
==== Front
Comp Immunol Rep
Comp Immunol Rep
Comparative Immunology Reports
2950-3116
Elsevier

S2950-3116(24)00031-4
10.1016/j.cirep.2024.200164
200164
Article
Dietary Psidium guajava, guava leaf extract protects Oreochromis niloticus, Nile tilapia from Pseudomonas aeruginosa infection and enhances growth
Hossain Md. Mer Mosharraf mmm.hossain@just.edu.bd
a⁎
Akter Shirin a
Dey Bipul Kumar ab
Alahmadi Tahani Awad c
Ansari Mohammad Javed d
Rahman Nimur a
Rojoni Suraiya Alam a
Rubayea Ummay a
Bristy Suraiya Afrin a
Hossain Md. Bayzed a
Alam Md. Mahbub a
Sen Bipul Kumar a
Ghosh Ritu Rani a
Rahman Mostafizur a
a Department of Fisheries and Marine Bioscience, Faculty of Biological Science and Technology, Jashore University of Science and Technology, Jashore, 7408, Bangladesh
b Aquaculture and Fisheries Group, Wageningen University and Research, the Netherlands
c Department of Pediatrics, College of Medicine and King Khalid University Hospital, King Saud University, Medical City, Riyadh, Saudi Arabia
d Department of Botany, Hindu College Moradabad (Mahatma Jyotiba Phule Rohilkhand University Bareilly), India
⁎ Corresponding author. mmm.hossain@just.edu.bd
13 8 2024
12 2024
13 8 2024
7 20016426 4 2024
23 7 2024
4 8 2024
© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
This study investigated the impact of dietary guava leaf extract (GLE) on immunity, resistance to Pseudomonas aeruginosa infection, and growth in Oreochromis niloticus (Nile tilapia). Four groups of fish (28.6 g.fish−1) were fed diets supplemented with ethanolic GLE at 0 (control), 3, 5, or 7 g.fish−1 diet (GLE0diet, GLE3diet, GLE5diet, GLE7diet) at 28 °C. Fish were fed thrice daily at 15 g.kg−0.8.d−1 for 42 days. Innate immune parameters, including mucus-bactericidal activity (MBA), serum-bactericidal activity (SBA), bacterial agglutination activity (BAA), and phagocytic activity (PA), were assessed on days 14, 28, and 42. Weight gain (WG), specific growth rate (SGR), and feed conversion ratio (FCR) were measured on day 42. Post-feeding, fish were injected with P. aeruginosa, and mortality was recorded for 30 days. Results showed that GLE7diet significantly increased MBA, SBA, BAA, and PA by 1.8-, 3.3-, 4.2-, and 3.5-fold, respectively, compared to control. GLE7diet also showed the highest significant reduction in post-challenge mortality (21 %) compared to the control group (83 %). Growth metrics for GLE7diet showed WG of 43.8 g, SGR of 2.21%.d−1, and FCR of 1.19, compared to WG of 37.1 g, SGR of 1.98%.d−1, and FCR of 1.41 in the control group. SGR showed an exponential increase (R² = 0.935) and FCR a decrease (R² = 0.958) with increasing GLE levels. GLE5diet and GLE7diet significantly increased MBA at all-time points compared to control. GLE7diet significantly increased SBA on days 14, 28, and 42 compared to control. GLE7diet significantly enhanced BAA at all-time points. GLE5diet and GLE7diet significantly increased PA at all time points compared to control. GLE7diet led to increased expression of IL-1, IL-6, IFN-α, IFN-β, and TNF-α genes, particularly from 10 to 30 days post-infection. Dietary GLE at 7 g.kg−1 significantly enhanced innate and acquired immune responses, growth performance, and resistance to P. aeruginosa in Nile tilapia. This study recommended incorporating 7 g.kg−1 GLE in Nile tilapia diets to improve disease resistance and growth performance.

Keywords

Guava leaf extract
Nile tilapia
Immunity
Infection resistance
Growth
==== Body
pmcIntroduction

Aquaculture is essential for meeting the increasing global demand for fish protein, thereby supporting food security, livelihoods, and economic growth worldwide [1]. However, the sustainable growth of aquaculture faces significant challenges, particularly disease outbreaks that threaten production efficiency and economic viability [2]. Fish are highly susceptible to bacterial infections, which adversely affect their health and welfare, leading to considerable economic losses and environmental issues [3]. Among these pathogens, Pseudomonas aeruginosa is especially problematic, causing severe infections in various fish species, including Nile tilapia [[4], [5], [6], [7]].

The common practice of using antibiotics and chemotherapeutic agents to control bacterial diseases in aquaculture [8,9] has raised concerns about antibiotic resistance, environmental contamination, and potential negative impacts on human health [[10], [11], [12]]. Consequently, there is an urgent need for alternative strategies that are effective, sustainable, and environmentally friendly to mitigate the impact of bacterial diseases in aquaculture [[13], [14], [15]].

One promising alternative approach is the use of immune-modulating dietary supplements derived from natural sources [16,17]. Guava (Psidium guajava), a tropical fruit tree, is known for its nutritional and pharmaceutical value, possessing medicinal qualities such as antimicrobial, anti-inflammatory, and immunomodulatory effects [[18], [19], [20]]. Guava leaves have been traditionally used in folk medicine for their therapeutic properties, especially in enhancing the immune system [[21], [22], [23]].

The leaves of guava contain a variety of bioactive compounds (Table 1), including flavonoids, polyphenols, and tannins, which exhibit antimicrobial and immunomodulatory properties [22,24,25]. These compounds have been shown to boost immunity and fight bacterial infections, making guava leaf extract (GLE) an attractive candidate for dietary supplementation in aquaculture [[26], [27], [28], [29]]. Despite promising initial research, there is still a lack of comprehensive evidence on how GLE can enhance immune defenses, particularly against bacterial challenges [24,[30], [31], [32], [33], [34]].Table 1 The chromatographic profile of Psidium guajava leaf extract, listing the active components identified through chromatographic techniques such as HPLC or LC-MS.

Table 1Bioactive Component*	Type	Retention Time (min)	Concentration (mg.g−1)	Reference	
Quercetin	Flavonoid	12.3	5.5	[[18], [19], [20]]	
Kaempferol	Flavonoid	14.8	4.2	[24,[30], [31], [32], [33], [34]]	
Gallic Acid	Phenolic	4.1	3.0	[[18], [19], [20]]	
Ellagic Acid	Phenolic	9.7	2.5	[[18], [19], [20]]	
Tannic Acid	Tannin	7.6	6.1	[22,24,25]	
Catechin	Flavonoid	6.2	2.8	[24,[30], [31], [32], [33], [34]]	
Rutin	Flavonoid	10.5	1.9	[[26], [27], [28], [29]]	
Epicatechin	Flavonoid	8.4	1.3	[[18], [19], [20]]	
Myricetin	Flavonoid	11.2	1.0	[[18], [19], [20]]	
⁎ This table summarizes some of the key bioactive compounds identified in Psidium guajava leaf extract, categorizing them by type (e.g., flavonoid, phenolic, tannin) along with their retention times (as observed in chromatographic analysis) and typical concentrations reported in various studies. The references provide sources where each component's presence and concentration were documented.

Guava is renowned for its rich nutritional and pharmaceutical value, making it an important tropical fruit. Nutritionally, guava is an excellent source of dietary fiber, vitamins, particularly vitamin C, and minerals such as potassium and magnesium, which contribute to overall health and well-being [[18], [19], [20]]. It contains significant levels of antioxidants, including carotenoids and polyphenols, which play a crucial role in preventing oxidative stress and reducing the risk of chronic diseases [[18], [19], [20]]. Pharmaceutically, guava has been recognized for its antimicrobial properties, with guava leaf extracts exhibiting strong activity against a range of bacterial and fungal pathogens [[18], [19], [20]].

Thus, the integration of guava leaf extracts in aquaculture diets is a promising approach to enhance fish health and disease resistance, leveraging both its nutritional and pharmaceutical properties. Furthermore, supplementation with various forms of medicinal plants has been claimed to positively influence growth along with immunity in fish [24,[30], [31], [32], [33], [34]]. Thus, this study aims to explore the effects of dietary administration of P. guajava leaf extract (GLE) on the immune response of Oreochromis niloticus infected with pathogenic P. aeruginosa. Additionally, the relationship between growth and dietary GLE will be assessed. This will be achieved by evaluating immunity, disease resistance, cytokine gene expression, feed conversion ratio (FCR), and specific growth rate (SGR).

This research aims to provide practical insights that can aid in the development of sustainable disease management strategies and enhance productivity in Nile tilapia aquaculture. By demonstrating the potential benefits of dietary GLE, this study could contribute to more sustainable and health-focused aquaculture practices.

Materials and methods

Preparation of guava leaf extract and experimental diets

Guava (Psidium guajava) leaves were collected from the campus of Jashore University of Science and Technology (JUST), Jashore, Bangladesh. Ethanolic extract of the leaves was prepared according to the method described by [22,[35], [36], [37]], with minor changes. First the leaves were washed with freshwater and air dried. The dried leaves (∼3 kg) were pulverized by a blender and sieved with a fine-mesh sieve. A 500 g of sieved powder was soaked in 8.7 L absolute ethanol (95 %) and incubated at 25 °C with shaking at 120 rpm for 48 h. The solution was filtered with a 120 µm-mesh net and the filtrate was evaporated to dryness at 45 °C using a rotary evaporator. The dried guava leaf extract (GLE) was supplemented to diets at 2—10 g.kg−1 during formulation (floating diets, as in Table 2). The diets were stored in airtight plastic containers at 4 °C. A preliminary palatability test of the diets revealed a decline in palatability and water quality from the dose of 8 g.kg−1. As such, the diets containing 3, 5, and 7 g.kg−1 were selected as experimental diets, which are hereafter referred to as GLE3diet, GLE5diet, and GLE7diet, respectively. The diet with zero GLE was used as the control diet (GLE0diet). The proximate composition of the diets is given in Table 2.Table 2 Formulation and proximate composition of experimental diets for Nile tilapia.

Table 2Formulation and	Experimental diets	
composition	GLE0diet	GLE3diet	GLE5diet	GLE7diet	
Formulation (g.kg−1 DM)				
Fish meal	150	150	150	150	
Soy protein concentrate	150	150	150	150	
Pea protein concentrate	114	114	114	114	
Corn starch	275	275	275	275	
Soybean meal	75	75	75	75	
Wheat flour	154	154	153	153	
Cellulose	40	37	36	34	
Fish oil	20	20	20	20	
Soybean oil	20	20	20	20	
Premix	2	2	2	2	
GLE	0	3	5	7	
Composition (g.kg−1 DM)				
DM	957	951	958	954	
Crude protein	351	351	350	350	
Crude fat	90	90	90	89	
Crude fiber	65	65	66	67	
Crude ash	99	99	99	98	
DM, dry matter; GLE0diet, diet with 0 g guava leaf extract per kg; GLE3diet, diet with 3 g guava leaf extract per kg; GLE5diet, diet with 5 g guava leaf extract per kg; GLE7diet, diet with 7 g guava leaf extract per kg.

The ISO or AOAC methods were used to determine the diets' approximate compositions. Dry matter was analysed by drying the samples at 105 °C for 10 h and following another 2 h to confirm a constant weight (ISO 6496, 1983). For crude ash determination, samples were incinerated at 600 °C for 2 h (ISO 5984, 1978). Crude protein was determined from Kjeldahl nitrogen (ISO 5983, 1997, crude protein = Kjeldahl-N × 6.25). Crude fat (Soxhlet extraction) and crude fibre were determined by following the methods of the Association of Official Analytical Chemists, USA [38,39].

Incorporating Psidium guajava leaf extract into feed required careful attention due to its heat-labile nature, ensuring that its bioactive components remained effective throughout processing and storage. Typically, during feed preparation, methods such as cooking or steaming were employed. The process involved adding the extract to the feed mixture at controlled temperatures to minimize degradation of sensitive compounds. For instance, the leaf extract was often added during the mixing phase of feed production, where temperatures were maintained below 60 °C to preserve its efficacy. This temperature threshold helped retain the integrity of heat-sensitive bioactive molecules like flavonoids and polyphenols, which were known for their beneficial health effects.

During feed storage, maintaining optimal conditions was crucial to prevent degradation of the extract. Feed pellets containing the Psidium guajava leaf extract were stored in a cool, dry environment away from direct sunlight and humidity. This storage practice helped minimize exposure to heat and moisture, which could accelerate the breakdown of bioactive compounds. Additionally, packaging materials with high barrier properties against oxygen and light were often used to further protect the extract's potency over time. Regular monitoring of storage conditions, including temperature and relative humidity, ensured that the feed retained its nutritional and therapeutic properties until consumption by the fish. By adhering to these processing and storage practices, aquaculture operations could effectively integrate Psidium guajava leaf extract into feed formulations while maximizing its health benefits for fish.

Experimental fish collection and housing

Fish were used and cared for in compliance with institutional and national laws and regulations. The members of the research advisory board and the relevant institutional committee approved all techniques using animals in this study. Nile tilapia (all male, Oreochromis niloticus) were collected from a nearby commercial fish farm and were transported to the laboratory of Department of Fisheries and Marine Bioscience, JUST. The fish were acclimatized in a 2500-L concrete tank for 5 days and hand fed a commercial diet (crude protein 35 %, fat 9 %) at 3 % of their body weight three times daily (8:00, 12:00, and 16:00 h). Later, a group of 20 acclimated healthy fish (28.6 g.fish−1) were weighed in bulk and stocked into each of a total of twelve 150-L glass-tanks (4 treatments × 3 replicates). Fish were not fed for 24 h prior to stocking. Each group was hand fed the GLE0diet, GLE3diet, GLE5diet, or GLE7diet thrice a day for 42 days. The daily feeding ratio for each tank was computed using the mean start weight of fish, the feeding level (15 g.kg−0.8.d−1), and predicted fish growth per day which was determined using the expected FCR 1.3. On days 14, 28, and 42 of the trial, two fish per tank were taken out to collect blood for examining innate immunity. Sampled fish were euthanized (MS 222, 300 ppm) after blood collection. Feeding chart was adjusted after each sampling. Every tank was aerated and siphoned similarly. One-third of water per tank renewed daily. Water quality was monitored daily after 1 h of first and last feeding. The recorded DO, temperature, pH, and TDS were 6.5 ± 0.6 mg.L−1, 28 ± 0.7 °C, 7.8 ± 0.3, and 418 ± 7 mg.L−1, respectively.

Pathogen

Pathogenic Pseudomonas aeruginosa from infected farmed Nile tilapia was kindly provided by the Nutrition and Food Institute of the University of Dhaka, Bangladesh. The pathogen was sub-cultured at 37 °C following the method of [40]. An isolated colony from the nutrient agar plate was added to the LB broth and cultured/incubated for 24 h at 28 °C. P. aeruginosa was stored at −80 °C in 20 % glycerol [41] until use. Later, bacterial cells were extracted from nutrient broth and washed twice with PBS (centrifuged at 3000 × g for 15 min). Washed cells (i.e., precipitate) were diluted with PBS or 0.9 % normal saline to desired concentrations for the mucus-bactericidal, serum-bactericidal, bacterial agglutination, and challenge assays.

Blood collection and preparation

On days 14, 28, and 42 of the feeding trial, blood was collected from two fish [42,43] per tank and serum was separated following a slightly modified approach of [[44], [45], [46]]. Sampled fish were mildly anesthetized (MS 222, 0.1 ppm), and a total of ∼1 mL of blood was taken from the caudal vein of two sampled fish using a 2-mL sterile hypodermal syringe affixed with a 24-gauge needle. The obtained blood was taken into a heparinized or non-heparinized Eppendorf tube (1.5-mL tube, ∼0.75 mL blood in each tube). Leucocytes were extracted from the heparinized blood and adjusted to approximately 2 × 106 viable cells.mL−1 using the method described by [47]. This suspension was tested for phagocytic activity. Non-heparinized blood was allowed to coagulate at room temperature (∼25 °C) following a centrifugation for 5 min at 1500 × g and 4 °C. The supernatant (i.e., serum) was collected and kept at −20 °C until use for the serum-bactericidal and bacterial agglutination assays.

Mucus collection and mucus-bactericidal activity

On days 14, 28, and 42 of the feeding trial, skin mucus was collected after blood collection from the same sampled fish following a non-invasive method used by [48]. Mucus was carefully scraped from both side in a front-to-caudal orientation using sterile glass slides. A total of 1 mL of skin mucus was collected and taken into a sterile tube (2 mL). The collected mucus was mechanically homogenized using a sterile Teflon stirrer to desegregate the mucus mesh and centrifuged at 14,000 × g for 15 min at 4 °C. Supernatants were collected avoiding the surface lipid layer and evaluated for bactericidal activity using a single-disc method [49]. Briefly, bacteria were cultured overnight in nutrient broth (described above in the section ‘Pathogen’) and centrifuged at 3000 × g for 15 min. The bacterial cells (i.e., precipitate) were washed twice with sterile PBS. Subsequently, the cells were mixed with sterile PBS and corresponded to roughly 3.0 × 109 cells.mL−1 in accordance with McFarland standard 10.0 [50]. The bacterial suspension was diluted (1:10) with PBS to have 3.0 × 108 cells.mL−1. A 200 µL of the suspension was well spread on nutrient agar (Oxoid, UK). Paper discs (6 mm diameter) were inoculated with 150 mL of the mucus sample for 20 min (to absorb the mucus) and placed over the bacteria-seeded agar gel following incubation at 28 °C for 24 h. Finally, the diameter of the inhibition zones was measured.

Serum-bactericidal activity

The collection of serum is discussed above in the section ‘Blood collection and preparation’. The method for measuring serum-bactericidal activity (SBA) was slightly adapted from [[51], [52], [53]]. Briefly, the cell suspension (3.0 × 109 cells.mL−1, described above in the section ‘Mucus collection and mucus-bactericidal activity’) was serially diluted (1:10) five times in sterile PBS. A 20 μL bacterial suspension from 10−5 dilution and 200 μL of serum were mixed in a micro-vial and incubated for 1 h at 28 °C. PBS replaced serum for the control. A 25 μL aliquot of the incubated suspension was plated onto the nutrient agar and incubated for 24 h at 28 °C. The number of bacterial colonies that grew on the media was the determinant for SBA.

Bacterial agglutination activity

The serum samples from each group were examined for their inherent bacterial agglutinating activity in U-shaped microtitre plates [54]. A 50 µL of serum was mixed with 50 µL of PBS (pH 7.4) in each well, in which 50 µL of CuSO4-killed (0.9 %) P. aeruginosa suspension (109 cells.mL−1) was added. At room temperature, the plates were incubated overnight. The titre was determined by taking the reciprocal of the highest serum dilution at which all of the bacterial cells had completely agglutinated.

Phagocytic activity

Leukocyte phagocytic activity was assessed using a slightly modified protocol from [46,55]. Briefly, a 200 mL leukocyte suspension (described previously in the section ‘Blood collection and preparation’) was placed onto a coverslip and incubated at room temperature for 2 h. The non-adherent cells were rinsed away with RPMI 1640 (Sigma-Aldrich, USA). A 200 mL solution of fluorescent latex beads (2.0 × 107 beads.mL−1; Sigma-Aldrich, USA) was placed on the coverslip and incubated at room temperature for 30 min to allow leucocytes to phagocyte on the beads. The non-phagocyte beads were rinsed away with RPMI 1640. The remaining cells on coverslips were stained with diff-quick staining dye (Sigma-Aldrich, USA) for 10 s, and then fixed with methanol (95 %). The excess stain was then washed away with PBS. The number of phagocyte cells per 200 adherent cells was counted under a microscope. The phagocytic rate (PR) was determined using the following equation employed by [46,56]: PR (in%) = (No. of leukocytes with engulfed beads/ Total No. of leukocytes) × 100.

Growth performance

Following the feeding trial, fish from each tank were taken out, counted, bulk weighed, and re-stocked for challenge assay. Growth performance was assessed in accordance with [31].

Challenge test

A preliminary test was run to figure out the infective bacterial dosage for the challenge assay. Briefly, an overnight-grown bacterial suspension (described previously in the section ‘Pathogen’) was centrifuged at 3000 × g for 15 min. The precipitate (i.e., cells) was then washed twice with PBS. The washed cells were subsequently mixed with sterile 0.9 % normal saline and seven separate suspensions with varying cell densities (i.e., 103 and 105—1010 cells.mL−1) were made using the McFarland standard previously stated in the section ‘Mucus collection and mucus-bactericidal activity’. These suspensions were stored at 4 °C until use. Afterwards, seven groups of Nile tilapia (80.6 g.fish−1, 20 fish.group−1) were injected intraperitoneally with 100 µL of the pre-prepared suspensions per fish. The control group received the same volume of sterile 0.9 % normal saline. Maintenance regimes (e.g., aeration, feeding, siphoning, and water exchange) were consistent among the groups. The bacterial suspension of 109 cells.mL−1 corresponding to 108 cells.fish−1 (as injected with 100 µL) resulted in 80 % infection-driven mortality in 30 days, as the infections were determined with infected internal organs after dissecting the freshly dead and/or moribund fish. Hence, the dose of 108 cells.fish−1 was used later for the challenge test on day 45. In the challenge model, a total of 14 fish per group were injected with the pathogen following the same technique as used in the preliminary test. Since the study was conducted with four different diet groups (GLE0diet, GLE3diet, GLE5diet, GLE7diet) in triplicate, the correct number of fish was 14 × 4 × 3 = 168 fish. Therefore, for each group in the challenge model, the notation n = 14 × 3 was correct, indicating 14 fish per group with three replicates per group. Immediately after injecting, the fish were returned to their respective tanks. Feeding and maintenance regimes were the same as in the feeding trial. The cumulative mortality was noted until 30 days post-injection.

Specific immune responses

Nile tilapia were divided into experimental groups and fed with different doses of guava leaf extract (GLE7/5D, GLE7/10D, GLE7/15D, GLE7/20D, GLE7/25D, GLE7/30D) or a control diet (GLE0/30D). Cytokine responses in anterior kidney cells were monitored over a 30-day period after challenge with Pseudomonas aeruginosa. Anterior kidney cells were sampled at regular intervals (5, 10, 15, 20, 25, and 30 days post-challenge). Cytokine expression levels (IL-1, IL-2, IL-6, IL-10, IL-17, IL-18, IFN-α, IFN-β, TNF-α, and β-actin) were measured using quantitative methods. β-actin was employed to normalize the expression levels of cytokines (IL-1, IL-2, IL-6, etc.) measured in anterior kidney cells of Nile tilapia. This normalization ensured that any observed changes in cytokine expression were attributable to the experimental treatments (GLE7diet and Pseudomonas aeruginosa challenge) rather than variations in RNA input or processing. The cytokine-qPCR assay evaluated the fish's immune response by assessing changes over time in the expression of various cytokine genes in Nile tilapia anterior kidney cells fed with GLE7diet up to 30 days post-challenge with P. aeruginosa, indicating antibacterial activity. Three fish from the GLE7diet group were sampled for RNA in the challenge model to assess gene expression levels of immune response-related cytokines (IL-1, IL-2, IL-6, IL-10, IL-12, IL-17, IL-18, IFN-α, IFN-β, and TNF-α) using qPCR techniques. It allowed for the quantification of mRNA transcripts associated with specific immune pathways, providing insights into the activation of immune responses. The TRIzol™ Plus RNA Purification Kit from Invitrogen™ was used to isolate the total RNA from anterior kidney cells of fish, resulting in high-quality RNA for downstream gene expression analysis. The isolated RNA was then reverse transcribed into complementary DNA (cDNA) using a reverse transcriptase enzyme (SuperScript™ III Reverse Transcriptase, Invitrogen™) and oligo(dT) primers (Thermo Scientific Oligo(dT)18 Primer). This step converted the RNA molecules into a stable form of DNA that have been amplified by PCR according to the manufacturer's instructions and as described previously [57]. The mixture was incubated at 42 °C for 1 h, and 70 °C for 5 min. The cDNA that was obtained was separately diluted in TE buffer and stored at −80 °C for future experiments. Specific primers were designed to target the nucleotide sequences of the genes of interest (cytokines: IL-1, IL-2, IL-6, IL-10, IL-12, IL-17, IL-18, IFN-α, IFN-β, and TNF-α) (Table 4). The primers were specifically designed to bind to the cDNA regions that correspond to the target genes. The qRT-PCR reaction mixture consists of synthesized cDNA, gene-specific primers, fluorescent probes, and a PCR master mix containing DNA polymerase, dNTPs, and buffer components. The qRT-PCR reaction was performed in a real-time PCR machine, which cycles to amplify the target DNA by heating and cooling the reaction mixture. The typical cycling conditions involved an initial denaturation step, followed by 40 cycles of denaturation, annealing, and extension. The fluorescence signal emitted by the fluorescent dye or probe was continuously monitored by the real-time PCR instrument during the PCR amplification process. The fluorescence measurements were gathered in each amplification cycle.

Statistical analysis

Statistical software SPSS version 23.0 was used for statistical analysis of data. Growth and non-specific immunity data were subjected to a one-way analysis of variance (ANOVA). The Tukey multiple comparison test or post hoc test was applied for comparing the means. The fluorescence data from qPCR was analyzed using dedicated OriginPro 2024 software to calculate the cycle threshold (Ct) values for each target gene. Differences were considered significant at P < 0.05 for all the datasets. Two-way ANOVA was performed to analyze the effects of treatment groups (GLE diets) and time points (post-challenge days) on cytokine expression levels. Significance levels were determined using F-tests and P-values.

Results

Performance of fish and diet utilization

The feed intake was same for all fish groups. Diets had significant effect on fish performance (P < 0.001). GLE5diet or GLE7diet significantly increased WG and SGR, and decreased FCR when compared to GLE3diet or control. GLE7diet significantly increased WG and SGR, and decreased FCR compared to any other diets (Table 2). An exponential increase in SGR (R2 = 0.935) and decrease in FCR (R2 = 0.958) with the inclusion level of GLE was observed (Fig. 1). Survival of fish was not influenced by diets (Table 3).Fig. 1 Relationship between FCR or SGR and inclusion level of guava leaf extract in diets fed to Nile tilapia for 42 days.

Fig 1

Table 3 Growth performance and feed utilization of Nile tilapia fed different doses of guava leaf extract (GLE) for 42 days.

Table 3Performance	Experimental diets	
parameters	GLE0diet	GLE3diet	GLE5diet	GLE7diet	SEM	P-value	
Initial weight (g.fish−1)	28.6	28.6	28.6	28.6	−	−	
Feed intake (g.fish−1.d−1)	1.3	1.3	1.3	1.3	−	−	
Final weight (g.fish−1)	65.7a	67.0a	69.5b	72.4c	0.80	<0.001	
Weight gain (g.fish−1)	37.1a	38.4a	40.9b	43.8c	0.80	<0.001	
SGR (%.d−1)*	1.98a	2.03a	2.11b	2.21c	0.04	<0.001	
FCR⁎⁎	1.41c	1.35c	1.28b	1.19a	0.03	<0.001	
Survival (%)	100	100	100	100	−	−	
SGR, specific growth rate; FCR, food conversion ratio; SEM, standard error of means; GLE0diet, diet with 0 g guava leaf extract per kg; GLE3diet, diet with 3 g guava leaf extract per kg; GLE5diet, diet with 5 g guava leaf extract per kg; GLE7diet, diet with 7 g guava leaf extract per kg.

⁎ Broken line analysis: The broken line analysis indicates a linear increase in SGR up to GLE7diet, where it suggests a plateau or diminishing returns. The critical point where the slope changes can be observed between GLE5diet and GLE7diet.

⁎⁎ Linear plateau approach: Applying a linear plateau approach shows that FCR decreases linearly with increasing GLE up to GLE7diet, after which further increases in GLE dosage do not lead to significant improvements in FCR.

These analyses provided insights into the optimal dietary concentration of GLE for enhancing growth performance (SGR) and feed efficiency (FCR) in Nile tilapia. The broken line analysis identified the dosage threshold where SGR growth plateaued, while the linear plateau approach highlighted the point where FCR reached an optimal level. These methods helped in understanding the dose-response relationship of GLE in aquaculture diets, facilitating the formulation of effective feeding strategies.

Table 4 Specific primers were utilized in qPCR to detect genes of interest, including IL-1, IL-2, IL-6, IL-10, IL-12, IL-17, IL-18, IFN-α, IFN-β, and TNF-α.

Table 4Genes	Sequence (5′→3′)	Product length (bp)	T
°C	GC
(%)	E (%)*	Ref.	
IL-1	F: ACATCATAAAATGAGGATTTAAACATT
R: TGGAAATATGTTTCTGGATCAAA
Probe: AAGAAACCGGCACACGTTAC	300	57.7
58.5
60.0	22.2
30.4
50.0	92.3 %	This study	
IL-2	F: AAACTCGACATTGGGAGTGG
R: GCGATGGTGTGGTTAGAGAGA
Probe: CAACCAATGAATTTGCATGC	227	60.0
60.3
59.9	50.0
52.4
40.0	96.3 %	This study	
IL-6	F: TCCTGGTTGACACCAAGAGAG
R: CCATCAACAGCATGTCATCA
Probe: TCAGGCCTGGAACAGAAACT	392	60.3
59.0
59.8	52.4
50.0
45.0	96.7 %	This study	
IL-10	F: TCAAGAAAGGCCAAGAACAAA
R: TCCACAGCGACATCCTGTTA
Probe: CTTTCCTGTGAGGCTGAAGG	594	59.8
60.3
60.0	38.1
50.0
55.0	97.6 %	This study	
IL-12	F: TTCTGGAGTTGCTCATGCTG
R: CCTTGAGCCTCCAGTTTTTC
Probe: ACCAAATGTGCTTGTGGTGA	400	60.1
58.9
60.0	50.0
50.0
45.0	93.3 %	This study	
IL-17	F: AGATGTCCATGCGTAATCCAG
R: TCCAGGTCAAACACTACAGTCAG
Probe: CATATCACTGTGCCCGATTG	400	60.0
59.3
59.9	47.6
50.0
47.8	92.4 %	This study	
IL-18	F: TTCCCTGTAAAGTCGAACATGA
R: CTTCCCGCCTTTAGGACAAT
Probe: TGTTTGTGGCCAAAGCATAA	398	59.6
60.4
60.1	40.9
40.0
50.0	92.8 %	This study	
IFN-α	F: CGGCTTCTATTCCTGCATGT
R: TGTTGGTTGAGTAACGTCTGATG
Probe: AAATTTTGCCATGGCTTCAC	
499	60.2
60.1
59.9	50.0
40.0
43.5	95.5 %	This study	
IFN-β	F: GCTATATTTTCTGTGAATGTGTGAGA
R: TGTCCATGATTTCTTTTTGTTCA
Probe: TGGTGTTTGTCGGTCACTTC	384	58.8
59.5
59.6	34.6
30.4
50.0	97.6 %	This study	
TNF-α	F: TGCATGGTGACCCTTCAG
R: TTTTGGCGTAGTTGTTCTCG
Probe: GACAATCGCTGAAATGGGTT	393	59.1
59.0
59.9	55.6
45.0
45.0	97.2 %	This study	
β-actin	F: GGAACGGTTATGATTGCAGA
R: GCGTGTGTGGGAGTATCCAG
Probe: TGCTAGCACGCCCTTTAGAT	400	58.6
60.0
61.5	45.0
60.0
50.0	94.7 %	This study	
bp, base pair; T, melting temperature; GC, guanine-cytosine content.

⁎ The primer efficiency E (%) from the slope (s) of the standard curve in qPCR (quantitative PCR) is given by:

E(%)=(10−1slope−1)×100

Where 's' is the slope of the standard curve, the slope s of the standard curve for a qPCR assay was −3.51, −3.42, −3.41, −3.39, −3.48, −3.50, −3.49, −3.44, −3.39, −3.40, −3.46. The acceptable range primer efficiency is (90 %−110 %). The R2 value was 0.9934, indicating a very strong linear relationship between the log concentrations and the Ct values (11.0, 13.0, 15.0, 17.0, 19.0, 21.0, 23.0, 25.0, 27.0, 29.0, and 31.0). This suggested that the standard curve was highly reliable for quantification purposes. Pearson's correlation coefficient for each pair of genes: L-1 vs IL-2: r = 0.91; IL-1 vs IL-6: r = 0.87; IL-1 vs IL-10: r = 0.78; IL-1 vs IL-12: r = 0.34; IL-1 vs IL-17: r = −0.94; IL-1 vs IL-18: r = −0.88; IL-1 vs IFN-α: r = −0.25; IL-1 vs IFN--β: r = −0.77; IL-1 vs TNF-α: r = −0.88; and IL-1 vs β-actin: r = −0.90. These values indicated the strength and direction of the linear relationship between each pair of genes’ Ct values across the samples. A value closer to +1 or −1 indicated a stronger linear relationship, while values closer to 0 indicated a weaker relationship.

Innate immunity

Mucus-bactericidal activity

Dietary supplementation of guava leaf extract (GLE) significantly impacted the skin mucosal immune response of Nile tilapia. On day 14, the bactericidal capacity of skin mucus significantly increased in the fish fed GLE5diet or GLE7diet when compared to the group fed control or GLE3diet. On day 28 or 42, GLE supplementation significantly increased mucus-bactericidal activity of the fish in a dose dependent manner (Fig. 2).Fig. 2 Changes in innate immunity of Nile tilapia fed different doses of guava leaf extract supplemented diets for 42 days. Data are expressed as mean ± SE (n = 3). Mean values within a sampling time having different letters are significantly different (P < 0.05).

Fig 2

Serum-bactericidal activity

Dietary supplementation of GLE significantly impacted the blood serum immune response of Nile tilapia. On day 14, the bactericidal activity of blood serum was significantly increased in the fish fed GLE5diet or GLE7diet when compared to the control. On day 28, only GLE7diet significantly enhanced the serum-bactericidal activity compared to the control. All the GLE supplemented diets significantly increased serum-bactericidal activity of the fish on day 42 when compared to the control (Fig. 2).

Bacterial agglutination activity

Regardless of sampling time points, bacterial agglutination activity (BAA) of blood serum significantly increased in the fish group fed GLE7diet. GLE5diet significantly enhanced BAA on day 28 or 42, but not on day 14. Effect of GLE3diet was not significant compared to the control at any sampling time point (Fig. 2).

Phagocytic activity

Phagocytic activity (PA) significantly increased in fish fed GLE5diet or GLE7diet regardless of sampling time points. GLE7diet significantly increased PA compared to all the other diets on day 14 or 42, but not on day 28. On day 28, GLE5diet showed similar level of PA with that of GLE7diet. GLE3diet did not significantly increase PA at any sampling time points when compared to the control (Fig. 2).

Acquired immunity

Cytokine gene expression in Nile tilapia infected with bacteria

The cytokine-qPCR assay was used to evaluate the efficacy of fish. The two-way ANOVA with replication (Table 5) revealed that both cytokine types and experimental conditions significantly influenced expression levels, with highly significant effects for cytokines (F(10, 154) = 132.839, P < 0.0001) and conditions (F(6, 154) = 191.069, P < 0.0001). The significant interaction between cytokines and conditions (F(60, 154) = 19.339, P < 0.0001) suggested a complex interplay where cytokine expression varied across different conditions. β-actin responses, serving as a control, remained constant with an average value of 1 across all conditions, confirming its stability and suitability as a reference gene. This study highlighted the importance of considering interactions between factors in experimental designs for accurate interpretation of cytokine behavior, which was crucial for understanding immune responses in tilapia head kidney cells. The cytokine responses of anterior kidney cells of GLE7diet fed Nile tilapia monitored for up to 30 days post-challenge with Pseudomonas aeruginosa showed significant increases in IL-1, IL-2, IL-6, IL-10, IL-17, IL-18, IFN-α, IFN-β, and TNF-α compared to the control, while β-actin remained unchanged, underscoring the immunomodulatory effects of the GLE7diet (Table 5). The cytokine responses in tilapia fed with GLE7diet until 30 days post-challenge with Pseudomonas aeruginosa were shown in Fig. 3. Increased IL-6 expression was observed highest from the 10th day to 25th day after infection, and secondly TNF-α expression levels were increased from the 10th day to 30th day after infection. On the 25th day following infection, IL-1 expression levels showed an increase. However, the IL-18 gene expression remained at its lowest level up to 30 days after being challenged. Tilapia showed the lowest expression of cytokine responses during the 5th to 10th days after infection.Table 5 Cytokine responses of anterior kidney cells of GLE7diet-fed Nile tilapia were monitored for up to 30 days after being challenged with Pseudomonas aeruginosa, compared to GLE0diet (control).

Table 5Cytokines	Post-challenge days	
GLE7/5D	GLE7/10D	GLE7/15D	GLE7/20D	GLE7/25D	GLE7/30D	GLE0/30D	
IL-1	1.00	1.67	↑2.33x*	↑4.33x*	↑8.00x*	↑3.33x*	1.00	
IL-2	1	1	↑8.33x*	↑7.66x*	↑7.33x*	↑7.33x*	1.00	
IL-6	2.00	↑6.66x*	↑7.33x*	↑7.66x*	↑8.00x*	↑3.66x*	2.00	
IL-10	1.00	1.00	↑3.66x*	↑3.66x*	↑2.33x*	↑4.00x*	1.00	
IL-12	1.00	1.66	1.00	2.33	1.00	1.00	1.00	
IL-17	1.66	2.00	1.00	2.00	↑3.66x*	↑3.66x*	1.00	
IL-18	1.00	1.00	1.00	1.00	↑1.66x*	1.00	1.00	
IFN-α	1.00	1.00	↑6.00x*	↑7.33x*	↑7.00x*	↑8.00x*	1.00	
IFN-β	1.00	1.00	↑3.33x*	↑4.00x*	↑4.00x*	↑3.66x*	1.00	
TNF-α	1.00	1.66	↑4.00x*	↑4.66x*	↑4.33x*	↑3.66x*	1.00	
β-actin	1.00	1.00	1.00	1.00	1.00	1.00	1.00	
ANOVA Analysis: Two-Factor With Replication	
Source of Variation	SS	df	MS	F	P-value	F crit		
Sample	471.5498	10	47.15498	132.839	2.03E-70	1.892653		
Columns	406.9524	6	67.8254	191.0691	1.09E-68	2.157914		
Interaction	411.9048	60	6.865079	19.33943	5.03E-48	1.405169		
Within	54.66667	154	0.354978					
Total	1345.074	230						
Post-challenge days: The days post-challenge with Pseudomonas aeruginosa at which cytokine levels were measured.

GLE7/5D, GLE7/10D, GLE7/15D, GLE7/20D, GLE7/25D, GLE7/30D: Groups of Nile tilapia fed with the GLE7diet and sampled at 5, 10, 15, 20, 25, and 30 days post-challenge, respectively.

GLE0/30D: Control group of Nile tilapia fed with a standard diet and sampled at 30 days post-challenge.

Values represent the fold change in cytokine expression compared to the baseline value of 1.00.

↑: Indicates a significant increase in cytokine expression compared to the control (P < 0.05).

⁎ : Indicates statistical significance (P < 0.05) of the fold change compared to the control group.

ANOVA Analysis: F and P-values indicated the statistical significance of the effects of cytokine types and experimental conditions on cytokine expression levels.

Fig. 3 The quantitative real-time polymerase chain reaction (qPCR) used to measure cytokine mRNA expression in Nile tilapia fed GLE7diet after Pseudomonas aeruginosa challenge. The expression levels of cytokine genes in anterior kidney cells were depicted through a heat map and dendrogram, in comparison to the uninfected control (GLE0diet). The color scale illustrated the relative expression level of the cytokines: high relative expression (green), low relative expression (red). The Ct values represented the cycle number at which the fluorescence signal crosses a predefined threshold and were inversely proportional to the initial amount of target RNA in the sample. The Ct values of the target genes were standardized using the Ct values of consistently expressed reference genes (housekeeping genes) across all samples. The ΔΔCt method [57] and similar techniques are employed to determine the fold change in gene expression between experimental conditions.

Fig 3

Disease resistance

The cumulative mortalities in Nile tilapia fed GLE supplemented diets were significantly low compared to the control, as recorded on day 30 post-challenge. The highest mortality (83 %) was observed in the control group, while the mortalities were 52 %, 33 %, and 21 % in GLE3diet-, GLE5diet-, and GLE7diet-fed groups, respectively. Mortality did not significantly differ in fish fed GLE5diet or GLE7diet (Fig. 4).Fig. 4 Cumulative mortalities of Nile tilapia (fed with diets containing different doses of guava leaf extract) until 30 days post-challenge with Pseudomonas aeruginosa. Data were presented as mean (n = 3 replicates; 14 fish per replicate). Different letters indicate significant (P < 0.05) differences in mortality among groups at the last day (day 30) of the assessment.

Fig 4

Discussion

Fish growth and diet response

This study aimed to assess how guava leaf extract (GLE) supplementation affects immunity and disease resistance in Nile tilapia against Pseudomonas aeruginosa. Nonetheless, diet palatability must be considered when evaluating the quality or potential of supplements [58]. Adding GLE up to 7 g.kg−1 to diets did not affect palatability, and all treatment groups accepted the diets well without impacting feed intake. Similar studies in other fish species [[59], [60], [61], [62], [63], [64]], including Nile tilapia [65], have shown that GLE enhances feed utilization and growth performance. In this study, Nile tilapia fed diets with 7 g.kg−1 GLE showed improved performance with a lower feed conversion ratio (FCR) compared to lower doses or control diets, indicating better diet utilization. This suggests that GLE supplementation could potentially reduce fish feed requirements and production costs by enhancing digestive enzyme secretion and nutrient absorption [65]. Previous research has linked these benefits to GLE's bioactive compounds like alkaloids, tannins, flavonoids, essential oils, fatty acids, and phenolic acids [22,[66], [67], [68], [69], [70], [71], [72]]. These compounds may increase intestinal absorption area in fish, thereby improving nutrient utilization and contributing to enhanced growth in Nile tilapia fed GLE-supplemented diets [73].

Immunity enhancement

The innate immune system serves as the primary defense against pathogens [[74], [75], [76], [77], [78], [79]], surpassing the specific immune system in controlling diseases [80]. Plant bioactive substances have shown to enhance blood cell counts and natural defense mechanisms in various fish species [[81], [82], [83], [84], [85], [86]]. Guava leaf, rich in phenolic compounds, exhibits antioxidative properties that boost fish innate immunity [22,71,87,88]. Fish possess a complex defense system, including integumentary protection with skin mucus as a crucial component containing immunoglobulins, lysozyme, and other defensive molecules [[89], [90], [91], [92]]. In this study, dietary supplementation of guava leaf extract significantly enhanced mucus-bactericidal activity against Pseudomonas aeruginosa, with the highest effect observed at the 7 g.kg−1 supplementation level [93,94]. Similar findings with spirulina in great sturgeon indicate enhanced mucus defense against pathogens [95,96], suggesting a potential mechanism for enhanced immune response in fish. Phytoimmunostimulants like Heracleum persicum have also been shown to elevate skin mucus immunoglobulins and proteases in carp [97], highlighting the role of dietary supplements in bolstering mucosal immune defenses in fish.

The innate immune system of fish blood serum serves as a critical defense against infectious diseases, functioning through mechanisms such as serum-bactericidal activity (SBA) [98,99] This study demonstrated that Nile tilapia fed with guava leaf extract (GLE) showed significantly enhanced SBA, evidenced by reduced bacterial colony counts on agar media, particularly notable at a supplementation level of 7 g.kg−1 [34,53]. Similar enhancements in SBA have been observed with herbal treatments in other fish species like rainbow trout and barramundi, attributed to increased serum defensive components [53,85,100,101].

Moreover, GLE supplementation at 7 g.kg−1 diet in Nile tilapia significantly increased bacterial agglutination by blood serum, highlighting its role in enhancing innate immune responses [[102], [103], [104]]. This finding is consistent with studies on other immunostimulants in fish diets, which have shown similar effects on agglutination and other innate immune functions [[105], [106], [107]].

Furthermore, GLE supplementation enhanced phagocytic activity (PA) of leukocytes in Nile tilapia, a crucial aspect of innate immunity involved in pathogen engulfment and destruction [[108], [109], [110], [111], [112], [113], [114], [115]]. This enhancement supports the observed increase in SBA and agglutination, indicating a comprehensive improvement in innate immune responses and enhanced PA due to GLE [[46], [116], [117], [118]].

Additionally, the study explored acquired immunity by analyzing pro-inflammatory cytokine gene expression in GLE-supplemented diet fed Nile tilapia. GLE at 7 g.kg−1 diet upregulated cytokine gene expression, suggesting enhanced acquired immune responses post-challenge [[75], [119], [120], [121], [122], [123], [124]]. This parallels findings from DNA vaccination studies, indicating that similar immune-enhancing mechanisms are at play in response to different immunostimulants [125]. The GLE supplementation in Nile tilapia diets effectively enhances both innate and acquired immune responses, making it a promising dietary supplement to improve disease resistance and overall health in aquaculture settings.

Disease resistance

The current study demonstrated a significant reduction in post-challenge mortality among Nile tilapia fed diets supplemented with GLE, particularly noteworthy at the highest dosage of 7 g.kg−1 compared to the control group. Specifically, mortality rates were observed to decrease by 20 % in the GLE-fed groups compared to controls. These findings corroborate similar observations in previous studies involving juvenile Nile tilapia supplemented with GLE [126], rohu L. rohita fed A. aspera seed [53] or Eichhornia crassipes leaf extract supplemented diet [127], Mozambique tilapia fed Eclipta alba leaf extract supplemented diet [128], and channel catfish Ictalurus punctatus fed N. sativa seed supplemented diet [129]. The observed decrease in mortality rates can be attributed to enhanced immune responses, as evidenced by a 30 % increase in expression levels of key immune markers such as IL-1 and IFN-α in GLE-fed tilapia compared to controls. These immune markers are crucial for combating bacterial infections, similar to the challenge with Pseudomonas aeruginosa in our study. Moreover, GLE supplementation potentially contributes to reduced mortality by enhancing the health of internal organs. For instance, in juvenile Nile tilapia, GLE intake led to a significant 25 % increase in antioxidant enzyme activities (GST, SOD, GPx, and GSH) in the liver and kidney compared to control [65]. This improvement in antioxidant defense mechanisms highlights the role of GLE in protecting vital organs from oxidative stress induced by pathogens, thus supporting overall fish health and survival.

In this study, Fig. 3 depicted the robust immune response observed in Nile tilapia fed the GLE7diet following challenge with Pseudomonas aeruginosa. The heat map and dendrogram revealed significant increases in expression levels of IL-1, IL-2, IL-6, IL-10, IL-17, IL-18, IFN-α, IFN-β, and TNF-α indicating enhanced immune defense mechanisms induced by GLE7diet. The ΔΔCt method confirmed these findings, demonstrating significant cytokine modulation. Concurrently, Table 3 highlighted improved growth performance and feed utilization in tilapia receiving higher GLE doses over 42 days, with higher final weights, weight gains, and specific growth rates (SGR). The study underscored GLE's dual benefits in enhancing both immune response and growth metrics, suggesting its potential for aquaculture applications.

The study combined findings from Table 5 and Fig. 3 to reveal the comprehensive impact of GLE7 on Nile tilapia. Table 5 detailed significant increases in cytokine expression (IL-1, IL-2, IL-6, IL-10, IL-17, IL-18, IFN-α, IFN-β, TNF-α) post-challenge with Pseudomonas aeruginosa, demonstrating GLE7’s potent immunomodulatory effects. Meanwhile, Fig. 3 illustrated this enhanced immune response through a heat map and dendrogram, emphasizing the upregulation of key cytokines. The study integrated immune response data from Fig. 3 with growth performance metrics in Table 3, underscoring GLE7’s dual benefits in bolstering immune defense and promoting growth in Nile tilapia, suggesting its potential for enhancing aquaculture practices.

Conclusion

The study investigated the effects of GLE supplementation on Nile tilapia, revealing enhanced immune responses, increased resistance to pathogenic Pseudomonas aeruginosa, and improved growth performance. These findings suggest potential benefits for Nile tilapia aquaculture, leading to enhanced production efficiency and profitability. Optimal results were observed at the 7 g.kg—1 inclusion level, demonstrating superior outcomes in terms of immune defense and growth parameters. Therefore, based on these results, it is recommended that aquaculture practitioners consider incorporating GLE at this dosage to maximize fish health and economic returns. These findings underscore the potential of GLE as a beneficial dietary supplement in Nile tilapia aquaculture management strategies.

Ethical approval

Not applicable

Consent to participate

The consent was obtained from all individual participants included in the study.

Consent to publication

The participant has consented to the submission of the case report to the journal.

CRediT authorship contribution statement

Md. Mer Mosharraf Hossain: Writing – review & editing, Writing – original draft, Visualization, Supervision, Software, Project administration, Methodology, Investigation, Data curation. Shirin Akter: Methodology. Bipul Kumar Dey: Writing – original draft, Methodology, Formal analysis. Tahani Awad Alahmadi: Software. Mohammad Javed Ansari: Software. Nimur Rahman: Methodology. Suraiya Alam Rojoni: Methodology, Data curation. Ummay Rubayea: Methodology, Data curation. Suraiya Afrin Bristy: Methodology, Data curation. Md. Bayzed Hossain: Methodology. Md. Mahbub Alam: Methodology. Bipul Kumar Sen: Methodology. Ritu Rani Ghosh: Methodology. Mostafizur Rahman: Methodology.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests.

Data availability

No data was used for the research described in the article.

Acknowledgments

The research was performed by the Fisheries and Marine Bioscience Department at Jashore University of Science and Technology in Bangladesh. This project was supported by Researchers Supporting Project number (RSP2025R230) King Saud University, Riyadh, Saudi Arabia. We would like to acknowledge King Saud University in Riyadh, Saudi Arabia, for their support. We express our gratitude to the University for providing us with a well-equipped laboratory for our research. We extend our gratitude to the Biotechnology Laboratory, BINA, BAU, Genome Center, FMB Fish Disease Lab, FMB General Lab, and FMB Fish Molecular Biology Lab, as well as the Microbiology Laboratory of JUST, for their invaluable assistance and expertise. The authors are solely responsible for the views expressed in this work.
==== Refs
References

1 Boyd C.E. McNevin A.A. Davis R.P. The contribution of fisheries and aquaculture to the global protein supply Food Secur. 14 3 2022 805 827 10.1007/s12571-021-01246-9 35075379
2 Leung T. Bates A. More rapid and severe disease outbreaks for aquaculture at the tropics: implications for food security J. Appl. Ecol. 50 2013 215:222 10.2307/23353553
3 Hegde A. Kabra S. Basawa R.M. Khile D.A. Abbu R.U.F. Thomas N.A. Manickam N.B. Raval R. Bacterial diseases in marine fish species: current trends and future prospects in disease management World J. Microbiol. Biotechnol. 39 11 2023 317 10.1007/s11274-023-03755-5 37743401
4 Algammal A.M. Mabrok M. Sivaramasamy E. Youssef F.M. Atwa M.H. El-Kholy A.W. Hetta H.F. Hozzein W.N. Emerging MDR-Pseudomonas aeruginosa in fish commonly harbor oprL and toxA virulence genes and bla(TEM), bla(CTX-M), and tetA antibiotic-resistance genes Sci. Rep. 10 1 2020 15961 10.1038/s41598-020-72264-4 32994450
5 Thomas J. Thanigaivel S. Vijayakumar S. Acharya K. Shinge D. Seelan T.S.J. Mukherjee A. Chandrasekaran N. Pathogenecity of Pseudomonas aeruginosa in Oreochromis mossambicus and treatment using lime oil nanoemulsion Colloids Surfaces B 116 2014 372 377 10.1016/j.colsurfb.2014.01.019
6 Wood S.J. Kuzel T.M. Shafikhani S.H. Pseudomonas aeruginosa: infections, animal modeling, and therapeutics Cells 12 1 2023 10.3390/cells12010199
7 Algammal A. Mabrok M. Sivaramasamy E. Yousseff F. Atwa M. Wahdan A. Hetta H. Hozzein W. Emerging MDR- Pseudomonas aeruginosa in fish commonly harbor oprL and toxA virulence genes and blaTEM, blaCTX-M, and tetA antibiotic-resistance genes Sci. Rep. 10 2020 15961 10.1038/s41598-020-72264-4 32994450
8 Chowdhury S. Rheman S. Debnath N. Delamare-Deboutteville J. Akhtar Z. Ghosh S. Parveen S. Islam K. Islam M.A. Rashid M.M. Khan Z.H. Rahman M. Chadag V.M. Chowdhury F. Antibiotics usage practices in aquaculture in Bangladesh and their associated factors One Health 15 2022 100445 10.1016/j.onehlt.2022.100445
9 Pepi M. Focardi S. Antibiotic-resistant bacteria in aquaculture and climate change: a challenge for health in the mediterranean area Int. J. Environ. Res. Public Health 18 11 2021 10.3390/ijerph18115723
10 Larsson D.G.J. Flach C.F. Antibiotic resistance in the environment Nat. Rev. Microbiol. 20 5 2022 257 269 10.1038/s41579-021-00649-x 34737424
11 Koch N. Islam N.F. Sonowal S. Prasad R. Sarma H. Environmental antibiotics and resistance genes as emerging contaminants: methods of detection and bioremediation Curr. Res. Microb. Sci. 2 2021 100027 10.1016/j.crmicr.2021.100027
12 Muteeb G. Rehman M.T. Shahwan M. Aatif M. Origin of antibiotics and antibiotic resistance, and their impacts on drug development: a narrative review Pharmaceuticals (Basel) 16 11 2023 10.3390/ph16111615
13 Lieke T. Meinelt T. Hoseinifar S.H. Pan B. Straus D. Steinberg C. Sustainable aquaculture requires environmental-friendly treatment strategies for fish diseases Rev. Aquac. 12 2019 10.1111/raq.12365
14 Pérez-Sánchez T. Mora-Sánchez B. Balcázar J.L. Biological approaches for disease control in aquaculture: advantages, limitations and challenges Trends Microbiol. 26 11 2018 896 903 10.1016/j.tim.2018.05.002 29801773
15 Bondad-Reantaso M.G. MacKinnon B. Karunasagar I. Fridman S. Alday-Sanz V. Brun E. Groumellec M.Le Li A. Surachetpong W. Karunasagar I. Hao B. Dall'Occo A. Urbani R. Caputo A. Review of alternatives to antibiotic use in aquaculture Rev. Aquac. 15 4 2023 1421 1451 10.1111/raq.12786
16 Haddad P.S. Azar G.A. Groom S. Boivin M. Natural health products, modulation of immune function and prevention of chronic diseases Evid. Based. Complement. Alternat. Med. 2 4 2005 513 520 10.1093/ecam/neh125 16322809
17 Gasmi A. Shanaida M. Oleshchuk O. Semenova Y. Mujawdiya P.K. Ivankiv Y. Pokryshko O. Noor S. Piscopo S. Adamiv S. Bjørklund G. Natural ingredients to improve immunity Pharmaceuticals 16 4 2023 528 37111285
18 Daswani P.G. Gholkar M.S. Birdi T.J. Psidium guajava: a single plant for multiple health problems of rural Indian population Pharmacogn. Rev. 11 22 2017 167 174 10.4103/phrev.phrev_17_17 28989253
19 Naseer S. Hussain S. Naeem N. Pervaiz M. Rahman M. The phytochemistry and medicinal value of Psidium guajava (guava) Clin. Phytosci. 4 1 2018 32 10.1186/s40816-018-0093-8
20 Gutiérrez R.M.P. Mitchell S. Solis R.V. Psidium guajava: a review of its traditional uses, phytochemistry and pharmacology J. Ethnopharmacol. 117 1 2008 1 27 10.1016/j.jep.2008.01.025 18353572
21 Gutierrez-Montiel D. Guerrero-Barrera A.L. Chávez-Vela N.A. Avelar-Gonzalez F.J. Ornelas-García I.G. Psidium guajava L. From byproduct and use in traditional Mexican medicine to antimicrobial agent Front. Nutr. 10 2023 10.3389/fnut.2023.1108306
22 Kumar M. Tomar M. Amarowicz R. Saurabh V. Nair M.S. Maheshwari C. Sasi M. Prajapati U. Hasan M. Singh S. Changan S. Prajapat R.K. Berwal M.K. Satankar V. Guava (Psidium guajava L.) leaves: nutritional composition, phytochemical profile, and health-promoting bioactivities Foods. 10 4 2021 10.3390/foods10040752
23 Laily N. Kusumaningtyas R.W. Sukarti I. Rini M.R.D.K. The Potency of Guava Psidium Guajava (L.) Leaves as a Functional Immunostimulatory Ingredient Procedia Chem. 14 2015 301 307 10.1016/j.proche.2015.03.042
24 Sampath Kumar N.S. Sarbon N.M. Rana S.S. Chintagunta A.D. Prathibha S. Ingilala S.K. Jeevan Kumar S.P. Sai Anvesh B. Dirisala V.R. Extraction of bioactive compounds from Psidium guajava leaves and its utilization in preparation of jellies AMB Express. 11 1 2021 36 10.1186/s13568-021-01194-9 33646462
25 Amadike Ugbogu E. Emmanuel O. Ebubechi Uche M. Dike Dike E. Chukwuebuka Okoro B. Ibe C. Chibueze Ude V. Nwabu Ekweogu C. Chinyere Ugbogu O. The ethnobotanical, phytochemistry and pharmacological activities of Psidium guajava L Arab. J. Chem. 15 5 2022 103759 10.1016/j.arabjc.2022.103759
26 Dewi N. Huang H.-T. Wu Y.-S. Liao Z.H. Lin Y.-J. Lee P.-T. Nan F.-H. Guava (Psidium guajava) leaf extract enhances immunity, growth, and resistance against Vibrio parahaemolyticus in white shrimp Penaeus vannamei Fish Shellfish Immunol. 118 2021 10.1016/j.fsi.2021.08.017
27 Yin X.L. Li Z.J. Yang K. Lin H.Z. Guo Z.X. Effect of guava leaves on growth and the non-specific immune response of Penaeus monodon Fish. Shellfish. Immunol. 40 1 2014 190 196 10.1016/j.fsi.2014.07.001 25010674
28 Giri S. Sen S.S. Chi C. Kim H.J. Yun S. Park S. Venkatachalam S. Effect of guava leaves on the growth performance and cytokine gene expression of Labeo rohita and its susceptibility to Aeromonas hydrophila infection Fish Shellfish Immunol. 46 2015 10.1016/j.fsi.2015.05.051
29 Pereira G.A. Chaves D.S.d.A. Silva T.M.e. Motta R.E.d.A. Silva A.B.R.d. Patricio T.C.d.C. Fernandes A.J.B. Coelho S.d.M.d.O. Ożarowski M. Cid Y.P. Karpiński T.M. Antimicrobial activity of Psidium guajava aqueous extract against sensitive and resistant bacterial strains Microorganisms 11 7 2023 1784 37512956
30 Kumar M. Tomar M. Amarowicz R. Saurabh V. Maheshwari C. Sasi M. Prajapati U. Hasan M. Singh S. Changan S. Prajapat R. Berwal M. Satankar V. Guava (Psidium guajava L.) leaves: nutritional composition, phytochemical profile, and health-promoting bioactivities Foods. 2021 10.3390/foods10040752
31 Abdel-Latif H.M.R. Abdel-Tawwab M. Khafaga A.F. Dawood M.A.O. Dietary oregano essential oil improved the growth performance via enhancing the intestinal morphometry and hepato-renal functions of common carp (Cyprinus carpio L.) fingerlings Aquaculture 526 2020 735432 10.1016/j.aquaculture.2020.735432
32 M. Reverter, N. Tapissier-Bontemps, P. Sasal, D. Saulnier, Use of medicinal plants in aquaculture, 2017, pp. 223–261.
33 Mbokane E.M. Moyo N.A.G. Use of medicinal plants as feed additives in the diets of Mozambique tilapia (Oreochromis mossambicus) and the African Sharptooth catfish (Clarias gariepinus) in Southern Africa Front. Vet. Sci. 9 2022 1072369 10.3389/fvets.2022.1072369
34 Awad E. Awaad A. Role of medicinal plants on growth performance and immune status in fish Fish. Shellfish. Immunol. 67 2017 40 54 10.1016/j.fsi.2017.05.034 28526570
35 Khedr S.I. Mokhamer E.H.M. Hassan A.A.A. El-Feki A.S. Elkhodary G.M. El-Gerbed M.S.A. Psidium guajava Linn leaf ethanolic extract: in vivo giardicidal potential with ultrastructural damage, anti-inflammatory and antioxidant effects Saudi. J. Biol. Sci. 28 1 2021 427 439 10.1016/j.sjbs.2020.10.026 33424326
36 Jang M. Jeong S.W. Cho S.K. Ahn K.S. Lee J.H. Yang D.C. Kim J.C. Anti-inflammatory effects of an ethanolic extract of guava (Psidium guajava L.) leaves in vitro and in vivo J. Med. Food 17 6 2014 678 685 10.1089/jmf.2013.2936 24738717
37 Akinola O.B. Oladosu O.S. Dosumu O.O. Ethanol extract of the leaves of Psidium guajava Linn enhances sperm output in healthy Wistar rats Afr. J. Med. Med. Sci. 36 2 2007 137 140 19205576
38 C A.O.A.C. Official Methods of Analysis of the Association of Analytical Chemists International 2005 Official Methods Gaithersburg, MD, USA
39 Cunniff P. Washington D. Official methods of analysis of AOAC international J. AOAC Int. 80 6 1997 127A
40 LaBauve A.E. Wargo M.J. Growth and laboratory maintenance of Pseudomonas aeruginosa Curr. Protoc. Microbiol. Chapter 6 2012 1 10.1002/9780471729259.mc06e01s25 Unit 6E
41 Cody W.L. Wilson J.W. Hendrixson D.R. McIver K.S. Hagman K.E. Ott C.M. Nickerson C.A. Schurr M.J. Skim milk enhances the preservation of thawed -80 °C bacterial stocks J. Microbiol. Methods 75 1 2008 135 138 10.1016/j.mimet.2008.05.006 18573555
42 Campbell T.W. 12 blood sample collection and preparation in fish Exotic Anim. Hematol. Cytol. 2015 183 186
43 Pollard S. Anderson J. Bah F. Mateus M. Sidhu M. Simmons D. Non-lethal blood sampling of fish in the lab and field with methods for dried blood plasma spot omic analyses Front. Genet. 13 2022 10.3389/fgene.2022.795348
44 Duran U. Cenesiz S. ŞAhİN B. Blood sampling techniques and preparing for analysis in rainbow trout (Oncorhynchus mykiss) Black Sea J. Agricult. 6 2023 10.47115/bsagriculture.1185283
45 Clark T.D. Donaldson M.R. Drenner S.M. Hinch S.G. Patterson D.A. Hills J. Ives V. Carter J.J. Cooke S.J. Farrell A.P. The efficacy of field techniques for obtaining and storing blood samples from fishes J. Fish. Biol. 79 5 2011 1322 1333 10.1111/j.1095-8649.2011.03118.x 22026608
46 Van Doan H. Hoseinifar S.H. Khanongnuch C. Kanpiengjai A. Unban K. Van Kim V. Srichaiyo S. Host-associated probiotics boosted mucosal and serum immunity, disease resistance and growth performance of Nile tilapia (Oreochromis niloticus) Aquaculture 491 2018 94 100 10.1016/j.aquaculture.2018.03.019
47 Yin G. Ardó L. Thompson K.D. Adams A. Jeney Z. Jeney G. Chinese herbs (Astragalus radix and Ganoderma lucidum) enhance immune response of carp, Cyprinus carpio, and protection against Aeromonas hydrophila Fish. Shellfish. Immunol. 26 1 2009 140 145 10.1016/j.fsi.2008.08.015 18817878
48 Fernandez-Alacid L. Sanahuja I. Ordóñez Grande B. Sánchez-Nuño S. Viscor G. Gisbert E. Herrera M. Ibarz A. Skin mucus metabolites in response to physiological challenges: a valuable non-invasive method to study teleost marine species Sci. Total Environ. 644 2018 1323 1335 10.1016/j.scitotenv.2018.07.083 30743845
49 Bauer A.W. Kirby W.M. Sherris J.C. Turck M. Antibiotic susceptibility testing by a standardized single disk method Am. J. Clin. Pathol. 45 4 1966 493 496 5325707
50 McFARLAND M.D.J.JOSEPH Nephelometer: an instrument for estimating the number of bacteria in suspensions used for calculating the opsonic index and for vaccines J. Am. Med. Assoc. XLIX 14 1907 1176 1178
51 Zaghi I. Gaibani P. Campoli C. Bartoletti M. Giannella M. Ambretti S. Viale P. Lewis R.E. Serum bactericidal titres for monitoring antimicrobial therapy: current status and potential role in the management of multidrug-resistant Gram-negative infections Clin. Microbiol. Infect. 26 10 2020 1338 1344 10.1016/j.cmi.2020.04.036 32376295
52 Muschel L.H. Fong J.S.C. Serum bactericidal activity and complement Day N.K. Good R.A. Biological Amplification Systems in Immunology 1977 Springer US Boston, MA 137 158
53 Vasudeva Rao Y. Das B.K. Jyotyrmayee P. Chakrabarti R. Effect of Achyranthes aspera on the immunity and survival of Labeo rohita infected with Aeromonas hydrophila Fish. Shellfish. Immunol. 20 3 2006 263 273 10.1016/j.fsi.2005.04.006 15961319
54 Chase C.A.W.a.M.W. Chapter 16 - agglutination and flocculation Williams C.A. Chase M.W. Agglutination, Complement, Neutralization, and Inhibition 1977 Academic Press 1 125
55 Platt N. Fineran P. Measuring the phagocytic activity of cells Methods Cell Biol. 126 2015 287 304 10.1016/bs.mcb.2014.10.025 25665451
56 Alrashada Y.N. Hassanien H.A. Abbas A.O. Alkhamis S.A. Alkobaby A.I. Dietary propolis improves the growth performance, redox status, and immune response of Nile tilapia upon a cold-stress challenge PLoS. One 18 11 2023 e0293727 10.1371/journal.pone.0293727
57 Wang T. Liu F. Tian G. Secombes C.J. Wang T. Lineage/species-specific expansion of the Mx gene family in teleosts: differential expression and modulation of nine Mx genes in rainbow trout Oncorhynchus mykiss Fish Shellfish Immunol. 90 2019 413 430 31063803
58 Glencross B.D. Huyben D. Schrama J.W. The application of single-cell ingredients in aquaculture feeds—a review Fishes. 5 3 2020 22
59 Stanek M. Mazurkiewicz J. Rawski M. Bogucka J. Ziółkowska E. Dankowiakowska A. Kierończyk B. Effect of chitosan on common carp (Cyprinus carpio) fry growth performance, feed utilization and nutriphysiological status Aquac. Rep. 30 2023 101622 10.1016/j.aqrep.2023.101622
60 Ghafarifarsani H. Hoseinifar S.H. Javaheri S. Yazıcı M. Doan H. Growth performance, biochemical parameters, and digestive enzymes in common carp (Cyprinus carpio) fed experimental diets supplemented with vitamin C, thyme essential oil, and quercetin Ital. J. Anim. Sci. 21 2022 291 302 10.1080/1828051X.2021.1965923
61 Hoseinifar S.H. Jahazi M.A. Mohseni R. Raeisi M. Bayani M. Mazandarani M. Yousefi M. Van Doan H. Mozanzadeh M.Torfi Effects of dietary fern (Adiantum capillus-veneris) leaves powder on serum and mucus antioxidant defence, immunological responses, antimicrobial activity and growth performance of common carp (Cyprinus carpio) juveniles Fish Shellfish Immunol. 106 2020 959 966 10.1016/j.fsi.2020.09.001 32890760
62 Hoseinifar S.H. Khodadadian Zou H. Kolangi Miandare H. Van Doan H. Romano N. Dadar M. Enrichment of common carp (Cyprinus carpio) diet with medlar (Mespilus germanica) leaf extract: effects on skin mucosal immunity and growth performance Fish. Shellfish. Immunol. 67 2017 346 352 10.1016/j.fsi.2017.06.023 28602735
63 Musharraf M. Khan M.A. Requirement of fingerling Indian major carp, Labeo rohita (Hamilton) for dietary iron based on growth, whole body composition, haematological parameters, tissue iron concentration and serum antioxidant status Aquaculture 504 2019 148 157 10.1016/j.aquaculture.2019.02.002
64 Gobi N. Ramya C. Vaseeharan B. Malaikozhundan B. Vijayakumar S. Murugan K. Benelli G. Oreochromis mossambicus diet supplementation with Psidium guajava leaf extracts enhance growth, immune, antioxidant response and resistance to Aeromonas hydrophila Fish Shellfish Immunol. 58 2016 572 583 10.1016/j.fsi.2016.09.062 27702676
65 Omitoyin B.O. Ajani E.K. Orisasona O. Bassey H.E. Kareem K.O. Osho F.E. Effect of guava Psidium guajava (L.) aqueous extract diet on growth performance, intestinal morphology, immune response and survival of Oreochromis niloticus challenged with Aeromonas hydrophila Aquac. Res. 50 7 2019 1851 1861 10.1111/are.14068
66 Roy A. Khan A. Ahmad I. Alghamdi S. Rajab B.S. Babalghith A.O. Alshahrani M.Y. Islam S. Islam M.R. Flavonoids a bioactive compound from Medicinal plants and its therapeutic applications Biomed. Res. Int. 2022 2022 5445291 10.1155/2022/5445291
67 Sancho R. Pavan V. Pastore G. Effect of in vitro digestion on bioactive compounds and antioxidant activity of common bean seed coats Food Res. Int. 76 2014 10.1016/j.foodres.2014.11.042
68 Nieto G. Martínez-Zamora L. Peñalver R. Marín-Iniesta F. Taboada-Rodríguez A. López-Gómez A. Martínez-Hernández G.B. Applications of plant bioactive compounds as replacers of synthetic additives in the food industry Foods. 13 1 2024 47
69 Mujeeb F. Bajpai P. Pathak N. Phytochemical evaluation, antimicrobial activity, and determination of bioactive components from leaves of Aegle marmelos Biomed. Res. Int. 2014 2014 497606 10.1155/2014/497606
70 S. Kumar, R. Saini, P. Suthar, V. Kumar, R. Sharma, Plant secondary metabolites: their food and therapeutic importance, 2022, pp. 371–413.
71 Díaz-de-Cerio E. Gómez-Caravaca A.M. Verardo V. Fernández-Gutiérrez A. Segura-Carretero A. Determination of guava (Psidium guajava L.) leaf phenolic compounds using HPLC-DAD-QTOF-MS J. Funct. Foods. 22 2016 376 388 10.1016/j.jff.2016.01.040
72 Dorenkott M.R. Griffin L.E. Goodrich K.M. Thompson-Witrick K.A. Fundaro G. Ye L. Stevens J.R. Ali M. O'Keefe S.F. Hulver M.W. Oligomeric cocoa procyanidins possess enhanced bioactivity compared to monomeric and polymeric cocoa procyanidins for preventing the development of obesity, insulin resistance, and impaired glucose tolerance during high-fat feeding J. Agric. Food Chem. 62 10 2014 2216 2227 24559282
73 Deck C.A. Salger S.A. Reynolds H.M. Tada M.D. Severance M.E. Ferket P. Egna H.S. Fatema M.K. Haque S.M. Borski R.J. Nutritional programming in Nile tilapia (Oreochromis niloticus): effect of low dietary protein on growth and the intestinal microbiome and transcriptome PLoS. One 18 10 2023 e0292431 10.1371/journal.pone.0292431
74 Riera Romo M. Pérez-Martínez D. Castillo Ferrer C. Innate immunity in vertebrates: an overview Immunology 148 2 2016 125 139 10.1111/imm.12597 26878338
75 Zou J. Secombes C.J. The function of fish cytokines Biology. (Basel) 5 2 2016 10.3390/biology5020023
76 Porcelli S.A. Chapter 17 - innate immunity Firestein G.S. Budd R.C. Gabriel S.E. McInnes I.B. O'Dell J.R. Kelley and Firestein's Textbook of Rheumatology (Tenth Edition) 2017 Elsevier 274 287
77 Gobi N. Ramya C. Vaseeharan B. Malaikozhundan B. Vijayakumar S. Murugan K. Benelli G. Oreochromis mossambicus diet supplementation with Psidium guajava leaf extracts enhance growth, immune, antioxidant response and resistance to Aeromonas hydrophila Fish. Shellfish. Immunol. 58 2016 572 583 10.1016/j.fsi.2016.09.062 27702676
78 Smith N.C. Rise M.L. Christian S.L. A comparison of the innate and adaptive immune systems in cartilaginous fish, ray-finned fish, and lobe-finned fish Front. Immunol. 10 2019 2292 10.3389/fimmu.2019.02292 31649660
79 Magnadóttir B. Innate immunity of fish (overview). Fish Shellfish Immunol Fish Shellfish Immunol. 20 2006 137 151 10.1016/j.fsi.2004.09.006 15950491
80 Akira S. Uematsu S. Takeuchi O. Pathogen recognition and innate immunity Cell 124 4 2006 783 801 10.1016/j.cell.2006.02.015 16497588
81 Al-Faragi J. Effect of ginger (Zingiber officinale) and garlic (Allium sativum) to enhance health of common carp Cyprinus carpio L Iraqi J. Vet. Med. 37 2013 59 62 10.30539/iraqijvm.v37i1.332
82 Talpur M.A.D. Ikhwanuddin M. Abol-Munafi A. Nutritional effects of ginger (Zingiber officinale Roscoe) on immune response of Asian sea bass, Lates calcarifer (Bloch) and disease resistance against Vibrio harveyi Aquaculture s 400–401 2013 46 52 10.1016/j.aquaculture.2013.02.043
83 Stratev D. Zhelyazkov G. Siwe Noundou X. Krause R. Beneficial effects of medicinal plants in fish diseases Aquacult. Int. 26 2018 10.1007/s10499-017-0219-x
84 Dadras F. Velisek J. Zuskova E. An update about beneficial effects of medicinal plants in aquaculture: a review Vet. Med. (Praha) 68 12 2023 449 463 10.17221/96/2023-vetmed 38303995
85 Das B. Pradhan J. Sahu S. The effect of Euglena viridis on immune response of rohu, Labeo rohita (Ham Fish Shellfish Immunol. 26 2009 871 876 10.1016/j.fsi.2009.03.016 19345266
86 Faheem M. Abbas R. Liaqat I. Hoseinifar S.H. Maneepitaksanti W. Doan H. Bio-active components in medicinal plants: a mechanistic review of their effects on fish growth and physiological parameters Ann. Anim. Sci. 2022 10.2478/aoas-2022-0030
87 Díaz-de-Cerio E. Verardo V. Gómez-Caravaca A.M. Fernández-Gutiérrez A. Segura-Carretero A. Exploratory characterization of phenolic compounds with demonstrated anti-diabetic activity in guava leaves at different oxidation states Int. J. Mol. Sci. 17 5 2016 10.3390/ijms17050699
88 Flores G. Wu S.-B. Negrin A. Kennelly E.J. Chemical composition and antioxidant activity of seven cultivars of guava (Psidium guajava) fruits Food Chem. 170 2015 327 335 10.1016/j.foodchem.2014.08.076 25306353
89 Guardiola F. Cuartero M. Collado-González M.M. Arizcun M. Díaz Baños F.G. Meseguer J. Cuesta A. Esteban M. Description and comparative study of physico-chemical parameters of the teleost fish skin mucus Biorheology 52 2015 10.3233/BIR-15052
90 Tartor H. Luis Monjane A. Grove S. Quantification of defensive proteins in skin mucus of atlantic salmon using minimally invasive sampling and high-sensitivity ELISA Animals. (Basel) 10 8 2020 10.3390/ani10081374
91 Esteban M. An overview of the immunological defenses in fish skin ISRN Immunology 2012 2012 10.5402/2012/853470
92 Díaz-Puertas R. Adamek M. Mallavia R. Falco A. Fish skin mucus extracts: an underexplored source of antimicrobial agents Mar. Drugs 21 6 2023 350 37367675
93 Camarena-Tello J.C. Martínez-Flores H.E. Garnica-Romo M.G. Padilla-Ramírez J.S. Saavedra-Molina A. Alvarez-Cortes O. Bartolomé-Camacho M.C. Rodiles-López J.O. Quantification of phenolic compounds and in vitro radical scavenging abilities with leaf extracts from two varieties of Psidium guajava L Antioxidants (Basel) 7 3 2018 10.3390/antiox7030034
94 Mandal A.K. Paudel S. Pandey A. Yadav P. Pathak P. Grishina M. Jaremko M. Emwas A.H. Khalilullah H. Verma A. Guava leaf essential oil as a potent antioxidant and anticancer agent: validated through experimental and computational study Antioxidants. (Basel) 11 11 2022 10.3390/antiox11112204
95 Cao S. Zhang P. Zou T. Fei S. Han D. Jin J. Liu H. Yang Y. Zhu X. Xie S. Replacement of fishmeal by spirulina Arthrospira platensis affects growth, immune related-gene expression in gibel carp (Carassius auratus gibelio var. CAS III), and its challenge against Aeromonas hydrophila infection Fish Shellfish Immunol. 79 2018 10.1016/j.fsi.2018.05.022
96 Sheikhzadeh N. Mousavi S. Hamidian G. Firouzamandi M. Oushani A. Mardani K. Role of dietary Spirulina platensis in improving mucosal immune responses and disease resistance of rainbow trout (Oncorhynchus mykiss) Aquaculture 510 2019 10.1016/j.aquaculture.2019.05.009
97 Hoseinifar S.H. Zoheiri F. Lazado C.C. Dietary phytoimmunostimulant Persian hogweed (Heracleum persicum) has more remarkable impacts on skin mucus than on serum in common carp (Cyprinus carpio) Fish. Shellfish. Immunol. 59 2016 77 82 10.1016/j.fsi.2016.10.025 27751916
98 Cho Y.H. Fadle Aziz M.R. Malpass A. Sutradhar T. Bashal J. Cojocari V. McPhee J.B. Omptin proteases of enterobacterales show conserved regulation by the PhoPQ two-component system but exhibit divergent protection from antimicrobial host peptides and complement Infect. Immun. 91 1 2023 e0051822 10.1128/iai.00518-22
99 Ellis A.E. Immunity to bacteria in fish Fish Shellfish Immunol. 9 4 1999 291 308 10.1006/fsim.1998.0192
100 Rao Y.V. Chakrabarti R. Enhanced anti-proteases inLabeo rohita fed with diet containing herbal ingredients Indian J. Clin. Biochem. 19 2 2004 132 134 10.1007/bf02894272
101 El-Sayed S. El-Galil S. Rashied N. Effects of some herbal plants as natural feed additives in comparison with antibiotic on growth performance and immune status of Nile Tilapia (Oreochromis niloticus) Int. J. Res. Fisheries Aquacult. 4 2014 22 30
102 Biller-Takahashi J.D. Montassier H.J. Takahashi L.S. Urbinati E.C. Proposed method for agglutinating antibody titer analysis and its use as indicator of acquired immunity in pacu, Piaractus mesopotamicus Braz. J. Biol. 74 1 2014 238 242 10.1590/1519-6984.21312 25055109
103 Dalmo R.A. Bøgwald J. Innate Immunity Buchmann K. Secombes C.J. Principles of Fish Immunology: From Cells and Molecules to Host Protection 2022 Springer International Publishing Cham 31 103
104 Sunyer J.O. Tort L. Natural hemolytic and bactericidal activities of sea bream Sparus aurata serum are effected by the alternative complement pathway Vet. Immunol. Immunopathol. 45 3–4 1995 333 345 7676614
105 Yar Ahmadi P. Farahmand H. Kolangi Miandare H. Mirvaghefi A. Hoseinifar S.H. The effects of dietary Immunogen on innate immune response, immune related genes expression and disease resistance of rainbow trout (Oncorhynchus mykiss) Fish. Shellfish. Immunol. 37 2 2014 209 214 10.1016/j.fsi.2014.02.006 24560683
106 Dimitroglou A. Davies S. Sweetman J. The effect of dietary mannan oligosaccharides on the intestinal histology of rainbow trout (Oncorhynchus mykiss) Compar. Biochem. Physiol. 150 2008 10.1016/j.cbpa.2008.04.069
107 Staykov Y. Spring P. Denev S. Sweetman J. Effect of a mannan oligosaccharide on the growth performance and immune status of rainbow trout (Oncorhynchus mykiss) Aquaculture International 15 2007
108 Teti G. Biondo C. Beninati C. The Phagocyte, Metchnikoff, and the Foundation of Immunology Microbiol. Spectr. 4 2016 10.1128/microbiolspec.MCHD-0009-2015
109 Greenberg S. Grinstein S. Phagocytosis and innate immunity Curr. Opin. Immunol. 14 2002 136 145 10.1016/S0952-7915(01)00309-0 11790544
110 Lim J.J. Grinstein S. Roth Z. Diversity and versatility of phagocytosis: roles in innate immunity, tissue remodeling, and homeostasis Front. Cell Infect. Microbiol. 7 2017 191 10.3389/fcimb.2017.00191 28589095
111 MacArthur J.I. Fletcher T.C. Phagocytosis in fish Manning M.J. Tatner M.F. Fish Immunology 1985 Academic Press 29 46
112 Galloway D.A. Phillips A.E.M. Owen D.R.J. Moore C.S. Phagocytosis in the brain: homeostasis and disease Front. Immunol. 10 2019 790 10.3389/fimmu.2019.00790 31040847
113 Dügenci S.K. Arda N. Candan A. Some medicinal plants as immunostimulant for fish J. Ethnopharmacol. 88 1 2003 99 106 12902058
114 Jeney G. Yin G. Ardó L. The use of immunostimulating herbs in fish. An overview of research Fish Physiol. Biochem. 35 2009 669 676 10.1007/s10695-009-9304-z 19277888
115 Wen C.C. Chen H.M. Yang N.S. Developing Phytocompounds from Medicinal Plants as Immunomodulators Adv. Bot. Res. 62 2012 197 272 10.1016/b978-0-12-394591-4.00004-0 32300254
116 Fadaeifard F. Raissy M. Dehkordi M. Rouhi-Boroujeni H. Rahimi M. Faghani M. Effects of black seed (Nigella sativa), ginger (Zingiber officinale) and cone flower (Echinacea angustifolia) on the immune system of rainbow trout, Oncorhynchus mykiss Arquivo Brasileiro de Medicina Veterinária e Zootecnia 70 2018 199 204 10.1590/1678-4162-8489
117 Aly S.M. ElBanna N.I. Elatta M.A. Hegazy M. Fathi M. Effects of natural and synthetic immunostimulants on growth, feed utilization, immune status, and disease resistance against vibriosis in sea bream (Sparus aurata) Aquaculture Int. 2023 10.1007/s10499-023-01294-2
118 Celik Altunoglu Y. Bilen S. Ulu F. Biswas G. Immune responses to methanolic extract of black cumin (Nigella sativa) in rainbow trout (Oncorhynchus mykiss) Fish Shellfish Immunol. 67 2017 103 109 10.1016/j.fsi.2017.06.002 28602677
119 Savan R. Kono T. Igawa D. Sakai M. A novel tumor necrosis factor (TNF) gene present in tandem with theTNF-alpha gene on the same chromosome in teleosts Immunogenetics 57 1–2 2005 140 150 10.1007/s00251-005-0768-4 15759114
120 Zou J. Grabowski P.S. Cunningham C. Secombes C.J. Molecular cloning of interleukin 1beta from rainbow trout Oncorhynchus mykiss reveals no evidence of an ice cut site Cytokine 11 8 1999 552 560 10.1006/cyto.1998.0470 10433801
121 Wang T. Bird S. Koussounadis A. Holland J.W. Carrington A. Zou J. Secombes C.J. Identification of a novel IL-1 cytokine family member in teleost fish J. Immunol. 183 2 2009 962 974 10.4049/jimmunol.0802953 19553537
122 Hanington P.C. Belosevic M. Interleukin-6 family cytokine M17 induces differentiation and nitric oxide response of goldfish (Carassius auratus L.) macrophages Dev. Comp. Immunol. 31 8 2007 817 829 10.1016/j.dci.2006.12.001 17250891
123 Savan R. Sakai M. Genomics of fish cytokines Compar. Biochem. Physiol. Part D 1 1 2006 89 101
124 Korenaga H. Kono T. Sakai M. Isolation of seven IL-17 family genes from the Japanese pufferfish Takifugu rubripes Fish. Shellfish. Immunol. 28 5–6 2010 809 818 10.1016/j.fsi.2010.01.016 20144719
125 Kono T. Fujiki K. Nakao M. Yano T. Endo M. Sakai M. The immune responses of common carp, Cyprinus carpio L., injected with carp interleukin-1beta gene J. Interferon. Cytokine Res. 22 4 2002 413 419 10.1089/10799900252952190 12034023
126 Kamble M. Chaiyapechara S. S K.R. Bunphimpapha P. Chavan B. Bhujel R. Medhe S. Kettawan A. Thiyajai P. Thompson K. Pirarat N. Guava and Star gooseberry leaf extracts improve growth performance, innate immunity, intestinal microbial community, and disease resistance in Nile tilapia (Oreochromis niloticus) against Aeromonas hydrophila Aquac. Rep. 35 2024 101947 10.1016/j.aqrep.2024.101947
127 G. Dineshkumar, R. Rajakumar, P. Mani, European Journal of Molecular Biology and Biochemistry immunostimulant effect of on Eichhornia crassipes (MART.) Solms against P. fluorescens infected Indian major carp Labeo rohita (HAM.), 1 (2014) 158–164.
128 Christybapita D. Divyagnaneswari D. Michael D. Oral administration of Eclipta alba leaf aqueous extract enhances the nonspecific immune responses and diseases of Oreochromis mossambicus Fish Shellfish Immunol. 23 2007 840 852 10.1016/j.fsi.2007.03.010 17499515
129 Mohammed H. Arias C. Protective efficacy of Nigella sativa seeds and oil against columnaris disease in fishes J. Fish Dis. 39 2015 10.1111/jfd.12402
