fertility (Table 1 and SI Appendix, Table S1). We found that while usp7 RNAiIII knockdown in both the female and male germlines resulted in fertile progeny comparable to controls, knockdown using usp7 RNAiII resulted in a significant decrease in fertility of females and virtual sterility in the males. The stronger effect on fertility in usp7 RNAiII compared to usp7 RNAiIII is consistent with this line having a greater level of knockdown in usp7 expression within the whole ovary. The decrease in female fertility was due to reduced expression in the germline, as in no defect was observed in the absence of driver (SI Appendix, Table S1). When we used the maternal-α-Gal4 driver (called matα-Gal4), which drives expression of the shRNA after early meiotic prophase events (starting in germarial stage 3/vitellarium stage 2, see SI Appendix, Fig. S2) and continues throughout oogenesis (22–25), we observed a similar decrease in female fertility for usp7 RNAiII compared to the nanos-Gal4 driver (SI Appendix, Table S1). This observation suggests that the decrease in fertility is mostly due to an effect of knockdown at a point in development past the early meiotic events in the germarium.

Reduction of usp7 Expression Leads to a SC Maintenance Phenotype.

We next tested whether knockdown of usp7 expression altered those early events in female meiotic prophase that have been most thoroughly characterized for D. melanogaster females. Within the ovary, the ovarioles are arranged in a linear fashion by developmental age, and the timing of events can be analyzed cytologically. In addition, progeny that are produced from mated females can be analyzed for various meiotic defects, including failed chromosome segregation or recombination defects. The timing of the meiotic events relevant to this study is shown in SI Appendix, Fig. S2. Meiosis begins after the formation of the 16-cell cyst, where SC begins to form in several cells within the cyst in early pachytene. Following punctate SC loading, full-length SC formation can be seen before the induction of DSBs which are visualized with a marker to a posttranslational modification on the histone 2A variant (γH2Av). As the cyst matures and moves posteriorly in the germarium, the γH2Av foci number decreases until it reaches near zero at the posterior end of the germarium in the selected oocyte. This gradual reduction of γH2Av number indicates that DSB repair is underway and/or complete before the cyst exits the germarium, producing the first vitellarium egg chamber. As the egg chamber matures posteriorly, the SC begins to disassemble along the euchromatic arms but is maintained at the centromeres where it is thought to aid in chromosome alignment at metaphase I.

We first analyzed whether usp7 knockdown in the female germline affected the formation of the SC or the kinetics of SC assembly and disassembly. We visualized SC formation in the germarium from early pachytene through the beginning of mid-pachytene using an antibody to the SC transverse filament protein, C(3)G (Fig. 1A). We found that usp7 knockdown by either usp7 RNAiII or usp7 RNAiIII showed a defect in the ability to maintain the SC structure throughout pachytene in the germarium. In both cases, by the start of mid-pachytene (region 3), the last cyst within the germarium, only punctate foci of SC remained in most oocytes. This contrasts with the full-length SC observed in the control. Further analysis revealed that the SC maintenance defect in usp7 RNAiII occurs earlier than usp7 RNAiIII (Fig. 1B). We found that the SC defect in usp7 RNAiII was already apparent by early pachytene with only 77% of the nuclei having wild-type thread-like SC compared to both usp7 RNAiIII and the control, where 100% of the pro-oocyte nuclei had normal thread-like SC. In both usp7 RNAiII and usp7 RNAiIII pro-oocytes, as the cyst matured throughout the germarium, the frequencies of SC maintenance defect increased, with both constructs causing complete or near complete disassembly of the SC by mid-pachytene (region 3) (100% of usp7 RNAiII and 96% of usp7 RNAiIII nuclei have only fragments or spots of SC remaining).

Fig. 1. Germline knockdown of usp7 by RNAi results in failure to maintain the SC throughout pachytene. (A) Immunofluorescence analysis of nuclei in the germarium from early pachytene (region 2A) through mid-pachytene (region 3) in y w nanos-Gal4/y sc cv v f·y+ with either no RNAi construct (+) or the indicated usp7 RNAi construct (usp7 RNAiII or usp7 RNAiIII). Ovaries were stained with an antibody to C(3)G (white) to mark the SC. Region 2A and 2B pro-oocytes are categorized as early and late by position within the germarium. Images are maximum-intensity projections of the deconvolved z-series through the selected nuclei. (Scale bar, 1 μm.) (B) Quantification of the SC phenotype in y w nanos-Gal4/y sc cv v f·y+ with either no RNAi construct (+) or the indicated usp7 RNAi construct throughout early pachytene (early and late region 2A), early/mid-pachytene (early and late region 2B), and mid-pachytene (region 3). N, number of nuclei analyzed.

We then used SIM to examine the structure of the SC at higher resolution in both usp7 RNAiII and usp7 RNAiIII to detect any gross abnormality that could explain the premature disassembly or maintenance. Using antibodies that recognizes the lateral sides of the SC (C terminus C(3)G antibody) and a central region protein, Corolla, we found that the SC that forms in early pachytene looked structurally normal (SI Appendix, Fig. S3 A–C). In addition, we could see that in early/mid-pachytene some of the fragments/spots of SC in ovaries expressing either shRNA construct still retained tripartite structure with two lateral sides and a central element with similar interaxis distances. This indicates that the SC defect is not related to the inability to assemble structurally normal SC, but rather in the ability to stabilize or maintain the SC structure.

To determine whether the failure to maintain the SC was related to cohesion between the sister chromatids, we analyzed centromere clustering in usp7 RNAiII and usp7 RNAiIII females (SI Appendix, Table S2). In Drosophila, centromeres of the eight chromosomes pair with their homolog and cluster into one to two aggregates by early pachytene and remain clustered throughout prophase I (26, 27). This active clustering of centromeres occurs primarily from the association of homologous chromosome interactions (27). Centromere pairing is dependent on cohesion, and centromere clustering is dependent on SC formation (26–31). We performed an immunofluorescence assay to determine whether defects in SC maintenance could be explained by potential defects in cohesion. We found that centromere pairing is not affected using either shRNA construct, as there were never greater than four centromere pairs, indicating that cohesion defects are likely not the cause of the failure to maintain the SC. Even at mid/late prophase, where the cohesion mutant, ord, shows a complete lack of centromere pairing (8 CID foci) (26), both usp7 shRNA constructs maintain the ability to pair centromeres (3.8 CID foci for usp7 RNAiII and 3.0 CID foci for usp7 RNAiIII). In addition, we found that there is only a mild effect on centromere clustering that is similar to the previously published null mutation in the cona gene, which encodes an SC structural component (4.3 CID foci at mid/late prophase) (26). However, we acknowledge that these studies cannot exclude potential defects in arm cohesion that are independent of cohesion at the centromeres.

We conclude from these studies that when usp7 expression is reduced, the pro-oocytes fail to maintain the SC and that stronger reduction in usp7 transcript is correlated with an earlier SC defect. We also note that the failure to maintain the SC structure is likely not due to a defect in cohesion or some gross abnormality in the ability to form the tripartite SC.

Effect of usp7 RNAi on Meiotic Crossing Over and Chromosome Segregation.

To determine whether the failure to maintain the SC during these critical points in prophase I resulted in a change in recombination frequency or position, we assayed meiotic crossing over along the X chromosome (Table 2). This assay also allowed us to analyze nondisjunction (ND) levels of the X chromosome at the same time (see Materials and Methods for details). We found that crossing over within the sc-f region of the X chromosome in both usp7 RNAi females was reduced by approximately 60% compared to control. Crossover distribution on the X chromosome in usp7 RNAiII oocytes was reduced in a nonuniform fashion, such that the centromere distal interval of sc-cv was affected to a lesser extent than the more proximal euchromatic interval of cv-f. However, crossovers in usp7 RNAiIII were reduced uniformly along the X chromosome. These differences in X chromosome crossover distribution between the two usp7 RNAi oocytes could be attributed to the poor fertility of usp7 RNAiII oocytes and the possibility that some marker combinations could be more favorable than others. While the overall rate of X chromosome crossing over was similarly reduced in both usp7 RNAi females, we observed significant differences in the rate of X chromosome missegregation. usp7 RNAiII oocytes exhibit a ninefold higher level of X ND than usp7 RNAiIII oocytes (35.1% X ND for usp7 RNAiII compared to 4.4% in usp7 RNAiIII), although both ND levels are significantly increased compared to controls (P < 0.001) (32). However, both these results led us to speculate there could be differences in the effects of usp7 reduction on the autosomes.

Table 2. Effect on X chromosome recombination frequency and ND in usp7 RNAi females

	X chromosome interval								
Genotype*	sc-cv (% of control)	cv-f (% of control)	Total (% of control)	n	% NCO	% SCO	% DCO	Adj N (N)	% X ND	
+	10.4 (100)	36.3 (100)	46.7 (100)	1,700	55.0	43.3	1.7	3,330
(3,324)	0.4	
usp7RNAiII	7.3 (70)	10.7 (29)	18.1† (39)	177	81.9	18.7	0.0	473
(390)	35.1‡	
usp7RNAiIII	4.8 (46)	15.7 (43)	20.5† (44)	2,096	80.2	19.1	0.7	4,297
(4,202)	4.4‡	
*All females were y w nanos-Gal4::VP16/ y sc cv v f·y+ with either no RNAi construct (+) or the indicated usp7 RNAi construct. Only the markers sc, cv, and f were scored in female progeny when crossed to y sc cv v f·car males. (n) number of females assayed for X chromosome recombination from the progeny of 43 (+), 52 (usp7 RNAiII), and 58 (usp7 RNAiIII) females (SI Appendix, Table S1). NCO, SCO, and DCO refer to non, single, or double crossovers. Adj N is the adjusted total progeny scored in the ND assay and accounts for the inviable progeny class (Materials and Methods). N is the number of progeny before adjusting.

†A chi-square test, analyzing the total number of crossovers verses the total number of non-crossovers, indicates that recombination in both usp7 RNAi oocytes is significantly different from control (P < 0.001) but not significantly different from each other (P = 0.5801). The total number of crossovers:noncrossovers is 765:935 for control, 32:145 for usp7 RNAiII, and 415:1681 for usp7 RNAiIII.

‡Nondisjunction levels are significantly different from control (P < 0.001). See Methods for statistical analysis.

Because the ND of nonexchange X chromosomes observed in recombination-deficient mutants reflects nonhomologous segregation events, in which the two noncrossover X chromosomes segregate from a nonexchange autosome, this process by definition requires the presence of nonexchange autosomes (see below) (33). Thus, it seemed possible that the observed differences in the level of X ND might reflect a differential effect of the two constructs on autosomal crossing over. To test this possibility, we analyzed the crossover frequency and distribution on the 2nd chromosome for usp7 RNAiIII. In this assay, we were able to test crossing over along the entire length of the 2L chromosome arm, as well as across the centromere (see Materials and Methods for chromosomal position of markers). We found no reduction in total crossing over in usp7 RNAiIII females compared to controls (115% of control levels); however, the crossover distribution was shifted toward the centromere (Table 3). Similar X chromosome-specific defects on the X chromosome with minimal effects on X chromosome segregation and shifted crossover distribution on the autosomes have been observed before in hypomorphic mutants of the major SC protein C(3)G(4) (Discussion). While these results explain why the rate of X chromosome ND is low for usp7 RNAiIII, they do not explain why usp7 RNAiII females have considerably higher missegregation, which suggests that crossovers could be additionally affected on the autosomes in usp7 RNAiII (see below).

Table 3. Effect on 2nd chromosome recombination frequency in usp7 RNAi females

	2nd chromosome interval			
Genotype*	net- dppho (% of control)	dppho-dpy (% of control)	dpy-b (% of control)	b-pr (% of control)	pr-cn (% of control)	Total (% of control)	N	
+	4.97 (100)	7.02 (100)	25.9 (100)	8.55 (100)	3.06 (100)	49.01 (100)	784	
usp7RNAiIII	4.56 (92)	5.05 (72)	18.2 (70)	24.9 (291)	3.91 (127)	56.29 (115)	614†	
*Females were y w nanos-Gal4::VP16/ naryagfpcrispr; net dppho dpy b pr cn/+ with either no RNAi construct (+) or the indicated usp7 RNAi construct. Single female virgins (33 for control and 34 for usp7RNAiIII) were crossed to X/Y; net dppho dpy b pr cn males. Only female progeny were scored for the markers net, dppho, dpy, b, pr, and cn. (N) is the total number of females scored.

†A chi-square test, analyzing the total number of crossovers verses the total number of noncrossovers, indicates that usp7 RNAiIII oocytes are not significantly different from control (P = 0.128). The total number of crossovers:noncrossovers is 351:433 for control and 300:314 for usp7 RNAiIII.

Direct Cytogenetic Evaluation of Homolog Co-orientation at Prometaphase I.

Unfortunately, the 2nd chromosome recombination assay yields fewer progeny than the X recombination assay, with an average of 40% fewer scorable progeny for the control and usp7 RNAiIII. Because of this we were unable to test 2nd chromosome recombination in fertility-compromised usp7 RNAiII females by the classical genetic approach (The number of scorable progeny produced by usp7 RNAiII for X recombination was only ~3/tester female compared to 40 for control and 36 for usp7 RNAiIII females). To ascertain whether autosomal crossing over was reduced in usp7 RNAiII females, we analyzed homolog co-orientation and DNA mass morphologies in prometaphase I oocytes. Females that have reduced crossing over on all chromosomes fail to produce enough chiasmata required to align and hold homologs along the prometaphase I spindle and instead have maloriented homologs that are separated by significant distance (34). We used fluorescence in situ hybridization (FISH) probes that recognized heterochromatic regions of the X, 2nd, 3rd, and 4th chromosomes to determine the co-orientation of each chromosome in prometaphase I. Examples of prometaphase I X and 4th chromosome orientation are shown in SI Appendix, Fig. S4A; examples of 2nd and 3rd chromosome orientation are shown in SI Appendix, Fig. S4B; and DNA mass morphology images are shown in SI Appendix, Fig. S4C (see SI Appendix for details).

Consistent with the low levels of ND and chromosome crossover frequencies on the X (Table 2) and 2nd (Table 3) chromosomes, co-orientation of homologs in usp7 RNAiIII was only mildly affected (96%, 90%, 90%, and 83% compared to 100%, 100%, 100%, and 89% in controls were properly co-oriented for X, 2nd, 3rd, and 4th chromosomes, respectively) (Fig. 2). However, usp7 RNAiII prometaphase I oocytes had a much higher percentage of maloriented homologs compared to either control or usp7 RNAiIII females (only 63%, 57%, 46%, and 76% were properly co-oriented for X, 2nd, 3rd, and 4th chromosome, respectively). [Note that the less than complete 4th chromosome co-orientation in wild-type females is expected due to their dynamic nature on the meiosis I spindle (35).]

Fig. 2. Homolog orientation by FISH in usp7 RNAi prometaphase I oocytes. Quantification of homolog orientation in y w nanos-Gal4/y sc cv v f·y+ with either no RNAi construct (+, blue) or the indicated usp7 RNAi construct (usp7 RNAiII, orange or usp7 RNAiIII, green) using a probe to the X (359 repeat), 2L (AATAG), 3R (Dodeca), and 4th chromosome (AATAT). DNA mass configuration was analyzed by DAPI. See SI Appendix, Fig. S4 for representative immunofluorescence images. N, number of oocytes analyzed for each probe or prometaphase I DNA mass configuration.

In addition to the inability of usp7 RNAiII to co-orient homologs properly, these females also failed to hold homologs at the prometaphase I mid-spindle almost 50% of the time, compared to control and usp7 RNAiIII which aligned properly 100% and 75% of the time, respectively (Fig. 2). These data indicate that usp7 RNAiII females suffer significant reductions in crossing over on both the X and autosomes, and it is that failure (and subsequent nonhomologous segregations) that results in the elevated levels of ND observed specifically in this genotype.

Effect of usp7 RNAi on Nonexchange Chromosome Segregation.

As shown in Table 2, despite similar effects of the two constructs on X chromosomal crossing over, usp7 RNAiII oocytes exhibit a much higher rate of ND compared to usp7 RNAiIII oocytes. To further test the idea the effects of usp7 depletion on segregation are not a reflection of the differences in X recombination frequency distribution observed between the two lines, we tested the effects of our two shRNA constructs on X chromosome ND in oocytes where the occurrence of crossing over is strongly suppressed by heterozygosity for the FM7 X chromosome balancer (36, 37). Despite removal of exchange as a variable between the usp7 RNAiIII and usp7 RNAiIII genotypes, the level of X chromosome ND is approximately 15-fold higher in usp7 RNAiIII X/FM7 females than it is in usp7 RNAiIII X/FM7 females (Table 4). In addition, we observed a significant increase in 4th chromosome achiasmate ND in usp7 RNAiIII, as well as recovered progeny that phenotypically appear to be meiosis II exceptions.

Table 4. Effect on X and 4th chromosome ND in usp7 RNAi females with achiasmate X chromosomes

Genotype*	N	Adj N	% X ND	% 4th ND	MII exceptions§	
FM7a/+	815	817	0.2	0.0	0	
FM7a/+; usp7RNAiII	567	853	29.5†	5.2†	16	
FM7w/+;; usp7RNAiIII	923	944	2.1‡	0.1¶	0	
*The following genotypes were y w nanos-Gal4::VP16/ FM7a or FM7w with either no RNAi construct (+) or the indicated usp7 RNAi construct. Female progeny were crossed to X^Y, In(1)EN,v f B; C(4)RM,ci eyR males and females and males were scored for both X and 4th ND. Only 4th chromosome nullo-exceptions are presented in the table. The total number of progeny scored (N) is adjusted to account for the inviable progeny class (Adj N) (Materials and Methods).

†ND levels are significantly different from control (P < 0.001).

‡ND levels are significantly different from control (P < 0.05).

§Female progeny that resulted from meiosis II (MII) exceptions (phenotypically carried 2 copies of 1 of their female parents X chromosomes) were not included when calculating the levels of ND.

¶Not significantly different from control (P > 0.05). See Materials and Methods for statistical analysis.

These observations are easily explained by the difference in the effects of the two constructs on autosomal recombination. Oocytes expressing the usp7 RNAiIII construct show relatively low levels of X ND, presumably a consequence of the high levels of autosomal crossing over. The presence of only one pair of nonexchange chromosomes allows the “distributive systems” to segregate nonexchange Xs in the absence of nonexchange 2nd and 3rd chromosomes (33, 36, 38, 39). However, in usp7 RNAiIII oocytes there is a global effect on crossing over that created both nonexchange X chromosomes and nonexchange autosomes. The presence of multiple nonexchange chromosomes overloads the distributive system, leaving it incapable of properly segregating the nonexchange X chromosomes. As a result, nonhomologous segregations (for example both X chromosomes segregate from one autosome, XX<~>A, with the remaining autosome segregating at random) occur at high frequency. These heterologous segregation events result in the high levels of X chromosome ND, in both meiosis I and meiosis II, observed in Tables2 and 4.

To rule out that any reduction in usp7 expression beyond the germarium was the cause of the variance in ND, we assayed X ND when the shRNA constructs were driven by the matα-Gal4 driver that drives expression after early meiotic prophase events (SI Appendix, Figs. S2 and S5). We found that reducing usp7 expression after early/mid-pachytene had no effect on either SC maintenance (SI Appendix, Fig. S5A) or on the proper segregation of homologs during meiosis I (SI Appendix, Fig. S5B), indicating that Usp7 expression is specifically required during the early events in the germarium for the disjunction of homologs. These observations allow us to conclude that the effects of these constructs on segregation are best explained by their effects of crossing over.

The Observed Reductions in Crossing Over Are Not a Result of Failed DSB Induction.

The recombination phenotype observed when usp7 expression is reduced, especially in usp7 RNAiII females which fail to form enough chiasmata to biorient homologs along the prometaphase I spindle, could be explained by a role of Usp7 in DSB formation and/or repair. To test this, we analyzed DSB formation and repair kinetics is usp7 RNAi females from early to mid-pachytene (see SI Appendix, Fig. S2 for timing of events). We found, by immunofluorescence analysis, that DSBs are formed and repaired with normal kinetics (Fig. 3 and SI Appendix, Fig. S6) indicating that the recombination defects observed in usp7 RNAi females are not due to the absence or failure in the timely repair of DSBs. In addition, from the studies shown in Fig. 3, in which we used the cytoplasmic Orb protein to help locate the SC depleted mid-pachytene oocyte, we can determine that there is also no observable defect in cyst development and oocyte specification, as Orb concentrates around a single nucleus in the mid-pachytene cyst.

Fig. 3. DSB formation and repair kinetics are globally unaltered in usp7 RNAi germaria using a germline driver. Immunofluorescence analysis of whole mount germarium from control (+) and usp7 RNAi females (usp7 RNAiII or usp7 RNAiIII) showing DSB formation and repair kinetics are unaltered in usp7 RNAi females. Germaria from the three genotypes are all similarly orientated, and early pachytene, early/mid-pachytene, and mid-pachytene cysts are labeled as region 2A, 2B, and 3, respectively. Germarium are stained with antibodies to C(3)G (green) to mark the SC, γH2Av (red) to mark the histone modification of phosphorylation at DSBs, and Orb (blue) to assay developmental defects and to mark the mid-pachytene (region 3) oocyte. (Scale bar, 5 μm.) See SI Appendix, Fig. S6 for γH2Av foci quantification throughout the germaria.

The SC Maintenance Phenotype Is Not Dependent on DSB Formation.

While DSB formation and repair is unaltered when usp7 expression is decreased, it is possible that a process related to DSBs, for example, meiotic recombination, is directly responsible for the mechanism relating to the failed maintenance of the SC. Therefore, we combined the knockdown of usp7 with a mutation in a gene that is required for the formation of DSBs, vilya (Fig. 4). We found that the SC maintenance phenotype in usp7 RNAi females is independent of the meiotic recombination process, as the SC phenotype is both present and similar in the DSB competent and DSB incompetent backgrounds (Fig. 4A). In addition, these results show that the entire SC fails to be maintained, as two components of the SC, C(3)G (Fig. 1A) and Corolla (Fig. 4A), show similar SC defects throughout pachytene (Fig. 4B, compare to Fig. 1B).

Fig. 4. SC phenotype of usp7 RNAi females is independent of the meiotic recombination process. (A) Immunofluorescence analysis of nuclei from a DSB competent background (y w nanos-Gal4/y sc cv v f·y+) and a DSB incompetent background (y w vilya826 nanos-Gal4/vilya826) from control (+) and usp7 RNAi (usp7 RNAiII or usp7 RNAiIII) females. Ovaries were stained with antibodies to Lamin (magenta) to mark nuclear envelope and Corolla (green) to mark the SC and are shown from meiotic stages of early pachytene (region 2A), early/mid-pachytene (region 2B), and mid-pachytene (region 3). Images are maximum-intensity projections of the deconvolved z-series though the selected nuclei. (Scale bar, 1 μm.) (B) Quantification of the SC phenotype in y w vilya826 nanos-Gal4/vilya826 with either no RNAi construct (vilya826) or the indicated usp7 RNAi construct (vilya826; usp7 RNAiII or vilya826;; usp7 RNAiIII) throughout early pachytene (early and late region 2A), early/mid-pachytene (early and late region 2B), and mid-pachytene (region 3). N, number of nuclei analyzed for SC phenotype based on C(3)G staining.

Taken together, these combined studies suggest that the recombination and ND phenotype observed in usp7 RNAi females are a direct consequence of the failure to maintain the SC structure throughout critical stages of pachytene. In the absence of proper SC maintenance, exchange occurs much less frequently which results in increased ND. To further understand the role of Usp7 in SC assembly and maintenance, we chose to study the effects of these shRNA constructs in a context of PC formation, which is independent of homolog–homolog interactions such as pairing and crossing over.

PC Formation Is Affected in usp7 RNAiII Oocytes.

To determine whether Usp7 may have a direct role in SC structure, we took advantage of loss-of-function mutations in sina, an E3 ubiquitin ligase that regulates SC formation and disassembly (11). sina mutations result in the formation of large PCs that are heterogenous SC structures that form in early pachytene and persist into late prophase I (11) (Materials and Methods). We hypothesized that if we saw changes within the PC structure and/or PC number, this could indicate that Usp7 plays a direct role in the formation of the SC. Specifically, we set out to determine whether usp7 RNAiII, the stronger of the two shRNAs, influenced sina PC formation. Reduction of Usp7 by usp7 RNAiII in the background of sina mutations showed PC formation is indeed abnormal (Fig. 5 A–C). When usp7 expression is reduced, the sina PCs appear thinner throughout the germarium. The large, often tapered, cone-shaped PCs normally found in sinaA4/sinaDf are not present when usp7 is reduced. A detailed analysis of sina PC number, length, and width from early/mid-pachytene to mid/late-pachytene identified that while the number and length of PCs in the germarium are not affected in usp7 RNAiII (P > 0.05), the width of the PCs formed is significantly affected throughout pachytene when coupled with usp7 RNAiII (P < 0.001) (Fig. 5 B and E). These results suggest that Usp7 may be directly acting on an SC component rather than the resulting SC phenotype being due to a downstream effect on chromatin.

Fig. 5. sina-induced PC width is diminished in usp7 RNAiII females. (A–E) Analysis of PC formation from y w nanos-Gal4/y or w with either no RNAi construct (+) or usp7 RNAiII in sinaA4/sinaDf. (A) Immunofluorescence image of the entire germarium showing PC formation (C(3)G, white) throughout pachytene. (Scale bar, 5 μm.) (B) Individual nuclei from early/mid-pachytene (region 2B) through mid/late-pachytene (stage 8 egg chambers) stained with antibodies to Lamin (magenta) to mark nuclear envelope and C(3)G (green) to mark the SC. Images are maximum-intensity projections of the deconvolved z-series though the selected nuclei. (Scale bar, 5 μm.) (C) Individual nuclei from early/mid-pachytene pro-oocytes stained with C(3)G (green) showing PC structure by high-resolution imaging in the indicated genotypes. (Scale bar, 1 μm.) (D) Individual nuclei from early/mid-pachytene pro-oocytes stained with C(3)G (green) and CID (magenta) showing centromere association with sina induced PCs in usp7 RNAiII oocytes. (Scale bar, 1 μm.) (E) Quantification of the number, length, and width of PCs in early/mid-pachytene (region 2B) and mid-pachytene (region 3). N, number of oocytes analyzed for each stage. Number, the average number of PCs per nuclei. SD is in parentheses. * denotes width in usp7 RNAiII is significantly different from control (P < 0.001) (statistical test, two-tailed Mann–Whitney test).

Discussion

Regulation of Key Events in Meiosis.

The meiotic cell cycle is highly regulated from its entry to its exit through the regulation of cyclin-dependent kinases (40). In addition, specific events throughout meiosis are tightly regulated in both time and space. For example, the SC, a key meiosis-specific structure, which is required for meiotic processes including DSB formation, meiotic recombination, and chromosome segregation [all of which are also regulated posttranslationally (2, 9, 41, 42)], is regulated both in its formation and disassembly (43). In this manuscript, we have uncovered a layer of regulation of the SC in Drosophila by the deubiquitinase Usp7. Using RNAi knockdown we showed that usp7 is required for SC maintenance, a function that is independent of the meiotic recombination process, and likely affecting the SC structure directly. These studies allowed us to study the importance of the SC at specific time points during meiotic prophase and provided strong evidence that maintaining the SC through early/mid-pachytene was essential for the normal level and placement of crossovers.

Deubiquitinase Usp7 and Its Role in Gametogenesis.

While small posttranslational protein modifiers like ubiquitination and sumoylation are known to be important for SC formation and meiotic recombination (2, 9, 41, 42), the process of deubiquitination has not been extensively studied as a potential regulator of meiotic prophase. In general, Usp7 is one of the most well-studied deubiquitinases due to its diverse cellular functions and its role in regulating cellular levels of p53, a tumor suppressor protein. As a cysteine peptidase, plays roles in transcriptional regulation, cell cycle progression, DNA damage response, DNA replication, and epigenetic regulation (16, 44). Because of Usp7’s p53-dependent role in tumor suppression, as well as its p53-independent role in triple-negative breast cancers, substantial research has focused on finding inhibitors of Usp7 for therapeutic use (45–47).

Several DUBs have been shown to play a role in spermatogenesis, including Usp7 (48). In mice pachytene spermatocytes, Usp7 localizes to the XY body in a SCML2 (testes-specific polycomb protein)-specific manner which likely aids in mediating transcriptional silencing. In the absence of SCML2, Usp7 fails to load at the XY body, which indirectly leads to an upregulation of histone H2A monoubiquitination and subsequent apoptosis. This action of Usp7 is thought to directly occur through the regulation of RNF2, an E3 ubiquitin ligase (49–51).

Given the diverse roles and overall importance of Usp7, studying its function during specific cellular events can be difficult. Although usp7 is an essential gene, in Drosophila, we circumvented its essential roles in growth and development by specifically downregulating its presence using shRNA constructs driven in a tissue specific manner. Using the Gal4-UAS system to knockdown expression in the female and male germlines (nanos-Gal4), we were able to show that when there was a greater than 50% reduction in usp7 germline expression (usp7 RNAiII), there was a significant reduction in female fertility. This same construct when assayed for male fertility led to virtual sterility, indicating a role for Usp7 in spermatogenesis. From our data, we conclude that usp7 likely has a diverse set of functions in both the female and male germlines.

As we will discuss below, the SC maintenance phenotype observed in usp7 RNAi oocytes is separable from the effects on fertility in both sexes. Drosophila males do not form SC, nor recombine. Thus, the defects observed in males cannot be due to effects on SC assembly or structure. In addition, we showed that in delaying the knockdown of usp7 from starting in the germarium (where the SC and crossovers are established) to beginning in the vitellarium (matα-Gal4), showed that the decrease in fertility is due to a postpachytene role of usp7 in the vitellarium stages of oogenesis or in early embryos. Further studies will be required to identify whether Usp7 is involved in transcriptional silencing or apoptosis in the Drosophila male germline or in the vitellarium in the female germline.

Usp7’s Role in Prophase I in Drosophila Oocytes.

Using immunofluorescence analyses, we showed that Usp7 is required for the maintenance of the SC during prophase I. Although these studies cannot discern the precise knockdown level of usp7 at each stage of pachytene in the germarium, we hypothesize that the overall differences between the two shRNA constructs correlate with the differences in the timing of the SC defect we observed. Regardless of whether the overall decrease in germline expression was >50% (in usp7 RNAiII) or ~10% (in usp7 RNAiIII), the following observations were the same: 1) tripartite SC structure is able to form; 2) the SC progressively falls apart as the pro-oocytes proceeds though pachytene in the germarium; 3) the resulting SC phenotype in the oocyte by mid-pachytene was indistinguishable; 4) homologous centromeres are paired; and 5) DSB induction was normal. We also showed that the meiotic recombination process was not required to observe the SC phenotype found when usp7 was reduced. However, knockdown of usp7 starting in the germarium (nanos-Gal4) was required, as there was no SC maintenance phenotype when knockdown began in the vitellarium (matα-Gal4) (compare Fig. 1A and SI Appendix, Fig. S5A).

Because the initiation of the meiotic recombination process was not altered nor required for the usp7 RNAi phenotype, and centromere pairing remained intact even in the stronger of the two shRNA lines, we concluded that the failure to maintain the SC structure was not a result of gross effects on cohesion. For that reason, we investigated whether Usp7 might directly be affecting an SC component required for the formation and/or maintenance of the SC by analyzing whether reduced usp7 expression altered the ability to form large SC PCs in a sina mutant, which could point to a more direct role in SC formation and/or maintenance. We found that when usp7 expression is reduced, sina induced PC form and appear organized, but they are not able to form the elaborate structures normally found in this genetic background, like cones and complex shapes. While we currently do not know the substate for either the ubiquitin ligase Sina or the deubiquitinase Usp7 regarding their roles in SC formation and maintenance, an intriguing possibility is that they act upon the same substrate(s) to modulate their activity. Future studies will need to be done to address this possibility.

Taken together with the finding that normally structured SC forms prior to it coming apart in most usp7 RNAi germaria, we speculate that Usp7 may be required to stabilize, through the action of deubiquitination, a component of the SC or its connection to the lateral element. We cannot exclude the possibility that the effect could be along the lateral elements of the SC, as alterations in sina PC structure has also been observed in a c(2)M mutant, albeit in length not width (11). The idea the Usp7 is stabilizing a component of the SC is further strengthened by our finding that 83% of the sina induced PC in usp7 RNAi oocytes were associated with one or more CID foci (39/47 PC analyzed) (Fig. 5D), indicating that the SC at the centromeres might be less affected than the SC along the euchromatic arms. Which component is the direct target of Usp7 remains to be determined, as many of the known components of the SC and lateral elements in Drosophila melanogaster, C(3)G, Cona, Corolla, and C(2)M, all contain multiple motifs for Usp7 docking based on eukaryotic linear motif (ELM) prediction (SI Appendix). Nonetheless, these studies show that when Usp7 is reduced, the SC structure either between homologs or in aberrant PC structures is not able to form and/or maintain long extensions of SC.

SC Function during Critical Time Points in Meiotic Prophase.

Although the reduction of usp7 expression by usp7 RNAiII reduced fecundity, fertility was not so affected that it prohibited the analysis of offspring in some genotypes. Through our analysis of the genetic outcomes, we found that usp7 RNAiII females show high levels of ND and reduced recombination and altered crossover placement on the X chromosome. Our studies analyzing the rates of ND when females have achiasmate X chromosomes, in addition to the inability of usp7 RNAiII oocytes to biorient their homologs properly at metaphase I, indicate a global reduction in the ability to form crossovers. Supporting this finding is the result that offspring from usp7 RNAiII females resulted in meiosis II exceptions, which we speculate are from preceding meiosis I errors. These combined studies suggest that the failure to maintain the SC throughout the time DSBs are initiated (early pachytene) is important for both recombination processes and proper disjunction of homologs. On the other hand, usp7 RNAiIII females showed only a modest increase in ND, reduced recombination but normal distribution of crossovers on the X chromosome, and normal levels of crossovers that are shifted toward the centromeres on one of the autosomes, the 2nd chromosome. These females were also able to biorient all their homologs, which suggests that recombination rates on the autosomes are likely also not significantly affected. These results show that the ability to maintain the SC throughout early/mid-pachytene is critical for normal levels of crossovers, specifically on the X chromosome, and placement of crossovers on the autosomes.

Studies from our lab and many others indicate temporal events that occur between early, early/mid, and mid-pachytene could explain the differences observed in the requirements of the SC at these stages. For instance, DSB induction occurs immediately after SC formation in flies, at early pachytene, and the largest number of DSBs are visualized at this stage when using an antibody to the phosphorylation event that occurs immediately following DSB formation (γH2Av) (8, 52, 53). However, DSB formation and repair is very dynamic, and even in wild-type conditions only a subset of the DSBs that form are ever visualized (8). This indicates that DSB repair is occurring at the same time DSBs are being formed. By the time the pro-oocytes reach early/mid-pachytene, the number of DSBs has been reduced to the number of crossover events, as they colocalize with the recombination nodule components Vilya and Narya (54, 55). We would predict that a failure of the SC to be maintained at this stage would have significant global effects on crossover and noncrossover formation. Unfortunately, to date, the only proteins in flies that have been physically visualized at sites of recombination are themselves also found at DSB sites in both the future oocyte and pro-oocytes that are disassembling their SC as they back out of meiosis (54). Therefore, we are not confident that we can distinguish sites for recombination from DSBs that have failed to undergo repair when the SC is fragmented, as it is in usp7 RNAi females.

A recent study also highlights the importance of maintaining the SC throughout pachytene in Drosophila and shows that disruptions of the SC at critical time points affect the X chromosome differently than the autosomes (4). Using small deletions in the major transverse filament protein, C(3)G, that differ in when they affect SC structure, it was shown that there are critical times during which you need to maintain the SC. Using these mutants, a timeline was generated for when the SC is necessary to maintain pairing and support the recombination landscape on each of the chromosomes. These mutants suggest that the X chromosome requires the SC earlier than the autosome for pairing and crossing over and failure to maintain the SC in early/mid-pachytene alters only the recombination landscape on the autosomes. Our study is consistent with this timeline of full-length SC requirements. However, what has yet to be determined is whether any of these proteins, the C(3)G mutants or Usp7, directly affect the shift in crossovers toward the centromere on the autosomes. We favor the hypothesis that mutations that affect both the level and placement of X chromosome crossovers and only alter the distribution of crossovers on the autosomes may reflect an interchromosomal effect, rather than directly altering the position of the crossovers toward the centromere (37, 56, 57).

Materials and Methods

Drosophila Genetics.

Drosophila strains were maintained on standard food at 24 °C. Descriptions of genetic markers and chromosomes can be found at http://www.flybase.org/. In all figures and tables, (+) denotes the genotype y w nanos-Gal4/ y sc cv v f ·y+, usp7 RNAiII denotes the genotype y w nanos-Gal4/ y sc cv v f ·y+; usp7 RNAiII/+, and usp7 RNAiIII denotes the genotype y w nanos-Gal4/ y sc cv v f ·y+; +/+; usp7 RNAiIII/+, unless otherwise indicated. Stocks used in this study can be found in SI Appendix.

RNAi Constructs and qPCR.

An RNAi hairpin for usp7 was identified using http://www.flyrnai.org/cgi-bin/RNAi_find_primers.pl. The sequence identified (CACGTGCCCGGATTAAGCATTTGTT) (underlined below) is in the first exon and had no predicted off-targets. The hairpin was cloned using the oligos 5′-ctagcagtCACGTGCCCGGATTAAGCATTTGTTtagttatattcaagcataaACAAATGCTTAATCCGGGCACGTGgcg-3′ and 5′-aattcgcCACGTGCCCGGATTAAGCATTTGTTtatgcttgaatataactaaACAAATGCTTAATCCGGGCACGTGactg-3′ (IDT) into pValium20 vector (https://fgr.hms.harvard.edu/trip-plasmid-vector-sets) (gift from Jian-Quan Ni and Norbert Perrimon), https://fgr.hms.harvard.edu/trip-plasmid-vector-sets.

qPCR was performed as previously described (54), except that the Tecan Freedom Evo (Tecan Life Sciences) was used to prepare the plates. See SI Appendix for detailed methods.

Meiotic ND, Recombination, and Fertility Assays.

The frequencies of meiotic ND and meiotic recombination on the X chromosome were measured as previously described (54). To assay both X and 4th chromosome ND, tester female virgins were crossed to X^Y, In(1)EN,v f B; C(4)RM,ci eyR males. Calculations were performed as previously described (38, 39). Statistical test described in ref. 32. See SI Appendix for method details.

To assay for female fertility, single virgin females were crossed to three males (y sc w+ cv v f · car/B[S]Y) and allowed to mate for 5 d before parents were removed. Prior to removal of parents, vials were analyzed for death of the female. Only females that survived until day 5 were used to determine the average number of progeny per fly. The number of progeny was recorded for 18 d postmating. To assay for male fertility, single males were mated to single virgin females (FM7a for 5 d before parents were removed. Prior to removal of parents, vials were analyzed for death of either parent and noted accordingly. The number of progeny was recorded for 18 d postmating.

Immunostaining and Oocyte Staging.

Germaria preparation for whole-mount immunofluorescence was performed as previously described (55). Staging of oocytes was conducted as before (4, 55, 58) using both position and the morphological changes of the cyst. See SI Appendix for details of methods and antibodies used.

Imaging and Image Analysis.

All images, except Fig. 4C and SI Appendix, Fig. S3, were acquired using a DeltaVision Elite system (Applied Precision/Leica Microsystems) supplied with a 1 × 70 inverted microscope with a high-resolution CCD camera. Images were deconvolved using SoftWoRx v. 7.2.1 (Applied Precision/GE Healthcare) software. Fig. 4C and SI Appendix, Fig. S3 images were acquired using Elyra 7 microscope. Image analysis was performed using either SoftWoRx v. 7.2.1 or Imaris software 9.6.1 (Bitplane, Zurich, Switzerland) and cropped in Adobe Photoshop. Brightness and contrast were adjusted minimally to visualize signals during figure preparation.

Interaxis distance was measured using images acquired from the Elyra 7 microscope by similar methods reported in (4, 59, 60). See SI Appendix for detailed methods.

For the scoring of PC number in the sina mutant, only PCs with clearly defined shapes were scored. No foci/puncta or track-like structures were included in the scoring of PC number. The measurements for length and width of PCs were obtained using SoftWoRx v. 7.2.1 software two-point measurement function in the deconvolved images.

FISH.

See SI Appendix for detailed methods.

Analysis of Usp7 Docking Site.

See SI Appendix for detailed methods.

Supplementary Material

Appendix 01 (PDF)

We would like to thank members of the Hawley lab and Katherine Billmyre for helpful comments and discussion on this project and Angela Miller for illustrations in SI Appendix, Fig. S2. We would like to thank the Transgenic RNAi project at Harvard Medical School (NIH/NIGMS R01-GM084947) for providing the transgenic RNAi fly stock used in this study and the Bloomington Stock Center (NIH-P400D018537) for the distribution of stocks. R.S.H is an American Cancer Society Research Professor.

Author contributions

C.M.L., J.G., and R.S.H. designed research; C.M.L., J.G., S.B., Z.Y., and G.M. performed research; C.M.L. contributed new reagents/analytic tools; C.M.L., J.G., S.B., G.M., and R.S.H. analyzed data; and C.M.L. and R.S.H. wrote the paper.

Competing interests

The authors declare no competing interest.

Data, Materials, and Software Availability

All original data have been deposited in Stowers Original Data Repository (https://www.stowers.org/research/publications/libpb-2410). All other data are included in the manuscript and/or SI Appendix. Previously published data were used for this work (26).

Supporting Information

Reviewers: N.C., Case Western Reserve University; H.O., University of Edinburgh; and O.R., The University of Utah.
==== Refs
1 S. I. Nagaoka, T. J. Hassold, P. A. Hunt, Human aneuploidy: Mechanisms and new insights into an age-old problem. Nat. Rev. Genet. 13 , 493–504 (2012).22705668
2 D. Zickler, N. Kleckner, Recombination, pairing, and synapsis of homologs during meiosis. Cold Spring Harb. Perspect. Biol. 7 , a016626 (2015).25986558
3 S. L. Page, R. S. Hawley, The genetics and molecular biology of the synaptonemal complex. Annu. Rev. Cell Dev. Biol. 20 , 525–558 (2004).15473851
4 K. K. Billmyre , X chromosome and autosomal recombination are differentially sensitive to disruptions in SC maintenance. Proc. Natl. Acad. Sci. U.S.A. 116 , 21641–21650 (2019).31570610
5 B. de Massy, Initiation of meiotic recombination: How and where? Conservation and specificities among eukaryotes. Annu. Rev. Genet. 47 , 563–599 (2013).24050176
6 F. Baudat, K. Manova, J. P. Yuen, M. Jasin, S. Keeney, Chromosome synapsis defects and sexually dimorphic meiotic progression in mice lacking Spo11. Mol. Cell 6 , 989–998 (2000).11106739
7 P. J. Romanienko, R. D. Camerini-Otero, The mouse Spo11 gene is required for meiotic chromosome synapsis. Mol. Cell 6 , 975–987 (2000).
8 S. Mehrotra, K. S. McKim, Temporal analysis of meiotic DNA double-strand break formation and repair in Drosophila females. PLoS Genet. 2 , e200 (2006).17166055
9 S. E. Hughes, D. E. Miller, A. L. Miller, R. S. Hawley, Female meiosis: Synapsis, recombination, and segregation in Drosophila melanogaster. Genetics 208 , 875–908 (2018).29487146
10 D. E. Miller, Synaptonemal complex-deficient Drosophila melanogaster females exhibit rare DSB Repair events, recurrent copy-number variation, and an increased rate of de novo transposable element movement. G3 (Bethesda) 10 , 525–537 (2020).31882405
11 S. E. Hughes , The E3 ubiquitin ligase Sina regulates the assembly and disassembly of the synaptonemal complex in Drosophila females. PLoS Genet. 15 , e1008161 (2019).31107865
12 P. Barbosa , SCF-Fbxo42 promotes synaptonemal complex assembly by downregulating PP2A-B56. J. Cell Biol. 220 , e202009167 (2021).33382409
13 M. K. Jo, K. Rhee, K. P. Kim, S. Hong, Yeast polyubiquitin unit regulates synaptonemal complex formation and recombination during meiosis. J. Microbiol. 60 , 705–714 (2022).35781625
14 Y. Wang , FBXW24 controls female meiotic prophase progression by regulating SYCP3 ubiquitination. Clin. Transl. Med. 12 , e891 (2022).35858239
15 L. Zhou , Ubiquitin-specific peptidase 7: A novel deubiquitinase that regulates protein homeostasis and cancers. Front. Oncol. 11 , 784672 (2021).34869041
16 A. Pozhidaeva, I. Bezsonova, USP7: Structure, substrate specificity, and inhibition. DNA Repair (Amst) 76 , 30–39 (2019).30807924
17 G. J. Valles, I. Bezsonova, R. Woodgate, N. W. Ashton, USP7 is a master regulator of genome stability. Front. Cell Dev. Biol. 8 , 717 (2020).32850836
18 T. Zhang, G. Periz, Y. N. Lu, J. Wang, USP7 regulates ALS-associated proteotoxicity and quality control through the NEDD4L-SMAD pathway. Proc. Natl. Acad. Sci. U.S.A. 117 , 28114–28125 (2020).33106424
19 J. Q. Ni , A genome-scale shRNA resource for transgenic RNAi in Drosophila. Nat. Methods 8 , 405–407 (2011).21460824
20 L. Cui , Deubiquitinase USP7 regulates Drosophila aging through ubiquitination and autophagy. Aging (Albany NY) 12 , 23082–23095 (2020).33221768
21 M. V. Doren, A. L. Williamson, R. Lehmann, Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr. Biol. 8 , 243–246 (1998).9501989
22 M. A. Haseeb, A. C. Bernys, E. E. Dickert, S. E. Bickel, An RNAi screen to identify proteins required for cohesion rejuvenation during meiotic prophase in Drosophila oocytes. G3 (Bethesda) 14 , jkae123 (2024).38849129
23 P. Rørth, Gal4 in the Drosophila female germline. Mech. Dev. 78 , 113–118 (1998).9858703
24 K. A. Weng, C. A. Jeffreys, S. E. Bickel, Rejuvenation of meiotic cohesion in oocytes during prophase I is required for chiasma maintenance and accurate chromosome segregation. PLoS Genet. 10 , e1004607 (2014).25211017
25 A. M. Hudson, L. Cooley, Methods for studying oogenesis. Methods 68 , 207–217 (2014).24440745
26 S. Takeo, C. M. Lake, E. Morais-de-Sá, C. E. Sunkel, R. S. Hawley, Synaptonemal complex-dependent centromeric clustering and the initiation of synapsis in Drosophila oocytes. Curr. Biol. 21 , 1845–1851 (2011).22036182
27 N. Christophorou, T. Rubin, J. R. Huynh, Synaptonemal complex components promote centromere pairing in pre-meiotic germ cells. PLoS Genet. 9 , e1004012 (2013).24367278
28 N. S. Tanneti, K. Landy, E. F. Joyce, K. S. McKim, A pathway for synapsis initiation during zygotene in Drosophila oocytes. Curr. Biol. 21 , 1852–1857 (2011).22036181
29 R. Yan, B. D. McKee, The cohesion protein SOLO associates with SMC1 and is required for synapsis, recombination, homolog bias and cohesion and pairing of centromeres in Drosophila meiosis. PLoS Genet. 9 , e1003637 (2013).23874232
30 M. R. Gyuricza , Dynamic and stable cohesins regulate synaptonemal complex assembly and chromosome segregation. Curr. Biol. 26 , 1688–1698 (2016).27291057
31 B. Krishnan , Sisters unbound is required for meiotic centromeric cohesion in Drosophila melanogaster. Genetics 198 , 947–965 (2014).25194162
32 Y. Zeng, H. Li, N. M. Schweppe, R. S. Hawley, W. D. Gilliland, Statistical analysis of nondisjunction assays in Drosophila. Genetics 186 , 505–513 (2010).20660647
33 B. S. Baker, J. C. Hall, “Meiotic mutants: Genetic control of meiotic recombination and chromosome segregation” in The Genetics of Biology of Drosophila, M. Ashburner, E. Novitski, Eds. (Academic Press, New York, NY, 1976), vol. 1a , pp. 351–434.
34 K. S. McKim, J. Ko Jang, W. E. Theurkauf, R. Scott Hawley, Mechanical basis of meiotic metaphase arrest. Nature 362 , 364–366 (1993).8455723
35 S. E. Hughes , Heterochromatic threads connect oscillating chromosomes during prometaphase I in Drosophila oocytes. PLoS Genet. 5 , e1000348 (2009).19165317
36 D. E. Miller, K. R. Cook, R. S. Hawley, The joy of balancers. PLoS Genet. 15 , e1008421 (2019).31697682
37 H. Li , Heterozygous inversion breakpoints suppress meiotic crossovers by altering recombination repair outcomes. PLoS Genet. 19 , e1010702 (2023).37053290
38 R. S. Hawley , There are two mechanisms of achiasmate segregation in Drosophila females, one of which requires heterochromatic homology. Dev. Genet. 13 , 440–467 (1992).1304424
39 A. E. Zitron, R. S. Hawley, The genetic analysis of distributive segregation in Drosophila melanogaster. I. Isolation and characterization of Aberrant X segregation (Axs), a mutation defective in chromosome partner choice. Genetics 122 , 801–821 (1989).2503421
40 I. Palacios-Blanco, C. Martín-Castellanos, Cyclins and CDKs in the regulation of meiosis-specific events. Front. Cell Dev. Biol. 10 , 1069064 (2022).36523509
41 M. Ito, A. Shinohara, Chromosome architecture and homologous recombination in meiosis. Front. Cell Dev. Biol. 10 , 1097446 (2022).36684419
42 G. V. Börner, A. Hochwagen, A. J. MacQueen, Meiosis in budding yeast. Genetics 225 , iyad125 (2023).37616582
43 C. K. Cahoon, R. S. Hawley, Regulating the construction and demolition of the synaptonemal complex. Nat. Struct. Mol. Biol. 23 , 369–377 (2016).27142324
44 R. Rawat, D. T. Starczynowski, P. Ntziachristos, Nuclear deubiquitination in the spotlight: The multifaceted nature of USP7 biology in disease. Curr. Opin. Cell Biol 58 , 85–94 (2019).30897496
45 J. Yi , Inhibition of USP7 induces p53-independent tumor growth suppression in triple-negative breast cancers by destabilizing FOXM1. Cell Death Differ. 30 , 1799–1810 (2023).37291217
46 Y. T. Lin , USP7 induces chemoresistance in triple-negative breast cancer via deubiquitination and stabilization of ABCB1. Cells 11 , 3294 (2022).36291159
47 R. I. Oliveira, R. A. Guedes, J. A. R. Salvador, Highlights in USP7 inhibitors for cancer treatment. Front. Chem. 10 , 1005727 (2022).36186590
48 Y. Xiong, C. Yu, Q. Zhang, Ubiquitin-proteasome system-regulated protein degradation in spermatogenesis. Cells 11 , 1058 (2022).35326509
49 M. Luo , Polycomb protein SCML2 associates with USP7 and counteracts histone H2A ubiquitination in the XY chromatin during male meiosis. PLoS Genet. 11 , e1004954 (2015).25634095
50 P. de Bie, D. Zaaroor-Regev, A. Ciechanover, Regulation of the Polycomb protein RING1B ubiquitination by USP7. Biochem. Biophys. Res. Commun. 400 , 389–395 (2010).20800574
51 D. U. Menon, Y. Shibata, W. Mu, T. Magnuson, Mammalian SWI/SNF collaborates with a polycomb-associated protein to regulate male germline transcription in the mouse. Development 146 , dev174094 (2019).31043422
52 J. K. Jang, D. E. Sherizen, R. Bhagat, E. A. Manheim, K. S. McKim, Relationship of DNA double-strand breaks to synapsis in Drosophila. J. Cell Sci. 116 , 3069 (2003).12799415
53 H. Liu, J. K. Jang, N. Kato, K. S. McKim, mei-P22 encodes a chromosome-associated protein required for the initiation of meiotic recombination in Drosophila melanogaster. Genetics 162 , 245–258 (2002).12242237
54 C. M. Lake , Narya, a RING finger domain-containing protein, is required for meiotic DNA double-strand break formation and crossover maturation in Drosophila melanogaster. PLoS Genet. 15 , e1007886 (2019).30615609
55 C. M. Lake , Vilya, a component of the recombination nodule, is required for meiotic double-strand break formation in Drosophila. eLife 4 , e08287 (2015).26452093
56 K. N. Crown, D. E. Miller, J. Sekelsky, R. S. Hawley, Local inversion heterozygosity alters recombination throughout the genome. Curr. Biol. 28 , 2984–2990.e3 (2018).30174188
57 A. H. Sturtevant, A case of rearrangement of genes in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 7 , 235–237 (1921).16576597
58 E. R. Wesley, R. S. Hawley, K. K. Billmyre, Genetic background impacts the timing of synaptonemal complex breakdown in Drosophila melanogaster. Chromosoma 129 , 243–254 (2020).33068154
59 Y. Xiang , Multiple reorganizations of the lateral elements of the synaptonemal complex facilitate homolog segregation in Bombyx mori oocytes. Curr. Biol. 34 , 352–360.e4 (2024).38176417
60 C. K. Cahoon , Superresolution expansion microscopy reveals the three-dimensional organization of the Drosophila synaptonemal complex. Proc. Natl. Acad. Sci. U.S.A. 114 , E6857–E6866 (2017).28760978
