
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39256553
72075
10.1038/s41598-024-72075-x
Article
Effects of grape seed proanthocyanidin extract on cholesterol metabolism and antioxidant status in finishing pigs
Wang Wenjing 1
Xu Meng xumeng@swun.edu.cn

123
Diao Hui 4
Long Qingtao 1
Gan Fang 1
Mao Yi 1
1 https://ror.org/04gaexw88 grid.412723.1 0000 0004 0604 889X College of Animal & Veterinary Sciences, Southwest Minzu University, Chengdu, 610041 China
2 grid.412723.1 0000 0004 0604 889X Key Laboratory of Qinghai-Tibetan Plateau Animal Genetic Resource Reservation and Utilization, Ministry of Education, Southwest Minzu University, Chengdu, 610041 China
3 https://ror.org/04gaexw88 grid.412723.1 0000 0004 0604 889X Key Laboratory of Animal Science of National Ethnic Affairs Commission of China, Southwest Minzu University, Chengdu, 610041 China
4 Livestock and Poultry Biological Products Key Laboratory of Sichuan Province, Sichuan Animtche Group Co. Ltd, Chengdu, 610066 China
10 9 2024
10 9 2024
2024
14 2111713 5 2024
3 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Grape seed proanthocyanidin extract (GSPE) is a natural polyphenolic compound, which plays an important role in anti-inflammatory and antioxidant. The present study aimed to investigate the effects of GSPE supplementation on the cholesterol metabolism and antioxidant status of finishing pigs. In longissimus dorse (LD) muscle, the data showed that GSPE significantly decreased the contents of total cholesterol (T-CHO) and triglyceride (TG), and decreased the mRNA expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoAR) and Fatty acid synthase (FAS), while increased the mRNA expression of carnitine palmitoyl transferase-1b (CPT1b), peroxisome proliferator-activated receptors (PPARα) and peroxisome proliferator activated receptor-γ coactivator-1α (PGC-1α). GSPE also reduced the enzyme activities of HMG-CoAR and FAS, and meanwhile amplified the activity of CPT1b in LD muscle of finishing pigs. Furthermore, dietary GSPE supplementation increased the serum catalase (CAT) and total antioxidant capacity (T-AOC), serum and liver total superoxide dismutase (T-SOD) and glutathione peroxidase (GSH-Px) levels, while reduced serum and liver malondialdehyde (MDA) level in finishing pigs. In the liver, Superoxide Dismutase 1 (SOD1), catalase (CAT), glutathione peroxidase 1 (GPX1), Nuclear Factor erythroid 2-Related Factor 2 (NRF2) mRNA levels were increased by GSPE. In conclusion, this study showed that GSPE might be an effective dietary supplement for improving cholesterol metabolism and antioxidant status in finishing pigs.

Keywords

GSPE
Cholesterol metabolism
Cholesterol metabolism-related genes
Antioxidant status
Subject terms

Glycerides
Nutrition
the Natural Science Foundation of Sichuan Province2022NSFSC1613 Xu Meng the Fundamental Research Funds for the Central Universities/Southwest Minzu UniversityZYN2023038 Xu Meng issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

The content and composition of lipids in mammals are maintained in a dynamic equilibrium state, particularly cholesterol, which is a vital component of cell barrier formation and signaling transduction involved in many essential physiologic processes1. Malfunctioning of cholesterol metabolism, caused by excessive synthesis or reduced clearance, leads to cholesterol accumulation in tissues, eventually resulting in cardiovascular diseases (CVDs), nonalcoholic fatty liver disease (NAFLD), atherosclerosis (AS) and other chronic diseases2,3. Various enzymes related to cholesterol metabolism such as 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoAR) and Cholesterol-7α-hydroxylase (CYP7A1) play a critical role in sustaining normal cholesterol levels4,5. In addition, it is well known that higher triglycerides (TG) and total cholesterol (T-CHO) will result in liver damage and increase the risk of NAFLD. High-density lipoprotein cholesterol (HDL-C) or low-density lipoprotein cholesterol (LDL-C) can combine with cholesterol and transport cholesterol to liver or peripheral tissues6. Higher low-density lipoprotein cholesterol and lower high-density lipoprotein cholesterol levels will bring about excessive cholesterol accumulation, which increases the risk of CVDs and AS7.

Under normal conditions, the body's antioxidant system safeguards the organism from oxidative damage by maintaining a dynamic balance between the production and elimination of reactive oxygen species (ROS)8. Once the balance is disrupted, excessive accumulation of oxygen free radicals causes oxidative stress to damage cell structures and lead to an imbalance in cholesterol metabolism, thereby accelerating the progression of cholesterol-related diseases9,10. Notably, there exists a complex interplay between cholesterol metabolism and antioxidant system. Oxidised low-density lipoprotein (ox-LDL), a product of cholesterol metabolism, significantly elevates intracellular ROS levels, increasing the risk of oxidative damage11,12. On the contrary, the antioxidant enzyme SOD1 (superoxide dismutase 1) inhibits the HMG-CoAR activity during cholesterol synthesis13. In addition to promoting cholesterol-to-bile acid conversion to regulate cholesterol metabolism, the liver also eliminates ROS through SOD and catalase (CAT) and non-enzymatic antioxidants such as glutathione and vitamin C14,15. Furthermore, the excellent antioxidant capacity of the mammal body will prevent the damage of excessive oxygen free radicals to cell structure by increasing the activity of CAT, total superoxide dismutase (T-SOD) and glutathione peroxidase (GSH-Px)16. Recent reports have shown that plant extracts rich in bioactive substances have a positive effect on antioxidant status and maintaining the balance of cholesterol metabolism, and possess the properties to reduce the risks of cardiovascular and chronic diseases17.

Proanthocyanidins, a group of polyphenol compounds that are widely distributed in the bark, fruit core and various plants18, have been reported to possess wide-ranging biological functions, especially antioxidant capacity and anti-inflammatory19. Grape seed proanthocyanidin extract (GSPE) is a flavonoid polyphenolic compounds and study have reported the GSPE had the ability to protect the myocardium from damage, prevent diabetes20, alleviate oxidative stress damage and prevent obesity and inflammatory reaction19. Given that the close relationship among cholesterol metabolism, antioxidant status and body health, we hypothesize that dietary GSPE supplementation may improve cholesterol metabolism and enhance antioxidant status in finishing pigs. Here, we used finishing pigs as experimental subjects to investigate the effects of GSPE on cholesterol metabolism and antioxidant status and explored the potential molecular mechanisms involved in these processes.

Materials and methods

Ethics statement

All animal procedures are carried out in accordance with the Guide for the Care and Use of Laboratory Animals at Sichuan Agricultural University and approved by the Sichuan Agricultural University Animal Care Advisory Committee. This study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).

Estimation of sample size, animals and diets

The sample size calculation was performed using G*Power 3.1.9.7, based on data from a previously published study21. To determine the sample size, the effect size was estimated (dz = 0.83) assuming a normal distribution, the number of groups is four, with α = 0.05 and a power of 0.8 (1-β error probability). Twenty-four healthy castrated Duroc × Landrace × Yorkshire (DLY) pigs with initial body weight of 68.28 ± 0.12 kg were randomly assigned to four groups: a basal diet supplemented with 0 mg, 50 mg, 100 mg and 200 mg GSPE per kg of feed. Each group contained six replicates with one pig per replicate. The weighed GSPE is first mixed with vitamin premix, minerals, chloride choline and amino acids, then mixed with corn, soybean meal and other feed components. The basal diet (Table 1) was formulated based on the nutrient requirements for pigs (Nutrient Requirements of Swine, 11th revised edition, 2012). GSPE was obtained from Tianjin Jianfeng Natural Product R&D Co. Ltd (purity > 95%, Tianjin, China). All pigs were housed separately and had free access to feed and clean water. The initial and final body weights were measured at the beginning and end of the feeding trial, respectively. Feed intake was recorded daily and average daily gain (ADG), average daily feed intake (ADFI) and the ratio of feed intake to gain (F/G) were measured at the end of the feeding trial. The experimental period lasted 7 weeks.Table 1 Feed ingredients and nutrient content of basal diets.

Ingredient	Content (%)	Nutrient levels3	Content	
Corn	82.15	Digestible energy (Mcal/kg)	3.40	
Soybean meal	11.15	Crude protein (%)	12.14	
Soybean oil	2.25	Calcium (%)	0.52	
Wheat bran	1.72	Available P (%)	0.24	
Limestone	0.73	Total P (%)	0.42	
Dicalcium phosphate	0.66	Digestible lysine (%)	0.73	
L-Lys·HCl (78%)	0.40	Digestible Trp (%)	0.13	
NaCl	0.30	Digestible Thr (%)	0.46	
DL-Met	0.09	Digestible Met + Cys (%)	0.42	
L-Trp (78%)	0.03			
L-Thr	0.14			
Chloride choline (50%)	0.15			
Vitamin premix1	0.03			
Mineral premix2	0.20			
Total	100.00			
1Vitamin premix provides the following per kg of complete diet: vitamin A, 9000 IU; vitamin D3, 3000 IU; vitamin E, 24 IU; vitamin B12, 0.036 mg; vitamin K3, 3.0 mg; vitamin B12, Folic acid, 1.5 mg; 3 mg; vitamin B6, 3.6 mg; vitamin B2, 0.15 mg; 7.5 mg; vitamin B5, 1.5 mg; Nicotinamide, 30 mg.

2Mineral premix provides the following per kg of complete diet: I, 0.14 mg; Se, 0.15 mg; Mn, 2 mg; Cu, 3 mg; Zn, 50 mg; Fe, 40 mg.

3Data were calculated values.

Sample collection

At the 49nd day of the feeding trial, pigs were electrically stunned, and slaughtered according to the Chinese guidelines (Science and Technology Ministry of China, 2006) after blood collection. After static settlement for 30 min, blood samples were centrifuged at 3500 g for 10 min. The supernatant was subsequently collected and stored at − 20 °C until analysis. The liver was quickly removed from the left side of the carcass, frozen in liquid nitrogen and stored at − 80 °C. An approximately 1 cm thick sample of longissimus dorse (LD) muscle was collected from the right side of the carcass at the 10th rib, then rapidly frozen in liquid nitrogen and used for RNA extraction and chemical analysis.

Antioxidant status

Approximately 100 mg of liver sample was homogenized in precooled 0.9% saline and then centrifuged at 2500 g for 10 min at 4 °C. Then, the liver supernatant was used to determine the activities of the total antioxidant capacity (T-AOC), T-SOD, CAT, GSH-Px, and the contents of MDA using kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The serum enzyme activities and MDA content were also examined. Enzyme activity was expressed as U/mg protein or U/mL serum. MDA content was expressed as nmol/mg protein or nmol/ mL serum.

Biochemistry parameters

Approximately 100 mg of LD muscle sample was homogenized in precooled 0.9% saline and then centrifuged at 2500 g for 10 min at 4 °C. The LD muscle, liver and blood supernatant were used for determining the contents of TG, T-CHO, LDL-C and HDL-C. The commercial kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China). The total protein concentrations of liver and LD muscle were examined by a Coomassie Brilliant Blue Protein Assay kit (Nanjing Jiancheng Bioengineering Institute). The biochemistry parameters were expressed as mmol/L serum or μmol/g protein.

Enzyme activities related to cholesterol metabolism

The muscle samples were homogenized in precooled 0.9% saline and centrifuged at 2500 g for 10 min, then the supernatant was used for enzyme activity determination. The specific steps were carried out according to the manufacturer's instructions. Finally, the standard curves were drawn, and the enzyme activities were calculated based on the curve equation. The activities of cholesterol 7α-hydroxylase (CYP7A1, Cat No.ml847445), 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoAR, Cat No.ml847440), fatty acid synthase (FAS, Cat No.ml847443) and carnitine palmitoyltransferase 1b (CPT1b, Cat No.ml847449) were determined using enzyme-linked immunosorbent assay kits (enzyme-linked Biotechnology Co. Ltd, Shanghai, China).

Real-time quantitative PCR

As directed by the manufacturer’s instructions, total RNA was extracted from LD muscle and liver tissue using RNAiso Plus reagent (TaKaRa, Dalian, China) and reverse transcribed to cDNA by a PrimeScript RT reagent kit with gDNA eraser (TaKaRa). Real-time quantitative PCR (RT-qPCR) was performed using SYBR select Master Mix (Applied Biosystems, Foster, CA, USA). The primer sequences were shown in Table 2. The 2ΔΔCt method was used to calculate the mRNA levels of the genes, with glyceraldehyde phosphate dehydrogenase (GAPDH) as an internal control.Table 2 Primer sequences used for real-time quantitative PCR.

Genes	Primer Sequence (5’ → 3’)	GeneBank ID Accession No	Product size (bp)	
GAPDH	F: ACTCACTCTTCTACCTTTGATGCT	NM_001206359.1	100	
R: TGTTGCTGTAGCCAAATTCA	
HSL	F: CCCATCCTCTCCATCGACT	NM_214315	83	
R: CAGCAGTAGGCGTAGAAGCAC	
ACC	F: ACCGAATTGGTTCCTTTGGAC	AF175308	123	
R: CCAGTCCGATTCTTGCTCCA	
FAS	F: ACACCTTCGTGCTGGCCTAC	NM_001099930	112	
R: ATGTCGGTGAACTGCTGCAC	
PPARα	F: GAGTTCGCCAAGTCCATCC	NM_001044526	122	
R: CCGTCCTTGTTCATCACAGAG	
CPT1b	F: TGACTCGAATGTTCCGGGAG	NM_001007191	118	
R: AGATCTTGCAGGTCTGCTTTCA	
HMG-CoAR	F: GGTCAGGATGCGGCACAGAACG	NM_001122988	127	
R: GCCCCACGGTCCCGATCTCTATG	
CYP7A1	F: TATAGGGCACGATGCACAGA	NM_001005352	200	
R: ACCTGACCAGTTCCGAGATG	
LDL-R	F: AGAACTGGAGGCTTAAGAGCATC	NM_001206354	115	
R: GAGGGGTAGGTGTAGCCGTCCTG	
SOD1	F: AGACCTGGGCAATGTGACTG	NM_001190422	102	
R: GTGCGGCCAATGATGGAATG	
CAT	F: CAGATGAAGCATTGGAAGGAGC	NM_214301	83	
R: TTGTCTCCTATCGGATTCCCAG	
GPX1	F: GTGAATGGCGCAAATGCTCA	NM_214201	126	
R: ATTGCGACACACTGGAGACC	
GST	F: CCAACCCAGAAGACTGCTCA	AB000884	102	
R: CATTCAGGTGGGCTCTTCGT	
NRF2	F: GCCCCTGGAAGCGTTAAAC	XM_003133500	67	
R: GGACTGTATCCCCAGAAGGTTGT	
Keap1	F: ACGACGTGGAGACAGAAACGT	NM_001114671	56	
R: GCTTCGCCGATGCTTCA	
PGC-1α	F: GCCCTCATTTGATGCACTG	DQ437884	150	
R: AGCTGAGTGTTGGCTGGTG	
AMPKα1	F: CGGCAAAGTGAAGGTTGG	NM_001167633	123	
R: AGGTTCTGAATTTCTCTGCGG	
AMPKα2	F: TCTGGAGGTGAATTGTTCGAC	NM_214266	151	
R: ACATTCTCTGGCTTCAGGTCC	

Statistical analysis

All data expressed as means ± the standard error of the mean (SEM) were analyzed using SAS 8.2 software (SAS Inst. Inc, Cary, NC, USA) by One-way analysis of variance followed by Tukey’s test. Differences were considered statistically significant at P < 0.05. The Shapiro–Wilk test was used for the normality test, and P > 0.05 was in accordance with the normal distribution.

Results

Effect of GSPE on growth performance of finishing pigs

As presented in Table 3, dietary GSPE supplementation had no effect on body weight, ADG, ADFI and F/G of finishing pigs.Table 3 Effects of GSPE supplementation on growth performance of finishing pig (n = 6).

Items	GSPE (mg/kg)	SEM	P value	
0	50	100	200	
Initial weight (kg)	68.18	68.16	68.22	68.40	0.528	0.999	
Final weight (kg)	111.56	113.42	112.08	113.88	1.582	0.957	
ADG (g)	0.88	0.92	0.89	0.93	0.029	0.950	
ADFI (g)	3.12	3.01	2.93	3.02	0.037	0.335	
F/G	3.57	3.32	3.36	3.30	0.111	0.840	

Effect of dietary GSPE supplementation on biochemistry parameters of finishing pigs

As shown in Table 4, compared with the control group, dietary supplementation of 100 mg/kg and 200 mg/kg GSPE significantly reduced T-CHO levels in LD muscle of finishing pigs (P < 0.05), and the TG content was significantly decreased in the 50 mg/kg, 100 mg/kg and 200 mg/kg GSPE groups (P < 0.05). There were no significant differences in biochemical parameters in the serum and liver among the control and GSPE groups.Table 4 Effect of dietary GSPE supplementation on biochemistry parameters of finishing pigs (n = 6).

Items	Control	50 mg/kg GSPE	100 mg/kg GSPE	200 mg/kg GSPE	P-value	
Serum	
 T-CHO, mmol/L	3.54 ± 0.31	3.00 ± 0.07	2.65 ± 0.13	3.05 ± 0.30	0.222	
 TG, mmol/L	0.41 ± 0.04	0.37 ± 0.05	0.31 ± 0.08	0.35 ± 0.01	0.468	
 LDL-C, mmol/L	0.57 ± 0.08	0.47 ± 0.05	0.36 ± 0.09	0.55 ± 0.12	0.232	
 HDL-C, mmol/L	1.94 ± 0.29	1.73 ± 0.18	1.82 ± 0.23	1.63 ± 0.09	0.698	
Liver	
 T-CHO, μmol/g prot	20.40 ± 0.98	17.72 ± 2.37	19.07 ± 1.74	21.39 ± 1.15	0.365	
 TG, μmol/g prot	125.75 ± 10.99	108.49 ± 19.24	120.83 ± 5.21	123.47 ± 11.23	0.824	
 LDL-C, μmol/g prot	26.38 ± 2.56	23.94 ± 4.68	26.37 ± 8.68	29.96 ± 5.93	0.936	
 HDL-C, μmol/g prot	14.95 ± 4.75	9.71 ± 1.62	12.38 ± 2.73	8.75 ± 2.13	0.683	
LD muscle	
 T-CHO, μmol/g prot	40.52 ± 3.98A	26.29 ± 1.54AB	11.47 ± 2.24B	21.57 ± 3.22B	0.004	
 TG, μmol/g prot	165.74 ± 15.46A	87.22 ± 7.60B	105.20 ± 9.25B	110.42 ± 8.02B	0.008	
 LDL-C, μmol/g prot	37.34 ± 7.71	31.81 ± 1.24	39.57 ± 6.68	39.56 ± 4.60	0.746	
 HDL-C, μmol/g prot	9.94 ± 0.72	9.57 ± 2.22	9.21 ± 1.11	8.84 ± 1.78	0.932	
Means within a row with different superscript letters are significantly different (P < 0.05).

Effect of dietary GSPE supplementation on the mRNA expression of genes and enzyme activities related to cholesterol metabolism

To investigate the mechanisms of GSPE on cholesterol reduction in LD muscle of finishing pigs, we measure the mRNA expression of HMG-CoAR, CYP7A1 and LDL-R that have been reported to relate to cholesterol metabolism. As shown in Fig. 1A, compared to the control group, the mRNA expressions of HMG-CoAR and CYP7A1 in the LD muscle of finishing pigs were significantly decreased in 50 mg/kg, 100 mg/kg and 200 mg/kg GSPE groups (P < 0.05), and the mRNA level of LDL-R was not affected by GSPE (Fig. 1A). Then we determined the enzyme activities of HMG-CoAR and CYP7A1. The data showed that GSPE treatments decreased the activities of HMG-CoAR and CYP7A1 in the LD muscle of finishing pigs (P < 0.05) (Fig. 1B).Fig. 1 Effect of dietary GSPE supplementation on mRNA levels of genes and enzyme activities related to cholesterol metabolism of LD muscle in finishing pigs. (A) RT-qPCR analysis of the mRNA levels of HMG-CoAR, CYP7A1 and LDL-R. (B) The enzyme activities of HMG-CoAR and CYP7A1. Data are expressed as the mean ± SE (n = 6). Values with different superscript letters are significantly different (P < 0.05).

Effect of dietary GSPE supplementation on the mRNA expression of genes and enzyme activities related to lipid metabolism

The mRNA expression of genes related to lipid metabolism was shown in Fig. 2A. Compared with the control group, dietary supplementation with 50 mg/kg, 100 mg/kg and 200 mg/kg GSPE increased CPT1b and PPARα mRNA levels in the LD muscle of finishing pigs (P < 0.05). Dietary supplementation with 100 mg/kg and 200 mg/kg GSPE decreased FAS mRNA level (P < 0.05). All the different GSPE treatments augmented the mRNA levels of PGC-1α (P < 0.05) (Fig. 2B). We further examined the activities of CPT1b and FAS in LD muscle. The activity of CPT1b was significantly augmented by GSPE treatments (P < 0.05), along with significant reduction in the activity of FAS by treatment with 200 mg/kg GSPE (P < 0.05) (Fig. 2C).Fig. 2 Effect of dietary GSPE supplementation on mRNA levels of genes and enzyme activities related to lipid metabolism of LD muscle in finishing pigs. (A) RT-qPCR analysis of the mRNA levels of ACC, FAS, HSL, CPT1b, PPARα and LPL. (B) RT-qPCR analysis of the mRNA levels of AMPKα1, AMPKα2 and PGC-1α. (C) The enzyme activities of FAS and CPT1b. Data are expressed as the mean ± SE (n = 6). Values with different superscript letters are significantly different (P < 0.05).

GSPE enhances the antioxidant status of finishing pigs

The effect of dietary GSPE supplementation on antioxidant status in the serum and liver of finishing pigs were presented in Table 5. The results showed that dietary 50 mg/kg, 100 mg/kg and 200 mg/kg GSPE supplementation significantly decreased the serum MDA content, and 100 mg/kg and 200 mg/kg GSPE groups significantly increased the T-SOD and T-AOC activities (P < 0.05). Meanwhile, dietary supplementation of 200 mg/kg GSPE increased the serum GSH-Px and CAT activities. In the liver, dietary 50 mg/kg and 100 mg/kg GSPE supplementation had a significant increase (P < 0.05) in T-SOD activity compared to basal diets (P < 0.05). Moreover, the results showed a statistically significant increased (P < 0.05) GSH-Px activity in liver of finishing pigs fed diet with 100 mg/kg and 200 mg/kg GSPE, and the MDA content was markedly decreased in 50 mg/kg, 100 mg/kg and 200 mg/kg GSPE groups compared with the control.Table 5 Effect of dietary GSPE supplementation on antioxidant capacity of finishing pigs (n = 6).

Items	Control	50 mg/kg GSPE	100 mg/kg GSPE	200 mg/kg GSPE	P-value	
Serum	
 MDA, nmol/mL	3.59 ± 0.19A	2.95 ± 0.04B	2.4 ± 0.09C	2.21 ± 0.03C	0.001	
 T-AOC, U/mL	1.91 ± 0.12B	3.03 ± 0.24AB	3.37 ± 0.32A	3.48 ± 0.26A	0.018	
 T-SOD, U/mL	95.62 ± 2.65B	119.58 ± 6.46AB	132.98 ± 6.70A	131.49 ± 5.95A	0.016	
 GSH-Px, U/mL	604.96 ± 15.54B	647.93 ± 18.47B	687.11 ± 38.32AB	734.71 ± 17.51A	0.009	
 CAT, U/mL	2.39 ± 0.16B	3.08 ± 0.51AB	3.93 ± 0.48AB	5.10 ± 0.56A	0.033	
Liver	
 MDA, nmol/mg prot	1.65 ± 0.12A	0.93 ± 0.07B	0.80 ± 0.02B	0.79 ± 0.09B	0.001	
 T-AOC, U/mg prot	0.89 ± 0.10	1.13 ± 0.12	0.92 ± 0.11	0.93 ± 0.03	0.121	
 T-SOD, U/mg prot	196.17 ± 10.48B	266.57 ± 29.73A	256.09 ± 25.06A	249.67 ± 32.93AB	0.016	
 GSH-Px, U/mg prot	377.77 ± 13.09B	441.86 ± 31.91AB	507.07 ± 27.82A	520.29 ± 27.26A	0.022	
 CAT, U/mg prot	49.60 ± 3.69	52.71 ± 7.56	49.73 ± 6.07	50.07 ± 6.38	0.986	
Means within a row with different superscript letters are significantly different (P < 0.05).

Effect of dietary GSPE supplementation on the mRNA expression of genes related to antioxidant status

To explore the potential mechanism by which GSPE enhances antioxidant status, we performed RT-qPCR to analyze the mRNA expression of certain signaling factors that have been reported to relate to antioxidant status. As shown in Fig. 3, compared with the control group, dietary supplementation of 50 mg/kg, 100 mg/kg and 200 mg/kg GSPE increased the liver SOD1 mRNA level of finishing pigs. Dietary supplementation of 50 mg/kg GSPE significantly increased CAT, GPX1 and NRF2 mRNA levels (P < 0.05). However, the mRNA levels of GST and Keap1 were not affected by GSPE supplementation.Fig. 3 Effect of dietary GSPE supplementation on mRNA levels of genes related to antioxidant in liver in finishing pigs. Data are expressed as the mean ± SE (n = 6). Values with different superscript letters are significantly different (P < 0.05).

Discussion

A considerable number of reports have shown that some plant extracts rich in bioactive substances have a positive effect on cholesterol metabolism and antioxidant status22,23. GSPE is a polyphenolic compound derived from grape seeds with a variety of biological activities. Given the close relationship among cholesterol metabolism, lipid accumulation and oxidative stress and the fact that cholesterol accumulation and oxidative stress will cause a series of chronic diseases8,24. Here, we investigate the effects of dietary GSPE supplementation on cholesterol metabolism, lipid metabolism and antioxidant status in finishing pigs and explored the potential molecular mechanism.

The dysfunction of lipid metabolism often leads to excessive fat deposition, which is detrimental to the body health25. Previous study showed that high TG, T-CHO levels and low HDL-C levels are associated with an increased risk of CVDs and NAFLD26. Dysregulation of cholesterol homeostasis also results in a variety of systemic diseases, such as hyperlipidaemia and AS27. In addition, oxysterols produced during cholesterol metabolism increase the risk of oxidative stress28. GSPE was reported to improve the lipid metabolism in various animal models. Dietary supplementation with 100 and 200 mg/kg GSPE decreased the contents of T-CHO and TG and increased HDL-C content in serum of the later fattening period of finishing pigs21. Supplementation with 250 mg/kg GSPE increased serum HDL-C levels in weaned piglets29. Dietary 100 mg/kg GSPE supplementation could improve blood lipid metabolism in rats, but higher doses of GSPE had a negative effect on intestinal health30,31. Moreover, the dose-dependent appearance of lipid metabolites in rat serum followed the oral administration of 125, 250 and 375 mg/kg of body weight of GSPE32. In this study, we found that dietary GSPE supplementation had no effect on biochemistry parameters in serum and liver, but 100 and 200 mg/kg GSPE could significantly decrease the contents of TG and T-CHO in LD muscle of rapid fattening period of finishing pigs, suggesting GSPE addition may produce pork with low cholesterol and triglycerides. To investigate the mechanisms of GSPE on cholesterol reduction in LD muscle of finishing pigs, HMG-CoAR, CYP7A1 and LDL-R mRNA expression levels were examined. HMG-CoAR is a rate-limiting enzyme for cholesterol synthesis and is strictly controlled at transcriptional and post-translational levels in response to cholesterol levels4. LDL-R is a clearance receptor that binds to LDL to synthesize steroid hormones and bile salts33. CYP7A1 serves as the rate-limiting enzyme in the bile acid synthesis pathway and reduces cholesterol levels by promoting the conversion of cholesterol into bile acids5. Our data showed that the mRNA levels of HMG-CoAR and CYP7A1 were significantly decreased by GSPE and LDL-R mRNA was not affected. To further verify our results, we detected the enzyme activities of HMG-CoAR and CYP7A1. The results showed that GSPE significantly reduced the enzyme activities of HMG-CoAR and CYP7A1, suggesting that the regulation of cholesterol metabolism by GSPE may be due to reducing cholesterol synthesis via downregulation of HMG-CoAR, rather than CYP7A1-mediated cholesterol conversion to bile acids as a cholesterol-lowering mechanism. This study provided the first evidence that the HMG-CoAR and CYP7A1 mRNA expression and enzyme activities were decreased by GSPE, which might partly account for the cholesterol metabolism improvement in finishing pigs. However, the definite mechanism of the cholesterol-lowering effect of GSPE is still unclear and requires further study.

As for fatty acid β-oxidation, CPT1b, PGC-1α and PPARα play major roles. CPT1b is a member of the CPTs family and a key rate-limiting enzyme for fatty acid β-oxidation, which plays a major role in the regulation of fatty acid decomposition and energy supply34. PPARα is a family of nuclear hormone receptors that act as transcription factors for genes associated with lipid metabolism and inflammation35. In the liver, PPARα is the highest expressed PPARα isoform and regulates fatty acid catabolism and lipid export36. Both PPARα and CPT1b act as marker genes for fatty acid β-oxidation. In addition, PPARα also regulates the mRNA expression level of CPT-1b23. Here, we showed that dietary GSPE supplementation increased the PPARα and CPT1b mRNA expression and significantly enhanced CPT1b enzymatic activity, suggesting that GSPE has a negative effect on the biosynthesis of fatty acids. PGC-1α, as a transcription factor, regulates lipid metabolism and long-chain fatty acid oxidation by upregulating the expression of multiple genes of the tricarboxylic acid cycle and mitochondrial fatty acid oxidation. In addition, PGC-1α regulates mitochondrial gene expression through interaction with NRF2 to control mitochondrial DNA replication and cellular oxidative metabolism37. FAS, a cell surface glycoprotein that belongs to the tumor necrosis factor (TNF) receptor superfamily, is involved in the condensation of acetyl-CoA, malonyl-CoA and NADPH and plays a key role in the initial synthesis of long-chain fatty acids38. It promotes the synthesis of fatty acids and induces fat accumulation. As expected, we showed that dietary GSPE supplementation reduced the mRNA expression and enzyme activities of FAS and increased the PGC-1α mRNA expression of LD muscle in finishing pigs. These results suggested that the potential positive effect of GSPE on lipid metabolism in finishing pigs might be achieved by the FAS and PGC-1α signal pathway.

In the study, we found that GSPE could improve cholesterol and lipid metabolism by regulating cholesterol metabolism related genes and enzyme activities. Previous researches indicates that an imbalance in cholesterol metabolism leads to accumulation of LDL, which is susceptible to oxidation to ox-LDL11,12. Ox-LDL elevates intracellular ROS levels and further exacerbates oxidative stress13,38. On the contrary, the antioxidant system protects LDL from oxidative damage by eliminating free radicals and ROS and inhibiting lipid peroxidation39. In addition, alterations in the functional state of the antioxidant system not only inflict damage to cells and their functions, but also affect the activity of cholesterol metabolic enzymes40,41. At the same time, oxidative stress is exacerbated by the oxidation products generated during cholesterol metabolism such as oxysterols15, which subsequently contributes to cholesterol accumulation28,42. In view of the close relationship between antioxidant and cholesterol metabolism, we detected the effect of GSPE on antioxidant status of finishing pigs.

As we all know, oxidative stress is caused by the imbalance between oxidation and antioxidant defense systems. T-SOD is known to be an important antioxidant enzyme that distributed in the cytoplasm and mitochondria8. It also plays an important role in maintaining low levels of superoxide anions8. GSH is a very important antioxidant substance and contributes to defending oxidative stress22. CAT is presumably involved in biological control systems protecting cells from H2O2 toxicity43. MDA, a by-product of lipid oxidation, which is an important indicator of oxidative stress and reflects damage caused by ROS44. Antioxidant enzymes reduce lipid peroxidation by scavenging free radicals and oxidation products, thereby minimizing the production of MDA45. As one of the final products of lipid peroxidation, the accumulation of MDA reflects the degree of lipid peroxidation and the antioxidant capacity of antioxidant system46. In this study, we showed that the serum T-AOC, CAT levels, the serum and liver GSH-Px and T-SOD levels were increased, while the serum and liver MDA levels were decreased by 100 mg/kg and 200 mg/kg GSPE, suggesting that GSPE has a positive effect on the antioxidant capacity in finishing pigs. In agreement with our results, it has been shown that dietary supplementation of 200 mg/kg GSPE increased T-SOD, T-AOC and GSH-Px levels, and decreased the level of MDA in liver and serum of the later fattening period of finishing pigs21. Dietary supplementation with 250 mg/kg GSPE could increase the activity of SOD and decrease MDA content in weaned piglets29. Dietary 50, 100 and 200 mg/kg GSPE supplementation also decreased MDA content, but increased T-AOC and T-SOD activities in LD muscle of finishing pigs47. SOD1, CAT, GPX1 and NRF2 are the marker genes responsible for antioxidant activity. CAT is a cellular antioxidant enzyme gene that eliminates hydrogen peroxide produced by the oxidation of various substrates, such as long-chain fatty acids48. SOD1 is one of the key antioxidant enzymes in organisms. It plays an important role in regulating and maintaining redox balance49. The levels of oxidative stress increased significantly after SOD1 knockdown50. During aerobic metabolism, cells produce energy and also produce a toxic oxygen intermediate termed ROS. Excessive ROS will lead to cellular homeostasis disturbance51. GPX1 is a selenium-dependent enzyme that reduces the content of intracellular hydrogen peroxide and lipid peroxides52. The transcription factor NRF2 is most widely known as one of the main orchestrators of the cellular antioxidants and oxidative stress response53. Keap1-NRF2 signaling pathway plays a key role in regulating the antioxidant stress response of the body. NRF2 is also important for the activation of antioxidant-related genes such as CAT, SOD1, GPX1 and GST54. Recently, an investigation reported that dietary supplementation of GSPE reduces oxidative stress via activating the NRF2 pathway in mice55. Dietary supplementation of GSPE not only increased the mRNA levels of SOD1, GST and NRF2 in LD muscle of finishing pigs, but also reduced the content of MDA and enhanced the activities of T-AOC, GSH-Px and T-SOD47. Consistently, we observed dietary GSPE supplementation improved the antioxidant status in the serum and liver of finishing pigs and upregulated the mRNA levels of CAT, SOD1, GPX1 and NRF2 in the liver, which are consistent with previous reports19,28,29,47. On the basis of the previous reports that the relationship between antioxidant capacity and cholesterol metabolism, we surmise that the improvement of cholesterol metabolism in GSPE-supplemented pigs may results from an improved antioxidant status.

Conclusions

It is generally known that intake of pork with low cholesterol and triglycerides is more beneficial to human health than pork with high cholesterol and triglycerides. We provide the evidence that the LD muscle cholesterol-lowering effect of GSPE is due to a decrease in cholesterol synthesis in finishing pigs. In addition, dietary GSPE supplementation improved the antioxidant status and cholesterol metabolism in finishing pigs. However, there is insufficient evidence to suggest that the dose of GSPE is physiologically relevant. Based on our findings, dietary supplementation of 100 mg/kg GSPE seemed to be a better added dose. This study will promote further research on the application of GSPE in animal health and provide important insights into producing pork with low cholesterol and triglycerides.

Author contributions

M.X. conceived and designed the experiments and performed the experiments. W.W. wrote original draft and M.X. revised it. M.X. and W.W. analyzed the data. H.D., Q.L., F.G. and Y.M. contributed reagents/materials/analysis tools. All authors read and approved the final manuscript.

Funding

This study was supported by the Natural Science Foundation of Sichuan Province (2022NSFSC1613) and the Fundamental Research Funds for the Central Universities/Southwest Minzu University (ZYN2023038).

Data availability

The datasets usedand/or analysed during the current study available from the corresponding author on request.

Competing interests

The authors declare no competing interests.

Informed consent

The informed consent was obtained from all participants.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Wenjing Wang and Meng Xu.
==== Refs
References

1. Yanagisawa R He C Asai A Hellwig M Henle T Toda M The impacts of cholesterol, oxysterols, and cholesterol lowering dietary compounds on the immune system Int. J. Mol. Sci. 2022 23 20 12236 10.3390/ijms232012236 36293093
Yanagisawa, R. et al. The impacts of cholesterol, oxysterols, and cholesterol lowering dietary compounds on the immune system. Int. J. Mol. Sci. 23(20), 12236 (2022).36293093 10.3390/ijms232012236
2. Guo Z Chen X Huang Z Chen D Yu J Yan H Chen H He J Zheng P Luo Y Apple polyphenols improve intestinal barrier function by enhancing antioxidant capacity and suppressing inflammation in weaning piglets Anim. Sci. J. 2022 93 1 e13747 10.1111/asj.13747 35699681
Guo, Z. et al. Apple polyphenols improve intestinal barrier function by enhancing antioxidant capacity and suppressing inflammation in weaning piglets. Anim. Sci. J. 93(1), e13747 (2022).35699681 10.1111/asj.13747
3. Wang Y Chen X Huang Z Chen D Yu B Yu J Chen H He J Luo Y Zheng P Dietary ferulic acid supplementation improves antioxidant capacity and lipid metabolism in weaned piglets Nutrients 2020 12 12 3811 10.3390/nu12123811 33322714
Wang, Y. et al. Dietary ferulic acid supplementation improves antioxidant capacity and lipid metabolism in weaned piglets. Nutrients 12(12), 3811 (2020).33322714 10.3390/nu12123811
4. Zhong S Li L Liang N Zhang L Xu X Chen S Yin H Acetaldehyde dehydrogenase 2 regulates HMG-CoA reductase stability and cholesterol synthesis in the liver Redox Biol. 2021 41 101919 10.1016/j.redox.2021.101919 33740503
Zhong, S. et al. Acetaldehyde dehydrogenase 2 regulates HMG-CoA reductase stability and cholesterol synthesis in the liver. Redox Biol. 41, 101919 (2021).33740503 10.1016/j.redox.2021.101919
5. Chiang JYL Ferrell JM Up to date on cholesterol 7 alpha-hydroxylase (CYP7A1) in bile acid synthesis Liver Res. 2020 4 47 63 10.1016/j.livres.2020.05.001 34290896
Chiang, J. Y. L. & Ferrell, J. M. Up to date on cholesterol 7 alpha-hydroxylase (CYP7A1) in bile acid synthesis. Liver Res. 4, 47–63 (2020).34290896 10.1016/j.livres.2020.05.001
6. Joseph J Shamburek RD Cochran EK Gorden P Brown RJ Lipid regulation in lipodystrophy versus the obesity-associated metabolic syndrome: The dissociation of HDL-C and triglycerides J. Clin. Endocrinol. Metab. 2014 99 E1676 E1680 10.1210/jc.2014-1878 24926953
Joseph, J., Shamburek, R. D., Cochran, E. K., Gorden, P. & Brown, R. J. Lipid regulation in lipodystrophy versus the obesity-associated metabolic syndrome: The dissociation of HDL-C and triglycerides. J. Clin. Endocrinol. Metab. 99, E1676–E1680 (2014).24926953 10.1210/jc.2014-1878
7. Xie C Chen Z Zhang C Xu X Jin J Zhan W Han T Wang J Dihydromyricetin ameliorates oleic acid-induced lipid accumulation in L02 and HepG2 cells by inhibiting lipogenesis and oxidative stress Life Sci. 2016 157 131 139 10.1016/j.lfs.2016.06.001 27265384
Xie, C. et al. Dihydromyricetin ameliorates oleic acid-induced lipid accumulation in L02 and HepG2 cells by inhibiting lipogenesis and oxidative stress. Life Sci. 157, 131–139 (2016).27265384 10.1016/j.lfs.2016.06.001
8. Yu L Peng Z Dong L Wang S Ding L Huo Y Wang H Bamboo vinegar powder supplementation improves the antioxidant ability of the liver in finishing pigs Livest. Sci. 2018 211 80 86 10.1016/j.livsci.2017.11.004
Yu, L. et al. Bamboo vinegar powder supplementation improves the antioxidant ability of the liver in finishing pigs. Livest. Sci. 211, 80–86 (2018).10.1016/j.livsci.2017.11.004
9. Pelicano H Carney D Huang P ROS Stress in cancer cells and therapeutic implications Drug Resist. Updat. 2004 7 97 110 10.1016/j.drup.2004.01.004 15158766
Pelicano, H., Carney, D. & Huang, P. ROS Stress in cancer cells and therapeutic implications. Drug Resist. Updat. 7, 97–110 (2004).15158766 10.1016/j.drup.2004.01.004
10. Borggreve SE De Vries R Dullaart RPF Alterations in high-density lipoprotein metabolism and reverse cholesterol transport in insulin resistance and type 2 diabetes mellitus: Role of lipolytic enzymes, lecithin:cholesterol acyltransferase and lipid transfer proteins: HDL metabolism and reverse cholesterol transport in insulin resistance and type 2 diabetes mellitus Eur. J. Clin. Investig. 2003 33 1051 1069 10.1111/j.1365-2362.2003.01263.x 14636288
Borggreve, S. E., De Vries, R. & Dullaart, R. P. F. Alterations in high-density lipoprotein metabolism and reverse cholesterol transport in insulin resistance and type 2 diabetes mellitus: Role of lipolytic enzymes, lecithin:cholesterol acyltransferase and lipid transfer proteins: HDL metabolism and reverse cholesterol transport in insulin resistance and type 2 diabetes mellitus. Eur. J. Clin. Investig. 33, 1051–1069 (2003).14636288 10.1111/j.1365-2362.2003.01263.x
11. Šošić-Jurjević B Borković-Mitić S Pavlović S Vlahović D Miler M Cesar T Ajdžanović V Milenkovic D Stellaard F Trifunović S Lemon flavonoid extract eriomin improves pro/antioxidant status and interferes with cholesterol metabolism without affecting serum cholesterol levels in aged rats Int. J. Mol. Sci. 2024 25 10 5221 10.3390/ijms25105221 38791260
Šošić-Jurjević, B. et al. Lemon flavonoid extract eriomin improves pro/antioxidant status and interferes with cholesterol metabolism without affecting serum cholesterol levels in aged rats. Int. J. Mol. Sci. 25(10), 5221 (2024).38791260 10.3390/ijms25105221
12. Liang C Wang X Hu J Lian X Zhu T Zhang H Gu N Li J PTPRO promotes oxidized low-density lipoprotein induced oxidative stress and cell apoptosis through toll-like receptor 4/nuclear factor κB pathway Cell. Physiol. Biochem. 2017 42 495 505 10.1159/000477596 28578349
Liang, C. et al. PTPRO promotes oxidized low-density lipoprotein induced oxidative stress and cell apoptosis through toll-like receptor 4/nuclear factor κB pathway. Cell. Physiol. Biochem. 42, 495–505 (2017).28578349 10.1159/000477596
13. De Felice B Santillo M Serù R Damiano S Matrone G Wilson RR Mondola P Modulation of 3-hydroxy-3-methylglutaryl-CoA reductase gene expression by CuZn superoxide dismutase in human fibroblasts and HepG2 cells Gene Expr. 2004 12 29 38 10.3727/000000004783992198 15473258
De Felice, B. et al. Modulation of 3-hydroxy-3-methylglutaryl-CoA reductase gene expression by CuZn superoxide dismutase in human fibroblasts and HepG2 cells. Gene Expr. 12, 29–38 (2004).15473258 10.3727/000000004783992198
14. Sadowska-Krępa E Kłapcińska B Nowara A Jagsz S Szołtysek-Bołdys I Chalimoniuk M Langfort J Chrapusta SJ High-dose testosterone supplementation disturbs liver pro-oxidant/antioxidant balance and function in adolescent male wistar rats undergoing moderate-intensity endurance training PeerJ 2020 8 e10228 10.7717/peerj.10228 33240609
Sadowska-Krępa, E. et al. High-dose testosterone supplementation disturbs liver pro-oxidant/antioxidant balance and function in adolescent male wistar rats undergoing moderate-intensity endurance training. PeerJ 8, e10228 (2020).33240609 10.7717/peerj.10228
15. Panzitt K Wagner M FXR in liver physiology: Multiple faces to regulate liver metabolism Biochim. Biophys. Acta Mol. Basis Dis. 2021 1867 7 166133 10.1016/j.bbadis.2021.166133 33771667
Panzitt, K. & Wagner, M. FXR in liver physiology: Multiple faces to regulate liver metabolism. Biochim. Biophys. Acta Mol. Basis Dis. 1867(7), 166133 (2021).33771667 10.1016/j.bbadis.2021.166133
16. Guo Z Chen X Huang Z Chen D Yu B Chen H Yu J Yan H Zheng P Luo Y Dietary dihydromyricetin supplementation enhances antioxidant capacity and improves lipid metabolism in finishing pigs Food Funct. 2021 12 6925 6935 10.1039/D0FO03094E 34132271
Guo, Z. et al. Dietary dihydromyricetin supplementation enhances antioxidant capacity and improves lipid metabolism in finishing pigs. Food Funct. 12, 6925–6935 (2021).34132271 10.1039/D0FO03094E
17. Zhang L Qi Y ALuo Z Liu S Zhang Z Zhou L Betaine increases mitochondrial content and improves hepatic lipid metabolism Food Funct. 2019 10 216 223 10.1039/C8FO02004C 30534761
Zhang, L. et al. Betaine increases mitochondrial content and improves hepatic lipid metabolism. Food Funct. 10, 216–223 (2019).30534761 10.1039/C8FO02004C
18. Zhao Y Jiang C Lu J Sun Y Cui Y Research progress of proanthocyanidins and anthocyanidins Phytother. Res. 2023 37 6 2552 2577 10.1002/ptr.7850 37118988
Zhao, Y., Jiang, C., Lu, J., Sun, Y. & Cui, Y. Research progress of proanthocyanidins and anthocyanidins. Phytother. Res. 37(6), 2552–2577 (2023).37118988 10.1002/ptr.7850
19. Alyami NM Abdi S Alyami HM Almeer R Proanthocyanidins alleviate pentylenetetrazole-induced epileptic seizures in mice via the antioxidant activity Neurochem. Res. 2022 47 3012 3023 10.1007/s11064-022-03647-4 35838827
Alyami, N. M., Abdi, S., Alyami, H. M. & Almeer, R. Proanthocyanidins alleviate pentylenetetrazole-induced epileptic seizures in mice via the antioxidant activity. Neurochem. Res. 47, 3012–3023 (2022).35838827 10.1007/s11064-022-03647-4
20. Gao Z Liu G Hu Z Shi W Chen B Zou P Li X Grape seed proanthocyanidins protect against streptozotocin-induced diabetic nephropathy by attenuating endoplasmic reticulum stress-induced apoptosis Mol. Med. Rep. 2018 18 2 1447 1454 29901130
Gao, Z. et al. Grape seed proanthocyanidins protect against streptozotocin-induced diabetic nephropathy by attenuating endoplasmic reticulum stress-induced apoptosis. Mol. Med. Rep. 18(2), 1447–1454 (2018).29901130
21. Cheng K Yu C Li Z Li S Yan E Song Z Zhang H Zhang L Wang T Resveratrol improves meat quality, muscular antioxidant capacity, lipid metabolism and fiber type composition of intrauterine growth retarded pigs Meat Sci. 2020 170 108237 10.1016/j.meatsci.2020.108237 32739758
Cheng, K. et al. Resveratrol improves meat quality, muscular antioxidant capacity, lipid metabolism and fiber type composition of intrauterine growth retarded pigs. Meat Sci. 170, 108237 (2020).32739758 10.1016/j.meatsci.2020.108237
22. Xu X Chen X Huang Z Chen D He J Zheng P Chen H Luo J Luo Y Yu B Yu J Effects of dietary apple polyphenols supplementation on hepatic fat deposition and antioxidant capacity in finishing pigs Animals 2019 9 11 937 10.3390/ani9110937 31717391
Xu, X. et al. Effects of dietary apple polyphenols supplementation on hepatic fat deposition and antioxidant capacity in finishing pigs. Animals 9(11), 937 (2019).31717391 10.3390/ani9110937
23. Yang R Le G Li A Zheng J Shi Y Effect of antioxidant capacity on blood lipid metabolism and lipoprotein lipase activity of rats fed a high-fat diet Nutrition 2006 22 1185 1191 10.1016/j.nut.2006.08.018 17095404
Yang, R., Le, G., Li, A., Zheng, J. & Shi, Y. Effect of antioxidant capacity on blood lipid metabolism and lipoprotein lipase activity of rats fed a high-fat diet. Nutrition 22, 1185–1191 (2006).17095404 10.1016/j.nut.2006.08.018
24. Xu Q Li S Tang W Yan J Wei X Zhou M Diao H The effect of ellagic acid on hepatic lipid metabolism and antioxidant activity in mice Front. Physiol. 2021 12 751501 10.3389/fphys.2021.751501 34690819
Xu, Q. et al. The effect of ellagic acid on hepatic lipid metabolism and antioxidant activity in mice. Front. Physiol. 12, 751501 (2021).34690819 10.3389/fphys.2021.751501
25. Cai X Liu Z Dong X Wang Y Zhu L Li M Xu Y Hypoglycemic and lipid lowering effects of theaflavins in high-fat diet-induced obese mice Food Funct. 2021 12 9922 9931 10.1039/D1FO01966J 34492673
Cai, X. et al. Hypoglycemic and lipid lowering effects of theaflavins in high-fat diet-induced obese mice. Food Funct. 12, 9922–9931 (2021).34492673 10.1039/D1FO01966J
26. Eilam Y Pintel N Khattib H Shagug N Taha R Avni D Regulation of cholesterol metabolism by phytochemicals derived from algae and edible mushrooms in non-alcoholic fatty liver disease Int. J. Mol. Sci. 2022 23 22 13667 10.3390/ijms232213667 36430146
Eilam, Y. et al. Regulation of cholesterol metabolism by phytochemicals derived from algae and edible mushrooms in non-alcoholic fatty liver disease. Int. J. Mol. Sci. 23(22), 13667 (2022).36430146 10.3390/ijms232213667
27. Akhter R Masoodi FA Wani TA Rather SA Impact of microencapsulated natural antioxidants on the lipid profile and cholesterol oxidation of γ-irradiated meat emulsions LWT 2022 159 113155 10.1016/j.lwt.2022.113155
Akhter, R., Masoodi, F. A., Wani, T. A. & Rather, S. A. Impact of microencapsulated natural antioxidants on the lipid profile and cholesterol oxidation of γ-irradiated meat emulsions. LWT 159, 113155 (2022).10.1016/j.lwt.2022.113155
28. Feng Y Chen X Chen D He J Zheng P Luo Y Yu B Huang Z Dietary grape seed proanthocyanidin extract supplementation improves antioxidant capacity and lipid metabolism in finishing pigs Anim. Biotechnol. 2023 34 8 4021 4031 37647084
Feng, Y. et al. Dietary grape seed proanthocyanidin extract supplementation improves antioxidant capacity and lipid metabolism in finishing pigs. Anim. Biotechnol. 34(8), 4021–4031 (2023).37647084
29. Wu Y Ma N Song P He T Levesque C Bai Y Zhang A Ma X Grape seed proanthocyanidin affects lipid metabolism via changing gut microflora and enhancing propionate production in weaned pigs J. Nutr. 2019 149 1523 1532 10.1093/jn/nxz102 31175811
Wu, Y. et al. Grape seed proanthocyanidin affects lipid metabolism via changing gut microflora and enhancing propionate production in weaned pigs. J. Nutr. 149, 1523–1532 (2019).31175811 10.1093/jn/nxz102
30. Ginés I Gil-Cardoso K Serrano J Casanova-Martí À Blay Mt Pinent M Ardévol A Terra X Effects of an intermittent grape-seed proanthocyanidin (GSPE) treatment on a cafeteria diet obesogenic challenge in rats Nutrients 2018 10 3 315 10.3390/nu10030315 29518911
Ginés, I. et al. Effects of an intermittent grape-seed proanthocyanidin (GSPE) treatment on a cafeteria diet obesogenic challenge in rats. Nutrients 10(3), 315 (2018).29518911 10.3390/nu10030315
31. Pons Z Margalef M Bravo FI Arola-Arnal A Muguerza B Chronic administration of grape-seed polyphenols attenuates the development of hypertension and improves other cardiometabolic risk factors associated with the metabolic syndrome in cafeteria diet-fed rats Br. J. Nutr. 2017 117 200 208 10.1017/S0007114516004426 28162106
Pons, Z., Margalef, M., Bravo, F. I., Arola-Arnal, A. & Muguerza, B. Chronic administration of grape-seed polyphenols attenuates the development of hypertension and improves other cardiometabolic risk factors associated with the metabolic syndrome in cafeteria diet-fed rats. Br. J. Nutr. 117, 200–208 (2017).28162106 10.1017/S0007114516004426
32. Margalef M Guerrero L Pons Z Bravo FI Arola L Muguerza B Arola-Arnal A A dose-response study of the bioavailability of grape seed proanthocyanidin in rat and lipid-lowering effects of generated metabolites in HepG2 cells Food Res. Int. Ott. Ont 2014 64 500 507 10.1016/j.foodres.2014.07.019
Margalef, M. et al. A dose-response study of the bioavailability of grape seed proanthocyanidin in rat and lipid-lowering effects of generated metabolites in HepG2 cells. Food Res. Int. Ott. Ont 64, 500–507 (2014).10.1016/j.foodres.2014.07.019
33. Osono Y Woollett LA Herz J Dietschy JM Role of the low density lipoprotein receptor in the flux of cholesterol through the plasma and across the tissues of the mouse J. Clin. Invest. 1995 95 1124 1132 10.1172/JCI117760 7883961
Osono, Y., Woollett, L. A., Herz, J. & Dietschy, J. M. Role of the low density lipoprotein receptor in the flux of cholesterol through the plasma and across the tissues of the mouse. J. Clin. Invest. 95, 1124–1132 (1995).7883961 10.1172/JCI117760
34. Peffer PL Lin X Odle J Hepatic β-oxidation and carnitine palmitoyltransferase I in neonatal pigs after dietary treatments of clofibric acid, isoproterenol, and medium-chain triglycerides Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2005 288 R1518 R1524 10.1152/ajpregu.00822.2004 15731399
Peffer, P. L., Lin, X. & Odle, J. Hepatic β-oxidation and carnitine palmitoyltransferase I in neonatal pigs after dietary treatments of clofibric acid, isoproterenol, and medium-chain triglycerides. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 288, R1518–R1524 (2005).15731399 10.1152/ajpregu.00822.2004
35. Wahli W Michalik L PPARs at the Crossroads of lipid signaling and inflammation Trends Endocrinol. Metab. 2012 23 351 363 10.1016/j.tem.2012.05.001 22704720
Wahli, W. & Michalik, L. PPARs at the Crossroads of lipid signaling and inflammation. Trends Endocrinol. Metab. 23, 351–363 (2012).22704720 10.1016/j.tem.2012.05.001
36. Michalik L Auwerx J Berger JP Chatterjee VK Glass CK Gonzalez FJ Grimaldi PA Kadowaki T Lazar MA O’Rahilly S International union of pharmacology. LXI. Peroxisome proliferator-activated receptors Pharmacol. Rev. 2006 58 726 741 10.1124/pr.58.4.5 17132851
Michalik, L. et al. International union of pharmacology. LXI. Peroxisome proliferator-activated receptors. Pharmacol. Rev. 58, 726–741 (2006).17132851 10.1124/pr.58.4.5
37. Cheng CF Ku HC Lin H PGC-1α as a pivotal factor in lipid and metabolic regulation Int. J. Mol. Sci. 2018 19 3447 10.3390/ijms19113447 30400212
Cheng, C. F., Ku, H. C. & Lin, H. PGC-1α as a pivotal factor in lipid and metabolic regulation. Int. J. Mol. Sci. 19, 3447 (2018).30400212 10.3390/ijms19113447
38. Zou C Ma J Wang X Guo L Zhu Z Stoops J Eaker AE Johnson CJ Strom S Michalopoulos GK Lack of fas antagonism by met in human fatty liver disease Nat. Med. 2007 13 1078 1085 10.1038/nm1625 17704785
Zou, C. et al. Lack of fas antagonism by met in human fatty liver disease. Nat. Med. 13, 1078–1085 (2007).17704785 10.1038/nm1625
39. Singh RK Lund FW Haka AS Maxfield FR High-density lipoprotein or cyclodextrin extraction of cholesterol from aggregated LDL reduces foam cell formation J. Cell Sci. 2019 132 23 jcs237271 10.1242/jcs.237271 31719160
Singh, R. K., Lund, F. W., Haka, A. S. & Maxfield, F. R. High-density lipoprotein or cyclodextrin extraction of cholesterol from aggregated LDL reduces foam cell formation. J. Cell Sci. 132(23), jcs237271 (2019).31719160 10.1242/jcs.237271
40. Sies H Berndt C Jones DP Oxidative stress Annu. Rev. Biochem. 2017 86 715 748 10.1146/annurev-biochem-061516-045037 28441057
Sies, H., Berndt, C. & Jones, D. P. Oxidative stress. Annu. Rev. Biochem. 86, 715–748 (2017).28441057 10.1146/annurev-biochem-061516-045037
41. Valérie M Edgard D Alain TS André T Emile L Expression of concern: Oxidative stress influences cholesterol Efflux in THP-1 macrophages: Role of ATP-binding cassette a1 and nuclear factors Cardiovasc. Res. 2023 119 1296 1296 10.1093/cvr/cvad020 36857297
Valérie, M., Edgard, D., Alain, T. S., André, T. & Emile, L. Expression of concern: Oxidative stress influences cholesterol Efflux in THP-1 macrophages: Role of ATP-binding cassette a1 and nuclear factors. Cardiovasc. Res. 119, 1296–1296 (2023).36857297 10.1093/cvr/cvad020
42. Goicoechea L de la Rosa LC Torres S García-Ruiz C Fernández-Checa JC Mitochondrial cholesterol: Metabolism and impact on redox biology and disease Redox Biol. 2023 61 102643 10.1016/j.redox.2023.102643 36857930
Goicoechea, L., de la Rosa, L. C., Torres, S., García-Ruiz, C. & Fernández-Checa, J. C. Mitochondrial cholesterol: Metabolism and impact on redox biology and disease. Redox Biol. 61, 102643 (2023).36857930 10.1016/j.redox.2023.102643
43. Zhang C Luo J Yu B Chen J Chen D Effects of resveratrol on lipid metabolism in muscle and adipose tissues: A reevaluation in a pig model J. Funct. Foods 2015 14 590 595 10.1016/j.jff.2015.02.039
Zhang, C., Luo, J., Yu, B., Chen, J. & Chen, D. Effects of resveratrol on lipid metabolism in muscle and adipose tissues: A reevaluation in a pig model. J. Funct. Foods 14, 590–595 (2015).10.1016/j.jff.2015.02.039
44. Desagher S Glowinski J Premont J Astrocytes protect neurons from hydrogen peroxide toxicity J. Neurosci. 1996 16 2553 2562 10.1523/JNEUROSCI.16-08-02553.1996 8786431
Desagher, S., Glowinski, J. & Premont, J. Astrocytes protect neurons from hydrogen peroxide toxicity. J. Neurosci. 16, 2553–2562 (1996).8786431 10.1523/JNEUROSCI.16-08-02553.1996
45. Zhang X Lu X Li J Xia Q Gao J Wu B Mito-tempo alleviates cryodamage by regulating intracellular oxidative metabolism in spermatozoa from asthenozoospermic patients Cryobiology 2019 91 18 22 10.1016/j.cryobiol.2019.11.005 31734127
Zhang, X. et al. Mito-tempo alleviates cryodamage by regulating intracellular oxidative metabolism in spermatozoa from asthenozoospermic patients. Cryobiology 91, 18–22 (2019).31734127 10.1016/j.cryobiol.2019.11.005
46. Dludla PV Orlando P Silvestri S Marcheggiani F Cirilli I Nyambuya TM Mxinwa V Mokgalaboni K Nkambule BB Johnson R Coenzyme Q(10) supplementation improves adipokine levels and alleviates inflammation and lipid peroxidation in conditions of metabolic syndrome: A meta-analysis of randomized controlled trials Int. J. Mol. Sci. 2020 21 9 3247 10.3390/ijms21093247 32375340
Dludla, P. V. et al. Coenzyme Q(10) supplementation improves adipokine levels and alleviates inflammation and lipid peroxidation in conditions of metabolic syndrome: A meta-analysis of randomized controlled trials. Int. J. Mol. Sci. 21(9), 3247 (2020).32375340 10.3390/ijms21093247
47. Xu M Chen X Huang Z Chen D Li M He J Chen H Zheng P Yu J Luo Y Effects of dietary grape seed proanthocyanidin extract supplementation on meat quality, muscle fiber characteristics and antioxidant capacity of finishing pigs Food Chem. 2022 367 130781 10.1016/j.foodchem.2021.130781 34391997
Xu, M. et al. Effects of dietary grape seed proanthocyanidin extract supplementation on meat quality, muscle fiber characteristics and antioxidant capacity of finishing pigs. Food Chem. 367, 130781 (2022).34391997 10.1016/j.foodchem.2021.130781
48. Xu H Ranjit R Richardson A Van Remmen H Muscle mitochondrial catalase expression prevents neuromuscular junction disruption, atrophy, and weakness in a mouse model of accelerated sarcopenia J. Cachexia Sarcopenia Muscle 2021 12 1582 1596 10.1002/jcsm.12768 34559475
Xu, H., Ranjit, R., Richardson, A. & Van Remmen, H. Muscle mitochondrial catalase expression prevents neuromuscular junction disruption, atrophy, and weakness in a mouse model of accelerated sarcopenia. J. Cachexia Sarcopenia Muscle 12, 1582–1596 (2021).34559475 10.1002/jcsm.12768
49. Dong N Liu W Regulatory mechanism of downregulation of SOD1 expression on cardiomyocyte function Sleep Breath 2023 27 399 410 10.1007/s11325-022-02595-1 35307768
Dong, N. & Liu, W. Regulatory mechanism of downregulation of SOD1 expression on cardiomyocyte function. Sleep Breath 27, 399–410 (2023).35307768 10.1007/s11325-022-02595-1
50. Park JH Elpers C Reunert J McCormick ML Mohr J Biskup S Schwartz O Rust S Grüneberg M Seelhöfer A SOD1 deficiency: A novel syndrome distinct from amyotrophic lateral sclerosis Brain 2019 142 2230 2237 10.1093/brain/awz182 31332433
Park, J. H. et al. SOD1 deficiency: A novel syndrome distinct from amyotrophic lateral sclerosis. Brain 142, 2230–2237 (2019).31332433 10.1093/brain/awz182
51. Cadenas E Davies KJ Mitochondrial free radical generation, oxidative stress, and aging Free Rad. Biol. Med. 2000 29 222 230 10.1016/S0891-5849(00)00317-8 11035250
Cadenas, E. & Davies, K. J. Mitochondrial free radical generation, oxidative stress, and aging. Free Rad. Biol. Med. 29, 222–230 (2000).11035250 10.1016/S0891-5849(00)00317-8
52. Huang JQ Zhou JC Wu YY Ren FZ Lei XG Role of glutathione peroxidase 1 in glucose and lipid metabolism-related diseases Free Radic. Biol. Med. 2018 127 108 115 10.1016/j.freeradbiomed.2018.05.077 29800654
Huang, J. Q., Zhou, J. C., Wu, Y. Y., Ren, F. Z. & Lei, X. G. Role of glutathione peroxidase 1 in glucose and lipid metabolism-related diseases. Free Radic. Biol. Med. 127, 108–115 (2018).29800654 10.1016/j.freeradbiomed.2018.05.077
53. He F Ru X Wen T NRF2, a transcription factor for stress response and beyond Int. J. Mol. Sci. 2020 21 4777 10.3390/ijms21134777 32640524
He, F., Ru, X. & Wen, T. NRF2, a transcription factor for stress response and beyond. Int. J. Mol. Sci. 21, 4777 (2020).32640524 10.3390/ijms21134777
54. Wakabayashi N Itoh K Wakabayashi J Motohashi H Noda S Takahashi S Imakado S Kotsuji T Otsuka F Roop DR Keap1-null mutation leads to postnatal lethality due to constitutive Nrf2 activation Nat. Genet. 2003 35 238 245 10.1038/ng1248 14517554
Wakabayashi, N. et al. Keap1-null mutation leads to postnatal lethality due to constitutive Nrf2 activation. Nat. Genet. 35, 238–245 (2003).14517554 10.1038/ng1248
55. Niu L Shao M Liu Y Hu J Li R Xie H Zhou L Shi L Zhang R Niu Y Reduction of oxidative damages induced by titanium dioxide nanoparticles correlates with induction of the Nrf2 pathway by GSPE supplementation in mice Chem. Biol. Interact. 2017 275 133 144 10.1016/j.cbi.2017.07.025 28780322
Niu, L. et al. Reduction of oxidative damages induced by titanium dioxide nanoparticles correlates with induction of the Nrf2 pathway by GSPE supplementation in mice. Chem. Biol. Interact. 275, 133–144 (2017).28780322 10.1016/j.cbi.2017.07.025
