
==== Front
iScience
iScience
iScience
2589-0042
Elsevier

S2589-0042(24)01946-1
10.1016/j.isci.2024.110721
110721
Article
Stapokibart (CM310) targets IL-4Rα for the treatment of type 2 inflammation
Liu Wei 14
Zhao Yan 24
He Yanyun 1
Yan Xinyu 1
Yu Juntao 1
Song Qin 1
Zhang Libo 1
Dong Bohan 3
Xu Gang 1
Wang Changyu 1
Zhang Jianzhong rmzjz@126.com
2∗
Chen Bo knybochen@keymedbio.com
15∗∗
1 Research and Development Department, Keymed Biosciences (Chengdu) Limited, Chengdu 610000, China
2 Department of Dermatology, Peking University People’s Hospital, Beijing 100044, China
3 Tallulah Falls School, Georgia, GA 30573, USA
∗ Corresponding author rmzjz@126.com
∗∗ Corresponding author knybochen@keymedbio.com
4 These authors contributed equally

5 Lead contact

13 8 2024
20 9 2024
13 8 2024
27 9 1107213 4 2024
3 7 2024
8 8 2024
© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Summary

Stapokibart (CM310) is a humanized IL-4Rα monoclonal antibody currently undergoing phase 3 trials for type 2 inflammatory diseases. In contrast to dupilumab, which bound exclusively to human IL-4Rα, stapokibart demonstrated cross-species reactivity to IL-4Rα from human, cynomolgus monkey, and rat. Stapokibart exhibited comparable blocking activity to dupilumab. Epitope mapping revealed that stapokibart bound to distinct sites on IL-4Rα compared to dupilumab. In vitro assays showed that stapokibart was comparable or numerically superior in blocking IL-4Rα-mediated signaling compared to dupilumab. In vivo studies further demonstrated that stapokibart effectively inhibited the progression of type 2 inflammation. Pharmacokinetic studies revealed a circulating half-life of approximately 298–351 h in cynomolgus monkeys and 55–142 h in rats for stapokibart. Toxicity studies indicated a favorable safety profile in cynomolgus monkeys and rats. The preclinical evaluation of stapokibart supports its clinical development.

Graphical abstract

Highlights

• Stapokibart is humanized IL-4Rα monoclonal antibody with different epitope

• Stapokibart cross-reactive with IL-4Rα from human, cynomolgus monkey, and rat

• Stapokibart inhibits the progression of type 2 inflammation in vitro and in vivo

• Stapokibart is well tolerated in cynomolgus monkey and rat

Immunology; Drugs

Subject areas

Immunology
Drugs
Published: August 13, 2024
==== Body
pmcIntroduction

Allergies arise from a complex interplay of genetic and environmental factors, culminating in an abnormal systemic type 2 inflammatory response to innocuous antigens (allergens). This aberrant immune response gives rise to a spectrum of type 2 chronic inflammatory diseases, which share common pathophysiological characteristics such as epithelial barrier abnormalities, tissue infiltration by eosinophils, mast cells and basophils, tissue remolding, and immune dysregulation.1,2 Five major type 2 chronic inflammatory diseases, including asthma, atopic dermatitis (AD), chronic rhinosinusitis with nasal polyps (CRSwNP), chronic prurigo (CPG), and chronic urticaria (CU), collectively affect up to 30% of the global population,1,3 significantly impairing the quality of life and imposing a substantial economic burden on individuals and society.4,5,6 The overall prevalence and incidence of allergic diseases have increased worldwide. Although numerous patients with type 2 inflammatory diseases are treated with immunosuppressive therapies such as corticosteroids, ciclosporin A, methotrexate, and azathioprine, the overall benefit for patients remains constrained, accompanied by noticeable long-term side effects.7

Significant progress has been made in understanding the pathogenesis of type 2 inflammatory diseases, providing valuable insights for the development of novel therapies. Type 2 inflammatory diseases are intricately linked to the effects and interactions of a variety of molecular and cellular drivers, including alarmin cytokines (such as TSLP, IL-25, IL-33), IL-4, IL-5, IL-13, IgE, IL-31, neuropeptides (such as substance P), and other targets like mast cells and eosinophils, along with their respective receptors. Kinases involved in signal transduction, such as BTK and JAKs, also play pivotal roles in these complex pathways.1 An increasing number of biologics targeting these molecules have received approval for the treatment of patients with type 2 inflammatory diseases, including anti-TSLP antibody (tezepelumab), anti-IL-4Rα antibody (dupilumab), anti-IL-13 antibodies (tralokinumab, lebrikizumab), anti-IgE antibody (omalizumab), anti-IL-5 antibody (mepolizumab, reslizumab), anti-IL-5Rα antibody (benralizumab) and JAK inhibitors (baricitinib, upadacitinib, and abrocitinib). Among them, dupilumab, which simultaneously inhibits both IL-4 and IL-13 mediated signaling pathways, has received approval for the treatment of asthma, AD,8,9 CRSwNP,10 CPG,11 and eosinophilic esophagitis.12 Additionally, it has demonstrated confirmed clinical benefits in patients with chronic obstructive pulmonary disease (COPD) with type 2 inflammation,13 showcasing remarkable success and versatility as a biologic in treating type 2 inflammatory diseases.

In contrast to dupilumab, a fully human monoclonal antibody, stapokibart is a humanized antibody targeting IL-4Rα, designed to block both IL-4 and IL-13. The safety and efficacy of stapokibart have been demonstrated in healthy volunteers and patients with AD or CRSwNP in phase 1b/2a (NCT04893941), phase 2b (NCT0480541114), and phase 2 (NCT0480539815) clinical trials. In a clinical trial focused on severe eosinophilic CRSwNP, stapokibart treatment showed significant improvements in the coprimary efficacy endpoints, including reduction of nasal polyp size and alleviation of nasal congestion.15 In a Phase III clinical trial for patients with moderate to severe AD, the percentage of subjects achieving EASI-75 was 66.9% and IGA score of 0/1 with a reduction of ≥2 points was 44.2% for the stapokibart treatment group, both of which were significantly superior to the placebo group at 25.8% and 16.1%, respectively.16 However, the underlying mechanism and preclinical profile of stapokibart have not been disclosed yet.

Herein, we report the preclinical profile of stapokibart, emphasizing the epitope difference between stapokibart and dupilumab. We determined the cross-species reactivity of stapokibart to IL-4Rα from different species and its blocking activity against the binding of IL-4 and IL-13/IL-13Rα1 to IL-4Rα. A comprehensive head-to-head comparison of stapokibart versus dupilumab was conducted to assess the in vitro biological activity in inhibiting IL-4 and IL-13-mediated signaling pathways. Considering the allergic multimorbidity observed in type 2 inflammatory diseases, various rat models of allergic conditions were utilized to assess the in vivo efficacy of stapokibart, including ovalbumin (OVA)-induced asthma, IL-4/IL-13-induced airway inflammation, OVA-induced rhinitis, and OVA-induced dermatitis. The pharmacokinetics and safety profile of stapokibart were evaluated in cynomolgus monkeys and rats.

Results

Binding and blocking activities of stapokibart to IL-4Rα

The binding affinity of stapokibart to IL-4Rα and its blocking activity antagonizing the interaction of IL-4 or IL-13/IL-13Rα1 complex with IL-4Rα were investigated using surface plasmon resonance (SPR) analysis. In contrast to dupilumab, which exclusively binds to human IL-4Rα,17 stapokibart demonstrated high-affinity binding to IL-4Rα across human (Figure 1A), cynomolgus monkey (Figure S1A), and rat (Figure S1B) species, with an equilibrium dissociation constant (KD) value of 0.25, 1.5, and 2.75 nM, respectively. These findings validated cynomolgus monkeys and rats as relevant species for stapokibart. The blocking results showed potent efficiency of stapokibart in antagonizing the binding of both IL-4 and IL-13/IL-13Rα1 to IL-4Rα (Figures 1B and 1C). Stapokibart completely prevented the binding of IL-4 to IL-4Rα, whereas dupilumab showed only partial inhibition (Figure 1B). For the blocking of IL-13/IL-13Rα1 complex to IL-4Rα, stapokibart showed comparable antagonizing effects to dupilumab at a concentration of 37 nM (Figure 1C). Competitive ELISA results further confirmed the potent effects of stapokibart in blocking the interaction of IL-4 with IL-4Rα, with IC50 value of 0.40 nM compared to 0.45 nM for dupilumab (Figure S1C).Figure 1 Binding and blocking activities of stapokibart to IL-4Rα

(A) The binding of stapokibart to human IL-4Rα. The concentrations of IL-4Rα analyzed are indicated (colored).

(B and C) The blocking activities of stapokibart on the interaction of IL-4 (B) and IL-13/IL-13Rα1 complex (C) with IL-4Rα.

(D) The binding of stapokibart to HEK293 cells transfected with wild-type IL-4Rα or IL-4Rα mutants. The Data are presented as the fold changes in the EC50 values, comparing the IL-4Rα mutants to the wild-type IL-4Rα. & indicates the binding sites of stapokibart. ∗indicates dupilumab’s epitope (PDB: 6WGL).

(E) The binding of stapokibart to HEK293 cells transfected with wild-type IL-4Rα or IL-4Rα mutants (M39A, S95A or L135A). MFI, mean fluorescence intensity.

(F) Epitope mapping of stapokibart or dupilumab to IL-4Rα/γc/IL-4 complex. See also Figure S1.

The distinct cross-species reactivity between stapokibart and dupilumab suggested different binding epitopes. To confirm this, alanine-scanning mutagenesis method and hydrogen-deuterium exchange mass spectrometry (HDX-MS) were conducted to identify stapokibart’s binding epitope on IL-4Rα. The results showed that IL-4Rα mutants, specifically M39A, S95A, and L135A, significantly impaired the binding of stapokibart (Figures 1D and 1E). We then mapped these sites onto the conformational structure of IL-4Rα/γc/IL-4 complex,18 confirming they did not overlap with dupilumab’s binding sites (Figure 1F).19 Collectively, these results establish stapokibart as a humanized anti-IL-4Rα monoclonal antibody with a different conformational epitope and underscore its potential for developing effective treatments for inflammatory diseases.

Stapokibart demonstrates potent inhibition of IL-4- and IL-13-mediated signaling in vitro

IL-4 and IL-13 play vital roles in type 2 inflammatory diseases (Figure 2A). Once IL-4Rα on the cell surface binds to IL-4 or IL-13, it forms a receptor complex with other subunits to activate intracellular STAT6 signaling pathway,20,21 initiating the release of thymus activation-regulated chemokine (TARC) and the upregulation of IgE receptor CD23.22,23 The binding of IgE to its receptor on mast cells initiates mast cell degranulation, resulting in the release of various inflammatory mediators, such as histamine, serotonin, leukotrienes, and lysosomal enzymes (e.g., beta-hexosaminidase, beta-glucuronidase), which trigger an inflammatory response.21 Accordingly, we conducted comprehensive in vitro evaluations to delineate the inhibitory bioactivity of stapokibart against signaling pathways induced by IL-4 or IL-13. In HEK293-STAT6 reporter cells, stapokibart exhibited a concentration-dependent inhibition of IL-4 or IL-13-induced STAT6 activation. The IC50 value of stapokibart was approximately 2-fold lower than that of dupilumab when stimulated with IL-4 (IC50 = 0.039 nM for stapokibart versus 0.088 nM for dupilumab) and IL-13 (IC50 = 0.041 nM for stapokibart versus 0.102 nM for dupilumab) (Figure 2B). In TF-1 cells, stapokibart effectively inhibited cell proliferation induced by IL-4 (IC50 = 1.75 nM for stapokibart versus 2.26 nM for dupilumab) or IL-13 (IC50 = 0.13 nM for stapokibart versus 0.19 nM for dupilumab) (Figure 2C). Subsequently, we assessed the inhibitory effects of stapokibart on TARC release from human PBMCs, and the results showed that stapokibart significantly reduced TARC release induced by IL-4 (IC50 = 0.13 nM for stapokibart versus 0.22 nM for dupilumab) and IL-13 (IC50 = 0.29 nM for stapokibart versus 0.71 nM for dupilumab) (Figure 2D). Furthermore, we investigated the impact of stapokibart on CD23 expression induced by IL-4 and observed that stapokibart significantly suppressed the upregulation of CD23 (IC50 = 0.53 nM for stapokibart versus 0.92 nM for dupilumab) (Figure 2E). In addition, stapokibart dose-dependently inhibited IgE production (Figure 2F), β-hexosaminidase (Figure 2G) and histamine (Figure 2H) release. Collectively, these findings underscore that stapokibart potently inhibited the signal pathways triggered by IL-4 and IL-13, manifesting biological activity that is either comparable or slightly superior to dupilumab.Figure 2 Stapokibart demonstrates potent inhibition of IL-4- and IL-13-mediated signaling in vitro

(A) Schematic diagram of type 2 inflammatory signaling pathway during diseases.

(B) Stapokibart inhibited IL-4 or IL-13 induced STAT6 activation, n = 3.

(C) Stapokibart inhibited IL-4 or IL-13 induced TF-1 cell proliferation, n = 3.

(D) Stapokibart decreased IL-4 or IL-13 induced TARC release from PBMCs, n = 3.

(E) Stapokibart inhibited IL-4 induced CD23 expression on Ramos cells, n = 2.

(F) Stapokibart decreased IL-4 induced IgE release from CGM1 cells, n = 6.

(G and H) Stapokibart decreased IL-4 induced β-hexosaminidase release (G) and histamine secretion (H) from LAD2 cells, n = 6. Data are presented as mean ± SEM. Statistical analysis was performed using GraphPad Prism and significance is shown as ∗p < 0.05, ∗∗P & ##p < 0.01, ∗∗∗P & ###p < 0.001. #indicates statistical significance compared to the control group; ∗denotes significance compared to the model group.

Stapokibart provides protection against airway inflammation in rats

To assess the in vivo efficacy, we investigated the therapeutic effects of stapokibart in rat models associated with type 2 inflammation. We firstly evaluated the therapeutic effects of stapokibart in the ovalbumin (OVA)-induced asthma model (Figure 3A). Phenotypically, stapokibart (at doses of 25, 50, 100 mg/kg) dose-dependently decreased methacholine (Mch)-induced airway hyperresponsiveness (AHR), characterized by airway resistance (Raw) and lung dynamic compliance (Cdyn) (Figure 3B). The repeated use of dexamethasone (DEX) resulted in slower body weight gain compared to other groups (Figure S2A). In contrast, stapokibart at a dosage of 100 mg/kg showed a therapeutic response comparable to DEX, without adversely affecting body weight gain. Next, we explored the impact of stapokibart on airway inflammation. Inflammatory responses were assessed ex vivo by determining inflammatory cell subtypes and cytokines in bronchoalveolar lavage fluid (BALF) or serum, and in situ by the qualitative histologic examination of lung tissues. Cellularly, stapokibart (at doses of 25, 50, 100 mg/kg) demonstrated a dose-dependent decrease in total white blood cells (Figure 3C), eosinophils (Figure 3D), and macrophages (Figure S2B) in BALF compared to the model group. Specifically, there was a remarkable reduction in eosinophil counts by 9%, 33%, and 66%, respectively. Molecular analysis revealed that stapokibart treatment induced a dose-dependent decrease in type 2-related cytokines in BALF, including IL-4, IL-5, IL-13, eotaxin, and histamine (Figures 3E and 3F), along with a dose-dependent reduction in serum total IgE and OVA-specific IgE (Figure 3G). Consistently, elevated mRNA levels of IL-4, IL-5, IL-13, eotaxin, TNF, IL-1β, and CCL-2 were also dose-dependently decreased in lung tissues of stapokibart-treated rats (Figure S2C). Histologically, stapokibart reduced peribronchial infiltrates of inflammatory cells, goblet cell hyperplasia, mucus secretion, mast cell degranulation and collagen deposition around the airways (Figures 3H and 3I). IL-4 and IL-13 are known to drive the pathogenesis of type 2 inflammation through activation of the JAK-STAT signaling pathway.20 Immunohistochemistry (IHC) results indicated that stapokibart effectively inhibited the upregulation of JAK1, JAK3, and STAT6 expression in lung tissue in a dose-dependent manner (Figures S2D and S2E). Additionally, consistent with its efficacy in the OVA-induced asthma model, stapokibart also demonstrates protective effects against IL-4/IL-13-induced airway inflammation in rats (Figure S3).Figure 3 Stapokibart provides protection against OVA-induced asthma in rats

(A) Schematic illustration of the OVA-induced asthma rat model. Stapokibart was administered subcutaneously at indicated doses. ip, intraperitoneal; sc, subcutaneous.

(B) Stapokibart decreased Mch-induced AHR, n = 10.

(C and D) Total white blood cells (C) and eosinophils (D) counts in BALF, n = 10.

(E) Protein levels of IL-4, IL-13, IL-5 and eotaxin in BALF.

(F) Histamine levels in BALF, n = 10.

(G) Total IgE and OVA-specific IgE levels in serum, n = 8.

(H) Representative histopathologic images of lung tissue, n = 10. Hematoxylin and eosin (H&E) staining was utilized to assess lung morphology, periodic acid–Schiff (PAS) staining to identify goblet cell hyperplasia, toluidine blue O (TBO) staining to evaluate mast cell degranulation, and Masson’s staining to examine collagen deposition. The H&E scoring was conducted based on a standardized grading system, which assigns scores from 0 (normal) to 5 (profound) reflecting the severity of eosinophilic infiltrations, edema, and lesion extent. The red triangles in the TBO staining images represent degranulated mast cells, and the black triangles represent undergranulated mast cells. In the H&E, PAS and TBO staining images, scale bar = 40 μm. In the Masson’s staining images, scale bar = 200 μm.

(I) Semi-quantitative analysis of H&E scores, goblet cell hyperplasia, mast cell degranulation, and collagen deposition in lung tissues, n = 10. Data are presented as mean ± SEM. Statistical analysis was performed using GraphPad Prism and significance is shown as ∗P & #p < 0.05, ∗∗p < 0.01, ∗∗∗ P & ###p < 0.001. #indicates statistical significance compared to the control group, ∗denotes significance compared to the model group. More information is available in Figures S2 and S3.

Stapokibart alleviates disease severity in the OVA-induced rhinitis in rats

To determine the effects of stapokibart on allergic rhinitis, we induced allergic rhinitis in rats via the intranasal challenge of OVA (Figure 4A). Phenotypically, stapokibart (at doses of 25, 50, 100 mg/kg) led to a dose-dependent reduction in rubbing and sneezing behaviors on days 23, 25 and 27 in rats exposed to OVA (Figures 4B and 4C). At a dose of 100 mg/kg, stapokibart showed a response comparable to the DEX group in decreasing sneezing occurrences (Figure 4C). In contrast, DEX did not significantly reduce rubbing times and resulted in the adverse effect of slower weight gain after repeated use (Figure S4). To investigate the role of stapokibart in nasal inflammation, we evaluated leukocyte subtypes and cytokines levels in nasal lavage fluid (NALF) or in serum and characterized the features of the nasal tissues through histological examination. Cellular analysis of leukocyte subtypes showed a reduction in eosinophils and macrophages counts in nasal mucosa of stapokibart-treated rats (Figures 4D and 4E). Molecularly, the elevated levels of eotaxin in NALF, as well as total IgE and OVA-specific IgE in serum, were diminished in stapokibart-treated rats (Figures 4F and 4G). In line with this, elevated mRNA levels of IL-4, IL-13, IL-5, and MUC5AC in nasal mucosa were reduced by the treatment of stapokibart (Figure 4H). Histological examination revealed alleviation of inflammation in nasal mucosa in stapokibart-treated rats, as evidenced by decreased eosinophil infiltration, diminished goblet cell metaplasia and hyperplasia in nasal mucosa, and reduced mast cell degranulation at the edge of nasal tissue and connective tissue, accompanied by decreased MUC5AC expression in nasal tissues (Figures 4I and 4J).Figure 4 Stapokibart alleviates disease severity in the OVA-induced rhinitis rat model

(A) Schematic illustration of the OVA-induced rhinitis rat model. Stapokibart was administered subcutaneously at indicated doses.

(B and C) Frequency of rubbing (B) and sneezing (C) in the rats, n = 16.

(D and E) Eosinophils (D) and macrophages (E) counts in NALF, n = 8.

(F) Protein level of eotaxin in NALF, n = 8.

(G) Total IgE and OVA-specific IgE levels in serum, n = 8.

(H) mRNA levels of IL-4, IL-13, IL-5, MUC5AC in nasal tissues, n = 8. Data are presented as fold changes relative to the control group.

(I) Representative histopathologic images of nasal tissues. H&E staining was utilized to assess nasal morphology, PAS staining to identify goblet cell hyperplasia, TBO staining to evaluate mast cell degranulation, and IHC staining to determine the expression of MUC5AC, n = 6–8. The black arrows in the PAS staining images indicate the epithelial cell layer of rat nasal mucosa. The H&E scoring was conducted based on a standardized grading system, which assigns scores from 0 (normal) to 5 (profound) reflecting the severity of eosinophil infiltrations around nasal mucosa and vessels, edema and lesion. The red triangles in the PAS staining images represent goblet cells. Scale bar = 40 μm.

(J) Semi-quantitative analysis of H&E scores, goblet cell hyperplasia, mast cell degranulation, and expression of MUC5AC in nasal tissues, n = 6–8. Data are presented as mean ± SEM. Statistical analysis was performed using GraphPad Prism and significance is shown as ∗P & #p < 0.05, ∗∗P & ##p < 0.01, ∗∗∗ P & ###p < 0.001. #indicates statistical significance compared to the control group, ∗denotes significance compared to the model group. More information is available in Figure S4.

Stapokibart treatment improves OVA-induced dermatitis symptoms in rats

The therapeutic effects of stapokibart on AD-like dermatitis were assessed in rats sensitized to OVA and subjected to local challenge on the dorsal skin (Figure 5A). The AD-like dermatitis model induced various symptoms, such as edema, wrinkles, erythema, exudation, oozing, and increased scarring on the dorsal skin. Treatment with stapokibart at varying doses resulted in remarkable improvements in these dermatitis symptoms. Notably, stapokibart effectively mitigated skin redness, swelling, scarring, and exudation, and reducing inflammatory cell infiltration within the dermis of OVA-sensitized rats (Figures 5B and 5C). At a dosage of 100 mg/kg, stapokibart elicited a therapeutic response that was comparable to treatment with mometasone furoate cream (MFC). However, in contrast to stapokibart, MFC treatment was associated with body weight loss (Figure S5). Furthermore, in comparison to the control group, the model group exhibited significant increases in thickness and weight at the OVA-treated skin (Figures 5D and 5E), due to increased inflammatory cell infiltration and edema. Stapokibart effectively meliorated these conditions in a dose-dependent manner, resulting in a reduction of 20% in both thickness and weight at the OVA-treated skin. Consistent with these findings, the detection of type 2 inflammatory cytokines showed that stapokibart treatment significantly reduced IL-4 protein expression within the skin (Figure 5F) and decreased serum IgE levels at a dosage of 100 mg/kg, achieving an inhibition rate of 44.81% (Figure 5G).Figure 5 Stapokibart treatment improves OVA-induced dermatitis symptoms in rats

(A) Schematic illustration of the OVA-induced AD-like dermatitis rat model.

(B) H&E staining of dorsal skin tissues, n = 10. ① scar; ② loss of epidermis; ③ edema; ④ inflammatory cell infiltration. Scale bar was 100 μm for 40× H&E staining images, and 10 μm for 200× H&E staining images.

(C) Semi-quantitative analysis of inflammatory cell infiltration, exudation, edema, and scarring was conducted based on a standardized grading system, which assigns scores as follows: slight (1), mild (2), moderate (3), severe (4), and normal (0), n = 10.

(D and E) Thickness (D) and weight (E) of OVA challenged dorsal skin, n = 10.

(F) Protein level of IL-4 within skin tissues, n = 10.

(G) Total IgE level in serum, n = 10. Data are presented as mean ± SEM. Statistical analysis was performed using GraphPad Prism and significance is shown as ∗P & #p < 0.05, ∗∗P & ##p < 0.01. #indicates statistical significance compared to the control group, ∗denotes significance compared to the model group. More information is available in Figure S5.

Pharmacokinetic (PK) of stapokibart in both cynomolgus monkeys and rats

In cynomolgus monkeys, PK parameters were evaluated following a single subcutaneous (SC) administration of stapokibart at doses of 5, 15, and 45 mg/kg, and a single intravenous (IV) administration at a dose of 15 mg/kg. The time to peak plasma concentration (Tmax) ranged from 8 to 336 h after SC administration, with a median Tmax of 55.8 h. Drug exposure, including the maximum concentration (Cmax) and area under the curve (AUC0-t), showed approximate dose proportionality of 1:3.0:9.3 for Cmax and 1:2.4:7.2 for AUC0-t, respectively, indicating a nearly linear PK profile for stapokibart within the tested dose range. For the IV administration group, Tmax ranged from 0.167 to 2 h, with a median Tmax of 0.47 h. The Cmax and AUC0-t values were approximately 524 ± 79.2 μg/mL and 101,000 ± 40,500 h∗μg/mL, respectively (Figure 6A). The bioavailability of a single SC dose was calculated to be 63.3%. The circulating half-life of stapokibart was approximately 298–351 h in cynomolgus monkeys.Figure 6 Pharmacokinetics of stapokibart in cynomolgus monkeys and rats

(A) Serum drug concentrations at specified time points following a single dose of stapokibart administered to cynomolgus monkeys. Data are presented as mean ± SEM, n = 6.

(B) Serum drug concentrations at specified time points following a single dose of stapokibart administered to rats. Data are presented as mean ± SEM, n = 8.

(C) Distribution of 125I-stapokibart radioactivity across different rat tissues.

In rats, the Tmax ranged from 72 to 120 h after a single SC injection of stapokibart at doses of 10, 30, and 90 mg/kg, with a median Tmax of 76 h. The Cmax and AUC0-t in SC dose groups of 10, 30, and 90 mg/kg showed a ratio of 1:3.0:6.8 and 1:3.4:6.4, respectively (Figure 6B), also indicating a nearly linear pharmacokinetic profile. After a single IV injection of 30 mg/kg stapokibart, the Tmax was 0.0167 h. The bioavailability after a single SC dose was determined to be 98.7%. The circulating half-life of stapokibart was approximately 55–142 h in rats.

Tissue distribution and excretion studies were conducted in rats utilizing 90 mg/kg 125I-stapokibart administered subcutaneously. After SC administration, the peak concentration of the radioactive stapokibart in serum and tissues observed between 24 and 72 h. Stapokibart exhibited predominant distribution in the serum and circulatory system, with higher concentrations in organs characterized by rich blood flow, such as the lungs, ovaries, heart, and excretory organs like the kidneys (Figure 6C). In addition, the radioactive drug was barely detected in the brain, indicating that stapokibart does not cross the blood-brain barrier.

Stapokibart is well-tolerated in both cynomolgus monkeys and rats

The safety profile of stapokibart was comprehensively evaluated in both cynomolgus monkeys and rats through single dose and repeat-dose toxicology studies for 4 and 26 weeks. In the single-dose toxicity studies, stapokibart was subcutaneously administered to cynomolgus monkeys at doses of 150, 300 mg/kg, and to rats at doses of 300, 600, and 900 mg/kg, with an observation period of 14 days. Throughout this period, no stapokibart-related adverse effects were observed. The maximum tolerated dose (MTD) was established at 300 mg/kg and 900 mg/kg for cynomolgus monkeys and rats, respectively.

Four-week repeat-dose toxicity studies in cynomolgus monkeys and rats

In the 4-week repeat-dose toxicity studies, stapokibart was subcutaneously administered to cynomolgus monkeys once weekly for 4 weeks (5 doses) at doses of 10, 50, and 100 mg/kg, with an 8-week recovery period. Throughout the study, no adverse effects related to stapokibart were observed, establishing a no observed adverse effect level (NOAEL) of 100 mg/kg. The average AUClast was 169826.362 h∗μg/mL and 336043.82 h∗μg/mL after the first and last administration, respectively. No anti-stapokibart antibodies (ADA) were detected across all dose groups.

In rats, stapokibart of 60, 100, and 150 mg/kg were subcutaneously administered once weekly for 4 weeks (5 doses). A dose-dependent inflammatory response in the hypodermis at the injection sites, ranging from minimal to moderate, was observed in stapokibart treated rats. This response was fully reversible by the end of the recovery period. No other stapokibart related adverse effects were noted. The NOAEL was established at 150 mg/kg for 4-week repeat-dose toxicity in rats, associated with average AUClast of 75029.20 h∗μg/mL and 26147.82 h∗μg/mL after the first and last administration, respectively. ADA were detected in 7 out of 8 rats in the 15 mg/kg group, 5 out of 8 rats in the 50 mg/kg group, and 5 out of 8 rats in the 150 mg/kg group, with initial detection occurring on day 29.

26-week repeat-dose toxicity studies in cynomolgus monkeys and rats

To elucidate the safety profile of stapokibart over an extended administration period, we conducted 26-week repeated toxicity studies in cynomolgus monkeys and rats. Cynomolgus monkeys received weekly SC administration of stapokibart for 26 weeks (27 doses) at doses of 15, 50 and 150 mg/kg. Stapokibart-related and dose-dependent monocytes infiltration in the hypodermis at the SC administration sites was observed in several monkeys, accompanied by epidermal hyperplasia at the highest dose. However, these effects were completely reversible by the end of the recovery period. No other stapokibart related adverse effects were noted, and no ADA were detected in any of the dose groups. The NOAEL was established at 150 mg/kg for 26-week repeat-dose toxicity in cynomolgus monkeys. After the initial and second doses at 150 mg/kg, the mean AUC0–336h of stapokibart in serum of male and female monkeys were 674 h∗mg/mL and 623 h∗mg/mL, respectively. After the 26th and 27th doses, the mean AUC0–336h of stapokibart in serum of male and female monkeys were 702 h∗mg/mL and 657 h∗mg/mL, respectively.

Rats were subcutaneously injected with 15, 50, and 150 mg/kg of stapokibart once a week for 26 weeks (27 doses). A dose-dependent inflammatory response in the hypodermis at the SC administration sites, ranging from minimal to moderate, was observed in stapokibart treated rats, which was fully reversible by the end of the recovery period. No other stapokibart related adverse effects were identified in this study. There was no significant gender difference in serum mean AUClast of stapokibart after the first dose (81.6 h∗mg/mL for males and 101 h∗mg/mL for females). The NOAEL for the 26-week rat toxicity study was established at 150 mg/kg, with an associated average AUClast of 91.3 h∗mg/mL after the first dose.

Discussion

The management of type 2 inflammatory diseases typically relies on a multifaceted therapeutic approach, including corticosteroids, antihistamines, immunosuppressants, JAK inhibitors, and biologics. Despite the breadth of available treatments, a subset of patients, particularly those with moderate to severe conditions, exhibit suboptimal responses to conventional therapies. Moreover, the long-term use of systemic immunosuppressants, glucocorticoids, and JAK inhibitors is associated with notable toxicities and side effects, which can be limiting factors in patient care. Conversely, biologics, including dupilumab, the only approved antibody targeting IL-4Rα for the treatment of type 2 inflammation, have demonstrated more favorable efficacy and safety profiles. In contrast to the fully human monoclonal antibody dupilumab, which bound exclusively to human IL-4Rα,17 the humanized antibody stapokibart shows high binding affinity to IL-4Rα across human, cynomolgus monkey, and rat, confirming cynomolgus monkey and rat as relevant animal species for the evaluation of stapokibart. The in vivo efficacy of dupilumab was evaluated in Il4rahu/huIl4hu/hu mice and wild type Balb/c mice using the surrogate antibody REGN1103. The results showed that both dupilumab and REGN1103 decreased serum IgE and allergen-specific IgG1, suppressed eosinophils infiltration, and reduced goblet cell metaplasia.17,24 Meanwhile, toxicity studies of dupilumab were conducted in cynomolgus and mice using the surrogate antibody REGN646 and REGN1103, respectively.17,24 However, studies conducted in non-relevant species using transgenic mice or surrogate may be misleading, as the exact pharmacological mechanisms may differ between the surrogates and the product intended for clinical use, and the immune responses may vary between transgenic and wild type mice.25 Both cynomolgus monkeys and rats were identified as the relevant species of stapokibart, which led to a scientific justification of the safety evaluation. Thus, we directly evaluated the in vivo efficacy of stapokibart in multiple rat allergen or inflammatory disease models, consistently showing that stapokibart effectively improved disease severity by inhibiting inflammation development in a dose-dependent manner, bolstering confidence in its therapeutic potential. Safety evaluations, including single and repeat-dose administration for 4- and 26-week toxicity studies, showed stapokibart no significant toxic effects, proving its favorable safety profile. Furthermore, stapokibart exhibited comparable efficacy to DEX at high dose without adversely affecting the body weight gain, suggesting a potentially safer therapeutic option compared to DEX.

Stapokibart represents a humanized monoclonal antibody targeting IL-4Rα to block the type 2 inflammation in clinical trials. Distinct epitopes between dupilumab and stapokibart, along with their different cross-species reactivities, suggested differentiated mechanisms in inhibiting IL-4Rα signaling, which may lead to distinct clinical outcomes.26 On the epitope mapping, it was revealed that stapokibart bound to IL-4Rα at a location closer to the ligand binding site than dupilumab, shedding light on the reason why stapokibart exerts a more potent inhibitory effect on the binding of IL-4Rα to ligands than dupilumab (Figure 2). Although direct comparisons of clinical efficacy between stapokibart and dupilumab were lacking, as they were evaluated in separate clinical trials with different study designs and patient populations, the findings also suggested promising efficacy of stapokibart in type 2 inflammatory diseases. In a phase II clinical trial (CROWNS-1) focused on patients with severe CRSwNP, a remarkable 79% (22/28) of patients treated with stapokibart achieved at least a 2-point improvement in the Nasal Polyp Score (NPS) by week 16.15 In contrast, this proportion was 46% (66/143) in the SINUS-24 trial and 46% (136/295) in the SINUS-52 trial for dupilumab.10 In a Phase III clinical trial for treating moderate to severe AD, 66.9% of subjects in the stapokibart treatment group achieving EASI-75 endpoint, and this figure was 57.3% for dupilumab in a separate phase III trial with a similar ethnic demographic, accompanied with placebo group at 25.8% and 14.5%, respectively. Additionally, the IGA score of 0/1 with a reduction of ≥2 points was 44.2% for the stapokibart and 26.8% for dupilumab, with placebo group at 16.1% and 4.8%, respectively.27 Further head-to-head clinical studies are required to definitively validate these findings. Dupilumab has been approved for treatment of patients with AD, asthma, CRSwNP, CPG, and eosinophilic esophagitis. Currently, it is also under investigation for the treatment of urticaria and COPD. Additionally, dupilumab achieved the primary endpoint and all secondary endpoints in a Phase III clinical trial (NCT03930732) for the treatment of patients with COPD who had type 2 inflammation, as indicated by elevated blood eosinophil counts.13 These clinical outcomes of dupilumab suggest promising prospects for stapokibart.

In summary, we present the comprehensive preclinical profile of stapokibart, an investigational humanized monoclonal antibody that targets IL-4Rα. Our findings reveal that stapokibart exhibited cross-species reactivity, interacting with IL-4Rα from human, cynomolgus monkey, and rat. Epitope mapping studies demonstrate that stapokibart binds to distinct sites on IL-4Rα compared to dupilumab. Stapokibart exhibites comparable blocking activity to dupilumab, effectively inhibiting the binding of both IL-4 and IL-13/IL-13Rα1 complex to IL-4Rα. In vitro efficacy experiments demonstrate comparable or slightly superior biological activity than dupilumab. In vivo pharmacological studies further demonstrate that the inhibition of IL-4/IL-13 signaling with stapokibart effectively protected rats against multiple type 2 allergy models. Moreover, toxicity studies highlight the stapokibart’s favorable safety profile, with NOAEL 150 mg/kg when administered once weekly for 26 weeks. This study supports stapokibart clinical development and holds the potential to deliver clinical benefits to the versatile patients with allergic diseases.

Limitations of the study

The main limitation of our study is the absence of a head-to-head efficacy comparison between stapokibart and dupilumab within an appropriate animal model. Such a comparison can provide additional insights into stapokibart’s clinical potential, especially given its non-inferior or potentially superior in vitro activity.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Antibodies	
	
Stapokibart	This paper	N/A	
Anti-human IL-4Rα 44A12	This paper	N/A	
Anti-KLH-hIgG4	This paper	N/A	
Dupilumab	Sanofi Genzyme	N/A	
Human anti-CD23 FITC antibody	BioLegend	338506	
Anti-human CD40	Invivomab	BE0189	
JAK1 Polyclonal Antibody	4A Biotech	4AA21191F	
JAK3 Polyclonal Antibody	4A Biotech	4AB191911F	
STAT6 Polyclonal Antibody	4A Biotech	4AA21193F	
MUC5AC Antibody	Santa Cruz	sc-71620	
HRP-conjugated goat anti-mouse antibody	Jackson	115035071	
Alexa 647-conjugated anti-human IgG Fc antibody	Jackson	109-606-170	
	
Biological samples	
	
PBMCs	Aosels Biotechnology	LP190708	
	
Chemicals, peptides, and recombinant proteins	
	
Human IL-4-mFc	This paper	N/A	
Human IL-4-His	This paper	N/A	
Human IL-13-His	This paper	N/A	
Human IL-13Rα1-His	This paper	N/A	
Human IL-4Rα-His	This paper	N/A	
Cynomolgus monkey IL-4Rα-His	This paper	N/A	
Rat IL-4Rα-His	This paper	N/A	
IL-4	PeproTech	200–04	
IL-13	PeproTech	200–13	
Ovalbumin (OVA)	Sigma-Aldrich	SLBQ9036V	
Dexamethasone	Macklin	C10014291	
0.9% physiological saline solution	Qidu Pharmaceutical	1B18030608	
Mometasone Furoate Cream	Bayer	180905	
Methacholine	Sigma-Aldrich	MKCF3289	
Streptavidin	Macklin	S6367	
Biotin Human IgE (non-immune)	AntibodyShop	Q0510-02	
Propidium iodide (PI)	Sigma-Aldrich	P4170-10MG	
Fetal Bovine Serum (FBS)	Excell	FSP500	
Bovine Calf Serum (BCS)	Hyclone	SH30626.03	
RPMI 1640	Gibco	C11875500BT	
DMEM	Gibco	C11995500BT	
PBS (pH7.4)	Gibco	C10010500BT	
L-Glutamine	Sigma-Aldrich	G7531-100ML	
Lipofectamine™ RNAiMAX Transfection Reagent	Thermo	13778150	
Triton X-100	BBI Life Sciences	9002-93-1	
3,3′,5,5′- Tetramethylbenzidine (TMB)	Sigma-Aldrich	860336	
TRIZON Reagent	Jiangsu Cowin Biotech	CW0580	
Puromycin	Gibco	A1113803	
	
Critical commercial assays	
	
Amine Coupling Kit	GE Healthcare	BR-1000-50	
Bright-Glo Luciferase assay system	Promega	E2650	
Cell Titer-Glo Luminescent Cell Viability Assay	Promega	G7572	
Human TARC Quantikine ELISA kit	R&D systems	DY364-05	
Human histamine ELISA KIT	Shanghai Westang Biotechnology	F01012	
Human IgE ELISA KIT	Multi Sciences	EK175	
Rat IL-4 ELISA KIT	4A Biotech	CRE0004	
Rat IL-13 ELISA KIT	Boster Biological Technology	EK0900	
Rat IL-5 ELISA KIT	Jiangsu Cowin Biotech	CSB-E07435r	
Rat Eotaxin ELISA KIT	Boster Biological Technology	EK1435	
Rat MUC5AC ELISA KIT	Shanghai Westang Biotechnology	F16199	
Rat histamine ELISA KIT	Shanghai Westang Biotechnology	F15632	
Rat OVA-specific IgE ELISA KIT	Cusabio	CSB-E08913r	
Rat IgE ELISA KIT	Shanghai Westang Biotechnology	F15750	
Wright-Giemsa composite Stain kit	Baso	BA4017	
Mast Cells Stain Solution (Toluidine Blue Method)	Solarbio Life Science	G3670	
Hematoxylin and eosin (H&E) staining kit	Baso	BA4099, BA4097	
AB-Periodic Acid-Schiff (PAS) staining kit	Solarbio Life Science	G1285	
Masson’s staining kit	Solarbio Life Science	G1346	
SP Rabbit & mouse HRP kit (DAB)	Jiangsu Cowin Biotech	20335	
HiFiScript cDNA Synthesis Kit	Jiangsu Cowin Biotech	CW2569	
UltraSYBR Mixture (Low ROX)	Jiangsu Cowin Biotech	CW2601	
	
Experimental models: Cell lines	
	
HEK293-STAT6 reporter cell	This paper	N/A	
HEK293	ATCC	CRL-1573	
TF-1	ATCC	CRL-2003	
Ramos	ATCC	CRL-1923	
LAD2	Hunan Fenghui Biotechnology	CL0506	
CGM1	Hunan Fenghui Biotechnology	CL0068	
	
Experimental models: Organisms	
	
Sprague-Dawley (SD) rats	Shanghai SLAC Laboratory Animal Co., Ltd.	N/A	
Zhejiang Laboratory Animal Center.	N/A	
Beijing Vital River Laboratory Animal Technology Co., Ltd.	N/A	
Brown Norway (BN) rats	Beijing Vital River Laboratory Animal Technology Co., Ltd.	N/A	
Cynomolgus monkeys	Guangxi Guidong Quadrumana Development & Laboratory Co., Ltd.	N/A	
Hainan Jingang Biotech Co., Ltd.	N/A	
	
Oligonucleotides: Primers	
	
Rat IL-4 forward: AAGGAACACCACGGAGAACG	This paper	N/A	
Rat IL-4 reverse: CAGACCGCTGACACCTCTAC	This paper	N/A	
Rat IL-13 forward: GATCCACATCTCCCCCTGTG	This paper	N/A	
Rat IL-13 reverse: GGGAAGTCTTCTGGTCTTGTGT	This paper	N/A	
Rat IL-5 forward: GAATCAAACTGTCCGAGGGGG	This paper	N/A	
Rat IL-5 reverse: CCACACTTCTCTTTTTGTCCGTCA	This paper	N/A	
Rat Eotaxin forward: GATGCCACAAAGCACCTGGA	This paper	N/A	
Rat Eotaxin reverse: GGATGGGTGCCGATATTCTCC	This paper	N/A	
Rat MUC5A forward: CTCCGTCTTAGTCAATAACCACC	This paper	N/A	
Rat MUC5A reverse: GGAACTCGTTGGATTTTGGACTG	This paper	N/A	
Rat β-actin forward: TATCCTGGCCTCACTGTCCA	This paper	N/A	
Rat β-actin reverse: AAGGGTGTAAAACGCAGCTCA	This paper	N/A	
Rat TNF-α forward: ACTGAACTTCGGGGTGATTG	This paper	N/A	
Rat TNF-α reverse: GCTTGGTGGTTTGCTACGAC	This paper	N/A	
Rat IL-1β forward: TTCCTTGTGCAAGTGTCTGAAGC	This paper	N/A	
Rat IL-1β reverse: GCCTCAAAGAACAGGTCATTCTC	This paper	N/A	
Rat CCL2 forward: TGATCCCAATGAGTCGGCTG	This paper	N/A	
Rat CCL2 reverse: TGGACCCATTCCTTATTGGGG	This paper	N/A	
Rat GAPDH forward: AGAAGGCTGGGGCTCATTTG	This paper	N/A	
Rat GAPDH reverse: AGGGGCCATCCACAGTCTTC	This paper	N/A	
Rat IL-17 forward: GGACTCTGAGCCGCAATGA	This paper	N/A	
Rat IL-17 reverse: GACGCATGGCGGACAATAGA	This paper	N/A	
	
Recombinant DNA	
	
Human IL-4Rα plasmid	This paper	N/A	
Cynomolgus monkey IL-4Rα plasmid	This paper	N/A	
Rat IL-4Rα plasmid	This paper	N/A	
Human IL-4 plasmid	This paper	N/A	
Human IL-13Rα plasmid	This paper	N/A	
	
Software and algorithms	
	
GraphPad Prism 5	GraphPad Software	https://www.graphpad.com/scientific-software/prism/	
WinNonlin 6.4 software	WinNonlin 6.4 software	https://www.certara.com/software/phoenix-winnonlin/	

Resource availability

Lead contact

Further information and requests for reagents should be directed to the corresponding author Bo Chen (knybochen@keymedbio.com).

Materials availability

All reagents used in this study will be made available upon reasonable request to the lead contact.

Data and code availability

All data reported in this paper will be shared by the lead contact upon request.

This paper does not report original code.

Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Experimental model and study participant details

Rat models

For OVA-induced asthma rat model, 6–8 weeks Sprague-Dawley (SD) rats (female) were obtained from Zhejiang Laboratory Animal Center. Rats were maintained under specific-pathogen-free (SPF) environment with access to sterilized food and water ad libitum. Environmental conditions were tightly controlled, maintaining a temperature range of 20°C–26°C, humidity levels between 40 and 70%, and 12 h light/dark cycles. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Breath Smooth Biotech Hangzhou Co., Ltd. (Experimental animals use license number: SYXK (Zhe) 2014-0008).

For IL-4/IL-13-induced airway inflammation rat model, 6–8 weeks SD rats (male) were obtained from Zhejiang Laboratory Animal Center. Rats were maintained under SPF environment with access to sterilized food and water ad libitum. Environmental conditions were tightly controlled, maintaining a temperature range of 20°C–26°C, humidity levels between 40 and 70%, and 12 h light/dark cycles. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Breath Smooth Biotech Hangzhou Co., Ltd. (Experimental animals use license number: SYXK (Zhe) 2014-0008).

For OVA-induced rhinitis rat model, 6–8 weeks SD rats (male) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. Rats were maintained under SPF environment with access to sterilized food and water ad libitum. Environmental conditions were tightly controlled, maintaining a temperature range of 20°C–26°C, humidity levels between 40 and 70%, and 12 h light/dark cycles. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Breath Smooth Biotech Hangzhou Co., Ltd. (Experimental animals use license number: SYXK (Zhe) 2018-0016).

For OVA-induced AD-like dermatitis rat model, 6–8 weeks Brown Norway (BN) rats (female) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Rats were maintained under SPF environment with access to sterilized food and water ad libitum. Environmental conditions were tightly controlled, maintaining a temperature range of 20°C–26°C, humidity levels between 30 and 70%, and 12 h light/dark cycles. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Shanghai Institute of Pharmaceutical Industry Co., Ltd. (Experimental animals use license number: SYXK (Hu) 2014-0018).

In PK study of stapokibart in rats, 6–8 weeks SD rats (male and female) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Rats were housed in controlled conditions of temperature (20°C–26°C), humidity (30–70%), and 12/12 h light/dark cycles, with free access to food and water. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of United-Power Pharma Tech Co., Ltd. (Experimental animals use license number: SYXK (Gui) 2017-0006).

In single dose toxicity study of stapokibart in rats, 5–6 weeks SD rats (male and female) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Rats were housed in controlled conditions of temperature (22°C–25°C), humidity (44–66%), and 12/12 h light/dark cycles, with free access to food and water. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of WestChina-Frontier PharmaTech Co., Ltd. (Experimental animals use license number: SYXK (Chuan) 2018-123).

In 4-week repeat-dose toxicity study of stapokibart in rats, 5–7 weeks SD rats (male and female) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Rats were housed in controlled conditions of temperature (21°C–26°C), humidity (40–70%), and 12/12 h light/dark cycles, with free access to food and water. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of WestChina-Frontier PharmaTech Co., Ltd. (Experimental animals use license number: SYXK (Chuan) 2018-123).

In 26-week repeat-dose toxicity study of stapokibart in rats, 5–6 weeks SD rats (male and female) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Rats were housed in controlled conditions of temperature (20°C–26°C), humidity (40–70%), and 12/12 h light/dark cycles, with free access to food and water. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of WestChina-Frontier PharmaTech Co., Ltd. (Experimental animals use license number: SYXK (Chuan) 2018-123).

In tissue distribution and excretion study of rats, 6–8 weeks SD rats (male and female) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Rats were housed in controlled conditions of temperature (20°C–26°C), humidity (40–70%), and 12/12 h light/dark cycles, with free access to food and water. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Institute of Radiation Medicine Chinese Academy of Medical Sciences.

Non-human primate studies

In PK study of stapokibart in cynomolgus monkeys, 3–6 years cynomolgus monkeys (male and female) were obtained from Guangxi Guidong Quadrumana Development & Laboratory Co., Ltd. Monkeys were fed once a day with approximately 120 g of food, supplemented by an assortment of fruits. Toys were provided to enrichment their daily lives. Monkeys were housed in controlled conditions of temperature (19°C–26°C), humidity (40–70%), and 12/12 h light/dark cycles. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of United-Power Pharma Tech Co., Ltd. (Experimental animals use license number: SYXK (Gui) 2017-0005).

In single dose toxicity study of stapokibart in cynomolgus monkeys, 3–5 years cynomolgus monkeys (male and female) were obtained from Guangxi Guidong Quadrumana Development & Laboratory Co., Ltd. Cynomolgus monkeys were housed in standard conditions, in a 12/12 h dark/light cycle, at 22°C–26°C, and 43%–72% humidity, with free access to food and water. Fresh fruits were provided at least 2 times per week. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of WestChina-Frontier PharmaTech Co., Ltd. (Experimental animals use license number: SYXK (Chuan) 2013-123).

In 4-week repeat-dose toxicity study of stapokibart in cynomolgus monkeys, 3–5 years cynomolgus monkeys (male and female) were obtained from Guangxi Guidong Quadrumana Development & Laboratory Co., Ltd. Cynomolgus monkeys were housed in standard conditions, in a 12/12 h dark/light cycle, at 21°C–25°C, and 40%–79% humidity, with free access to food and water. Fresh fruits were provided at least 2 times per week. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of WestChina-Frontier PharmaTech Co., Ltd. (Experimental animals use license number: SYXK (Chuan) 2018-123).

In 26-week repeat-dose toxicity study of stapokibart in cynomolgus monkeys, 3–5 years cynomolgus monkeys (male and female) were obtained from Hainan Jingang Biotech Co., Ltd. Cynomolgus monkeys were housed in standard conditions, in a 12/12 h dark/light cycle, at 21°C–25°C, and 40%–79% humidity, with free access to food and water. Fresh fruits were provided at least 2 times per week. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of WestChina-Frontier PharmaTech Co., Ltd. (Experimental animals use license number: SYXK (Chuan) 2018-123).

Cell lines

Each cell line was cultured in its specific medium and grown at 37°C on a 5% CO2 air incubator. All cell lines were authenticated by STR profiling and verified to be mycoplasma negative through PCR. HEK293 cells (ATCC) were cultured in DMEM supplemented with 10% Fetal Bovine Serum (FBS) and 2 mM L-glutamine. HEK293-STAT6 reporter cells were generated by transiently transfection with a construct containing the STAT6 cis-acting element linked to luciferase reporter gene, followed by puromycin selection and limiting dilution cloning. Ramos cells (ATCC, originally derived from male) were maintained in RPMI-1640 supplemented with 10% FBS and 2 mM L-glutamine. TF-1 cells (ATCC, originally derived from male) were maintained in RPMI-1640 with additional supplements including 10% FBS, 2 mM L-glutamine, 1% sodium pyruvate, 0.4% glucose, 1% HEPES, 2.7% sodium bicarbonate, and 2 ng/mL GM-CSF. Furthermore, CGM1 (Hunan Fenghui Biotechnology, originally derived from male) and LAD2 (Hunan Fenghui Biotechnology, originally derived from male) cells were maintained in RPMI-1640 supplemented with 10% FBS.

Method details

Recombinant protein production

The extracellular domains of human, cynomolgus monkey, and rat IL-4Rα, as well as the human IL-13Rα1, were individually cloned into an expression vector containing a His tag. Additionally, the full-length human IL-13 and IL-4 was cloned into an expression vector with a His tag, respectively. Furthermore, the full-length human IL-4 was fused with the Fc region of mouse IgG2a to construct the IL-4-mFc fusion protein. HEK293 cells were transfected with expression vectors using Lipofectamine 3000 reagent and cultured under conditions of 37°C and 5% CO2 for 4 days. The His-tagged recombinant proteins were purified from the culture supernatant using Ni Bestarose FF (Bestchrom). While IL-4-mFc fusion protein was purified from the culture supernatant using AT Protein A Diamond (Bestchrom).

Blocking activity of stapokibart

96-well plates were coated with 100 μL per well of human IL-4Rα protein at a concentration of 1 μg/mL and incubated overnight at 4°C. After washing and blocking, 50 μL of serially diluted antibodies were added and incubated for 30 min at room temperature. After washing, 50 μL of IL-4-mFc fusion protein (2.9 nM) was added to each well and incubated for 60 min at room temperature. Then the plates were washed and 100 μL of Horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody was added to each well and incubated for 60 min at room temperature. The plates were washed and developed color by adding 100 μL of 3,3′,5,5′-Tetramethylbenzidine (TMB) substrate solution to each well for 30 min at 37°C in the dark. The reaction was stopped with 50 μL of 2 M Sulfuric acid solution. The absorbance of the wells was read at 450 nm using ELISA reader (Spectra Max i3x). The data was analyzed using SoftMax which is included with the instrument and a four-parameter logistic regression analysis was employed to calculate the half maximum inhibition concentration (IC50).

SPR

SPR assays were conducted on Biacore T200 (GE Healthcare) to investigate the binding kinetics of stapokibart to IL-4Rα from human, cynomolgus monkey, and rat, as well as its ability to antagonize the binding of IL-4 and the IL-13/IL-13Rα1 complex to IL-4Rα. To determine the binding kinetics, stapokibart was immobilized on the surface of a Protein A chip (Cytiva). Then, serially diluted IL-4Rα protein of human, cynomolgus monkey, or rat was introduced as an analyte, flowing over the chip at a rate of 30 μL per minute. The association step was set to 120 s, followed by a dissociation step of up to 600 s. Data were analyzed using the Biacore T200 Evaluation software 3.1, employing the Langmuir 1:1 kinetics model to determine the association constant (ka), dissociation constant (kd), and equilibrium constant (KD) of the interaction between stapokibart and IL-4Rα.

To evaluate the blocking efficiency of stapokibart, the CM5 chip (Cytiva) was immobilized with human IL-4Rα protein at a concentration of 400 nM, and then blocked with serially diluted antibodies. Subsequently, IL-4 protein or IL-13/IL-13Rα1 complex formed by pre-incubating IL-13 with IL-13Rα1 was flowed across the chip surface and the binding signal of the analyte was measured. A non-neutralizing antibody called anti-human IL-4Rα 44A12 was used as the negative control antibody.

Hydrogen-deuterium exchange mass spectrometry (HDX-MS)

HDX-MS was used to identify the binding sites of stapokibart on IL-4Rα, as previously described. The IL-4Rα protein was incubated with stapokibart, resulting the formation of an antigen-antibody complex. Then, either this complex or unbound IL-4Rα protein was immersed in heavy water, facilitating the exchange of surface hydrogen atoms for deuterium. The hydrogen atoms at the binding sites were less accessible to heavy water leading to a slower hydrogen-deuterium exchange rate. By measuring the deuterium incorporation levels at various reaction times using mass spectrometry (MS), the binding sites of stapokibart on IL-4Rα were identified through comparing the exchange behavior between the unbound IL-4Rα and the antigen-antibody complex.

Alanine scanning mutagenesis

To confirm the binding sites of stapokibart on IL-4Rα as identified by HDX-MS, alanine-scanning mutagenesis method was utilized. Specific residues of IL-4Rα were individually mutated to alanine and the mutated IL-4Rα constructs were cloned into an expression vector. HEK293 cells were transfected with these vectors and cultured under 37°C and 5% CO2 for 24 h. Following incubation with a serial dilution of stapokibart on ice for 60 min, the cells were washed and treated with Alexa 647-conjugated anti-human IgG Fc antibody for an additional 30 min on ice in the dark. Post-incubation, the cells were washed and incubated with propidium iodide solution on ice for 5 min in the dark. The cells were then washed and resuspended in PBS. The mean fluorescence intensity (MFI) was measured using flow cytometry. The data was analyzed using GraphPad Prism software, employing a four-parameter logistic regression analysis to calculate the half maximum effective concentration (EC50) of stapokibart binding to the cells.

Luciferase reporter assay

HEK293-STAT6 reporter cells were seeded in 96-well plates at a density of 1.5 × 104 cells per well in a volume of 50 μL and cultured under 37°C and 5% CO2 for 16–18 h. The cells were then incubated with IL-4 (40 p.m.) or IL-13 (160 p.m.) in the presence of either stapokibart, or dupilumab or anti-KLH-hIgG4 at 37°C and 5% CO2 for 6 h. The fluorescence intensity was measured using a luciferase assay kit and the results were recorded. The data was analyzed using GraphPad Prism software and a four-parameter logistic regression method was used to calculate the IC50 values.

TF-1 cell proliferation assay

TF-1 cells were seeded into 96-well plates at a density of 3 × 104 cells per well in a volume of 100 μL and cultured at 37°C with 5% CO2 for 20 h. Subsequently, stapokibart, dupilumab or anti-KLH hIgG4 were prepared as serial dilutions and mixed with an equal volume of IL-4 (1.6 nM) or nM IL-13 (3.2 nM). Aliquots of 100 μL from each mixture was added to the wells and cultured for 96 h at 37°C with 5% CO2. Cell viability was measured using the Cell Titer-Glo Luminescent Cell Viability Assay kit. The results were analyzed using GraphPad Prism software and the IC50 values were determined through a four-parameter logistic regression analysis.

CD23 expression level on B cells

Ramos B cells were plated into 96-well plates at a density of 1 × 105 cells per well in a volume of 100 μL. Serial dilutions of stapokibart, dupilumab or anti-KLH-hIgG4 were prepared and mixed with an equal volume of 2.67 nM IL-4. Then, 100 μL of each mixture was added to the wells and incubated at 37°C with 5% CO2 for 48 h. After washing and blocking, the cells were incubated with FITC-conjugated anti-human CD23 antibody on ice for 20 min in the dark. Subsequently, the cells were washed and treated with PI solution on ice for 5 min in the dark. The cells were washed and resuspended in PBS. The MFI was measured using flow cytometry, which reflected the expression of CD23 levels. The data was analyzed using GraphPad Prism software and the IC50 values were determined through a four-parameter logistic regression analysis.

TARC release assay

Cryopreserved PBMCs were rapidly thawed in a 37°C water bath and then centrifuged at 4 °C at 300 g for 10 min. The PBMCs were resuspended in culture medium and seeded into 96-well plates at a density of 1 × 105 cells per well in a volume of 100 μL. Stapokibart, dupilumab or anti-KLH-hIgG4 were prepared as serial dilutions and mixed with an equal volumes of 0.8 nM IL-4 or 3.2 nM IL-13, respectively. Subsequently, 100 μL of each mixture was added to the wells and incubated at 37°C with 5% CO2 for 96 h. The levels of TARC in the cell culture supernatants were measured using human TARC ELISA kit. Data analysis was performed using GraphPad Prism software, applying a four-parameter logistic regression method to determine the IC50 values.

β-hexosaminidase and histamine release assay

LAD2 cells were co-cultured with 20 ng/mL IL-4 for 2 weeks prior to being plated in 96-well plates at a density of 2 × 104 cells per well in a volume of 100 μL. Control wells received LAD2 cells not exposed with IL-4. After overnight culture, cells were treated with stapokibart (0.01, 0.03, or 0.1 ng/mL), 0.03 ng/mL dupilumab, or PBS as model wells for 1 h. Concurrently, control wells were supplemented with PBS. Subsequently, the cells in the treated wells and model wells were sensitized with 500 ng/mL IgE and 500 ng/mL IL-4 for 48 h and then stimulated with 500 ng/mL streptavidin (SP) for 1 h. For β-hexosaminidase release assays, cell culture supernatants were transferred to new 96-well plates in a volume of 100 μL. The co-cultured cells treated with PBS was lysed by 3% Triton X-100. Both the cell lysate and blank cell culture medium were also added to the new 96-well plates in a volume of 100 μL. Then, 50 μL of 4 mM 4-Nitrophenyl-2-Acetamido-2-deoxy-beta-D-glucopyranoside was added to each well and incubated at 37°C for 1 h. The reaction was terminated by adding 100 μL of 200 mM glycine buffer. The absorbance of the each well was read at 405 nm. The release rate of β-hexosaminidase (%) was calculated using the following formula:Releaserateofβhexosaminidase(%)=AbsorbanceSupernatant−AbsorbanceMediumAbsorbanceCelllysate−AbsorbanceMedium×100%

Histamine level in the supernatants were assayed using commercial Human Histamine ELISA kits. Data analysis was conducted using GraphPad Prism software.

IgE secretion assay

CGM1 cells were co-cultured with 20 ng/mL IL-4 for 2 weeks before being seeded into 6-well plates at a density of 2 × 105 cells per well. In the presence of 1 μg/mL anti-human CD40 and 20 ng/mL IL-4, cells were treated with stapokibart (0.01, 0.03, or 0.1 ng/mL), 0.03 ng/mL dupilumab, or PBS as model wells. Control wells seeded CGM1 cells not exposed with IL-4 and treated with PBS. Following 2 weeks of co-culture, IgE levels in the supernatants were quantifiedd using commercial Human IgE ELISA kits. Data analysis was performed using GraphPad Prism software.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted using TRIzol reagent, followed by the generation of cDNA utilizing cDNA reverse transcription kit. The mRNA levels of MUC5AC and inflammatory cytokines, including IL-4, IL-5, IL-13, eotaxin, TNF-α, IL-1β, CCL-2, and TNF-α, were quantified by qRT-PCR using SYBR Green and normalized to β-actin mRNA levels. The value of 2− ΔΔCt was used to evaluate relative gene expression. The primers used are listed in key resources table.

OVA-induced asthma rat model

70 female SD rats were randomly assigned into seven groups (10 in each group), including blank control group, model group, negative control group treated with 50 mg/kg of anti-KLH-hIgG4, stapokibart treatment groups at dosages of 25, 50, and 100 mg/kg, and positive control group treated with 0.5 mg/kg DEX. DEX, recognized for its widespread clinical use and well-documented efficacy in treating inflammatory conditions, was selected as a positive control to benchmark the anti-inflammatory effects of stapokibart. On day 0, rats underwent sensitization through subcutaneous and intraperitoneal injections of OVA emulsified in aluminum hydroxide, followed by a booster intraperitoneal injection on day 14. From days 21–27, rats were challenged via the airways with an aerosol of 10 mg/mL OVA in 0.9% physiological saline solution for 30 min daily. The blank control group was simultaneously inhaled with 0.9% physiological saline solution. Stapokibart and anti-KLH-hIgG4 were administered subcutaneously, beginning on the day before sensitization and continuing on days 4, 9, 14, 19, 21, 23, and 25. On the same days, DEX was intraperitoneally injected. Concurrently, rats in the blank control group and the model group received the vehicle solution. On day 20, prior to OVA challenge, approximately 1 mL of blood was collected from the tail vein of the rats and serum were separated for the quantification of total IgE and OVA-specific IgE levels using ELISA. On day 28, rats were anesthetized by intraperitoneal injection of ethyl carbamate and administered with Mch at 2, 4, 8, 12, and 16 μg/kg to induce AHR. Tidal volume, airway flow rate, and transpulmonary pressure were recorded using MedLab Biosignal Acquisition System before and after Mch administration. Raw and Cdyn were calculated using the following formulas:Raw=TranspulmonarypressureAirwayflowrate,Cdyn=TidalvolumeTranspulmonarypressure

Rawincrease(%)=RawPost−Mchtreatment−RawPre−MchtreatmentRawPre−Mchtreatment×100%

Cdyndecrease(%)=CdynPre−Mchtreatment−CdynPost−MchtreatmentCdynPre−Mchtreatment×100%

After AHR measurements, BALF was also collected to assess the counts of inflammatory cells via Wright-Giemsa staining and cytokines levels by ELISA, including IL-4, IL-13, IL-5, eotaxin, and histamine. Lung tissues collected from the rats were fixed in 4% formaldehyde and embedded in paraffin. Prepared tissue sections were stained with hematoxylin and eosin (H&E), toluidine blue O (TBO), Periodic Acid-Schiff (PAS) or Masson’s for pathological analysis.

IL-4/IL-13-induced airway inflammation rat model

70 male SD rats were randomly allocated into seven groups (10 in each group), including blank control group, model group, negative control group treated with 50 mg/kg of anti-KLH-hIgG4, stapokibart treatment groups at dosages of 25, 50, and 100 mg/kg, and positive control group treated with 0.5 mg/kg DEX. IL-4 and IL-13 were individually prepared to final concentrations of 80 μg/mL and 160 μg/mL, respectively, using 0.9% physiological saline solution and mixed in equal volumes immediately prior to each application. On days 1, 3, and 5, rats were anesthetized with isoflurane and 100 μL of the mixed IL-4/IL-13 solution was sprayed into their airways. The blank control group received an equivalent volume of 0.9% physiological saline solution. Stapokibart and anti-KLH-hIgG4 were subcutaneously administered to the rats immediately after airway spraying, while DEX was intraperitoneally injected. The rats in blank control group and the model group were concurrently administered with the vehicle solution. On day 6, rats were administered with Mch at 2, 4, 8, and 12 μg/kg to induce AHR. Serum was harvested to measure total IgE and OVA-specific IgE levels using ELISA. BALF was collected to assess the counts of inflammatory cells via Wright-Giemsa staining and cytokines levels by ELISA, including IL-4, IL-13, IL-5, eotaxin, and histamine. Lung tissues were fixed in 4% formaldehyde, embedded in paraffin, and sectioned for staining with H&E, TBO, PAS, or Masson’s for pathological analysis. Additionally, immunohistochemistry (IHC) staining was performed for JAK1, JAK3, and STAT6.

OVA-induced rhinitis rat model

112 male SD rats were randomly divided into seven groups (16 in each group), including blank control group, model group, negative control group treated with 50 mg/kg of anti-KLH-hIgG4, stapokibart treatment groups at dosages of 25, 50, and 100 mg/kg, and positive control group treated with 0.5 mg/kg DEX. On day 1, rats were sensitized to OVA via subcutaneous and intraperitoneal injections of an OVA emulsion in aluminum hydroxide and received intraperitoneal booster injections on days 3, 5, 7, 9, 11, 13 and 15. From days 21–27, rats were challenged intranasally with 100 mg/mL OVA solution prepared in 0.9% physiological saline solution, at a dosage of 40 μL per rat (20 μL per nostril), once daily for seven consecutive days. The blank control group rats were administered an equal volume of 0.9% physiological saline solution intranasally. Stapokibart and anti-KLH-hIgG4 were subcutaneously administered on days 0, 3, 5, 7, 10, 14, 17, 21, 23, 25, and 27, while DEX was intraperitoneally injected on the same schedule. Concurrently, rats in the blank control group and the model group received the vehicle solution. On day 21, serum was collected to analyze the levels of total IgE and OVA-specific IgE using ELISA. On day 23, 25 and 27, the frequency of rubbing and sneezing in the rats was recorded during a 30-min period following the challenge. On day 28, NALF was collected for assessment of inflammatory cells counts via Wright-Giemsa staining. The nasal mucosa was harvested to measure mRNA levels of IL-4, IL-13, IL-5 and MUC5A. Nasal tissues were fixed in 10% formalin, embedded in paraffin, and sectioned for staining with H&E, TBO, and PAS for pathological analysis. Additionally, IHC staining for MUC5A was performed.

OVA-induced AD-like dermatitis rat model

60 male BN rats were randomly assigned into six groups (10 in each group), comprising blank control group, model group, stapokibart treatment groups at dosages of 25, 50, and 100 mg/kg, and positive control group treated with mometasone furoate cream (MFC). On days 0, 7, and 14, rats were sensitized intraperitoneally with OVA, whereas the control group received physiological saline solution. On day 15, the dorsal fur of rats was shaved, the skin was gently scratched, and gauze soaked in OVA was adhered to the area for 7 days. Concurrently, the blank control group rats had gauze soaked in double distilled water adhered to the injured area. From days 29–33, the dorsal skin was topically challenged with OVA application. Stapokibart was subcutaneously administered on days 0, 7, 14, 17, 20, 23, 26, 29, and 32. Rats in the blank control and model groups received subcutaneous injections of physiological saline solution at the same dosing frequency. Rats in the positive control group were treated with 200 μL MFC (0.5 mg/mL) applied once daily to the dorsal skin from days 29–34. Body weights were monitored throughout the study. On day 35, serum was collected for the measurement of IgE levels using ELISA. Skin tissue homogenates were analyzed for the detection of IL-4 via ELISA. Additionally, Skin tissues were fixed by using 10% formalin, embedded in paraffin and sectioned for H&E staining.

PK studies in cynomolgus monkeys and rats

32 SD rats were allocated into four groups (4 males and 4 females in each group). Each group received a single subcutaneous injection of stapokibart at dosages of 10 mg/kg, 30 mg/kg or 90 mg/kg, or a single intravenous injection of stapokibart at a dose of 30 mg/kg. Similarly, 24 cynomolgus monkeys were assigned into four groups (4 males and 4 females in each group) and received a single subcutaneous injection of stapokibart at dosages of 5 mg/kg, 15 mg/kg or 45 mg/kg, or a single intravenous injection of stapokibart at a dose of 15 mg/kg. The serum concentrations of stapokibart were quantified using validated ELISA analytical methods.

Toxicity studies in cynomolgus monkeys and rats

The safety profile of stapokibart was assessed in cynomolgus monkeys and rats, including single dose and repeat-dose toxicology studies for 4 and 26 weeks. The parameters evaluated included a comprehensive set of clinical observations, clinical pathology, ophthalmology examinations, dietary intake, body weight, body temperature, electrocardiography, blood pressure measurements, hematology, serum biochemistry, urinalysis, organ weights assessments, and immunotoxicity biomarkers. Additionally, the presence of ADA was evaluated using validated ELISA analytical methods.

In the single-dose toxicity study of stapokibart in rats, 40 SD rats were allocated into three groups (5 males and 5 females in each group) and stapokibart was subcutaneously administered at doses of 300 mg/kg, 600 mg/kg or 900 mg/kg. At the same time, the control group was subcutaneously injected with Stapokibart solvent.

In the 4-week repeat-dose toxicity study of stapokibart in rats, 200 SD rats were assigned into four groups (25 males and 25 females in each group). Stapokibart was administered subcutaneously to rats once weekly for 4 weeks at doses of 60 mg/kg, 100 mg/kg or 150 mg/kg. At the same time, the control group was subcutaneously injected with Stapokibart solvent.

In the 26-week repeat-dose toxicity study of stapokibart in rats, 200 SD rats were allocated into four groups (38 in control group and 54 in each stapokibart group; half males and half females in each group) and received subcutaneous injection of stapokibart at dosages of 15 mg/kg, 50 mg/kg, and 150 mg/kg, or subcutaneous injection of stapokibart solvent as control group, once weekly for 26 weeks.

In the single-dose toxicity study of stapokibart in cynomolgus monkeys, 6 cynomolgus monkeys were allocated into three groups (1 male and 1 female in each group) and stapokibart was subcutaneously administered at doses of 150 mg/kg or 300 mg/kg. At the same time, the control group was subcutaneously injected with Stapokibart solvent.

In the 4-week repeat-dose toxicity study of stapokibart in cynomolgus monkey, 40 cynomolgus monkeys were assigned into four groups (5 males and 5 females in each group). Stapokibart was administered subcutaneously to cynomolgus monkeys once weekly for 4 weeks at doses of 60 mg/kg, 100 mg/kg or 150 mg/kg. At the same time, the control group was subcutaneously injected with Stapokibart solvent.

In the 26-week repeat-dose toxicity study of stapokibart in cynomolgus monkey, 40 cynomolgus monkeys were allocated into four groups (5 males and 5 females in each group) and received subcutaneous injection of stapokibart at dosages of 15 mg/kg, 50 mg/kg, and 150 mg/kg, or subcutaneous injection of stapokibart solvent as control group, once weekly for 26 weeks.

Tissue distribution and excretion study

24 SD rats (half male and half female) were subjected to a single subcutaneous injection of 90 mg/kg 125I-stapokibart, dosed at 20 ± 10μCi per rat. At 24, 72, 168, and 336 h post-administration, tissue samples were collected to evaluate the distribution of total radioactivity and trichloroacetic acid (TCA)-precipitated radioactivity across a range of tissues. The temporal dynamics of radioactivity distribution were evaluated by analyzing the ratio of total radioactivity to TCA-precipitable radioactivity.

Quantification and statistical analysis

Statistical analysis in PK parameters calculation

The primary pharmacokinetic parameters, such as Tmax (Peak time), Cmax (Peak concentration), and AUC0-t (Area under the concentration-time curve from the beginning of administration to the last time), were calculated by WinNonlin 6.4 software using non-compartmental analysis (NCA).

Statistical analysis in animal studies

Computer program GraphPad Prism 5 was used for statistical calculation. Data were subjected to a test for homogeneity of variance. If the variances were homogeneous (p > 0.05), a one-way analysis of variance (ANOVA) was conducted, followed by Dunnett’s test for comparisons between groups. If the variances were not homogeneous (p ≤ 0.05), a non-parametric test was performed, with the Mann-Whitney U test used for comparisons between groups. For comparisons between two groups, an independent samples t-test was conducted, and a difference was considered statistically significant at p < 0.05.

Supplemental information

Document S1. Figures S1–S5

Acknowledgments

The authors would like to thank Mr. Xiuqiang Sun for assisting with the production of the figures and Dr Lin Shao for preliminary manuscript. The research was supported by the project from Major New Drug Development (No. 2017ZX09302010 ).

Author contributions

W.L., J.Y., Q.S., L.Z., and B.D. performed the experiments; W.L., Y.H., X.Y., J.Y., Q.S., and L.Z. analyzed the data; Y.Z., G.X., and C.W. contributed conception and reviewed the data; W.L. and Y.Z. conducted the research; J.Z. and B.C. contributed conception and design of the study; W.L. and Y.H. wrote the manuscript; Y.H., X.Y., G.X., and C.W. revised the manuscript. All authors read and approved the final manuscript.

Declaration of interests

B.C., G.X., and C.W. are founders of Keymed Biosciences (Chengdu) Limited. W.L., Y.H., X.Y., J.Y., Q.S., and L.Z. are employees of Keymed Biosciences (Chengdu) Limited. The other authors declare no conflicts of interest. The patents disclosed included WO2019228405A1 and its patent family.

Supplemental information can be found online at https://doi.org/10.1016/j.isci.2024.110721.
==== Refs
References

1 Kolkhir P. Akdis C.A. Akdis M. Bachert C. Bieber T. Canonica G.W. Guttman-Yassky E. Metz M. Mullol J. Palomares O. Type 2 chronic inflammatory diseases: targets, therapies and unmet needs Nat. Rev. Drug Discov. 22 2023 743 767 10.1038/s41573-023-00750-1 37528191
2 Mu Z. Zhang J. The Role of Genetics, the Environment, and Epigenetics in Atopic Dermatitis Adv. Exp. Med. Biol. 1253 2020 107 140 10.1007/978-981-15-3449-2_4 32445093
3 GBD 2019 Diseases and Injuries Collaborators Global burden of 369 diseases and injuries in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019 Lancet 396 2020 1204 1222 10.1016/s0140-6736(20)30925-9 33069326
4 Maurer M. Abuzakouk M. Bérard F. Canonica W. Oude Elberink H. Giménez-Arnau A. Grattan C. Hollis K. Knulst A. Lacour J.P. The burden of chronic spontaneous urticaria is substantial: Real-world evidence from ASSURE-CSU Allergy 72 2017 2005 2016 10.1111/all.13209 28543019
5 Ariëns L.F.M. Van Nimwegen K.J.M. Shams M. De Bruin D.T. Van Der Schaft J. Van Os-Medendorp H. De Bruin-Weller M. Economic Burden of Adult Patients with Moderate to Severe Atopic Dermatitis Indicated for Systemic Treatment Acta Derm. Venereol. 99 2019 762 768 10.2340/00015555-3212 31073619
6 Harada N. Makita N. Fukui K. Nishida K. Oneda K. Tashiro N. A Retrospective Claims Database Study to Clarify Disease Burden of Severe Asthma Patients with Type 2 High or Low Inflammation J. Asthma Allergy 16 2023 83 93 10.2147/jaa.s378505 36636701
7 Megna M. Napolitano M. Patruno C. Villani A. Balato A. Monfrecola G. Ayala F. Balato N. Systemic Treatment of Adult Atopic Dermatitis: A Review Dermatol. Ther. 7 2017 1 23 10.1007/s13555-016-0170-1
8 Castro M. Corren J. Pavord I.D. Maspero J. Wenzel S. Rabe K.F. Busse W.W. Ford L. Sher L. FitzGerald J.M. Dupilumab Efficacy and Safety in Moderate-to-Severe Uncontrolled Asthma N. Engl. J. Med. 378 2018 2486 2496 10.1056/NEJMoa1804092 29782217
9 Silverberg J.I. Yosipovitch G. Simpson E.L. Kim B.S. Wu J.J. Eckert L. Guillemin I. Chen Z. Ardeleanu M. Bansal A. Dupilumab treatment results in early and sustained improvements in itch in adolescents and adults with moderate to severe atopic dermatitis: Analysis of the randomized phase 3 studies SOLO 1 and SOLO 2, AD ADOL, and CHRONOS J. Am. Acad. Dermatol. 82 2020 1328 1336 10.1016/j.jaad.2020.02.060 32135208
10 Bachert C. Han J.K. Desrosiers M. Hellings P.W. Amin N. Lee S.E. Mullol J. Greos L.S. Bosso J.V. Laidlaw T.M. Efficacy and safety of dupilumab in patients with severe chronic rhinosinusitis with nasal polyps (LIBERTY NP SINUS-24 and LIBERTY NP SINUS-52): results from two multicentre, randomised, double-blind, placebo-controlled, parallel-group phase 3 trials Lancet 394 2019 1638 1650 10.1016/S0140-6736(19)31881-1 31543428
11 Yosipovitch G. Mollanazar N. Ständer S. Kwatra S.G. Kim B.S. Laws E. Mannent L.P. Amin N. Akinlade B. Staudinger H.W. Dupilumab in patients with prurigo nodularis: two randomized, double-blind, placebo-controlled phase 3 trials Nat. Med. 29 2023 1180 1190 10.1038/s41591-023-02320-9 37142763
12 Dellon E.S. Rothenberg M.E. Collins M.H. Hirano I. Chehade M. Bredenoord A.J. Lucendo A.J. Spergel J.M. Aceves S. Sun X. Dupilumab in Adults and Adolescents with Eosinophilic Esophagitis N. Engl. J. Med. 387 2022 2317 2330 10.1056/NEJMoa2205982 36546624
13 Bhatt S.P. Rabe K.F. Hanania N.A. Vogelmeier C.F. Cole J. Bafadhel M. Christenson S.A. Papi A. Singh D. Laws E. Dupilumab for COPD with Type 2 Inflammation Indicated by Eosinophil Counts N. Engl. J. Med. 389 2023 205 214 10.1056/NEJMoa2303951 37272521
14 Zhao Y. Zhang J. Yang B. Li J. Ding Y. Wu L. Zhang L. Wang J. Zhu X. Zhang F. Efficacy and safety of CM310 in moderate-to-severe atopic dermatitis: A multicenter, randomized, double-blind, placebo-controlled phase 2b trial Chin. Med. J. 137 2024 200 208 10.1097/CM9.0000000000002747 37482623
15 Zhang Y. Yan B. Shen S. Song X. Jiang Y. Shi L. Zhao C. Yang Y. Jiang L. Li J. Efficacy and safety of CM310 in severe eosinophilic chronic rhinosinusitis with nasal polyps (CROWNS-1): a multicentre, randomised, double-blind, placebo-controlled phase 2 clinical trial EClinicalMedicine 61 2023 102076 10.1016/j.eclinm.2023.102076
16 Zhao Y. Zhang L. Zhang J. CM310AD005 Study Investigators Efficacy and safety of stapokibart (CM310) in adults with moderate-to-severe atopic dermatitis: a multicenter, randomized, double-blind, placebo-controlled phase 3 trial J. Am. Acad. Dermatol. 190 2024 2498 10.1016/j.jaad.2024.07.1447
17 FDA BLA 761055. Pharmacology review(s) https://www.accessdata.fda.gov/drugsatfda_docs/nda/2017/761055Orig1s000PharmR.pdf 2017
18 LaPorte S.L. Juo Z.S. Vaclavikova J. Colf L.A. Qi X. Heller N.M. Keegan A.D. Garcia K.C. Molecular and structural basis of cytokine receptor pleiotropy in the interleukin-4/13 system Cell 132 2008 259 272 10.1016/j.cell.2007.12.030 18243101
19 Zhang L. Zhang Y. Gao Y. Wang K. Lou H. Meng Y. Wang C. Long-term outcomes of different endoscopic sinus surgery in recurrent chronic rhinosinusitis with nasal polyps and asthma Rhinology 58 2020 126 135 10.4193/Rhin19.184 31904028
20 McCormick S.M. Heller N.M. Commentary: IL-4 and IL-13 receptors and signaling Cytokine 75 2015 38 50 10.1016/j.cyto.2015.05.023 26187331
21 Gandhi N.A. Bennett B.L. Graham N.M.H. Pirozzi G. Stahl N. Yancopoulos G.D. Targeting key proximal drivers of type 2 inflammation in disease Nat. Rev. Drug Discov. 15 2016 35 50 10.1038/nrd4624 26471366
22 Wirnsberger G. Hebenstreit D. Posselt G. Horejs-Hoeck J. Duschl A. IL-4 induces expression of TARC/CCL17 via two STAT6 binding sites Eur. J. Immunol. 36 2006 1882 1891 10.1002/eji.200635972 16810739
23 Goenka S. Kaplan M.H. Transcriptional regulation by STAT6 Immunol. Res. 50 2011 87 96 10.1007/s12026-011-8205-2 21442426
24 Le Floc'h A. Allinne J. Nagashima K. Scott G. Birchard D. Asrat S. Bai Y. Lim W.K. Martin J. Huang T. Dual blockade of IL-4 and IL-13 with dupilumab, an IL-4Rα antibody, is required to broadly inhibit type 2 inflammation Allergy 75 2020 1188 1204 10.1111/all.14151 31838750
25 Cavagnaro J.A. Preclinical safety evaluation of biotechnology-derived pharmaceuticals Nat. Rev. Drug Discov. 1 2002 469 475 10.1038/nrd822 12119749
26 Bahnan W. Happonen L. Khakzad H. Kumra Ahnlide V. De Neergaard T. Wrighton S. André O. Bratanis E. Tang D. Hellmark T. A human monoclonal antibody bivalently binding two different epitopes in streptococcal M protein mediates immune function EMBO Mol. Med. 15 2023 e16208 10.15252/emmm.202216208
27 Zhao Y. Wu L. Lu Q. Gao X. Zhu X. Yao X. Li L. Li W. Ding Y. Song Z. The efficacy and safety of dupilumab in Chinese patients with moderate-to-severe atopic dermatitis: a randomized, double-blind, placebo-controlled study Br. J. Dermatol. 186 2022 633 641 10.1111/bjd.20690 34358343
