
==== Front
iScience
iScience
iScience
2589-0042
Elsevier

S2589-0042(24)01918-7
10.1016/j.isci.2024.110693
110693
Article
IKKɛ induces STING non-IFN immune responses via a mechanism analogous to TBK1
Venkatraman Rajan 15
Balka Katherine R. 19
Wong Wilson 23
Sivamani Jananipriya 1
Magill Zoe 1
Tullett Kirsteen M. 1
Lane Rachael M. 1
Saunders Tahnee L. 45
Tailler Maximilien 6
Crack Peter J. 8
Wakim Linda M. 7
Lahoud Mireille H. 1
Lawlor Kate E. 23
Kile Benjamin T. 610
O’Keeffe Meredith 1
De Nardo Dominic dominic.denardo@monash.edu
111∗
1 Department of Biochemistry and Molecular Biology, Monash Biomedicine Discovery Institute, Monash University, Clayton, VIC, Australia
2 Centre for Innate Immunity and Infectious Diseases, Hudson Institute of Medical Research, Clayton, VIC, Australia
3 Department of Molecular and Translational Science, Monash University, Clayton, VIC, Australia
4 Ubiquitin Division, The Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia
5 Department of Medical Biology, The University of Melbourne, Parkville, VIC, Australia
6 Department of Anatomy and Developmental Biology, Monash Biomedicine Discovery Institute, Monash University, Clayton, VIC, Australia
7 Department of Microbiology and Immunology, The University of Melbourne, Peter Doherty Institute for Infection and Immunity, Parkville, VIC, Australia
8 Department of Biochemistry and Pharmacology, The University of Melbourne, Parkville, VIC, Australia
∗ Corresponding author dominic.denardo@monash.edu
9 Present address: Department of Systems Immunology and Proteomics, Institute of Innate Immunity, Medical Faculty, University of Bonn, Bonn, Germany

10 Present address: Garvan Institute of Medical Research, Darlinghurst, NSW, Australia

11 Lead contact

07 8 2024
20 9 2024
07 8 2024
27 9 11069318 10 2023
28 3 2024
5 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Summary

The cGAS-STING pathway responds to cytosolic DNA to elicit host immunity to infection. The activation of stimulator of interferon genes (STING) can trigger a number of critical cellular responses including inflammation, noncanonical autophagy, lipid metabolism, senescence, and cell death. STING-mediated immunity through the production of type I interferons (IFNs) and nuclear factor kappa B (NF-κB)-driven proinflammatory cytokines is primarily driven via the effector protein TBK1. We have previously found that IκBα kinase epsilon (IKKε), a homolog of TBK1, can also facilitate STING-NF-κB responses. Therefore, a thorough understanding of how IKKε participates in STING signaling is essential. Here, we used a combination of genetic and biochemical approaches to provide mechanistic details into how IKKε confers non-IFN (e.g., NF-κB and MAPK) STING responses in macrophages, including in the absence of TBK1. We demonstrate a conserved mechanism of STING binding between TBK1 and IKKε. These findings strengthen our understanding of cGAS-STING signaling and the preservation of host immunity in cases of TBK1-deficiency.

Graphical abstract

Highlights

• IKKε and TBK1 bind the same STING signaling complexes to drive non-IFN responses

• IKKε is recruited to STING via the defined TBK1-binding motif (TBM)

• Residues essential for STING binding are conserved between TBK1 and IKKε

• IKKε forms a unique hydrophobic interaction with the C-terminal tail (CTT) of STING

Molecular biology; Immunology; Cell biology

Subject areas

Molecular biology
Immunology
Cell biology
Published: August 7, 2024
==== Body
pmcIntroduction

Cytosolic double-stranded DNA (dsDNA) is a common hallmark of infection or tissue damage and is highly immunostimulatory. Our innate immune system has evolved to detect cytosolic dsDNA through binding to cyclic guanine-monophosphate (GMP) adenosine-monophosphate (AMP) (cGAMP) synthase (cGAS).1,2 Following dsDNA binding, cGAS catalyzes a noncanonical phosphodiester bond between GTP and ATP to produce the mammalian cyclic dinucleotide (CDN) 2′3′-cGAMP, which subsequently binds and activates the immune receptor, stimulator of interferon genes (STING).3,4,5 In addition to mammalian 2′3′-cGAMP, STING can also be activated following direct binding of bacterial CDNs secreted upon infection.6 STING activation induces robust anti-viral immunity due to the secretion of high levels of type I interferons (IFNs) (e.g., IFNβ) and the production of pro-inflammatory cytokines through the transcription factor nuclear factor-κB (NF-κB).7,8,9 Several additional downstream cellular responses can also be initiated following STING activation, including noncanonical autophagic responses, cell senescence, and in some cell types, death.10 Intriguingly, a number of recent studies have demonstrated that STING-mediated non-IFN responses, which include the production of NF-κB-dependent inflammatory cytokines, are critical for host immunity to HSV-1 and for driving autoimmune arthritis.11,12,13,14

Under resting conditions STING exists as preformed dimers embedded in endoplasmic reticulum (ER) membranes. Binding of CDN mediates STING trafficking to the Golgi region and later to endosomes and lysosomes for degradation.15 STING degradation is facilitated by components of a noncanonical autophagic response16,17 and was recently discovered to involve endosomal sorting complex required for transport (ESCRT)-dependent internalization of STING vesicles into multivesicular bodies (MVBs) prior to lysosome fusion.18,19,20 Structural data suggests that STING localization to Golgi membranes mediates the linear arrangement of STING dimers to form higher order STING oligomers.21,22 STING oligomeric complexes are thought to allow for recruitment of the effector kinase, TANK-binding kinase 1 (TBK1), via a highly conserved motif [(D or E)xPxPLR(S or T)D—x denotes any amino acid] within the C-terminal tail (CTT) of STING.23,24 Recruitment of TBK1 results in its increased local concentration, allowing TBK1 trans-autophosphorylation at Ser172 within its classical kinase activation loop. Once active, TBK1 phosphorylates serine (S) residue 366 (365 in murine STING) within the CTT region of adjacent STING molecules to license the recruitment and activation of the transcription factor, interferon regulatory factor 3 (IRF3), driving production of type I IFNs.25,26 We recently discovered that while TBK1 alone has the ability to induce the activation of IRF3 and type I IFN production in murine macrophages, both TBK1, and its homolog IκBα kinase epsilon (IKKε), are able to redundantly mediate NF-κB activity downstream of STING.27 However, how IKKε is able to transduce signaling responses following STING activation is not well understood.

Here, we show that similar to NF-κB activation, TBK1 and IKKε appear to redundantly elicit STING-mediated MAPK activity through TAK1, while the lipidation of LC3B in response to STING occurs independently of both TBK1 and IKKε. Furthermore, we show IKKε is recruited to STING forming active signaling complexes along with TBK1. Interestingly, the recruitment of IKKε is mediated via the same binding motif as TBK1 within the CTT and although we identified an additional site of hydrophobic interaction between STING and IKKε using in silico structural modeling, this unique interaction has no impact on NF-κB activation through STING. Hence, our study confirms a role for IKKε in monocyte and macrophage STING signaling and identifies a conserved mechanism of action with TBK1 for STING binding and induction of downstream non-IFN responses.

Results

IKKε displays activity downstream of STING activation in murine macrophages and human THP-1 monocytic cells

We recently discovered that STING-induced NF-κB responses can be mediated redundantly by TBK1 and IKKε.27 However, although we identified IKKε as a key downstream signaling component in the STING pathway, how IKKε induces signaling is poorly defined. We firstly assessed the phosphorylation of IKKε in response to STING activation over time. In response to 2′3′-cGAM(PS)2 (a modified stable form of 2′3′-cGAMP), we observed that both primary murine bone marrow-derived macrophages (BMDMs) and THP-1 monocytic-like cells induced IKKε phosphorylation with similar kinetics to STING, TBK1, IRF3, and p65 NF-κB (above the expected basal levels in macrophages28) phosphorylation events (Figures 1A and 1B). Lipidation of the autophagy marker, LC3B-I to its lower molecular weight form, LC3B-II was also induced with similar kinetics (Figures 1A and 1B). In comparison, phosphorylation of the MAPKs p38 and ERK1/2 appeared to be slightly delayed and was only detectable from 2 h post activation (Figures 1A and 1B). Of note, in THP-1 cells the activation of p38 and ERK1/2 above basal levels28 appeared minimal compared to those observed from BMDMs. These findings demonstrate IKKε activation occurs with similar kinetics to TBK1 and is upstream of MAPK activation.Figure 1 IKKε functions downstream of STING in human and murine myeloid cells

(A) Primary BMDMs were left untreated or challenged with 20 μg/mL 2′3′-cGAM(PS)2 for 1, 2, or 3 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 5 independent experiments.

(B) THP-1 monocytes were left untreated or challenged with 20 μg/mL 2′3′-cGAM(PS)2 for 1 or 2 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments.

(C) Primary BMDMs isolated from Sting+/+ and Sting−/− mice were left uninfected or infected with HSV-1 with the indicated multiplicity of infections (MOI) for 3 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments.

(D) STINGWT and STINGR284S THP-1 monocytes were left untreated or treated with doxycycline as indicated for 6 h. Cells were lysed and immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments. See also Figure S1.

It was initially observed that TBK1 alone can mediate STING-induced NF-κB activation in murine embryonic fibroblasts (MEFs).9 Our recent discovery on the other hand identified that IKKε can redundantly drive STING-dependent NF-κB activation in myeloid cells. While TBK1 is known to be ubiquitously expressed across cell types, IKKε expression is limited to certain types of immune cells. We therefore examined Tbk1 and Ikbke (the gene encoding IKKε) expression across various murine cell populations using BioGPS29 (Figure S1A). We noted that both BMDMs and peritoneal macrophages exhibited similar expression levels of Tbk1 and Ikbke, with expression of Ikbke more enhanced following LPS stimulation in BMDMs as previously reported.30 In contrast, BioGPS data revealed MEFs almost exclusively expressed Tbk1, which we confirmed at the protein level by examining immortalized (i)MEFs and iBMDMs (Figure S1B). Consistent with previous findings,27 we observed that Tbk1 deletion in MEFs rendered cells incapable of inducing IRF3 and p65 NF-κB phosphorylation in response to STING activation (Figure S1C). Together, these observations establish that control of STING-dependent NF-κB activation by IKKε is limited to specific immune cell types.

Type I herpes simplex virus (HSV-1) induces a physiological immune response via the cGAS-STING pathway.31 We therefore infected Sting+/+ (wild-type) and Sting−/− BMDMs with HSV-1 and assessed downstream signaling (Figures 1C, S1D, and S1E). HSV-1 infection resulted in phosphorylation of key signaling molecules, including IKKε, in a STING- and dose-dependent manner. Of note, STING degradation and the lipidation of LC3B were not observed in response to HSV-1 infection. We next utilized an in vitro model of the STING autoinflammatory condition, STING-associated vasculopathy in infants (SAVI), by expressing doxycycline-inducible autoactivating STING R284S in THP-1 cells. While, expression of wild-type STING failed to induce downstream responses, STING R284S expression resulted in robust dose-dependent signaling responses, which included phosphorylation of IKKε and MAPKs, as well as LC3B lipidation (Figure 1D). Taken together, these data further demonstrate IKKε phosphorylation is induced downstream of cGAS-STING during infection or SAVI-induced autoinflammation.

TBK1 and IKKε redundantly mediate STING-dependent MAPK activation but are dispensable for LC3B lipidation

In addition to a robust type I IFN response in macrophages, STING activation has also been shown to induce a number of non-IFN signaling responses.10 These include activation of NF-κB, MAPKs, and a noncanonical autophagic response linked to STING degradation. We therefore next wanted to further examine the requirement for IKKε in STING-mediated non-IFN responses. To this end, we initially generated primary BMDMs using bone marrow cells isolated from Tbk1fl/fl x RosaCre mice injected with tamoxifen to induce Tbk1 deletion or Tbk1fl/fl mice to serve as wild-type control cells. As with previous observations,27 BMDMs from tamoxifen treated Tbk1f/lfl x RosaCre mice displayed significant knockdown rather than a complete knockout of TBK1 (Figure 2A). As expected, we also observed significant defects in STING and IRF3 phosphorylation in Tbk1-deficient BMDMs, whereas phosphorylation of p65 NF-κB remained intact following STING activation (Figure 2A). The level of p38 MAPK phosphorylation appeared slightly increased in Tbk1-deficient compared to wild-type BMDMs, whereas ERK1/2 activity appeared to be more dependent on TBK1 (Figure 2A). To examine this further, we next assessed STING signaling responses in wild-type, TBK1KO, IKKεKO, or TBK1/IKKεKO iBMDMs following 2′3′-cGAM(PS)2 stimulation. Consistent with our published findings, we observed TBK1 predominantly drives the phosphorylation of STING and IRF3, while p65 NF-κB can be mediated by either TBK1 or IKKε (Figure 2B). It should be noted that although phosphorylation of p65 was not increased in TBK1/IKKεKO iBMDMs following stimulation, basal phosphorylation of p65 appeared to be higher in the absence of both TBK1 and IKKε. In addition, we found that analogous to our data in Figure 2A, the phosphorylation of p38 can be driven by either TBK1 or IKKε, while activation of ERK1/2 appears to be more reliant on TBK1 expression (Figure 2B). Previously, it had been shown that TBK1 and IRF3 are not required for LC3B lipidation following STING activation in HeLa cells and MEFs.17 Consistent with this, we found that both TBK1 and IKKε are dispensable for STING-dependent LC3B conversion in macrophages (Figure 2B). To examine what STING signaling responses IKKε can mediate in the absence of TBK1, we reconstituted TBK1KO/IKKεKO iBMDMs with a HA-tagged version of human IKKε, which as expected, led to restoration of p65 NF-κB activation, albeit with delayed kinetics (Figure 2C). We also observed moderate phosphorylation of STING and IRF3 in cells overexpressing HA-IKKε and restored phosphorylation of p38 and ERK1/2 MAPKs in TBK1KO/IKKεKO iBMDMs (also with delayed kinetics) (Figure 2C), demonstrating that IKKε can drive MAPK responses in the absence of TBK1. We previously established that TBK1 and IKKε signal via TAK1 to induce NF-κB activation. As TAK1 has been more broadly implicated in the activation of MAPKs, we examined whether STING-mediated MAPK activation is also dependent on TAK1. In contrast to the vehicle control, TAK1 inhibition (with 5z-7-oxozeaenol) prior to STING activation almost completely prevented p38 and ERK1/2 phosphorylation events, compared to modest reductions in p65 phosphorylation (Figures 2D and S2). Finally, we tested whether the kinase activity of TBK1/IKKε was required for STING-induced MAPK activation. Of note, while pre-treatment of BMDMs with the TBK1/IKKε inhibitor, MRT67307, greatly blunted STING-induced IRF3 activity, p38 and ERK1/2 phosphorylation remained unaffected (Figure 2E). Collectively, these data suggest that TBK1 or IKKε can facilitate STING-mediated and TAK1-dependent MAPK responses in macrophages largely independent of their kinase activities. In contrast, LC3B lipidation following STING activation occurs in the absence of both TBK1 and IKKε and thus appears entirely decoupled from STING immune signaling.Figure 2 TBK1 and IKKε redundantly mediate MAP kinase activation downstream of STING in a similar fashion to NF-κB

(A) Tbk1fl/fl × RosaCre (TBK1 KO) mice were treated with tamoxifen (+) or not (−) before primary BMDMs were left untreated or stimulated with 20 μg/mL 2′3-cGAM(PS)2 for 1.5 and 3 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments.

(B) WT, TBK1KO, IKKεKO, and TBK1/IKKεKO iBMDMs were left untreated or stimulated with 20 μg/mL 2′3′-cGAM(PS)2 for 1.5 and 3 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments.

(C) WT, TBK1/IKKεKO, and TBK1/IKKεKO expressing HA-IKKε iBMDMs were left untreated or stimulated with 20 μg/mL 2′3′-cGAM(PS)2 for 1.5 and 3 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments.

(D) Primary BMDMs were pre-treated with either a DMSO vehicle or 20 μM 5z-7-oxozeaenol (5z-7; TAK1 inhibitor) for 30 min. BMDMs were then left unstimulated or stimulated with 20 μg/mL 2′3′-cGAM(PS)2 for 1 and 2 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments.

(E) Primary BMDMs were pre-treated with either a DMSO vehicle or 50 nM MRT67307 (MRT: TBK1/IKKε kinase inhibitor) for 30 min. BMDMs were then left unstimulated or stimulated with 20 μg/mL 2′3′-cGAM(PS)2 for 1.5 and 3 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments. See also Figure S2.

Activation of STING leads to recruitment of IKKε

It is well established that TBK1 binds directly to STING in order to facilitate downstream signaling pathways. Given the high sequence homology between TBK1 and IKKε, it is likely IKKε can also directly interact with STING. To this end, we co-expressed Myc-tagged STING along with either FLAG-tagged wild-type or kinase-dead (K38A) IKKε or TBK1 in HEK293T and conducted FLAG immunoprecipitations. Similar to TBK1 (Figure S3A), we found that both the wild-type and kinase-dead forms of IKKε were able to interact with STING in this system (Figure S3B). Using endogenous STING immunoprecipitation, we then observed clear enrichment of IKKε and TBK1 upon STING activation in primary BMDMs, which correlated with the phosphorylation of STING and IRF3 in whole-cell lysates (Figure 3A). We were further able to detect the endogenous interaction between active (i.e., phosphorylated) STING and IKKε or TBK1 following activation in human THP-1 monocyte-like cells (Figure 3B). These data demonstrate that in addition to TBK1, IKKε interacts with activated STING in both murine macrophages and human monocytes.Figure 3 STING recruits IKKε following activation

(A) Primary BMDMs from Sting+/+ and Sting−/− mice were left unstimulated or stimulated with 50 μg/mL DMXAA for 90 min. Following stimulation, cells were lysed to generate whole cell lysate (WCL) for immunoblot while the remaining lysate underwent IP with an anti-STING antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(B) THP-1 monocytic-like cells were left untreated or treated with 20 μg/mL 2′3′-cGAM(PS)2 for 1 and 2 h. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-phospho-STING (S366) antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(C) Sting−/− iBMDMs reconstituted with mCitrine-fused murine STING (mCit-STING) were treated with 1 μg/mL doxycycline overnight. The cells were then left untreated or treated with 50 μg/mL DMXAA for 2 h. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-GFP antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(D–E) Sting−/− iBMDMs reconstituted with mCit-STING were treated with 1 μg/mL doxycycline overnight. The cells were then left untreated or treated with 50 μg/mL DMXAA for 1 h. Cells were fixed and underwent immunofluorescent staining for (D) P-IKKε or (E) P-TBK1. Images were acquired on the LSM980 confocal microscope. Images are displayed as merged images for a single Z slice. P-IKKε or P-TBK1 is shown in magenta, mCit-STING is in green, while nuclear staining (DAPI) is shown in blue. White boxes indicate magnified regions of interest. Scale bar, 10 μm. Data shown are representative of 3 independent experiments. See also Figure S3.

In order to examine the co-localization of IKKε and TBK1 with STING, we reconstituted Sting−/− iBMDMs with an mCitrine-tagged version of murine STING. Expression of mCitrine-STING was able to restore STING-dependent downstream signaling responses (Figure S3C) and, as with endogenous STING, we were able to observe the interaction between mCitrine-STING and IKKε or TBK1 following GFP (mCitrine reactive) immunoprecipitation (Figures 3C and S3D). Consistent with previous reports, in resting cells STING was diffusely localized throughout the ER network before redistribution to condensed puncta and vesicles upon activation, previously reported to be the Golgi and endosomes, respectively15 (Figures 3D and 3E). In line with our biochemical data, STING strongly colocalized with both P-IKKε and P-TBK1 following activation with DMXAA (Figures 3D and 3E). Taken together, these data clearly demonstrate that STING forms complexes with both TBK1 and IKKε following its activation.

IKKε and TBK1 are recruited to the same STING signaling complexes

We next wanted to directly compare the temporal binding of IKKε and TBK1 to STING signaling complexes. Using our mCitrine-STING reporter macrophages, we observed that IKKε and TBK1 interacted with STING with equivalent binding kinetics upon activation (Figures 4A and S4). Recruitment of IKKε and TBK1 to STING complexes was detectable as early as 15 min, reaching a peak at ∼90 min to 2 h post stimulation (Figures 4A and S4). We further observed an enrichment of endogenous IKKε to TBK1 following STING activation of primary BMDMs (Figure 4B), suggesting that IKKε and TBK1 are simultaneously recruited to the same active STING signaling complexes. To examine this in more detail, we reconstituted IKKεKO iBMDMs with HA-tagged human IKKε enabling us to examine molecular interaction with IKKε via HA immunoprecipitation. STING activation of these cells induced the interaction of both TBK1 and STING with HA-IKKε (Figure 4C), further suggesting the formation of active STING-TBK1-IKKε oligomeric signaling complexes. We found here that in TBK1-deficient macrophages, STING-induced NF-κB and MAPKs responses are maintained via the activity of IKKε. Consistent with this, we observed that in TBK1KO iBMDMs, IKKε is still enriched upon STING activation (Figure 4D), demonstrating that TBK1 is indeed dispensable for the recruitment of IKKε to STING. Together, these data suggest that, although TBK1 and IKKε are recruited to the same STING signaling complexes, IKKε recruitment occurs independently of TBK1.Figure 4 Understanding the composition of STING complexes with TBK1 and IKKε

(A) Sting−/− iBMDMs reconstituted with mCit-STING were left untreated or treated with 1 μg/mL doxycycline overnight before cells were left untreated or stimulated with 50 μg/mL DMXAA as indicated. Following stimulation, cells were lysed to generate whole cell lysate WCL for immunoblot while the remaining lysate underwent IP with an anti-GFP antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(B) Primary BMDMs were left untreated or treated with 50 μg/mL DMXAA for 90 min. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-TBK1 antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(C) IKKεKO iBMDMs and IKKεKO iBMDMs reconstituted with HA-IKKε were left untreated or treated with 50 μg/mL DMXAA for 1 and 2 h. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-HA antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(D) WT and TBK1KO iBMDMs were left untreated or stimulated with 50 μg/mL DMXAA for 90 min. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-STING antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments. See also Figure S4.

IKKε is recruited to STING via the defined TBK1-binding motif

Previous structural studies revealed that TBK1 interacts with STING via a highly conserved motif within the C-terminal tail (CTT) of mammalian STING—termed the TBK1-binding motif (TBM). It was shown that mutation of a critical leucine (L) residue at position 374 to an alanine (A) within the TBM of human STING (L373A in murine STING) completely disrupted TBK1 recruitment.24 In order to assess if IKKε is recruited to activated STING via the TBM, we therefore generated Sting−/− iBMDMs expressing either wild-type mCitrine-STING or mCitrine-STING L373A and conducted GFP immunoprecipitations. While DMXAA treatment induced the recruitment of TBK1 and IKKε to wild-type mCitrine-STING, in contrast, the activation of mCitrine-STING L373A failed to lead to enrichment of either TBK1 or IKKε (Figure 5A). Importantly, we found that loss of TBK1 and IKKε recruitment was not due to a defect in STING L373A trafficking, as comparable localization between wild-type mCitrine-STING and mCitrine-STING L373A was observed upon activation (Figure 5B). Consistent with the inability of STING L373A to recruit TBK1 and IKKε, we observed almost no phosphorylation of downstream signaling molecules upon activation from Sting−/− iBMDMs expressing STING L373A compared to those expressing wild-type STING (Figures 5C and S5A–S5C). Of note, consisitent with (Figure 2B), LC3B lipidation was not affected in cells expressing STING L373A (Figure 5C). In addition, the induction of Ifnb1 (gene encoding IFNβ) and the IFN-stimulated gene, Isg15, were blunted in macrophages expressing STING L373A (Figure S5D), as was the secretion of IFNβ and tumor necrosis factor (TNF) (Figures 5D, 5E, and S5E). In contrast, TLR4-dependent secretion of TNF in response to LPS was comparable across the cell lines (Figure S5E). Taken together these data demonstrate that TBK1 and IKKε recruitment is dependent on the same binding motif within the CTT of STING.Figure 5 STING recruits IKKε via the TBK1-binding motif within its C-terminal tail

(A) Sting−/− iBMDMs reconstituted with either wild-type (WT) mCit-STING or mCit-STING L373A were treated with 1 μg/mL doxycycline overnight. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-GFP antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(B) Following overnight doxycycline treatment (1 μg/mL) of mCit-STING WT or mCit-STING L373A iBMDMs were left untreated or stimulated with 50 μg/mL DMXAA for 1 h. Cells were fixed before images were acquired on the LSM980 confocal microscope. Images are displayed as a single Z slice. Scale bar, 10 μm. Data shown are representative of 3 independent experiments.

(C) Sting−/− iBMDMs and those reconstituted with either HA-STING WT or HA-STING L373A were left untreated or stimulated with 50 μg/mL DMXAA for 1 and 2 h. Cells were lysed, and lysate was immunoblotted with indicated antibodies. Data shown are representative of 3 independent experiments.

(D and E) Sting−/− iBMDMs and those reconstituted with either HA-STING WT or HA-STING L373A were left untreated or stimulated with 50 μg/mL DMXAA or 10 μM diABZi for 4 h before measuring IFNβ (D) and TNF (E) secretion in cell supernatants by ELISA. Data shown as mean ± SEM combined from 3 independent experiments. ∗∗p < 0.01, ∗∗∗p < 0.001, compared to HA-STING WT iBMDMs as determined by unpaired Student’s t test. See also Figure S5.

Residues essential for STING-binding are conserved between TBK1 and IKKε

Since we established that IKKε interacts with STING at the same region as TBK1, we posited that the interface residues within TBK1 that facilitate STING binding should be highly conserved within IKKε. Indeed, multiple sequence alignment of the residues 578–585 within human TBK1 demonstrated high conservation with this region between human IKKε (residues 568–575), as well as with murine TBK1 and IKKε (Figure 6A). In contrast, the other members of the IKK family lacked this sequence (Figure S6). To explore this further, we generated structural models of STING with TBK1 and IKKε dimers based on published and predicted protein structures respectively (Figures 6B and 6C). Consistent with previous reports,23,24 the interface between STING and TBK1 was facilitated by residues 373–376 within STING CTT that are buried within the groove formed by the kinase domain of one TBK1 subunit and the scaffold and dimerization domain (SDD) of a second TBK1 subunit (Figure 6B). This interface appeared to be almost identical for the predicted STING-IKKε interaction (Figure 6C). To confirm this region of interaction, we generated IKKεKO iBMDMs expressing either HA-tagged wild-type, Y568A, or Q572A forms of human IKKε (corresponding to Y577A and Q581A mutation in human TBK1). As we previously observed, DMXAA stimulation induced the interaction of TBK1 and STING with HA-IKKε, while in stark contrast, cells expressing HA-IKKε Y568A or Q572A failed to show enrichment of STING or TBK1 (Figure 6D). These data confirm that the STING-binding region within IKKε, which is conserved with TBK1, is essential for its recruitment to active STING complexes.Figure 6 TBK1 residues responsible for interaction with STING conserved in IKKε

(A) Multiple sequence alignment of human and murine TBK1 and IKKε. Green shading indicates conserved residues. Red line highlights the STING binding interface within human TBK1 that was previously identified to mediate the interaction with STING.

(B and C) Alignment of the cryo-EM structure of chicken STING C-terminal tail (shown in blue; line representation) in complex with: (B) human TBK1 (shown in green; cartoon representation); or (C) the Alpha-Fold predicted model of human IKKε (shown in yellow; cartoon representation).

(D) IKKεKO iBMDMs and IKKεKO iBMDMs reconstituted with HA-IKKε WT, HA-IKKε Y568A or HA-IKKε Q572A were left untreated or treated with 50 μg/mL DMXAA for 1 h. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-HA antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments. See also Figure S6.

IKKε forms a unique hydrophobic interaction with the CTT of STING

Aside from these conserved interactions, we observed that the SDD of TBK1 and IKKε have a notable amino acid substitution between H403 (polar residue) of hTBK1 and V403 (hydrophobic residue) of hIKKε that may influence their binding specificity (Figures 7A and 7B). Indeed, our predicted STING-IKKε structural model suggested that I365 of STING (I364 in murine STING) could form a hydrophobic interaction with IKKε V403 but not TBK1 H403 (Figures 7A and 7B). Correspondingly, Sting−/− iBMDMs reconstituted with HA-tagged murine STING I364A (corresponds to human STING I365A) displayed a reduced ability to interact with IKKε but not TBK1 upon DMXAA treatment, when compared to cells expressing wild-type HA-STING (Figure 7C). As expected, mutation of the IRF3-binding motif in STING (i.e., STING I364A) not only led to a complete loss of IFNβ production but also a reduction in TNF secretion (Figures 7D and 7E). As I364 of STING is located within the well-defined IRF3 binding motif,25 we examined if IRF3 can influence the interaction of STING with IKKε and TBK1 by performing endogenous STING IP from wild type and Irf3−/−/Irf7−/− BMDMs. However, as no differences were observed in the abilities of IKKε and TBK1 to bind STING these data demonstrate IRF3 is not required for the formation of STING-TBK1-IKKε complexes (Figure S7). We next undertook reciprocal experiments to those examining STING I364A by generating IKKεKO iBMDMs expressing either HA-tagged wild-type IKKε or IKKε V403A (predicted hydrophobic interaction residue with STING I364). Consistent with our predicted model, we observed the V403A mutation reduced the ability of IKKε to interact with STING and consequently TBK1, compared to wild-type IKKε (Figure 7F). Lastly, we reconstituted TBK1/IKKεKO iBMDMs with wild-type HA-IKKε, HA-IKKε V403A (unique interaction), or HA-IKKε Q572A (similar interface to TBK1) to directly compare their capacity to induce STING-induced NF-κB activation. Interestingly, while macrophages expressing IKKε containing a mutation in the STING-binding interface (i.e., HA-IKKε Q572A) failed to induce any detectable phosphorylation of STING, IKKε, or p65 NF-κB, nor detectable TNF secretion, those expressing IKKε V403A only displayed a moderate reduction in STING and IKKε phosphorylation, with no difference in p65 NF-κB activity nor TNF production (Figures 7G and 7H). Together, these data demonstrate that IKKε forms a unique secondary hydrophobic interaction with STING that contributes to maximal IKKε recruitment. Intriguingly however, this additional interaction is not required for IKKε to induce NF-κB responses downstream of STING.Figure 7 IKKε forms additional contact points with STING in comparison to TBK1

(A and B) Alignment of the cryo-EM structure of chicken STING C-terminal tail (line representation) in complex with: (A) human TBK1; or (B) the Alpha-Fold predicted model of human IKKε. The dotted line indicates a potential hydrophobic residue interaction. Amino acids are colored based on their hydrophobicity (red represents hydrophobic residue).

(C) Sting−/− iBMDMs reconstituted with HA-STING WT or HA-STING I364A were left untreated or stimulated with 50 μg/mL DMXAA for 1 h. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-HA antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(D and E) Sting−/− iBMDMs and those reconstituted with HA-STING WT or HA-STING I364A were left untreated or stimulated with 50 μg/mL DMXAA for 4 h before measuring IFNβ (D) and TNF (E) secretion in cell supernatants by ELISA. Data shown as mean ± SEM combined from 3 independent experiments. ∗p < 0.05, ∗∗p < 0.01, compared to HA-STING WT iBMDMs as determined by unpaired Student’s t test.

(F) IKKεKO iBMDMs reconstituted with HA-IKKε WT or HA-IKKε V403A were left untreated or treated with 50 μg/mL DMXAA for 1h. Following stimulation, cells were lysed to generate WCL for immunoblot while the remaining lysate underwent IP with an anti-HA antibody. Samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(G) TBK1KO/IKKεKO iBMDMs reconstituted with HA-IKKε WT, HA-IKKε V403A or HA-IKKε Q572A were left untreated or treated with 50 μg/mL DMXAA for 1 and 2 h. WCL samples then underwent immunoblot with the indicated antibodies. Data are representative of 3 independent experiments.

(H) TBK1KO/IKKεKO iBMDMs reconstituted with HA-IKKε WT, HA-IKKε V403A, or HA-IKKε Q572A were left untreated or treated with 50 μg/mL DMXAA for 4 h before measuring TNF secretion in cell supernatants by ELISA. Data shown as mean ± SEM combined from 3 independent experiments. ∗∗∗p < 0.001, compared to HA-IKKε WT iBMDMs as determined by unpaired Student’s t test. See also Figure S6.

Discussion

Despite the huge number of studies investigating the cGAS-STING pathway, we still lack a precise mechanistic understanding of some of the key molecular events that govern its signaling. Recently, we identified IKKε as a key molecule for eliciting STING-mediated NF-κB responses in certain immune cells. In the present study, we further investigated the role of IKKε in STING non-IFN responses and identified its role in MAPK activation. We further resolved the mechanism by which IKKε is recruited to STING signaling complexes. Consistent with our genetic findings, we show that both TBK1 and IKKε are recruited independently to STING to transduce signaling. Mechanistically, we demonstrate that IKKε utilizes a conserved binding interface with TBK1 that enables simultaneous recruitment to the STING CTT via the previously identified TBK1-binding motif. Our findings are consistent with those from mice expressing an L373A mutant form of STING (StingL373A mice) that are unable to transduce immunity downstream of STING activation.12 Our results in murine macrophages corroborate very recent data published on IKKε–STING binding in overexpression models in HEK293T cells and porcine macrophages.32 Finally, we identify a unique secondary hydrophobic interaction between IKKε and STING that appears to be dispensable for the immune functions of STING.

Our findings further highlight the complexities of STING signaling complexes. The current model based on structural and cryo electron microscopic (cryo-EM) data suggests that upon activation and transit to the Golgi, STING dimers assemble into a linear arrangement to form higher order oligomers, which facilitates the recruitment of TBK1 and its autoactivation. Spatially, the active site of TBK1 molecules interacting with STING at the CTT, which contains both the IRF3-binding motif and the TBK1-binding motif, is too far away from residue S366 of STING to enable phosphorylation on the same STING dimer. Hence, TBK1 bound to the CTT of one STING dimer acts to phosphorylate adjacent STING molecules within the linear STING assembly. Our data demonstrate that IKKε binds to STING in the same manner as TBK1, as well as via additional binding site (to STING I364). Interestingly, IKKε binding to the STING complex does not appear to impact TBK1-mediated phosphorylation of S366 as in the absence of IKKε (i.e., IKKε KOs); we do not observe greater phosphorylation of STING S366 nor increased IFNβ production.27 Our data from IKKε KO cells and TBK1 KO cells further demonstrate that there does not appear to be any competitive binding between these molecules to STING. Taken together, this leads us to envisage a stoichiometric complex in which we have excess STING dimers relative to the available molecules of both TBK1 and IKKε.

Interestingly, while TBK1 is ubiquitously expressed, IKKε expression is limited to specific immune cell types, such as monocytes, macrophages, and T cells. Indeed, dendritic cells, another innate immune cell type of the myeloid lineage, and MEFs appear to have negligible basal IKKε expression.33,34 This suggests that in some cell types IKKε may exist as a backup to drive immune functions when TBK1 is absent or inhibited, which may be particularly important in the setting of pathogen immune evasion. Indeed, while some viral effector proteins are known to inhibit both TBK1 and IKKε functions,35,36,37 there are other examples where infections are reported to selectively target TBK1, such as the case for SARS-CoV-2 and HIV-1.38,39 Likewise, the Shigella flexneri E3 ligase, IpaH4.5, has been shown to specifically act on TBK1 but not IKKε.40 Interestingly, although humans with heritable TBK1-deficiency display TNF-driven autoinflammation, they retain sufficient antiviral capacity through a partial production of type I IFNs and NF-κB.41 In contrast, expression of a kinase defective form of TBK1 leads to a complete loss of type I IFN induction. This discrepancy is likely explained by recent observations in TBK1-deficient human monocytes, where a compensatory increase in IKKε expression was found to drive sufficient IFN responses.42 Indeed, we found here that overexpression of human IKKε in TBK1-deficient murine macrophages led to a modest rescue of STING phosphorylation and IRF3 activity (Figure 2C). STING responses independent of IFN induction (e.g., through NF-κB and MAPK) play critical roles in host immunity. Hence, amplifying IKKε expression could be an evolutionary measure to preserve such functions in the absence of TBK1. Several studies have demonstrated that StingS365A mice are protected from HSV-1 viral infection despite being unable to elicit STING–IFN responses, highlighting the importance of non-IFN responses (e.g., NF-κB) downstream of STING during viral infection.12,13,14 In contrast, StingL373A mice that are unable to elicit IFN or NF-κB responses upon STING activation succumb rapidly to lethal HSV-1 infection comparable to mice lacking STING.12 Interestingly, in a model of Lewis lung carcinoma StingS365A mice, but not StingL373A mice, are still able to mount effective anti-tumor immunity in response to intratumoral treatment with a STING agonist.12 Collectively these studies emphasize the importance for STING-mediated immunity to have IKKε as a backup mechanism in the event of TBK1 deficiency.

Given the high sequence homology between TBK1 and IKKε, it is not surprising that there is currently limited evidence that they can have divergent substrate specificity. However, while the non-IFN immune functions of IKKε appear to be controlled similarly to TBK1 via the previously defined TBK1-binding motif, here, we did identify a unique hydrophobic IKKε-STING CTT interaction. Whether this unique interaction or IKKε in general can impart other specific responses through STING activation is currently not known. Recent studies have demonstrated that STING can influence metabolic homeostasis in both mice and Drosophila melanogaster.43,44 Interestingly, mice lacking IKKε are known to have altered expression of genes involved in both glucose and lipid metabolism and are protected from obesity when fed a high-fat diet.45 Thus, whether IKKε plays a distinct role in regulating STING-mediated cellular metabolism is an intriguing open question.

STING is an ancient protein, highly conserved through evolution with homologs present within bacteria.46,47 Interestingly, the CTT of STING only evolved in vertebrates,48 which implies STING has primitive functions not dependent on the recruitment of TBK1 or IKKε. One such function is thought to be the noncanonical autophagic response induced downstream of STING.49,50 Here, we show that STING-dependent conversion of LC3B, a commonly used autophagy marker, is completely independent of both TBK1 and IKKε (Figure 2B). This is consistent with findings from immune cells derived from StingL373A mice (unable to bind TBK1 or IKKε: Figure 5A) that also display normal LC3B lipidation upon STING activation.12 Thus, StingL373A expression can be utilized as a model system in which STING’s noncanonical autophagy response can be decoupled from its classical immune functions. A landmark study recently revealed STING-induced LC3B conversion is in fact mediated via the ability of STING itself to act as a channel upon activation leading to proton efflux from the Golgi lumen,51 a previously known signal for noncanonical LC3B lipidation during bacterial infection.52 A body of work has demonstrated that noncanonical autophagic STING responses are required for its effective degradation along with the ESCRT machinery16,17,18,19,20 and can also directly promote host defense against microbial infections.53,54,55 However, the fact StingL373A mice display little protection from HSV-1 infection12 suggests this may not always be the case and perhaps not in the absence of TBK1/IKKε-induced immune responses. To further examine the possibility of direct host defense by STING noncanonical autophagy, StingL373A mice should be employed in other models of infection (e.g., Mycobacterium tuberculosis).

In summary, our findings confirm the mechanistic details of how IKKε engages STING in order to function within the cGAS-STING signaling pathway, driving NF-κB and MAPK responses in monocytes and macrophages. These findings help to strengthen our understanding of STING non-IFN responses and suggest that future research into the IKKε-specific and TBK1/IKKε-independent functions downstream of STING is needed to delineate how manipulating STING may impact immune responses.

Limitations of the study

Our study examined the non-IFN functions of IKKε and its mechanism of action within the STING pathway. Given the limited basal expression profile of IKKε across cell types, our experiments focused primarily on murine macrophages. However, CD4+ and CD8+ T cell populations also express IKKε (ImmGen, BioGPS), and STING activation in T cells is known to induce a number of non-IFN responses including cell death. Future studies should therefore more closely examine the contribution of IKKε to STING-elicited responses in T cells and other lymphocytes. To thoroughly examine the molecular mechanisms of IKKε within STING signaling, our experiments were performed in vitro, often utilizing iBMDM cell lines that are highly amenable to both viral transduction and CRISPR gene editing. However, to identify specific contributions of IKKε to STING responses more broadly, comprehensive in vivo studies of IKKε-deficient mice should be performed following STING activation (e.g., HSV-1 infection or STING-driven disease models). Finally, here our genetic knockout studies have focused on murine macrophages; however, data from TBK1-deficient humans suggests that the compensatory roles of IKKε in human immunity may be greater than in the murine system. Hence, further careful investigation of STING-IKKε specific functions in human model systems such as human CD14+ monocytes, monocyte-derived macrophages, THP-1 monocytic-like cells or iPSC-derived macrophages is highly warranted.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Antibodies	
	
Rabbit monoclonal anti-NF-κB p65 (C22B4) antibody	Cell Signaling Technology	Cat# 4764; RRID:AB_823578	
Rabbit monoclonal anti-NF-κB P-p65 Ser536 (93H1) antibody	Cell Signaling Technology	Cat# 3033; RRID:AB_331284	
Rabbit monoclonal anti-STING (D2P2F) antibody	Cell Signaling Technology	Cat# 13647; RRID:AB_2732796	
Rabbit monoclonal anti-P-STING Ser366 (D7C3S) antibody	Cell Signaling Technology	Cat# 19781, RRID:AB_2737062	
Rabbit monoclonal anti-P-STING Ser366 (E9A9K) antibody	Cell Signaling Technology	Cat# 50907; RRID: AB_2827656	
Rabbit monoclonal anti-P-STING Ser365 (D8F4W) antibody	Cell Signaling Technology	Cat# 72971, RRID:AB_2799831	
Rabbit polyclonal anti-TBK1 antibody	Cell Signaling Technology	Cat# 3013; RRID:AB_2199749	
Rabbit monoclonal anti-P-TBK1 Ser172 (D52C2) antibody	Cell Signaling Technology	Cat# 5483; RRID:AB_10693472	
Rabbit monoclonal anti-IRF3 (D83B9) antibody	Cell Signaling Technology	Cat# 4302; RRID:AB_1904036	
Rabbit monoclonal anti-P-IRF3 Ser396 (4D4G) antibody	Cell Signaling Technology	Cat# 4947; RRID:AB_823547	
Rabbit monoclonal anti-IKKε (D61F9) antibody	Cell Signaling Technology	Cat# 3416; RRID:AB_1264180	
Rabbit monoclonal anti-IKKε antibody	Cell Signaling Technology	Cat# 2690; RRID: AB_915926	
Rabbit monoclonal anti-P-IKKε Ser172 (D1B7) antibody	Cell Signaling Technology	Cat# 8766; RRID:AB_2737061	
Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) (137F5) antibody	Cell Signaling Technology	Cat# 4695; RRID: AB_390779	
Rabbit monoclonal anti-P-p44/42 MAPK (Erk1/2) Thr202/Tyr204 (D13.14.4E) antibody	Cell Signaling Technology	Cat# 4370; RRID: AB_2315112	
Rabbit polyclonal anti-p38 MAPK antibody	Cell Signaling Technology	Cat# 9212; RRID: AB_330713	
Rabbit monoclonal anti-P-p38 MAPK Thr180/Tyr182 antibody	Cell Signaling Technology	Cat# 9211; RRID: AB_331641	
Rabbit monoclonal LC3B (D11) antibody	Cell Signaling Technology	Cat# 3868; RRID:AB_2137707	
Mouse 1gG2A monoclonal GFP (E36) antibody	Thermo Fisher Scientific	Cat# A-11120; RRID:AB_221568	
Rat monoclonal anti-HA high affinity (3F-10) antibody	Roche Biochemicals (Merck)	Cat# 11867431001;
RRID:AB_390919	
Mouse monoclonal anti-Myc Tag (9B111) antibody	Cell Signaling Technology	Cat# 2276; RRID: AB_331783	
Mouse Monoclonal ANTI-FLAG M2 antibody	Sigma-Aldrich (Merck)	Cat# F1804; RRID: AB_262044	
Mouse monoclonal anti-beta ACTIN HRP (C4) antibody	Santa Cruz Biotechnology	Cat# sc-47778 HRP; RRID:AB_2714189	
Rat anti-mouse IFNβ (IFN-beta, IFNb, IFB, IFF, IFNB1, Fibroblast Interferon, MGC96956) antibody	USBiological Life Sciences	Cat# 138027	
Rabbit polyclonal anti-Mouse IFNβ antibody	PBL Assay Science	Cat# 32400-1; RRID:AB_387872	
Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, HRP	Thermo Fisher Scientific	Cat# A16078; RRID:AB_2534751	
Peroxidase-AffiniPure F(ab')2 Fragment Donkey Anti-Rabbit IgG (H + L) antibody	Jackson ImmunoResearch Labs	Cat# 711-036-152; RRID:AB_2340590	
Peroxidase-AffiniPure Goat Anti-Rabbit IgG (H + L) antibody	Jackson ImmunoResearch Labs	Cat# 111-035-003; RRID:AB_2313567	
Goat polyclonal anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa 647	Thermo Fisher Scientific	Cat# A-21244;
RRID:AB_2535812	
	
Bacterial and virus strains	
	
HSV-1 (KOS strain)	Gebhardt Laboratory, Peter Doherty Institute, Australia	N/A	
5-α Competent E.coli (high efficiency)	New England Biolabs	Cat# C2987U	
	
Chemicals, peptides, and recombinant proteins	
	
Lipofectamine 2000 Transfection Reagent	Thermo Fisher Scientific	Cat# 11668030	
Recombinant mouse IFNβ (carrier-free)	PBL Assay Science	Cat# 12401-1	
DMXAA (5,6-Dimethylxanthenone-4-acetic acid)	InvivoGen	Cat# tlrl-dmx	
2′3′-cGAMP - Cyclic [G(2′,5′)pA(3′,5′)p]	InvivoGen	Cat# tlrl-nacga23	
2′3′-cGAM(PS)2 (Rp/Sp)	InvivoGen	Cat# tlrl-nacga2srs-05	
Ultrapure LPS from E. coli 055:B5	InvivoGen	Cat# tlrl-pb5lps	
Puromycin	InvivoGen	Cat# ant-pr-1	
Hygromycin B Gold	InvivoGen	Cat# ant-hg-1	
DMSO (Dimethyl sulfoxide)	Sigma-Aldrich (Merck)	Cat# D2650	
Doxycycline hyclate	Sigma-Aldrich (Merck)	Cat# D9891	
MRT67307 (TBK1/IKKε kinase inhibitor)	Sigma-Aldrich (Merck)	Cat# SML0702	
5z-7-Oxozeaenol (TAK1 kinase inhibitor)	Sigma-Aldrich	Cat# O9890	
	
Critical commercial assays	
	
NuPAGE™ 4–12% Bis-Tris Protein Gels, 1.5 mm, 10-well	Thermo Fisher Scientific	Cat# NP0335BOX	
NuPAGE™ 4–12% Bis-Tris Protein Gels, 1.5 mm, 15-well	Thermo Fisher Scientific	Cat# NP0336BOX	
NuPAGE™ 4–12% Bis-Tris Midi Protein Gels, 20-well	Thermo Fisher Scientific	Cat# WG1402A	
NuPAGE™ MES SDS Running Buffer (20X)	Thermo Fisher Scientific	Cat# NP000202	
Immobilon-P PVDF Membrane, 0.45 μm pore size, Hydrophobic PVDF	Millipore (Merck)	Cat# IPVH00005	
cOmplete™ Protease Inhibitor Cocktail	Roche Biochemicals (Merck)	Cat# 11836145001	
Immobilon Forte Western HRP substrate	Merck Millipore	Cat# WBLUF0500	
Dynabeads™ Protein G	Thermo Fisher Scientific	Cat# 10003D	
DynaMag™-2 Magnet	Thermo Fisher Scientific	Cat# 12321D	
TNF alpha Mouse Uncoated ELISA Kit	Thermo Fisher Scientific	Cat# 88-7324-88	
Nunc MaxiSorp™ flat-bottom ELISA plates	Thermo Fisher Scientific	Cat# 442404	
μ–Slide 8 well	Ibidi	Cat# 80826	
Q5® Site-Directed Mutagenesis Kit	New England Biolabs	Cat# E0552S	
	
Deposited data	
	
PBD–6NT9: Cryo-EM structure of the complex between human TBK1 and chicken STING	https://doi.org/10.2210/pdb6NT9/pdb	Zhang et al.24, Nature 2019	
	
Experimental models: Cell lines	
	
Human embryonic kidney (HEK) 293T cells	ATCC	CRL-3216	
WT immortalized bone marrow-derived macrophages (iBMDMs)	Latz Laboratory, University of Bonn, Germany	N/A	
WT immortalized bone marrow-derived macrophages (iBMDMs) expressing Cas9-mCherry	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
TBK1KO immortalized bone marrow-derived macrophages (iBMDMs)	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
IKKεKO immortalized bone marrow-derived macrophages (iBMDMs)	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
TBK1KO/IKKεKO immortalized bone marrow-derived macrophages (iBMDMs)	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
Sting−/− immortalized bone marrow-derived macrophages (iBMDMs)	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
WT THP-1 human monocytic cells	ATCC	TIB-202	
WT THP-1 human monocytic cells expressing Cas9-mCherry	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
THP-1 human monocytic cells expressing pTRIPZ empty vector (EV)	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
THP-1 human monocytic cells expressing WT human STING	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
THP-1 human monocytic cells expressing human STING R284S	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
Immortalized mouse embryonic fibroblasts (iMEF)	This paper	N/A	
Immortalized mouse embryonic fibroblasts (iMEF) expressing Cas9-mCherry	This paper	N/A	
TBK1KO immortalized mouse embryonic fibroblasts (iMEF)	This paper	N/A	
	
Experimental models: Organisms/strains	
	
Tbk1fl/fl (C56BL/6J-Tbk1tm1.1 mrl) mice	Taconic	Model# 11131	
Tbk1fl/fl x RosaCre+ (C56BL/6J) mice	Wicks Laboratory, Walter & Eliza Hall Institute, Australia	Balka et al.27, Cell Reports 2020	
C57BL/6J mice (for bone marrow-derived macrophages- BMDMs)	Jackson Laboratory	Cat# 000664	
Sting−/− mice (for bone marrow-derived macrophages- BMDMs)	De Nardo Laboratory. Monash University, Australia	N/A	
Sting+/+ mice (for bone marrow-derived macrophages- BMDMs)	De Nardo Laboratory. Monash University, Australia	N/A	
Irf3−/−/Irf7−/− mice (for bone marrow-derived macrophages- BMDMs)	Wakim Laboratory, Peter Doherty Institute, Australia	N/A	
	
Oligonucleotides	
	
Tbk1 targeting sgRNA: GAGGAGCCGTCCAATGCGTA	De Nardo Laboratory. Monash University, Australia	Balka et al.27, Cell Reports 2020	
hsIKKε PCR amplification forward primer: GCACCGGTATGGACTACAAGGACGAC
GATGACAAGCAGAGCACAGCCAATTAC	This paper	N/A	
hsIKKε PCR amplification reverse primer: GCGGATCCTCAGACATCAGGAGGTGC
TGG	This paper	N/A	
hsIKKε N-terminal HA tag mutagenesis forward primer: gccggattatgcgCAGAGCACAGCCAAT
TACC	This paper	N/A	
hsIKKε N-terminal HA tag mutagenesis reverse primer: acatcatacggataCATGGTGGCAGCGC
TCTA	This paper	N/A	
mmSTING PCR amplification forward primer: GCACCGGTATGGTGAGCAAGGGCG
AGGAG	This paper	N/A	
mmSTING PCR amplification reverse primer: CGACGCGTTCAGATGAGGTCAGTGCGGA
GTGGGA	This paper	N/A	
mmSTING L373A mutagenesis forward primer: GCCTCTCCCAgccCGCACTGACC	This paper	N/A	
mmSTING L373A mutagenesis reverse primer: TGATCCATACCACTGATGAG	This paper	N/A	
mmSTING I364A mutagenesis forward primer: AAGACTCCTCgcCAGTGGTATGGATCAG	This paper	N/A	
mmSTING I364A mutagenesis reverse primer: GGCTCTTGGGACAGTACG	This paper	N/A	
hsTBK1 K38A mutagenesis forward primer: ATTTGCTATCgcaGTATTTAATAACATAAGC	This paper	N/A	
hsTBK1 K38A mutagenesis reverse primer: AAATCACCAGTTTTCTTATG	This paper	N/A	
hsIKKε K38A mutagenesis forward primer: GGTTGCTGTGgcgGTCTTCAACAC	This paper	N/A	
hsIKKε K38A mutagenesis reverse primer: AGCTCTCCGGATTTCTTG	This paper	N/A	
hsIKKε Y568A mutagenesis forward primer: AGGGCTTGGCgccAACGAGGAGC	This paper	N/A	
hsIKKε Y568A mutagenesis reverse primer: GGCCTCATCCTAGACTTC	This paper	N/A	
hsIKKε Q572A mutagenesis forward primer: CAACGAGGAGgcgATTCACAAGCTGGA
TAAGGTG	This paper	N/A	
hsIKKε Q572A mutagenesis reverse primer: GGCTCTTGGGACAGTACG	This paper	N/A	
hsIKKε V403A mutagenesis forward primer: ATTTGCTATCgcaGTATTTAATAACATAAGC	This paper	N/A	
hsIKKε V403A mutagenesis reverse primer: AGCTCTCCGGATTTCTTG	This paper	N/A	
Mouse Hprt forward: TGAAGTACTCATTATAGTCAAGGGCA	This paper	N/A	
Mouse Hprt reverse: CTGGTGAAAAGGACCTCTCG	This paper	N/A	
Mouse Ifnb1 forward: CCAGCTCCAAGAAAGGACGA	This paper	N/A	
Mouse Ifnb1 reverse: TGGATGGCAAAGGCAGTGTA	This paper	N/A	
Mouse Isg15 forward: TGTGAGAGCAAGCAGCCAGA	This paper	N/A	
Mouse Isg15 reverse: CCCCCAGCATCTTCACCTTT	This paper	N/A	
	
Recombinant DNA	
	
pEF-BOS-mCitrine-mSTING	Hornung Laboratory, Ludwig Maximilian University of Munich, Germany	N/A	
pTRIPZ-mCitrine-mSTING	This paper	N/A	
pTRIPZ-mCitrine-mSTING L373A	This paper	N/A	
pLVX-HA-mSTING	De Nardo Laboratory. Monash University, Australia	Balka et al.20, EMBO J 2023	
pLVX-HA-mSTING L373A	This paper	N/A	
pLVX-HA-mSTING I364A	This paper	N/A	
pcDN3.1-FLAG-hIKKε	Mansell Laboratory, Hudson Institute, Australia	N/A	
pcDN3.1-FLAG-hIKKε K38A	This paper	N/A	
LentiBLAST-hIKKε	This paper	N/A	
LentiBLAST-HA-hIKKε	This paper	N/A	
LentiBLAST-HA-hIKKε Y568A	This paper	N/A	
LentiBLAST-HA-hIKKε Q572A	This paper	N/A	
LentiBLAST-HA-hIKKε V403A	This paper	N/A	
pCMV-Myc-STING	Helbig Laboratory, La Trobe University, Australia	N/A	
pcDNA3.1-FLAG-TBK1	Mansell Laboratory, Hudson Institute, Australia	N/A	
pcDN3.1-FLAG-hTBK1 K38A	This paper	N/A	
FUCas9mCherry	Addgene	Plasmid# 70182	
pFgH1tUT-GFP	Addgene	Plasmid# 70183	
pFgH1tUT-GFP Tbk1 targeting sgRNA	De Nardo Laboratory. Monash University, Australia	Balka et al.20, EMBO J 2023	
pMD2.G	Addgene	Plasmid# 12259	
psPAX2	Addgene	Plasmid# 12260	
pRSV-Rev	Addgene	Plasmid# 12253	
pMDLg/pRRE	Addgene	Plasmid# 12251	
	
Software and Algorithms	
	
FIJI	https://fiji.sc	RRID:SCR_002285	
Image Lab	Bio-Rad Laboratories	RRID:SCR_014210	
The PyMOL Molecular Graphics System	Schrödinger, LLC	RRID:SCR_000305	
AlphaFold Protein Structure Database	https://www.alphafold.ebi.ac.uk/	RRID:SCR_023662	
GraphPad Prism	http://www.graphpad.com/	RRID:SCR_002798	
Adobe Illustrator	http://www.adobe.com/products/illustrator.html	RRID:SCR_010279	

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dominic De Nardo (dominic.denardo@monash.edu).

Materials availability

All existing and newly generated reagents used in this study will be made available upon reasonable request to the lead contact.

Data and code availability

• Data reported in this paper will be shared by the lead contact upon request.

• Cryo-EM structure of a complex between human STING and chicken TBK1 (PDB:6NT9) was as a template reference for structural modeling.

• This paper does not report original code.

• Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Experimental model and study participant details

Primary murine bone marrow-derived macrophages (BMDMs)

Six-to eight-week-old male or female C57BL/6 wild-type, Sting−/− or Irf3−/−/Irf7−/− mice were euthanized using CO2 asphyxiation in accordance with ethics guidelines approved by the Monash University and University of Melbourne Animal Ethics Committees. Femur and tibia were harvested, and the bone marrow was flushed and cultured in complete Dulbecco’s Modified Eagle Medium (DMEM [made in house] with 0.1% (w/v) streptomycin, 100u/mL penicillin and 10% fetal bovine serum [FBS]) supplemented with 20% L929-conditioned media for 6 days at 37°C in a humidified incubator with 10% CO2.

Immortalized cell lines

iBMDMs, iMEFs and HEK293T cells were cultured in complete DMEM, while THP-1 monocytic cells were cultured in complete Roswell Park Memorial Institute media 1640 (RPMI 1640; with 0.1% (w/v) streptomycin, 100u/mL penicillin and 10% fetal bovine serum [FBS]) at 37°C in 10% CO2 humidified atmosphere and passaged every 2–3 days. WT and Sting−/− iBMDMs were generated previously.27,56 TBK1KO, IKKεKO and TBK1/IKKεKO iBMDMs were generate previously using CRISPR-Cas9 gene editing.27 All cell lines tested negative for mycoplasma contamination prior to use in this study.

Method details

Generation of lentiviral plasmids

All primers were ordered from Integrated DNA Technologies (IDT). The third-generation lentiviral plasmid LentiBLAST-HA-hIKKε was generated by amplifying IKKε cDNA from a template plasmid (pcDN3.1-FLAG-hIKKε) before the resultant PCR product was digested with AgeI and BamHI and cloned in-frame into the corresponding sites of the Lenti-P2A-BLAST backbone. The Q5 mutagenesis kit was then utilized to insert N-terminal HA tag. The second-generation pTRIPZ-mCitrine-mSTING lentiviral plasmid expressing a doxycycline-inducible mCitrine-fused murine STING, was generated by amplifying STING cDNA from a template plasmid (pEF-BOS-mCitrine-mSTING) before the resultant PCR product was digested with AgeI and MluI and cloned in-frame into the corresponding sites of pTRIPZ. The NEBasechanger online tool was used to design primers for Q5 mutagenesis (New England Biolabs). Using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs #E0554S). 5-α Competent E.coli (high efficiency) (New England Biolabs, C2987U) was used to prepare single colony preparations of plasmids. DNA was extracted and plasmids were verified using sanger sequencing by Monash Micromon prior to expansion. All primer sequences used are listed in the key resources table.

Lentiviral transduction

Lentiviral transduction of iBMDMs was performed similarly to published protocols.57 Third-generation lentivirus was generated by transient transfection of HEK293T cells with a lentiviral plasmid, pMDL (packaging), RSV-REV (packaging) and VSVg (envelope) plasmids complexed into liposomes using Lipofectamine 2000 (Thermo Scientific) diluted in OptimMEM (Thermo Scientific). Second-generation lentivirus was generated via transient transfection of HEK293T cells with a lentiviral plasmid, pPAX2 (packaging) and pMD2.G (envelope) plasmids complexed into liposomes using Lipofectamine 2000 (Thermo Scientific) diluted in OptimMEM (Thermo Scientific). To remove the transfection reagents, the media was changed 24 h following transfection. Lentiviruses were harvested after additional 24 h later, filtered through 0.45 μm filter and used to infect 1x105 iBMDMs target cell lines. Following infection and recovery, the cells were subsequently enriched for lentiviral plasmid expression via antibiotic selection or cell sorting using a BD Biosciences Influx sorter.

CRISPR/Cas9 gene editing

TBK1KO iMEFs were generated by CRISPR/Cas9 gene editing.27 Third generation lentiviral transduction was used to generate iMEFs expressing Cas9 fused to mCherry (FUCas9mCherry plasmid), which were subsequently enriched by FACS sorting. Doxycycline-inducible sgRNA plasmids (pFgH1tUT-GFP) targeting Tbk1 were then introduced into Cas9-mCherry expressing iMEFs via third generation lentiviral transduction (described above). Cells expressing sgRNA plasmids were then enriched by FACS sorting. Gene disruption was confirmed by immunoblot analysis of target proteins. The sgRNA targeting sequences used are provided in the KEY RESOURCES TABLE.

Whole-cell lysate (WCL) preparation

For immunoblot experiments, ∼4× 105 iBMDMs, ∼1× 106 BMDMs or ∼1.5× 106 THP-1 were seeded per well in 12-well plates the day prior to stimulation. Following stimulation, the cells were lysed on ice with 120 μL of Radioimmune precipitation assay (RIPA) buffer [20 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol, 0.1% SDS and 0.5% deoxycholate, 5 mM NaF, 10 mM NaPPi, 1 mM Na3VO4] supplemented with 1 mM phenylmethylsulphonyl fluoride (PMSF) and 1 × cOmplete protease inhibitors (Roche Biochemicals). WCLs were clarified by centrifugation at 17,000 × g for 1 min through Pierce centrifuge columns (Thermo Scientific) and diluted with 4× reducing LDS sample buffer (Thermo Scientific) supplemented with 5% β-mercaptoethanol (Sigma-Aldrich) and heated to 95°C for 10 min before SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot.

Immunoprecipitation (IP) assays

Immunoprecipitation experiments were performed similarly to before.58,59 Briefly, 2 × 107 BMDMs, 1-1.5 × 107 iBMDMs, 1.5 × 107 THP-1 monocytic-like cells or 3 × 106 HEK293T cells were lysed in 1 mL 1× NP-40 lysis buffer (40 mM Tris-HCl (pH 7.4), 2 mM EDTA, 2% Nonidet P-40 (IGEPAL), 20% Glycerol), supplemented with 1× cOmplete Protease inhibitor cocktail (Roche #11836145001), 100 μM PMSF, 1 mM NaPPi, 500 μM NaF, 100 μM Na3VO4) and incubated on ice for 30 min. Samples were centrifuged at 17,000 × g for 10 min at 4°C to clarify lysates. Following preparation of WCL samples for immunoblot, primary antibody (1 μg anti-HA [Roche; clone 3F-10, 11867431001], 1 μg anti-GFP [Thermo Scientific; clone E36, A-11120], 1 μg anti-FLAG [Sigma; clone M2, F1804]; anti-STING [Cell Signaling Technology (CST); clone D1V5L (Rodent Preferred), 50494, 1:50]; anti-p-STING Ser366 [CST; clone E9A9K, 50907, 1:50]; anti-TBK1 [CST; 3013, 1:50]) was added to the remaining lysate and incubated on a rotator for 1 h at 4°C. Subsequently, 50 μL of Protein G magnetic Dynabeads (Thermo Scientific, 10004D) was added to each sample and incubated for a further 1 h on a rotator at 4°C. Beads were washed 4× with 1 mL NP-40 lysis buffer using a DynaMag-2 magnet (Thermo Scientific; 12321D). Protein was then eluted from beads by addition of 1× reducing LDS sample buffer (Thermo Scientific) and heated to 95°C for 10 min prior to SDS-PAGE and immunoblot.

Immunoblotting

WCL or IP samples were run on NuPAGE 4–12% Bis-Tris Protein Gels (Thermo Scientific) with MES or MOPS running buffer (Thermo Scientific). Following activation of Immobilon-P polyvinyl difluoride (PVDF) membrane (Millipore Merk) in methanol, proteins were transferred to membranes using the Trans-Blot Turbo System (BioRad). Membranes were then blocked using 5% skim milk powder in TBS +0.1% Tween 20 (TBST) at room temperature (RT) for 1 h before incubation overnight in primary antibodies at 4°C. Membranes were then washed 3x in TBST and incubated with appropriate HRP-conjugated secondary antibodies (Peroxidase-AffiniPure Goat anti-rabbit IgG [Jackson ImmunoResearch Labs, 111-035-003, 1:20,000); Goat anti-mouse [Thermo Scientific, A16078, 1:20,000]) for 1 h at RT before membranes were again washed 3× in TBST. Chemiluminescence was detected by subjecting membranes to Immobilon Forte Western HRP substrate (Millipore Merk) before imaging using the ChemiDoc Touch Imaging System (BioRad). Images were acquired and converted to tagged image format file (TIFF) using Image Lab software (BioRad). When required, antibodies were removed from membranes using a mild stripping buffer (50 mM glycine +0.4% SDS pH 2.2) before 3× washes in TBST and re-probing with primary antibodies. Primary and secondary antibodies used for immunoblot are listed in the key resources table.

Enzyme-linked immunosorbent assay (ELISA)

Cell supernatants were assessed for murine TNF according to the manufacturer’s protocol (eBioscence, Thermo Scientific). Murine IFNβ was measured using a custom-made protocol as previously reported.60,61 The monoclonal rat anti-mouse IFNβ (USBiological Life Sciences; 138027) was used as a coating antibody, while the polyclonal rabbit anti-mouse IFNβ (PBL Assay Science; 32400-1) was used for detection. Recombinant mouse IFNβ (carrier-free) (PBL Assay Science; 12401-1) was used to generate a standard curve, peroxidase-conjugated AffiniPure F(ab’)2 fragment donkey anti-rabbit IgG (H + L) (Jackson Immuno Research; 711-036-152) was used for chemiluminescence, and PBS with 1% bovine serum albumin (BSA) was used as the assay diluent.

Immunofluorescence

2.5–5× 104 mCitrine-mSTING iBMDMs were seeded in 8-well μ-slide ibiTreat chamber slides (iBidi). The next day, following any cell treatments, cells were washed with PBS and fixed with 4% paraformaldehyde (PFA) in PBS at RT for 30 min. Cells were then washed twice with PBS, permeabilised with 0.15% Triton X-100 in PBS for 20 min and then incubated with blocking buffer (PBS +10% FBS) for 1 h at RT. Primary antibodies (CST: p-IKKε Ser172 [clone D1B7, 8766, 1:200]; p-TBK1/NAK Ser172 [clone D52C2, 5483, 1:200]) were diluted in blocking buffer and samples were incubated at 4°C overnight. The following day, samples were washed 3× with blocking buffer before incubation with a secondary Goat anti-rabbit IgG AlexaFlour 647 (Thermo Scientific, A21245, 1:1000) in blocking buffer. Samples were subsequently washed 3× with blocking buffer before nuclear staining with 300 nM DAPI (in PBS) for 10 min at RT and then a final wash using PBS. Z stack images (with a 0.5 μm Z step) were acquired using the Zeiss confocal light scanning microscope (LSM) 980, equipped with Airyscan 2 detector with ZEN software. A 63x/1.40 NA oil objective with Immersol 518 F immersion oil (Zeiss) was used. Images were processed using ImageJ.

Quantitative real-time PCR

RNA was isolated from 1-3 × 106 iBMDMs utilising the RNeasy Plus Mini Kit (QIAGEN). Complementary DNA (cDNA) was generated using SuperScript III Reverse Transcriptase (ThermoScientific). qPCR was performed with QuantiNova Probe PCR Master Mix SYBR Green (QIAGEN) using the Bio-Rad CFX384 Real-Time System Thermal Cycler. Expression levels are displayed as normalised to the housekeeping gene murine Hprt. Specific primer sequences used are listed in the key resources table.

In silico structural modeling

The structural models of human STING-IKKε complex and human STING-TBK1 complexes were generated using the cryo-EM structure of STING-TBK1 complex as a template reference (PDB:6NT9). The AlphaFold models of human IKKε, human TBK1 and human STING were aligned to the reference template to model the interaction between IKKε and the C-terminal tail of STING. Figures were visualised and generated using PyMOL (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC).

Sequence alignment

Protein sequences for TBK1 and IKKε orthologs from human (Homo sapiens) and mouse (Mus musculus) were obtained from the National Center for Biotechnology Information (NCBI) database and aligned using the online Basic Local Alignment Search Tool (BLAST) program (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

TBK1 and IKKε expression profiles

Murine TBK1 and IKKε gene expression levels measured by RNA-sequencing from various primary immune cells and cell lines were obtained from BioGPS (http://biogps.org/#goto=welcome). The data was graphed using GraphPad Prism 8.

Quantification and statistical analysis

For quantification of western blots, densitometry was performed using Image Lab software (BioRad). Levels of phosphorylated proteins were made relative to total protein controls and data is represented as the fold change compared to untreated samples (mean ± SEM). Statistical analyses were performed with Prism (GraphPad Software) and data are typically presented as the mean ± SEM, where a p value < 0.05 was considered significant as determined by an unpaired two-tailed Student’s t test and indicated within the specific figure legends. Significance is indicated by asterisks, defined as ∗p < 0.05, ∗∗p < 0.01 and ∗∗∗p < 0.001.

Supplemental information

Document S1. Figures S1–S7

Data S1. Uncropped western blot data, related to various figures as indicated

Acknowledgments

We are very thankful to C. Lewis and I. Wicks (Walter and Eliza Hall Institute, Australia) for bone marrow from Tbk1 fl/fl and Tbk1 fl/fl x RosaCre mice, N. McBain and T. Gebhardt (Peter Doherty Institute, Australia) for HSV-1 KOS, K. Helbig (La Trobe University, Australia) for the pCMV-Myc-STING expression plasmid, V. Hornung (LMU, Germany) for the pEF-BOS-mCitrine-STING expression plasmid, and A. Mansell (Hudson Institute, Australia) for pcDNA3.1-FLAG-TBK1 and pcDNA3.1-FLAG-IKKε expression plasmids. We acknowledge Monash Micro Imaging, Flowcore, Monash Micromon and Monash Animal Research Platform facilities for their support. 10.13039/100010313 R.V . and 10.13039/501100023737 Z.M . are supported by Australian Government Research Training Program Scholarships. K.R.B. was supported by a Monash Silver Jubilee Postgraduate Research scholarship and a Monash Graduate Excellence Scholarship. D.D.N. was supported in part by a Monash University FMNHS Senior Postdoctoral Fellowship. K.E.L. holds an 10.13039/501100000923 Australian Research Council Future Fellowship (FT190100266 ). This work was supported by an Australian National Health and Medical Research Council (NHMRC) Program grant (1113577 ) to B.T.K., an NHMRC Ideas grant (2020613 ) to M.H.L., and an ARC Discovery Project grant (DP210103122 ) to M.O’K.

Author contributions

Conceptualization: D.D.N. and R.V.; methodology: R.V., K.R.B., and D.D.N.; investigation: R.V., K.R.B., W.W., J.S., K.M.T., Z.M., R.M.L., T.L.S., M.T., and D.D.N.; resources: L.M.W., P.J.C, M.H.L., and B.T.K; writing – original draft: R.V. and D.D.N.; writing – review & editing: K.R.B. and M.O’K. with input from all authors; supervision: D.D.N., M.O’K., and K.E.L.; funding acquisition: B.T.K., M.O’K., and D.D.N.; project administration: D.D.N.

Declaration of interests

The authors declare no competing interests.

Supplemental information can be found online at https://doi.org/10.1016/j.isci.2024.110693.
==== Refs
References

1 Schoggins J.W. Wilson S.J. Panis M. Murphy M.Y. Jones C.T. Bieniasz P. Rice C.M. A diverse range of gene products are effectors of the type I interferon antiviral response Nature 472 2011 481 485 10.1038/nature09907 21478870
2 Hornung V. Hartmann R. Ablasser A. Hopfner K.P. OAS proteins and cGAS: unifying concepts in sensing and responding to cytosolic nucleic acids Nat. Rev. Immunol. 14 2014 521 528 10.1038/nri3719 25033909
3 Ablasser A. Goldeck M. Cavlar T. Deimling T. Witte G. Röhl I. Hopfner K.P. Ludwig J. Hornung V. cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING Nature 498 2013 380 384 10.1038/nature12306 23722158
4 Sun L. Wu J. Du F. Chen X. Chen Z.J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway Science 339 2013 786 791 10.1126/science.1232458 23258413
5 Wu J. Sun L. Chen X. Du F. Shi H. Chen C. Chen Z.J. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA Science 339 2013 826 830 10.1126/science.1229963 23258412
6 Burdette D.L. Monroe K.M. Sotelo-Troha K. Iwig J.S. Eckert B. Hyodo M. Hayakawa Y. Vance R.E. STING is a direct innate immune sensor of cyclic di-GMP Nature 478 2011 515 518 10.1038/nature10429 21947006
7 Balka K.R. De Nardo D. Molecular and spatial mechanisms governing STING signalling FEBS J. 288 2021 5504 5529 10.1111/febs.15640 33237620
8 Ishikawa H. Barber G.N. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling Nature 455 2008 674 678 10.1038/nature07317 18724357
9 Abe T. Barber G.N. Cytosolic-DNA-mediated, STING-dependent proinflammatory gene induction necessitates canonical NF-kappaB activation through TBK1 J. Virol. 88 2014 5328 5341 10.1128/JVI.00037-14 24600004
10 Wu J. Yan N. No Longer A One-Trick Pony: STING Signaling Activity Beyond Interferon J. Mol. Biol. 434 2022 167257 10.1016/j.jmb.2021.167257
11 Li T. Yum S. Li M. Chen X. Zuo X. Chen Z.J. TBK1 recruitment to STING mediates autoinflammatory arthritis caused by defective DNA clearance J. Exp. Med. 219 2022 e20211539 10.1084/jem.20211539
12 Yum S. Li M. Fang Y. Chen Z.J. TBK1 recruitment to STING activates both IRF3 and NF-kappaB that mediate immune defense against tumors and viral infections Proc. Natl. Acad. Sci. USA 118 2021 e2100225118 10.1073/pnas.2100225118
13 Yamashiro L.H. Wilson S.C. Morrison H.M. Karalis V. Chung J.Y.J. Chen K.J. Bateup H.S. Szpara M.L. Lee A.Y. Cox J.S. Vance R.E. Interferon-independent STING signaling promotes resistance to HSV-1 in vivo Nat. Commun. 11 2020 3382 10.1038/s41467-020-17156-x 32636381
14 Wu J. Dobbs N. Yang K. Yan N. Interferon-Independent Activities of Mammalian STING Mediate Antiviral Response and Tumor Immune Evasion Immunity 53 2020 115 126.e5 10.1016/j.immuni.2020.06.009 32640258
15 Gonugunta V.K. Sakai T. Pokatayev V. Yang K. Wu J. Dobbs N. Yan N. Trafficking-Mediated STING Degradation Requires Sorting to Acidified Endolysosomes and Can Be Targeted to Enhance Anti-tumor Response Cell Rep. 21 2017 3234 3242 10.1016/j.celrep.2017.11.061 29241549
16 Prabakaran T. Bodda C. Krapp C. Zhang B.C. Christensen M.H. Sun C. Reinert L. Cai Y. Jensen S.B. Skouboe M.K. Attenuation of cGAS-STING signaling is mediated by a p62/SQSTM1-dependent autophagy pathway activated by TBK1 EMBO J. 37 2018 e97858 10.15252/embj.201797858
17 Liu D. Wu H. Wang C. Li Y. Tian H. Siraj S. Sehgal S.A. Wang X. Wang J. Shang Y. STING directly activates autophagy to tune the innate immune response Cell Death Differ. 26 2019 1735 1749 10.1038/s41418-018-0251-z 30568238
18 Kuchitsu Y. Mukai K. Uematsu R. Takaada Y. Shinojima A. Shindo R. Shoji T. Hamano S. Ogawa E. Sato R. STING signalling is terminated through ESCRT-dependent microautophagy of vesicles originating from recycling endosomes Nat. Cell Biol. 25 2023 453 466 10.1038/s41556-023-01098-9 36918692
19 Gentili M. Liu B. Papanastasiou M. Dele-Oni D. Schwartz M.A. Carlson R.J. Al'Khafaji A.M. Krug K. Brown A. Doench J.G. ESCRT-dependent STING degradation inhibits steady-state and cGAMP-induced signalling Nat. Commun. 14 2023 611 10.1038/s41467-023-36132-9 36739287
20 Balka K.R. Venkatraman R. Saunders T.L. Shoppee A. Pang E.S. Magill Z. Homman-Ludiye J. Huang C. Lane R.M. York H.M. Termination of STING responses is mediated via ESCRT-dependent degradation EMBO J. 42 2023 e112712 10.15252/embj.2022112712
21 Shang G. Zhang C. Chen Z.J. Bai X.C. Zhang X. Cryo-EM structures of STING reveal its mechanism of activation by cyclic GMP-AMP Nature 567 2019 389 393 10.1038/s41586-019-0998-5 30842659
22 Ergun S.L. Fernandez D. Weiss T.M. Li L. STING Polymer Structure Reveals Mechanisms for Activation, Hyperactivation, and Inhibition Cell 178 2019 290 301.e10 10.1016/j.cell.2019.05.036 31230712
23 Zhao B. Du F. Xu P. Shu C. Sankaran B. Bell S.L. Liu M. Lei Y. Gao X. Fu X. A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1 Nature 569 2019 718 722 10.1038/s41586-019-1228-x 31118511
24 Zhang C. Shang G. Gui X. Zhang X. Bai X.C. Chen Z.J. Structural basis of STING binding with and phosphorylation by TBK1 Nature 567 2019 394 398 10.1038/s41586-019-1000-2 30842653
25 Tanaka Y. Chen Z.J. STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway Sci. Signal. 5 2012 ra20 10.1126/scisignal.2002521
26 Liu S. Cai X. Wu J. Cong Q. Chen X. Li T. Du F. Ren J. Wu Y.T. Grishin N.V. Chen Z.J. Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation Science 347 2015 aaa2630 10.1126/science.aaa2630
27 Balka K.R. Louis C. Saunders T.L. Smith A.M. Calleja D.J. D'Silva D.B. Moghaddas F. Tailler M. Lawlor K.E. Zhan Y. TBK1 and IKKepsilon Act Redundantly to Mediate STING-Induced NF-kappaB Responses in Myeloid Cells Cell Rep. 31 2020 107492 10.1016/j.celrep.2020.03.056
28 Stanley E.R. Chitu V. CSF-1 receptor signaling in myeloid cells Cold Spring Harbor Perspect. Biol. 6 2014 a021857 10.1101/cshperspect.a021857
29 Wu C. Jin X. Tsueng G. Afrasiabi C. Su A.I. BioGPS: building your own mash-up of gene annotations and expression profiles Nucleic Acids Res. 44 2016 D313 D316 10.1093/nar/gkv1104 26578587
30 Shimada T. Kawai T. Takeda K. Matsumoto M. Inoue J. Tatsumi Y. Kanamaru A. Akira S. IKK-i, a novel lipopolysaccharide-inducible kinase that is related to IkappaB kinases Int. Immunol. 11 1999 1357 1362 10.1093/intimm/11.8.1357 10421793
31 Ishikawa H. Ma Z. Barber G.N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity Nature 461 2009 788 792 10.1038/nature08476 19776740
32 Luo J. Cao Q. Zhang J. Jiang S. Xia N. Sun S. Zheng W. Chen N. Meurens F. Zhu J. Porcine IKKepsilon is involved in the STING induced type I IFN antiviral response of the cytosolic DNA signaling pathway J. Biol. Chem. 299 2023 105213 10.1016/j.jbc.2023.105213
33 Pang E.S. Daraj G. Balka K.R. De Nardo D. Macri C. Hochrein H. Masterman K.A. Tan P.S. Shoppee A. Magill Z. Discordance in STING-Induced Activation and Cell Death Between Mouse and Human Dendritic Cell Populations Front. Immunol. 13 2022 794776 10.3389/fimmu.2022.794776
34 Perry A.K. Chow E.K. Goodnough J.B. Yeh W.C. Cheng G. Differential requirement for TANK-binding kinase-1 in type I interferon responses to toll-like receptor activation and viral infection J. Exp. Med. 199 2004 1651 1658 10.1084/jem.20040528 15210743
35 Dalrymple N.A. Cimica V. Mackow E.R. Dengue Virus NS Proteins Inhibit RIG-I/MAVS Signaling by Blocking TBK1/IRF3 Phosphorylation: Dengue Virus Serotype 1 NS4A Is a Unique Interferon-Regulating Virulence Determinant mBio 6 2015 e00553-15 10.1128/mBio.00553-15
36 Wu X. Qi X. Qu B. Zhang Z. Liang M. Li C. Cardona C.J. Li D. Xing Z. Evasion of antiviral immunity through sequestering of TBK1/IKKepsilon/IRF3 into viral inclusion bodies J. Virol. 88 2014 3067 3076 10.1128/JVI.03510-13 24335286
37 Xia H. Cao Z. Xie X. Zhang X. Chen J.Y.C. Wang H. Menachery V.D. Rajsbaum R. Shi P.Y. Evasion of Type I Interferon by SARS-CoV-2 Cell Rep. 33 2020 108234 10.1016/j.celrep.2020.108234
38 Sui L. Zhao Y. Wang W. Wu P. Wang Z. Yu Y. Hou Z. Tan G. Liu Q. SARS-CoV-2 Membrane Protein Inhibits Type I Interferon Production Through Ubiquitin-Mediated Degradation of TBK1 Front. Immunol. 12 2021 662989 10.3389/fimmu.2021.662989
39 Jeremiah S.S. Miyakawa K. Matsunaga S. Nishi M. Kudoh A. Takaoka A. Sawasaki T. Ryo A. Cleavage of TANK-Binding Kinase 1 by HIV-1 Protease Triggers Viral Innate Immune Evasion Front. Microbiol. 12 2021 643407 10.3389/fmicb.2021.643407
40 Zheng Z. Wei C. Guan K. Yuan Y. Zhang Y. Ma S. Cao Y. Wang F. Zhong H. He X. Bacterial E3 Ubiquitin Ligase IpaH4.5 of Shigella flexneri Targets TBK1 To Dampen the Host Antibacterial Response J. Immunol. 196 2016 1199 1208 10.4049/jimmunol.1501045 26700764
41 Taft J. Markson M. Legarda D. Patel R. Chan M. Malle L. Richardson A. Gruber C. Martín-Fernández M. Mancini G.M.S. Human TBK1 deficiency leads to autoinflammation driven by TNF-induced cell death Cell 184 2021 4447 4463.e20 10.1016/j.cell.2021.07.026 34363755
42 Wegner J. Hunkler C. Ciupka K. Hartmann G. Schlee M. Increased IKKϵ protein stability ensures efficient type I interferon responses in conditions of TBK1 deficiency Front. Immunol. 14 2023 1073608 10.3389/fimmu.2023.1073608
43 Vila I.K. Chamma H. Steer A. Saccas M. Taffoni C. Turtoi E. Reinert L.S. Hussain S. Marines J. Jin L. STING orchestrates the crosstalk between polyunsaturated fatty acid metabolism and inflammatory responses Cell Metabol. 34 2022 125 139.e8 10.1016/j.cmet.2021.12.007
44 Akhmetova K. Balasov M. Chesnokov I. Drosophila STING protein has a role in lipid metabolism Elife 10 2021 e67358 10.7554/eLife.67358
45 Chiang S.H. Bazuine M. Lumeng C.N. Geletka L.M. Mowers J. White N.M. Ma J.T. Zhou J. Qi N. Westcott D. The protein kinase IKKepsilon regulates energy balance in obese mice Cell 138 2009 961 975 10.1016/j.cell.2009.06.046 19737522
46 Morehouse B.R. Govande A.A. Millman A. Keszei A.F.A. Lowey B. Ofir G. Shao S. Sorek R. Kranzusch P.J. STING cyclic dinucleotide sensing originated in bacteria Nature 586 2020 429 433 10.1038/s41586-020-2719-5 32877915
47 Patel D.J. Yu Y. Xie W. cGAMP-activated cGAS-STING signaling: its bacterial origins and evolutionary adaptation by metazoans Nat. Struct. Mol. Biol. 30 2023 245 260 10.1038/s41594-023-00933-9 36894694
48 Margolis S.R. Wilson S.C. Vance R.E. Evolutionary Origins of cGAS-STING Signaling Trends Immunol. 38 2017 733 743 10.1016/j.it.2017.03.004 28416447
49 Gui X. Yang H. Li T. Tan X. Shi P. Li M. Du F. Chen Z.J. Autophagy induction via STING trafficking is a primordial function of the cGAS pathway Nature 567 2019 262 266 10.1038/s41586-019-1006-9 30842662
50 Fischer T.D. Wang C. Padman B.S. Lazarou M. Youle R.J. STING induces LC3B lipidation onto single-membrane vesicles via the V-ATPase and ATG16L1-WD40 domain J. Cell Biol. 219 2020 e202009128 10.1083/jcb.202009128
51 Liu B. Carlson R.J. Pires I.S. Gentili M. Feng E. Hellier Q. Schwartz M.A. Blainey P.C. Irvine D.J. Hacohen N. Human STING is a proton channel Science 381 2023 508 514 10.1126/science.adf8974 37535724
52 Xu Y. Zhou P. Cheng S. Lu Q. Nowak K. Hopp A.K. Li L. Shi X. Zhou Z. Gao W. A Bacterial Effector Reveals the V-ATPase-ATG16L1 Axis that Initiates Xenophagy Cell 178 2019 552 566.e20 10.1016/j.cell.2019.06.007 31327526
53 Collins A.C. Cai H. Li T. Franco L.H. Li X.D. Nair V.R. Scharn C.R. Stamm C.E. Levine B. Chen Z.J. Shiloh M.U. Cyclic GMP-AMP Synthase Is an Innate Immune DNA Sensor for Mycobacterium tuberculosis Cell Host Microbe 17 2015 820 828 10.1016/j.chom.2015.05.005 26048137
54 Watson R.O. Bell S.L. MacDuff D.A. Kimmey J.M. Diner E.J. Olivas J. Vance R.E. Stallings C.L. Virgin H.W. Cox J.S. The Cytosolic Sensor cGAS Detects Mycobacterium tuberculosis DNA to Induce Type I Interferons and Activate Autophagy Cell Host Microbe 17 2015 811 819 10.1016/j.chom.2015.05.004 26048136
55 Liu Y. Gordesky-Gold B. Leney-Greene M. Weinbren N.L. Tudor M. Cherry S. Inflammation-Induced, STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain Cell Host Microbe 24 2018 57 68.e3 10.1016/j.chom.2018.05.022 29934091
56 De Nardo D. Kalvakolanu D.V. Latz E. Immortalization of Murine Bone Marrow-Derived Macrophages Methods Mol. Biol. 1784 2018 35 49 10.1007/978-1-4939-7837-3_4 29761386
57 Cardona Gloria Y. Latz E. De Nardo D. Generation of Innate Immune Reporter Cells Using Retroviral Transduction Methods Mol. Biol. 1714 2018 97 117 10.1007/978-1-4939-7519-8_7 29177858
58 De Nardo D. Balka K.R. Cardona Gloria Y. Rao V.R. Latz E. Masters S.L. Interleukin-1 receptor-associated kinase 4 (IRAK4) plays a dual role in myddosome formation and Toll-like receptor signaling J. Biol. Chem. 293 2018 15195 15207 10.1074/jbc.RA118.003314 30076215
59 Ullah T.R. Johansen M.D. Balka K.R. Ambrose R.L. Gearing L.J. Roest J. Vivian J.P. Sapkota S. Jayasekara W.S.N. Wenholz D.S. Pharmacological inhibition of TBK1/IKKepsilon blunts immunopathology in a murine model of SARS-CoV-2 infection Nat. Commun. 14 2023 5666 10.1038/s41467-023-41381-9 37723181
60 Labzin L.I. Schmidt S.V. Masters S.L. Beyer M. Krebs W. Klee K. Stahl R. Lütjohann D. Schultze J.L. Latz E. De Nardo D. ATF3 Is a Key Regulator of Macrophage IFN Responses J. Immunol. 195 2015 4446 4455 10.4049/jimmunol.1500204 26416280
61 Roberts Z.J. Goutagny N. Perera P.Y. Kato H. Kumar H. Kawai T. Akira S. Savan R. van Echo D. Fitzgerald K.A. The chemotherapeutic agent DMXAA potently and specifically activates the TBK1-IRF-3 signaling axis J. Exp. Med. 204 2007 1559 1569 10.1084/jem.20061845 17562815
