
==== Front
Discov Nano
Discov Nano
Discover Nano
2731-9229
Springer US New York

39256285
4095
10.1186/s11671-024-04095-5
Research
Theranostics: aptamer-assisted carbon nanotubes as MRI contrast and photothermal agent for breast cancer therapy
Khajuria Akhil 1
Alajangi Hema K. 12
Sharma Akanksha 12
Kaur Harinder 1
Sharma Prakriti 3
Negi Sushmita 3
Kumari Laxmi 1
Trivedi Manisha 4
Yadav Ashok Kumar 1
Kumar Robin 4
Raghuvanshi Rajeev Singh 4
Kaur Indu Pal 1
Tyagi Rajeev K. 3
Jaiswal Pradeep Kumar 5
Lim Yong-beom yblim@yonsei.ac.kr

6
Barnwal Ravi Pratap barnwal@pu.ac.in

2
Singh Gurpal gurpalsingh.ips@gmail.com

1
1 https://ror.org/04p2sbk06 grid.261674.0 0000 0001 2174 5640 University Institute of Pharmaceutical Sciences, Panjab University, Chandigarh, 160014 India
2 https://ror.org/04p2sbk06 grid.261674.0 0000 0001 2174 5640 Department of Biophysics, Panjab University, Chandigarh, 160014 India
3 grid.417641.1 0000 0004 0504 3165 Division of Cell Biology and Imunology, Biomedical Parasitology and Translational-Immunology Lab, CSIR-Institute of Microbial Technology (IMTECH), Chandigarh, 160036 India
4 grid.415820.a Indian Pharmacopoeia Commission, Ministry of Health and Family Welfare, Government of India, Ghaziabad, 201002 India
5 https://ror.org/01f5ytq51 grid.264756.4 0000 0004 4687 2082 Department of Biochemistry and Biophysics, Texas A & M University, College Station, TX 77843 USA
6 https://ror.org/01wjejq96 grid.15444.30 0000 0004 0470 5454 Department of Materials Science and Engineering, Yonsei University, Seoul, 03722 Korea
10 9 2024
10 9 2024
12 2024
19 1 14510 5 2024
24 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Breast cancer is one of the leading causes of death among women globally, making its diagnosis and treatment challenging. The use of nanotechnology for cancer diagnosis and treatment is an emerging area of research. To address this issue, multiwalled carbon nanotubes (MWCNTs) were ligand exchanged with butyric acid (BA) to gain hydrophilic character. The successful functionalization was confirmed by FTIR spectroscopy. Surface morphology changes were observed using SEM, while TEM confirmed the structural integrity of the MWCNTs after functionalization. Particle size, zeta potential, and UV spectroscopy were also performed to further characterize the nanoparticles. The breast cancer aptamer specific to Mucin-1 (MUC-1) was then conjugated with the functionalized MWCNTs. These MWCNTs successfully targeted breast cancer cells (MDA-MB-231) as examined by cellular uptake studies and exhibited a reduction in cancer-induced inflammation, as evidenced by gene transcription (qPCR) and protein expression (immunoblotting) levels. Immunoblot and confocal-based immunofluorescence assay (IFA) indicated the ability of CNTs to induce photothermal cell death of MDA-MB-231 cells. Upon imaging, cancer cells were effectively visualized due to the MWCNTs’ ability to act as magnetic resonance imaging (MRI) contrast agents. Additionally, MWCNTs demonstrated photothermal capabilities to eliminate bound cancer cells. Collectively, our findings pave the way for developing aptamer-labeled MWCNTs as viable “theranostic alternatives” for breast cancer treatment.

Graphical abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s11671-024-04095-5.

Highlights

Addressing breast cancer challenges by employing aptamer-labeled MWCNTs.

Functionalized MWCNTs, conjugated with MUC-1 aptamer, evaluated through diverse techniques.

Aptamer-labeled MWCNTs target, induce cell death, reduce inflammation, act as an MRI contrast agent.

Aptamer-MWCNTs are promising for targeted treatment and imaging for breast cancer.

Supplementary Information

The online version contains supplementary material available at 10.1186/s11671-024-04095-5.

Keywords

MWCNT
Aptamer
Breast cancer
Theranostics
Mucin
Nanotechnology
issue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2024
==== Body
pmcIntroduction

Breast cancer is one of the most prevalent malignant disease(s) among women with a high mortality rate globally. Three major subtypes of breast cancer based on molecular markers include erythroblastic oncogene B (ERBB2) negative/hormone receptor positive (ERBB2−/HR+), ERBB2 positive (ERBB2+), and triple negative [1] Cancer cells have prolonged and chronic proliferations without requiring any external stimuli for growth, whereas, the normal cells and tissues of the body have limited growth and regulation, thereby maintaining the structure and functional integrity of normal tissues. Moreover, inhibition of tumor suppressor genes also leads to enhanced and uncontrollable growth of cancerous cells [2]. There are numerous factors that aggravate the likelihood of breast cancer, for instance, injury to DNA, genetic alteration in the p53 gene, germline mutation in breast cancer gene 1 (BRCA1)/breast cancer gene 2 (BRCA2), excessive exposure of estrogen to estrogen receptors, and chromosomal shortening due to replicative senescence [3–5]. The immune system usually identifies cancer cells and cells with injured DNA and kills them. Malfunctioning of the immune system and inhibition of cellular apoptosis may promote rapid multiplication of these cells, ultimately leading to tumor formation [6]. The tumor cells obtain nutrients and oxygen by means of angiogenesis, breaking their boundaries and invading the bloodstream, lymphatic tissues, and other tissues to produce secondary tumor [7, 8].

In recent times, the detection and treatment of cancer has been facilitated by the new imaging techniques and the inspection of tissues (histopathology) or cells (cytology) at morphological level. These approaches contribute to rapid detection of malignancies. Various imaging modalities, including X-ray, magnetic resonance imaging (MRI), computed tomography (CT), endoscopy, and ultrasound, have the potential to identify the presence of cancer in cases when noticeable alterations occur inside the tissue [9, 10]. However, these techniques cannot differentiate between benign lesions and malignant lesions. The aforementioned techniques do not allow for the quantification of the precise tumor volume inside the designated region. Hence, the task of devising a method to detect malignant tumors in early stages poses an immense challenge. The timely detection of tumors is of paramount importance in the management of cancer [11].

Nanotheranostics involving the use of nanomaterial is gaining attention due to its properties that include targeted drug delivery, stimuli-response, and versatility. Carbon-based nanomaterials play a particularly important role in this context. Their exceptional surface functionalization prowess enables them to effectively transport drugs to specific locations [12]. Furthermore, carbon nanomaterials can be coupled with diverse imaging agents containing target moieties, thereby augmenting the detection of tumor cells. As a result, these procedures can be easily detected using bioimaging techniques that utilize carbon nanomaterials, leveraging their abundant optical characteristics such as near-infrared absorption, photoacoustic effects, and Raman scattering properties [12, 13].

It is important to note that theranostic capabilities can be enhanced through the apparent bioavailability facilitated by the functionalization of carbon nanomaterials [14]. Innovative surface modification strategies not only ensure the therapeutic agents' great efficacy due to their small size, but also reduce the drug-induced toxicity. This is because their compact size allows for a speedier dosage at the targeted area. Despite the existing concerns surrounding the safety of certain nanoparticles, it is apparent that the careful selection of their shape and composition has the potential to unveil novel theranostic opportunities [15]. Extensive efforts are now being made to develop nanotechnology-based technologies that exhibit optimized sensitivity and specificity, aiming to facilitate the precise and timely identification of cancer in its early stages. Various carbon-based nanomaterials, including carbon quantum dots (CQDs), carbon nanotubes (CNTs), and fullerene, have been employed in the field of cancer diagnostics [16–18]. Since the 1990s, CNTs have received significant attention due to their potential for developing novel nanomaterials suitable for theranostic applications, with a particular focus on cancer [19]. Multiple studies have thoroughly examined how CNTs can be used for developing sensors for tumour detection as well as for the delivery of drugs. Moreover, photothermal therapy (PTT) has garnered interest as a cutting-edge and effective anticancer therapy. The distinctive characteristics of nanostructured materials have led to the suggestion that PTTs assisted by nanomaterials represent cutting-edge therapeutic approaches. CNTs have demonstrated advantages over other forms of nanomaterials in this area, including excellent stability, low toxicity, permeability, and outstanding photothermal conversion efficiency [20].

In the current study, we have developed breast cancer-specific aptamer-conjugated MWCNTs as MRI contrast and photothermal agents for early-stage breast cancer diagnosis and treatment. MWCNTs were surface-modified with butyric acid for aqueous dispersibility. Comprehensive characterization was performed using various techniques. Further, the MUC1-specific aptamer was conjugated via EDC/NHS chemistry. Our results demonstrate high sensitivity and specificity for MDA-MB-231 cells, with anti-inflammatory properties confirmed through transcriptional and protein expression analyses. Efficient cancer cell targeting was observed microscopically, while MRI imaging revealed strong contrast abilities. This study highlights the potential of aptamer-conjugated MWCNTs as theranostic agents, offering both diagnostic and therapeutic capabilities for breast cancer management.

Materials and methods

The M.D. Anderson-Metastatic Breast 231 (MDA-MB-231) cell line, known for its tumorigenic, invasive, and metastatic properties, was obtained from National Centre for Cell Sciences (NCCS) in Pune, India. The aptamer (APT) targeting MDA-MB-231 was acquired from Eurofins Genomics India Pvt. Ltd. The compounds (1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide Hydrochloride) (EDC) and N-Hydroxysuccinimide (NHS) were acquired from TCI, Tokyo, Japan. Some chemicals were procured from Sisco Research Laboratories Pvt. Ltd, India: multiwalled carbon nanotubes type 3, N-methyl-2-pyrrolidone (NMP), aluminium chloride, dimethyl sulfoxide (DMSO), potassium dihydrogen phosphate, sodium chloride, acetone, succinic anhydride (SA), tris buffer, sodium hydroxide, ethanol, hydrochloric acid, and potassium hydrogen phosphate. The Dulbecco’s Modified Eagle Medium (DMEM) (Invitrogen, USA), fetal bovine serum (FBS), and agar were procured from HiMedia Laboratories, India. All the experiments involving cellular samples were conducted under relevant ethical guidelines and regulations.

Methods

Surface modification of multiwalled carbon nanotubes

The procured hydrophobic MWCNTs were surface modified to form water dispersible 1-butyric acid (BA)-functionalized multiwalled carbon nanotubes (MWCNTs-BA). For surface modification of MWCNTs, Succinic Anhydride (SA) was refluxed with AlCl3 in N-methyl-2-pyrrolidone (NMP) at approximately 90 °C in an inert atmosphere for 4 h. Moreover, MWCNTs were dispersed in anhydrous NMP, creating a suspension. Subsequently, the suspension of particles was gradually introduced into a solution consisting of SA, AlCl3, and NMP. The resulting reaction mixture was stirred at 150 °C for 48 h. Following the completion of the reaction, the mixture underwent decomposition through successive treatments with deionized (DI) water and 1 M hydrochloric acid (HCl). Consequently, the mixture was rinsed entirely with DI water until neutral pH was attained. Furthermore, the reaction mixture underwent filtration to get multi-walled carbon nanotubes functionalized with butyric acid (MWCNTs-BA). Next, the obtained MWCNTs-BA were subjected to vacuum drying for 12 h at 55 °C. These functionalized MWCNTs were stored at room temperature (RT) (25 °C) [21] until further usage.

Characterization of multi-wall carbon nanotubes

Fourier-transform infrared spectroscopy (FTIR)

The chemical composition of MWCNTs and MWCNTs functionalized with butyric acid (MWCNTs-BA) was analyzed using Fourier-transform infrared spectroscopy (FTIR). The spectra were obtained using the KBr pellet technique with a Spectrum 400 FT-IR/FIR Spectrometer (Perkin Elmer, USA) over the 400–4000 cm−1 wavelength range. The acquired spectra were analyzed to identify any notable alterations, as depicted in Fig. 1, to validate the adequate substitution of ligands on MWCNTs [22].Fig. 1 FTIR spectra of a MWCNTs and b MWCNTs-BA

Scanning electron microscopy (SEM)

Scanning electron microscopy (SEM) enables a more comprehensive examination of surface morphology and was employed to investigate the intricate features of MWCNTs and MWCNTs-BA. To perform SEM, lyophilized MWCNTs (1 mg) and MWCNTs-BA were mounted onto an adhesive stub (SEM stub) and subjected to gold–palladium coating under vacuum conditions using an ion coater. The samples underwent analysis, and the image was generated using JSM 6100 JEOL, Japan.

High-resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED)

The shape and size of the MWCNTs and MWCNTs-BA were verified at different magnifications by high-resolution transmission electron microscopy (HRTEM). The HRTEM analysis was conducted using a JEM-2100 electron microscope operating at an acceleration voltage of 200 kilovolts. Additionally, a transmission electron microscope (TEM) equipped with a LaB6 cathode and a digital camera from Gatan (SC1000 Orius) was utilized for the analysis. The samples for TEM were prepared by application of MWCNTs and MWCNTs-BA onto the carbon-coated copper grids. The grids were subsequently immersed in an aqueous dispersion of MWCNTs and MWCNTs-BA and dried at room temperature [23]. Moreover, to verify the crystalline structure of the MWCNTs and MWCNTs-BA, we performed selected area electron diffraction (SAED) in combination with high-resolution transmission electron microscopy (HRTEM). This involved employing a uniform electron beam directed at the sample and analyzing the diffraction pattern by measuring the peak widths perpendicular to the reciprocal lattice planes [24, 25].

Particle size analysis

Mastersizer 2000, a particle size analyzer from Malvern Panalytical Ltd., UK, was used to determine the mean diameter of MWCNTs and MWCNTs-BA. Our chosen method was laser diffraction, widely recognized for analyzing the particle size distribution of solid particles in suspensions or powders. Therefore, during the measurements, a laser beam passed through the diluted samples, and scattered light was collected at various angles, directly linked to particle size. We then applied a mathematical algorithm to the scattering pattern data, transforming it into a detailed particle size distribution, including the mean diameter. Our methodology, using laser diffraction with the Mastersizer 2000, yielded precise particle size information and provided valuable insights into MWCNTs and MWCNTs-BA characteristics [25, 26].

Zeta potential

The zeta potential of MWCNTs and MWCNTs-BA was measured following a suitable dilution (tenfold) using N-methyl-2-pyrrolidone (NMP) and phosphate-buffered saline (PBS) with Delsa™ Nano C Particle Analyser (Beckman Coulter, USA).

UV spectroscopy

Absorption spectra of MWCNTs-BA was obtained in the UV range 220–400 nm, after appropriate dilution with PBS using UV–VIS spectrophotometer 3000 + , Lab India Analytical Instruments Private Limited, Kolkata, India.

Activation of MWCNTs-BA

The APT specifically selected against MDA-MB-231 cells was coupled with MWCNTs-BA to facilitate the detection of breast cancer cells. MWCNTs-BA underwent activation using EDC/NHS. The activation of MWCNTs-BA was conducted by initially introducing EDC followed by NHS, while maintaining continuous stirring at ambient temperature for 30 min. Following this, the activated nanoparticles were held at a temperature of 4 °C until use for subsequent experiments [27, 28].

Bioconjugation of MWCNTs-BA with aptamer

Following the activation of MWCNTs-BA using EDC/NHS, APT was combined with the reactive intermediate (activated MWCNTs-BA) and subjected to continuous stirring at room temperature for 24 h. This process facilitated the creation of an amide bond between the NHS ester and the amino group present in the DNA oligonucleotides, ultimately forming the MWCNTs-BA-APT complex. After vortexing, the supernatant was separated from the sediment. The sediment i.e. MWCNTs-BA-APT was then re-dispersed in a Tris buffer solution, followed by triple washing to remove any remaining free APT. The APT-conjugated MWCNTs-BA, which had been purified, was then kept at a temperature of 4 °C until further use.

Confirmation of bioconjugation of MWCNTs-BA with APT

This was done to confirm whether the water-soluble MWCNTs-BA was conjugated with APT. Bioconjugation of APT with MWCNTs-BA containing –COOH functional groups were carried out by EDC/NHS as mentioned previously (Sect. 2.4). Since APT and MWCNTs-BA contain –NH2 and –COOH groups respectively, these were activated by EDC/NHS click chemistry. Hence, this bioconjugation process led to the formation of amide linkage which was confirmed by FTIR spectroscopy.

Fourier-transform infrared (FTIR) spectroscopy

Fourier-transform infrared (FTIR) spectra were obtained for both conjugated and unconjugated MWCNTs-BA. The purpose was to verify the presence of an amide bond resulting from the interaction between the amino group of the APT and the NHS carboxylate intermediate in the case of conjugated MWCNTs-BA or the presence of a coating layer composed of BA on the surface of the MWCNTs. The spectra acquired from conjugated and unconjugated MWCNTs were analyzed for potential alterations of significance, as illustrated in Fig. 1.

Cytotoxicity assay

The MDA-MB-231 breast cancer cells were cultivated in Dulbecco's Modified Eagle Medium (DMEM) supplemented with fetal bovine serum (FBS) and 1% streptomycin. The cells were then incubated at 37 °C with 5% carbon dioxide (CO2). In the experimental procedure, the cells were distributed onto 96-well plates at a density of 6 × 103 cells per well, followed by a 24-h incubation period. The culture media was also replaced with fresh media that included varying quantities of MWCNTs—butyric acid (BA) at 20, 40, 60, 80, and 100 μg/mL levels. This process was performed in triplicate for each well. Following a 5-h incubation period, the plates were retrieved from the incubator. Subsequently, cell viability was assessed using the 3-(4, 5-dimethylthiazol)-2-diphenyltetrazolium bromide (MTT) assay. The cytotoxicity was quantified by determining the percentage of cell viability relative to the untreated control cells [29].

Magnetic resonance imaging (MRI)

Preparation of phantom Agar gels for imaging

A 2.0% weight/volume (w/v) Agar solution was made by subjecting 400 mg of Agar to heating in 20 mL of phosphate-buffered saline (PBS) at a temperature of 80 °C for 20 min. To prepare phantom gels, 160 µL of the aforementioned Agar solution was thoroughly mixed with 840 µL of MWCNTs-BA and MWCNTs-BA-APT suspension for each concentration. This mixing process was performed at a temperature of 60 °C to prevent gelation, and the resulting mixture was then poured into 1.5 mL microcentrifuge tubes (MCTs). Subsequently, the tubes were allowed to cool at room temperature.

In each well of a six-well plate, 10 × 105 cells were seeded and allowed to proliferate for 24 h. The cells were subsequently cultured in DMEM supplemented with 10% FBS, penicillin (100 U ml−1), and streptomycin (100 μg ml−1) at a temperature of 37 °C. The DMEM included varying quantities (ranging from 20 to 100 µg/mL) of MWCNTs-BA-APT and MWCNTs-BA. Following a 6-h incubation period, the medium was subsequently extracted, and the cells were subjected to a thorough washing procedure employing phosphate-buffered saline (PBS) solution to eliminate any residual MWCNTs. The cells labeled with MWCNTs-BA-APT and MWCNTs-BA were detached from the well using trypsin/EDTA solution and collected using centrifugation at 1000 rpm for 1 min. The cells were suspended in PBS solution containing 1% paraformaldehyde and then incubated at 4 °C for 2 h. Then, the cells were transferred into MCTs, maintaining a consistent count of around 50,000 cells per tube for each concentration of MWCNTs-BA-APT and MWCNTs-BA. These samples were then subjected to MRI analysis utilizing the MAGNETOM Spectra, 3 T MRI Scanner manufactured by Siemens Healthcare Private Limited in Mumbai, India [30].

Photo-differential scanning calorimetry (photo-DSC)

The investigation of photo-to-thermal conversion in MWCNTs and MWCNTs-BA was conducted by employing a UV light source connected to the DSC through a bifurcated fiber optic light cable. During the process of photothermal analysis, a sample furnace was utilized to introduce an aluminium pan containing the powder sample. A reference furnace houses an aluminium pan containing no sample. The sample was subjected to photo-DSC measurements under isothermal circumstances at 37 °C. The measurements were conducted in an inert environment with a constant flow of nitrogen at a rate of approximately 20 ml/min. The thermal energy produced by the sample during a 2-min exposure to ultraviolet radiation was quantified. About 1 mg of MWCNTs was utilized for the photo-DSC studies [31].

Protein isolation and quantification

Each well was seeded with a concentration of 3 × 106 MDA-MB-231 cells. Following the application of MWCNTs-BA and MWCNTs-BA-APT, the cellular specimens were subjected to a delicate rinse using PBS (pH 7.4). Subsequently, the cells were carefully detached from the six-well plates. The harvested cells were then collected in MCTs with a volume of 1 mL and subjected to centrifugation at a speed of 1800 rpm for 10 min. Afterward, the supernatant was cautiously extracted, and  200 µL of RIPA buffer which consisted of 150 mM sodium chloride, 1.0% NP-40 or Triton-X 100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate, and 50 mM Tris (pH of 8.0) supplemented with 1X protease inhibitor was introduced. Later, the MCTs were preserved at a temperature of − 80 °C until they were utilized.

Western blot of proteins after treatment with MWCNTs-BA samples

Lysates of MDA-MB-231 cells were obtained. The cell lysate was combined with ice-cold RIPA buffer. Homogenization was performed for each sample, and 1µL of protease inhibitor was added. The cell lysate underwent centrifugation at 12,000 rpm for 15 min at a temperature of 4 °C. The supernatants were collected and the protein isolated from the cell lysate was kept at − 80 °C until it was ready for analysis. The protein concentration was determined using the Bicinchonic test, employing bovine serum albumin (BSA) as the reference standard. After 30 min incubation at 37 °C, optical density (O.D.) was checked at 660 nm and was compared with standards. The protein concentration was calculated from standard curve. The protein concentration was expressed in mg/ml or µg/ml. Samples were separated on 12.5% SDS-PAGE using Mini protein gel electrophoresis system (Bio-rad). Proteins were denatured by adding 2X laemmelli buffer and heated in water bath at 80 °C for 10 min. Denatured protein samples were loaded equally (40 µL) in each well of the gel and in one well protein ladder was loaded. For transfer, semidry method was used on the Polyvinylidene fluoride (PVDF) membrane transfer apparatus. The membrane was blocked using a 5% (w/v) BSA solution in TBST for 2 h at room temperature on a shaking incubator. Then, it was subjected to an overnight incubation at 4 °C with a primary antibody for specific proteins at a dilution of 1:1000 in a 2.5% (w/v) BSA solution. Similarly, an anti β-actin antibody was also incubated overnight at 4 °C at a dilution of 1:1000 in TBST containing 2.5% (w/v) BSA.

After five washes of 5 min each with 1X TBST, membrane was incubated with HRP labeled secondary antibody (1:1000) containing 2.5% (w/v) BSA for 2 h in shaker apparatus at RT. After 2 h, membrane was washed with 1X TBST for five min each and the step was repeated five times. The protein bands were visualized by enhanced chemiluminescence using ECL reagent (Bio-rad) and images were acquired via gel documentation system (ProteinSimple, San Jose, USA).

Relative mRNA expression by the quantitative RT-PCR (qRT-PCR)

The MDA-MB231 cell line was cultured in DMEM supplemented with 10% FBS, penicillin (100 U ml−1), and streptomycin (100 μg ml−1) at a temperature of 37 °C and was incubated in a carbon dioxide (CO2) incubator. The MDA-MB231 cells were subjected to differentiation and afterward cultured in 12-well tissue culture plates for 24 h. These cells were then stimulated with 1 µg/ml of LPS, followed by treatment with MWCNTs-BA-APT and MWCNTs-BA (100 µg/ml) for 24 h. Upon incubation, media was aspirated and 1 ml of 0.5 M EDTA was used to detach cells, followed by 15 min incubation and centrifuged at 1700 rpm for 10 min. Supernatant was discarded and washed twice with PBS, and total RNA was isolated using RNeasy Mini Kit, Qiagen (Cat. No 74104) from LPS stimulated and un-stimulated MDA-MB-231 cells and quantified RNA was converted into cDNA to carry out qRT-PCR using iScript cDNA kit, Biorad, USA (Cat no: 1708891). The information about the primer sequences for all genes has been given in Table 1. The mRNA expression was quantified by the changes in threshold method (ΔΔCT) and normalized to the house keeping ACTB mRNA (encoding β actin) expression.Table 1 Primer sequences for gene expression quantified by qRT-PCR

S. No	Gene	Forward (5′-3′) primer	Reverse (5′-3′) primer	
1	CAS3	CATGGAAGCGAATCAATGGACT	CTGTACCAGACCGAGATGTCA	
2	CAS8	TGGTCTGAAGGCTGGTTGTT	AAGTGACCAACTCAAGGGCT	
3	CAS9	GGACATGCTGGCTTCGTTTC	GGTCTTTCTGCTCGACATC	
4	AKT	TCTATGGCGCTGAGATTGTG	CTTAATGTGCCCGTCCTTGT	
5	NFKβ	TGAGTCCTGCTCCTTCCA	GCTTCGGTGTAGCCCATT	
6	BCL	GTAAACTGGGGTCGCATTGT	TGGATCCAAGGCTCTAGGTG	
7	CD40	CAGCCAGGACAGAAACTGGTGAGT	CTTCTTCACAGGTGCAGATGGTGTC	
8	BIM	GGCCCCTACCTCCCTACA	GGGGTTTGTGTTGATTTGTCA	
9	BAK	TTTTCCGCAGCTACGTTTTT	GGTGGCAATCTTGGTGAAGT	
10	IL-6	AGCCACTCACCTCTTCAGAAC	GCCTCTTTGCTGCTTTCACAC	
11	GAPDH	TGCACCACCAACTGCTTAGC	GGCATGGACTGTGGTCATGAG	

Confocal microscopy-based immunofluorescence assay (IFA)

After being adhered to a 12 mm coverslip for three hours, the differentiated MDA-MB-231 cells were stimulated with LPS (1 ug/ml) for 24 h. The cells were then treated with MWCNTs-BA-APT and MWCNT-BA (100 µg/ml) for another 24 h. The malignant cell formulations were subjected to fixation using a 4% paraformaldehyde (PFA) solution for 5 min, after which permeabilization was carried out using 0.1% Triton X-100 solution for 5 min. After blocking non-specific antibody binding with BSA (3%) for 1 h at room temperature, cells were treated with primary antibody (anti-FOXO1 and anti-Bim antibody; 1: 1000 dilutions) or isotype control antibody (1:500 dilutions) for 1 h at room temperature. The cells previously washed with PBS were subsequently subjected to incubation with a secondary antibody, specifically Alexa Fluor 568-conjugated goat anti-rabbit IgG, at a dilution of 1:1000. This incubation was carried out for 1 h at room temperature. In addition, the cells were subjected to staining using a nucleus-specific dye called DAPI. Subsequently, the stained cells were carefully placed on coverslips coated with a slow fade mounting medium from Thermo Fisher Scientific, USA. Finally, microphotographs of the stained cells were captured using a NIKON A1R Laser scanning confocal microscope.

Results

Surface modification of multiwalled carbon nanotubes (MWCNTs)

The surface functionalization of MWCNTs using butyric acid (BA) results in the covalent bonding of BA groups onto the MWCNTs surface. This technique ultimately leads to the synthesis of MWCNTs capable of being dispersed in water. The functionalization of MWCNTs with BA is shown in Fig. 1b. Functionalization of MWCNTs with BA containing the –COOH group facilitates the formation of the –CONH bond of MWCNTs-BA with the APT which promotes active targeting of breast cancer.

Characterization of MWCNTs-BA

Fourier-transform infrared spectroscopy (FTIR)

FTIR spectroscopy was used to characterize various functional groups present on the surface of MWCNTs. Figure 1a and b depict the IR spectra of MWCNTs and MWCNTs-BA, respectively. As shown in Fig. 1a, the FTIR spectra exhibit the clear presence of benzenoid and quinoid ring vibrations at 1500 cm−1 and 1600 cm−1, respectively. Additionally, the sharp peak at 1629 cm−1 also assigns to carbonyl of quinone type units along the side walls of the MWCNTs [32]. For MWCNTs-BA, the C=O stretching peak was observed at 1599.45 cm−1, and O–H stretching and bending vibrations were observed at 3429.02 cm−1 and 1405.66 cm−1, respectively. The peaks at 1459.38 cm−1 and 2930.17 cm−1 represent C-H bending vibrations, while the one at 1182.41 cm−1 represents a strong C–OH stretch. These vibrations confirm the attachment of the butyric acid group onto the sidewalls of MWCNTs [33, 34].

Scanning electron microscopy (SEM)

The surface morphology of MWCNTs and MWCNTs-BA exhibits distinct characteristics. The MWCNTs display a smooth and regular surface, while the MWCNTs-BA showed a comparably rough and irregular surface. This difference can be attributed to the butyric acid moiety on the surface, as depicted in Figure S1a and b of the Supplementary Information (SI).

High-resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED)

MWCNTs (Fig. 2a) and MWCNTs-BA (Fig. 2b) as depicted by the HRTEM images are cylindrical and hollow structures of CNTs, which necessarily highlight that the structure of the CNTs remains intact and unaffected by the Friedel–Craft reaction.Fig. 2 a HRTEM images of MWCNTs b HRTEM images of MWCNTs-BA

SAED is about 100 times more sensitive than XRD in elucidating crystal structure details. The crystal structure of MWCNTs (Figure S2a) and MWCNTs-BA (Figure S2b) was confirmed by selected area electron diffraction, which showed the presence of electrons in the concentric diffraction rings.

Particle size analysis and zeta potential

Figure S3a and b depict the adequate size and the size distribution of MWCNTs and MWCNTS-BA (Mastersizer 2000). The results demonstrated that the average particle size of MWCNTs is 5.754 µm and for MWCNTs-BA is 5.012 µm. The zeta potential of MWCNTs and MWCNTs-BA was observed to be + 0.98 mV and + 0.39 mV, respectively (Figure S4a & b). Slight difference was observed in the zeta potential values of MWCNTs, MWCNTs-BA and aptamer conjugated MWCNTs-BA (Figure S7). This positive charge prevents agglomeration and improves stability.

UV spectroscopy

The UV spectrum of MWCNTs-BA reveals broad absorption peaks at 232 nm, identified as signatures of π-plasmons in the system resulting from the collective excitations of π-band electrons. This absorption is attributed to the transition of carbon–carbon double bonds (C=C) within the graphene walls from π to π* states. In contrast, charge carrier plasmons originate from the behavior of free electrons within the system. This phenomenon, known as π-plasmons, is commonly referred to as interband plasmons in research. This observation, depicted in Figure S5, suggests the water solubility of MWCNTs-BA. The modification process involves succinic anhydride, which facilitates a Friedel–Crafts oxidative reaction on the MWCNTs, introducing hydrophilic groups.

Notably, π-plasmons have been observed in graphite, graphene, and SWCNTs, all of which are sp2 hybridized carbon-based systems. The observed absorption peak in the range of 250–400 nm suggests that the investigated MWCNTs-BA can exhibit a photothermal response [35, 36].

Confirmation of bioconjugation of MWCNTs-BA with APT

Confirmation of the presence of an amide bond resulting from the interaction between the amino group of the APT and the NHS carboxylate intermediate (MWCNTs-BA) was achieved by analyzing the FTIR spectra. FTIR spectra of APT-conjugated MWCNTs-BA (Figure S6) differed notably from MWCNTs-BA (Fig. 1b), revealing N–H stretching vibrations at 3340.66 cm−1 and C=O stretching vibrations at 1629.76 cm−1. These observations confirm the presence of aliphatic primary amines and the formation of an amide bond, elucidating chemical interactions in MWCNTs-BA-APT conjugates.

Cytotoxicity assay

Cell viability of MDA-MB-231 cells exposed to various concentrations of MWCNTs-BA for 24 h was assessed using the MTT assay (Fig. 3a). Results in Fig. 3b revealed a broad range of cell viability from 1 µg/mL (control) to 100 µg/mL, indicating potential toxicity of MWCNTs-BA at increasing doses compared to untreated cells (Figure S8). Additionaly, we performed a biocompatibility assessment for up to 72 h with healthy cells (L929) that do not express Mucin-1 receptor. Along with aggregations, significant cell viability was noted in Figure S9.Fig. 3 a % Cell viability of MDA-MB-231 cells over different range of concentrations of MWCNTs-BA b Microscopic images of MDA-MB-231 cells post 24 h treatment with MWCNTs-BA over different concentrations

Magnetic resonance imaging (MRI)

In Fig. 4, MWCNTs-BA treated cells maintained regular morphology (Fig. 4a), whereas MWCNTs-BA-APT at 100 µg/ml caused stress and distorted morphology in MDA-MB-231 cells after 6 h (Fig. 4b), confirming efficient targeting of MDA-MB-231 cells by MWCNTs-BA-APT. Additionally, Fig. 4c depicted enhanced contrast ability at a constant 5 µM APT concentration, with the signal increasing as the concentration of MWCNTs-BA was raised from 20 to 60 µg/mL and 100 µg/mL Furthermore, MUCIN 1 specific APT-conjugated MWCNTs-BA efficiently targeted MDA-MB-231 cells at 20 µg/mL, the lowest detectable concentration. Microscopic images further confirmed the successful targeting of aptamer-conjugated MWCNTs-BA with MUCIN 1 receptor-expressing in breast cancer cells.Fig. 4 a Microscopic Images of MDA-MB-231 cells post 6 h treatment with unconjugated MWCNTs-BA at various concentrations b Microscopic Images of MDA-MB-231 cells post 6 h treatment with APT-conjugated MWCNTs-BA at different concentrations. c MRI contrast image of MWCNTs-BA-APT at concentrations of 20 µg/mL, 40 µg/mL, 60 µg/mL, 80 µg/mL and 100 µg/mL

Photo-differential scanning calorimeter (photo-DSC)

This study investigated the photo-to-thermal conversion in MWCNTs and MWCNTs-BA under UV–visible light. Samples were exposed to light intensities (12.5–62.5 mW/cm2) for 2 min at approximately 37 °C. Photo-DSC data for MWCNTs is shown in Fig. 5, indicating heat generation upon UV light activation. Maximum heat output was approximately 19.91W/g at the highest irradiation intensity.Fig. 5 a Photo-DSC data of MWCNTs corresponding to the different light intensities; the legend of the graph indicates the light intensities in units of mW/cm2 b Photo-DSC data of MWCNTs-BA corresponding to the different light intensities; the legend of the graph indicates the light intensities in units of mW/cm2

Gene transcription profiling of the inflammatory and cell death mediators in the aptamer treated breast cancer cells

We next decided to assess the effect of MWCNTs-BA and MWCNTs-BA-APT on the transcriptional pattern of apoptotic and inflammatory immune makers (caspase-3, 8, 9, Akt1, NF-kβ, BCl, CD40, Bim, Bak, IL-6) in the breast cancer cells (MDA-MB231) (Fig. 8). We observed reduced expression of caspase-3 and 8 in the breast cancer cells treated with MWCNTs-BA-APT compared to that with MWCNTs-BA treatment (Fig. 8). Whereas Caspase-9 expression was observed to increase upon treatment with MWCNTs-BA. The transcriptional regulation of these apoptotic markers, however, did not reach the statistical significance. Furthermore, we observed a significant reduction in the expression of active (rel) nuclear factor (NF-kβ) expression controlled by PI3K-Akt pathway in the MWCNTs-BA treated MDA-MB231 cells as compared to that seen with the MWCNTs-BA-APT treatment (Fig. 2) confirmed the death of breast cancer cells programmed by the carbon nanotubes. The MWCNTs-BA treated cells exhibited reduced expression of BCL-2, a regulator of cell death, as compared to the MWCNTs-BA-APT treatment (Fig. 8). More interestingly, the co-stimulatory markers (CD40) that regulate the apoptosis of cancerous cells as well as pro-apoptotic gene Bak was seen to reduce with the MWCNTS-BA-APT and MWCNTS-BA treated MDA-MB231. The pro-apoptotic proteins (Bim and Bak) showed mixed results in MDA-MB231 cells but could not reach statistical significance when treated with our formulation. As cell death and inflammation are interlinked, we assessed the relative mRNA expression of the pro-inflammatory marker IL-6 in the MDA-MB231 cells receiving treatment with our formulations (Fig. 6). We observed a reduction in the levels of IL-6 in MDA-MB231 cells treated with our formulation as compared to untreated control.Fig. 6 The relative mRNA (fold change regulation) levels of the inflammatory (NF-kβ, IL-6), signaling (CD40, Akt) and pro-apoptotic (Caspase-3, 8 & 9, Bim, Bak, BcL) mediators following the treatment of MDA-MB231 cells with APT-MWCNTs-BA and MWCNTs-BA for 24 h hr. (*p < 0.05 (significant), ****p < 0.001 (highly significant)

Protein expression of cell death and metabolic enzyme

Based on our gene transcription profiling, we next determined the expression of metabolic (IDO-1), costimulatory (CD40) and cell death (p65, Bim, Caspase-3) markers at varying aptamer (10, 25, 50 µg/ml) concentrations conjugated with MWCNTs. The immunoblot analysis showed higher expression of CD40 at both 10 and 20 µg/ml aptamer conjugated MWCNT-BA formulations in MDA-MB231 cells compared to untreated control. The pro-apoptotic caspase-3 exhibited increased expression at both 10 and 20 µg/ml aptamer concentration. Total lysis of cells was observed at the 50 µg/ml aptamer conjugated formulations. The p65 subunit (Rel-A) of NF-kβ is the critical regulator of immune and inflammatory response. The lower expression of p65 at all the aptamer concentrations suggests that our formulations control inflammation mounted during breast cancer pathogenesis. The metabolic enzyme indolamine 2, 3 dioxygenase (IDO) is a crucial marker for the generation of inducible regulatory T cells (iTregs). Our findings indicate that our formulation suppresses the IDO production, hence minimizing immunosuppression. In the end, we observed a faint band of pro-apoptotic protein (Bim) due to the lyses of cells at higher aptamer concentration (Fig. 7).Fig. 7 The immunoblot analysis of the metabolic (IDO-1), costimulatory (CD40) and cell death (p65, Bim, Caspase-3) markers at varying aptamer (10, 25, 50 µg/ml) concentrations conjugated with MWCNTs. The CNT formulations treated cells were lysed and proteins were detected by immunoblotting. β-actin served as a loading control. This data represents three independent experiments (n = 3)

Immunofluorescence assay to detect expression of apoptotic markers (FOXO1 & Bim) using confocal microscopy

The overexpression of CD40 tightly controls the PI3-Akt signaling pathway in MDA-MB231 cells. This pathway controls the transcription factor FOXO1 when phosphorylated and the pro-apoptotic factor Bim. We used confocal microscopy to examine how much FOXO1 and Bim were expressed in MDA-MB231 cells treated with MWCNTs-BA after being activated with LPS. Figure 8A and C show that LPS-stimulated and unstimulated cells express FOXO1 and Bim (Fig. 8B, D) differently. This difference was seen after 1 h of LPS stimulation. The fluorescence intensity of FOXO1 (Fig. 8A, C) and Bim (Fig. 8B, D) cells in various regions was also measured. FOXO1 and Bim expression differed between our study's stimulated experimental group and the unstimulated control group.Fig. 8 Confocal microscopy-based Immunofluorescence assay for qualitative detection of the PI3-AKT pathways regulated qualitative (A) and quantitative (C) expression of FOXO1 and (B) & (D) Bim in LPS stimulated MDA-MB231. The quantification of the intensity of fluorescence of cells counted in different (15 fields/view area) fields for (C) FOXO1 and (D) Bim. The amenable difference was seen in both FOXO 1and Bim in the MDA-MB231 stimulated cells compared to unstimulated control (n = 2). (*p < 0.05 (significant), **p < 0.01 (moderately significant) and ***p < 0.001 (highly significant)

Discussion

The current study extensively characterizes the physicochemical properties and biological activities of MWCNTs-BA, demonstrating their potential as versatile nanoplatforms for combined photothermal therapy and regulation of apoptotic signaling in breast cancer cells. The FTIR spectroscopy results provide compelling evidence for the successful functionalization of MWCNTs with butyric acid (BA). The pristine MWCNTs (Fig. 1a) exhibit characteristic peaks at 1500 cm−1 and 1600 cm−1, indicative of benzenoid and quinoid ring structures, respectively, along with a sharp peak at 1629 cm−1 attributed to carbonyl groups in quinone-type units on the MWCNT sidewalls. Upon functionalization with butyric acid (Fig. 1b), several new peaks emerge, confirming the attachment of BA to the MWCNT surface. These include the C=O stretching peak at 1599.45 cm−1, O–H vibrations at 3429.02 cm−1 (stretching) and 1405.66 cm−1 (bending), C–H vibrations at 1459.38 cm−1 and 2930.17 cm−1, and a strong C–OH stretch at 1182.41 cm−1. These spectral changes collectively demonstrate the successful formation of MWCNTs-BA, which altered the surface properties of the nanotubes, potentially enhancing their dispersibility and compatibility in water for advanced applications. [33]. The characteristic vibration peaks corresponding to C=O, O–H, C–H, and C–OH moieties confirmed the introduction of the –COOH functional groups, laying the foundation for further investigations into how these modifications influence the physicochemical properties and biological activities of the nanosystems [21]. Further, SEM and HRTEM provided crucial insights into the morphological characteristics of the MWCNTs-BA. Our finding revealed that incorporating butyric acid imparts roughness to the nanotube surfaces while maintaining their intrinsic hollow cylindrical nanoarchitecture. This has also been corroborated via another study whereby the introduction of butyric acid imparted irregularity to the MWCNTs surface [21]. The retention of morphology is essential to ensure their sustained capability to interact with UV light and transduce photothermal effects, a key feature for their application in photothermal therapy [37, 38]. Additionally, SAED studies further verified that the crystallinity of the MWCNTs was retained through the covalent modification strategy. This finding confirmed that optical properties required to facilitate photothermal applications remained intact, ensuring the sustained efficacy of nanotubes for theranostic approach.

The zeta potential analysis of the functionalized MWCNTs-BA revealed a positive surface charge arising from the covalent conjugation of butyric acid groups. Here, the zeta potential (0.39 mV) might be attributed to colloidal stability due to steric repulsion [39, 57]. This provides essential insights for improving the dispersion strategies employed during the fabrication of MWCNTs-BA. This thus confirms the essentiality of the colloidal stability for preventing aggregation during storage and administration, which could otherwise compromise the bioavailability and therapeutic efficacy of MWCNTs-BA. Our work demonstrates the relationship between surface charge, electrokinetic properties, and colloidal stability, which are significant for developing robust formulation and delivery approaches to maintain the intended physicochemical and biological performance of MWCNTs-BA for their targeted applications in developing therapeutic interventions against breast cancer [40].

Interestingly, UV–Vis absorption spectroscopy findings confirmed the presence of characteristic π-plasmon peaks, indicating that these nanoconstructs possess an inherent photothermal transduction capability [35]. This observation prompted in-depth investigations using photo-differential scanning calorimetry to empirically quantify heat generation as a function of light irradiation intensity. The light-responsive photothermal profiles uncovered through these MWCNTs suspension studies provide key parameters, including the intensity thresholds and kinetics of thermal response, that shall open avenues for future optimization of irradiation parameters to achieve controlled hyperthermia-mediated ablation of tumor tissues in vivo. The photothermal conversion capabilities of MWCNTs-BA may present a viable approach for the treatment of breast cancer. By leveraging the strong optical absorption of MWCNTs-BA in the UV region, these nanomaterials can effectively convert the energy from UV irradiation into localized heat. When specifically targeted to breast cancer cells, the heat generated by the photo-excited MWCNTs-BA can selectively ablate the malignant cells through hyperthermia-induced apoptosis or necrosis. This targeted photothermal therapy approach, facilitated by the exceptional photo-to-thermal conversion efficiency of MWCNTs enables the latter to be minimally invasive,facilitate localized treatment of breast cancer, and mitigate collateral damage to surrounding healthy tissue [41].

Like earlier investigations [42, 43], we attested the site-specific molecular targeting of breast cancer cells through MRI and using the MDA-MB-231 cell line. MRI experiments revealed a clear dose-dependent enhancement in contrast signal in the presence of aptamer-conjugated nanotubes. Also, this confirmed successful binding and subsequent cellular internalization, exhibiting specificity toward malignant MDA-MB-231 cell line. Further microscopy studies provided validation, showing distorted morphology and signs of stress in the receptor-targeted breast cancer cell populations as compared to the controls (Fig. 3) [44]. Our observation of the target-specific delivery opened new avenues to explore the cellular responses. Collectively, the comprehensive characterization of the MWCNTs-BA provided pivotal insights into the underlying mechanisms that support both the inherent physicochemical properties of these nanosystems and their targeted interactions with signaling pathways that regulate cell death. The successful covalent functionalization of the carbon nanotubes with butyric acid moieties has been demonstrated, and the preservation of key morphological, crystallographic, and optical properties has been confirmed [37]. Importantly, the understanding of the surface charge characteristics and their influence on colloidal stability [39] lays the groundwork for the development of optimized synthetic protocols and administration strategies to ensure the therapeutic applicability of these nanoplatforms for breast cancer. Furthermore, the quantification of the photothermal response properties provides critical insights and parameters for the future optimization of irradiation conditions to achieve targeted hyperthermia-mediated ablation of tumour cells with minimal adverse effects on the healthy cells [45]. These comprehensive characterization efforts have significantly advanced the understanding of the structure–property–function relationships of the MWCNTs-BA, paving the way for their translation as a promising multifunctional nanoplatform for combined photothermal therapy that could regulate the apoptotic signalling during breast cancer treatment.

Also, we explored the intricate relationship between the MWCNTs formulations [46] and the intricate cellular pathways that regulate inflammation and apoptosis in MDA-MB-231 breast cancer by the transcriptional [47, 48] regulation and protein expression [49] profiles. Intriguingly, treatment with the MWCNTs-BA-APT formulation led to reduced expression of the apoptosis initiator caspases-3 and -8, while the non-targeted MWCNTs-BA elevated the executioner caspase-9 albeit without statistical significance. A pivotal discovery was the significant downregulation of the active nuclear form of NF-kβ, a critical transcription factor that regulates the PI3K-Akt pathway, in MWCNTs-BA-treated cells [50], suggesting potent induction of programmed cell death by the MWCNTs-BA-APT. Concordantly, the anti-apoptotic BCL-2 exhibited diminished expression with MWCNTs-BA versus MWCNTs-BA-APT. Interestingly, both formulations reduced levels of the co-stimulatory CD40 receptor and pro-apoptotic Bak, suggesting complicated immune modulation of apoptotic signaling cascades [51, 52].

Evaluating inflammatory markers revealed attenuated expression of the pro-inflammatory cytokine and IL-6 in nanoformulation-treated cells compared to untreated controls, underscoring their ability to regulate cancer-associated inflammation [53, 54]. Dose-dependent studies unveiled elevated CD40 and caspase-3 at 10 and 25 μg/ml aptamer, suggestive of amplified apoptotic signaling, while complete cancer cell lysis occurred at 50 μg/ml. Notably, the p65 subunit of NF-kβ, a master regulator of inflammation, showed diminished expression across all aptamer concentrations, substantiating the formulations' anti-inflammatory potential [54]. In addition, suppression of the immunosuppressive metabolic enzyme IDO suggested alleviation of tumor-mediated immune evasion [55, 56]. Complementing these molecular analyses, confocal microscopy demonstrated differential expression of pro-apoptotic FOXO1 and Bim in LPS-stimulated versus unstimulated MWCNTs-BA-treated MDA-MB-231 cells, highlighting modulation of the delicate pro-survival and cell-death immunological signaling balance controlled by the PI3K-Akt. Overall, our findings highlight the sophistication with which the carbon nanotube-based nanoplatforms orchestrate the intricate interplay between apoptosis and inflammation in breast cancer cells, paving the way for novel therapeutic alternatives.

Conclusion

Diagnostic and therapeutic approaches to managing breast cancer suffer from limitations. To address this issue, the current study devised a sensitive and specific nanotechnology-based tool with immense potential for early-stage detection and management of breast cancer. This involves the development of 1-butyric acid-functionalized multi-walled carbon nanotubes (MWCNTs-BA).

Surface modification led to efficient conjugation of MWCNTs-BA with MUC1 specific APT. Further characterization of the functionalized MWCNTs revealed morphological features including crystalline nature and the presence of diffraction rings, which are indicative of presence of electrons. π plasmons present in MWCNTs-BA may possess potential photothermal properties crucial for targeting breast cancer.

MWCNTs-BA conjugated with MUC-1 specific APT could efficiently detect and target MDA-MB-231 cancer cells and exhibit high sensitivity and selectivity. MRI contrast images of MWCNTs-BA-APT further confirmed the contrasting ability of the conjugated MWCNTs-BA. Our transcription and protein level expression data support the anti-inflammatory and pro-apoptotic potential of these aptamer conjugated MWCNTs. These nanotubes could be  a viable therapeutic alternative for diagnosis of breast cancer.

The APT conjugated multiwall carbon nanotubes prepared in the current study can serve as potent photothermal agents and also possess excellent MRI contrast ability. This further highlights their role for breast cancer diagnosis and management. Similar approach can be developed for other types of cancer.

Supplementary Information

Supplementary file1

Acknowledgements

GS and RPB acknowledge the financial supports from UGC-Faculty recharge program and ICMR-DHR International Fellowship for Senior Scientists (2023-24), DST UT (S&T&RE/RP/147(19-20/Sanc/10/2019/1703-1710), DBT (BT/PR27444/BRB/10/1645/2018), DST (DST/CSRI/2021/7), DST-SERB (CRG/2022/000628), ICMR (17X(3)/Ad-hoc/69/2022-ITR), CSIR (37/1743/23/EMR-II) and ICMR (35/2/2020-Nano/BMS), Government of India. HKA and AS acknowledge DHR, Government of India (YSS/2020/000047/PRCYSS) and ICMR, Government of India (HIV/STI/18/02/2022-ECD-II), respectively for the financial support. The cell culture facility at UIPS, Panjab University is duly acknowledged. We also acknowledge Dr. Khandelwal and his lab at Sector 11, Chandigarh India for the generous support in acquiring MRI data.

Author contributions

AK: Data curation, Formal analysis, Methodology, Investigation, Software, Validation, Visualization, Writing-original draft. HKA: Data curation, Formal analysis, Investigation, Validation, Visualization, Writing-original draft. AS: Data curation, Formal analysis, Methodology, Investigation, Software, Validation, Visualization, Writing-review and editing. HK: Data curation, Formal analysis, Methodology, Investigation. PS: Data curation, Formal analysis, Methodology, Investigation. SN: Data curation, Formal analysis, Methodology, Investigation. LK: Data curation, Methodology, Visualization. MT: Data curation, Methodology, Visualization. AKY: Data curation, Methodology, Supervision. RK: Data curation, Methodology, Visualization, Supervision. RSR: Data curation, Methodology, Visualization, Supervision. IPK: Formal analysis, Methodology, Investigation. RKT: Data curation, Formal analysis, Methodology, Investigation, Writing-original draft. PKJ: Data curation, Formal analysis, Methodology, Investigation, Writing-original draft. YbL: Conceptualization, Methodology, Software, Writing-review and editing, Supervision, Project administration, Funding acquisition. RPB: Conceptualization, Methodology, Software, Resources, Investigation, Writing-review and editing, Supervision, Project administration, Funding acquisition, Visualization. GS: Conceptualization, Methodology, Software, Resources, Investigation, Writing-review and editing, Supervision, Project administration, Funding acquisition, Visualization. All authors read and approved the manuscript for publication.

Funding

UGC, New Delhi, India, under Faculty Recharge Program, ICMR-DHR International Fellowship for Senior Scientists (2023–24), DST UT (S&T&RE/RP/147(19–20/Sanc/10/2019/1703–1710), DST (DST/CSRI/2021/7), DST-SERB (CRG/2022/000628), DBT (BT/PR27444/BRB/10/1645/2018), ICMR (17X(3)/Ad-hoc/69/2022-ITR), CSIR (37/1743/23/EMR-II) and ICMR (35/2/2020-Nano/BMS), Government of India.

Data availability

The data in current study are available from the corresponding author on request.

Code availability

Not applicable.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors read and approved the final manuscript.

Code availability

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Akhil Khajuria, Hema K. Alajangi and Akanksha Sharma contributed equally to this work.
==== Refs
References

1. Waks AG Winer EP Breast cancer treatment: a review JAMA J Am Med Assoc 2019 10.1001/jama.2018.19323
Waks AG, Winer EP. Breast cancer treatment: a review. JAMA J Am Med Assoc. 2019. 10.1001/jama.2018.19323.10.1001/jama.2018.19323
2. Grana X, Reddy EP. Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs). Oncogene. 1995
3. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation—PIIS0092867411001279.Pdf. Cell. 2011.
4. Dall GV Britt KL Estrogen effects on the mammary gland in early and late life and breast cancer risk Front Oncol 2017 10.3389/fonc.2017.00110 28603694
Dall GV, Britt KL. Estrogen effects on the mammary gland in early and late life and breast cancer risk. Front Oncol. 2017. 10.3389/fonc.2017.00110.28603694 10.3389/fonc.2017.00110
5. Trybek T Kowalik A Góźdź S Kowalska A Telomeres and telomerase in oncogenesis (review) Oncol Lett 2020 10.3892/ol.2020.11659 32724340
Trybek T, Kowalik A, Góźdź S, Kowalska A. Telomeres and telomerase in oncogenesis (review). Oncol Lett. 2020. 10.3892/ol.2020.11659.32724340 10.3892/ol.2020.11659
6. Gonzalez H Hagerling C Werb Z Roles of the immune system in cancer: from tumor initiation to metastatic progression Genes Dev 2018 10.1101/GAD.314617.118 30275043
Gonzalez H, Hagerling C, Werb Z. Roles of the immune system in cancer: from tumor initiation to metastatic progression. Genes Dev. 2018. 10.1101/GAD.314617.118.30275043 10.1101/GAD.314617.118
7. Fraisl P Mazzone M Schmidt T Carmeliet P Regulation of angiogenesis by oxygen and metabolism Dev Cell 2009 10.1016/j.devcel.2009.01.003 19217420
Fraisl P, Mazzone M, Schmidt T, Carmeliet P. Regulation of angiogenesis by oxygen and metabolism. Dev Cell. 2009. 10.1016/j.devcel.2009.01.003.19217420 10.1016/j.devcel.2009.01.003
8. Akram M Iqbal M Daniyal M Khan AU Awareness and current knowledge of breast cancer Biol Res 2017 10.1186/s40659-017-0140-9 28969709
Akram M, Iqbal M, Daniyal M, Khan AU. Awareness and current knowledge of breast cancer. Biol Res. 2017. 10.1186/s40659-017-0140-9.28969709 10.1186/s40659-017-0140-9
9. Beremauro S Girio-Fragkoulakis C Imaging techniques in breast cancer Surgery (United Kingdom) 2022 10.1016/j.mpsur.2021.11.014
Beremauro S, Girio-Fragkoulakis C. Imaging techniques in breast cancer. Surgery (United Kingdom). 2022. 10.1016/j.mpsur.2021.11.014.10.1016/j.mpsur.2021.11.014
10. Bhushan A Gonsalves A Menon JU Current state of breast cancer diagnosis, treatment, and theranostics Pharmaceutics 2021 10.3390/pharmaceutics13050723 34069059
Bhushan A, Gonsalves A, Menon JU. Current state of breast cancer diagnosis, treatment, and theranostics. Pharmaceutics. 2021. 10.3390/pharmaceutics13050723.34069059 10.3390/pharmaceutics13050723
11. Moloney BM O’Loughlin D Elwahab SA Kerin MJ Breast cancer detection—a synopsis of conventional modalities and the potential role of microwave imaging Diagnostics 2020 10.3390/diagnostics10020103 32075017
Moloney BM, O’Loughlin D, Elwahab SA, Kerin MJ. Breast cancer detection—a synopsis of conventional modalities and the potential role of microwave imaging. Diagnostics. 2020. 10.3390/diagnostics10020103.32075017 10.3390/diagnostics10020103
12. Sajjadi M Nasrollahzadeh M Jaleh B Soufi GJ Iravani S Carbon-based nanomaterials for targeted cancer nanotherapy: recent trends and future prospects J Drug Target 2021 10.1080/1061186X.2021.1886301 33566719
Sajjadi M, Nasrollahzadeh M, Jaleh B, Soufi GJ, Iravani S. Carbon-based nanomaterials for targeted cancer nanotherapy: recent trends and future prospects. J Drug Target. 2021. 10.1080/1061186X.2021.1886301.33566719 10.1080/1061186X.2021.1886301
13. Liang X Li N Zhang R Yin P Zhang C Yang N Liang K Kong B Carbon-based SERS biosensor: from substrate design to sensing and bioapplication NPG Asia Mater 2021 10.1038/s41427-020-00278-5
Liang X, Li N, Zhang R, Yin P, Zhang C, Yang N, Liang K, Kong B. Carbon-based SERS biosensor: from substrate design to sensing and bioapplication. NPG Asia Mater. 2021. 10.1038/s41427-020-00278-5.10.1038/s41427-020-00278-5
14. Ahmadian E Dizaj SM Sharifi S Shahi S Khalilov R Eftekhari A Hasanzadeh M The potential of nanomaterials in theranostics of oral squamous cell carcinoma: recent progress TrAC Trends Anal Chem 2019 10.1016/j.trac.2019.05.009
Ahmadian E, Dizaj SM, Sharifi S, Shahi S, Khalilov R, Eftekhari A, Hasanzadeh M. The potential of nanomaterials in theranostics of oral squamous cell carcinoma: recent progress. TrAC Trends Anal Chem. 2019. 10.1016/j.trac.2019.05.009.10.1016/j.trac.2019.05.009
15. Heller DA Jena PV Pasquali M Kostarelos K Delogu LG Meidl RE Rotkin SV Scheinberg DA Schwartz RE Terrones M Wang YH Bianco A Boghossian AA Cambré S Cognet L Corrie SR Demokritou P Giordani S Hertel T Ignatova T Islam MF Iverson NM Jagota A Janas D Kono J Kruss S Landry MP Li Y Martel R Maruyama S Naumov AV Prato M Quinn SJ Roxbury D Strano MS Tour JM Weisman RB Wenseleers W Yudasaka M Banning carbon nanotubes would be scientifically unjustified and damaging to innovation Nat Nanotechnol 2020 10.1038/s41565-020-0656-y 32157238
Heller DA, Jena PV, Pasquali M, Kostarelos K, Delogu LG, Meidl RE, Rotkin SV, Scheinberg DA, Schwartz RE, Terrones M, Wang YH, Bianco A, Boghossian AA, Cambré S, Cognet L, Corrie SR, Demokritou P, Giordani S, Hertel T, Ignatova T, Islam MF, Iverson NM, Jagota A, Janas D, Kono J, Kruss S, Landry MP, Li Y, Martel R, Maruyama S, Naumov AV, Prato M, Quinn SJ, Roxbury D, Strano MS, Tour JM, Weisman RB, Wenseleers W, Yudasaka M. Banning carbon nanotubes would be scientifically unjustified and damaging to innovation. Nat Nanotechnol. 2020. 10.1038/s41565-020-0656-y.32157238 10.1038/s41565-020-0656-y
16. Avitabile E Bedognetti D Ciofani G Bianco A Delogu LG How can nanotechnology help the fight against breast cancer? Nanoscale 2018 10.1039/c8nr02796j 29917035
Avitabile E, Bedognetti D, Ciofani G, Bianco A, Delogu LG. How can nanotechnology help the fight against breast cancer? Nanoscale. 2018. 10.1039/c8nr02796j.29917035 10.1039/c8nr02796j
17. Núñez C Estévez SV del Pilar Chantada M Inorganic nanoparticles in diagnosis and treatment of breast cancer J Biol Inorg Chem 2018 10.1007/s00775-018-1542-z 29453558
Núñez C, Estévez SV, del Pilar Chantada M. Inorganic nanoparticles in diagnosis and treatment of breast cancer. J Biol Inorg Chem. 2018. 10.1007/s00775-018-1542-z.29453558 10.1007/s00775-018-1542-z
18. Singh G Kaur H Sharma A Singh J Alajangi HK Kumar S Singla N Kaur IP Barnwal RP Carbon based nanodots in early diagnosis of cancer Front Chem 2021 10.3389/fchem.2021.669169 35087791
Singh G, Kaur H, Sharma A, Singh J, Alajangi HK, Kumar S, Singla N, Kaur IP, Barnwal RP. Carbon based nanodots in early diagnosis of cancer. Front Chem. 2021. 10.3389/fchem.2021.669169.35087791 10.3389/fchem.2021.669169
19. Monthioux M Kuznetsov VL Who should be given the credit for the discovery of carbon nanotubes? Carbon 2006 10.1016/j.carbon.2006.03.019
Monthioux M, Kuznetsov VL. Who should be given the credit for the discovery of carbon nanotubes? Carbon. 2006. 10.1016/j.carbon.2006.03.019.10.1016/j.carbon.2006.03.019
20. Lu GH Shang WT Deng H Han ZY Hu M Liang XY Fang CH Zhu XH Fan YF Tian J Targeting carbon nanotubes based on IGF-1R for photothermal therapy of orthotopic pancreatic cancer guided by optical imaging Biomaterials 2019 10.1016/j.biomaterials.2018.12.025 31918220
Lu GH, Shang WT, Deng H, Han ZY, Hu M, Liang XY, Fang CH, Zhu XH, Fan YF, Tian J. Targeting carbon nanotubes based on IGF-1R for photothermal therapy of orthotopic pancreatic cancer guided by optical imaging. Biomaterials. 2019. 10.1016/j.biomaterials.2018.12.025.31918220 10.1016/j.biomaterials.2018.12.025
21. Hua MY Lin YC Tsai RY Chen HC Water dispersible 1-one-butyric acid-functionalised multi-walled carbon nanotubes for enzyme immobilisation and glucose sensing J Mater Chem 2012 10.1039/c2jm15200b
Hua MY, Lin YC, Tsai RY, Chen HC. Water dispersible 1-one-butyric acid-functionalised multi-walled carbon nanotubes for enzyme immobilisation and glucose sensing. J Mater Chem. 2012. 10.1039/c2jm15200b.10.1039/c2jm15200b
22. Matyszewska D Napora E Żelechowska K Biernat JF Bilewicz R Synthesis, characterization, and interactions of single-walled carbon nanotubes modified with doxorubicin with langmuir-blodgett biomimetic membranes J Nanopart Res 2018 10.1007/s11051-018-4239-x 29780275
Matyszewska D, Napora E, Żelechowska K, Biernat JF, Bilewicz R. Synthesis, characterization, and interactions of single-walled carbon nanotubes modified with doxorubicin with langmuir-blodgett biomimetic membranes. J Nanopart Res. 2018. 10.1007/s11051-018-4239-x.29780275 10.1007/s11051-018-4239-x
23. Alarifi S Ali D Mechanisms of multi-walled carbon nanotubes-induced oxidative stress and genotoxicity in mouse fibroblast cells Int J Toxicol 2015 10.1177/1091581815584799 25998517
Alarifi S, Ali D. Mechanisms of multi-walled carbon nanotubes-induced oxidative stress and genotoxicity in mouse fibroblast cells. Int J Toxicol. 2015. 10.1177/1091581815584799.25998517 10.1177/1091581815584799
24. de Keijser T Mittemeijer EJ Rozendaal HCF The determination of crystallite-size and lattice-strain parameters in conjunction with the profile-refinement method for the determination of crystal structures J Appl Crystallogr 1983 10.1107/s0021889883010493
de Keijser T, Mittemeijer EJ, Rozendaal HCF. The determination of crystallite-size and lattice-strain parameters in conjunction with the profile-refinement method for the determination of crystal structures. J Appl Crystallogr. 1983. 10.1107/s0021889883010493.10.1107/s0021889883010493
25. Meyer JC Eder F Kurasch S Skakalova V Kotakoski J Park HJ Roth S Chuvilin A Eyhusen S Benner G Krasheninnikov AV Kaiser U Accurate measurement of electron beam induced displacement cross sections for single-layer graphene Phys Rev Lett 2012 10.1103/PhysRevLett.108.196102 23368550
Meyer JC, Eder F, Kurasch S, Skakalova V, Kotakoski J, Park HJ, Roth S, Chuvilin A, Eyhusen S, Benner G, Krasheninnikov AV, Kaiser U. Accurate measurement of electron beam induced displacement cross sections for single-layer graphene. Phys Rev Lett. 2012. 10.1103/PhysRevLett.108.196102.23368550 10.1103/PhysRevLett.108.196102
26. Eitoku T Tange M Kato H Okazaki T Depolarized dynamic light scattering study of multi-walled carbon nanotubes in solution Mater Express 2013 10.1166/mex.2013.1096
Eitoku T, Tange M, Kato H, Okazaki T. Depolarized dynamic light scattering study of multi-walled carbon nanotubes in solution. Mater Express. 2013. 10.1166/mex.2013.1096.10.1166/mex.2013.1096
27. Singh G Kumar M Soni U Arora V Bansal V Gupta D Bhat M Dinda AK Sapra S Singh H Cancer cell targeting using folic acid/anti-HER2 antibody conjugated fluorescent CdSe/CdS/ZnS-Mercaptopropionic acid and CdTe-Mercaptosuccinic acid quantum dots J Nanosci Nanotechnol 2016 16 1 130 143 10.1166/jnn.2016.10825 27398438
Singh G, Kumar M, Soni U, Arora V, Bansal V, Gupta D, Bhat M, Dinda AK, Sapra S, Singh H. Cancer cell targeting using folic acid/anti-HER2 antibody conjugated fluorescent CdSe/CdS/ZnS-Mercaptopropionic acid and CdTe-Mercaptosuccinic acid quantum dots. J Nanosci Nanotechnol. 2016;16(1):130–43. 10.1166/jnn.2016.10825.27398438 10.1166/jnn.2016.10825
28. Pandit C Alajangi HK Singh J Khajuria A Sharma A Hassan MS Parida M Semwal AD Gopalan N Sharma RK Suttee A Soni U Singh B Sapra S Barnwal RP Singh G Kaur IP Development of magnetic nanoparticle assisted aptamer-quantum dot based biosensor for the detection of Escherichia coli in water samples Sci Total Environ 2022 10.1016/j.scitotenv.2022.154857 35351510
Pandit C, Alajangi HK, Singh J, Khajuria A, Sharma A, Hassan MS, Parida M, Semwal AD, Gopalan N, Sharma RK, Suttee A, Soni U, Singh B, Sapra S, Barnwal RP, Singh G, Kaur IP. Development of magnetic nanoparticle assisted aptamer-quantum dot based biosensor for the detection of Escherichia coli in water samples. Sci Total Environ. 2022. 10.1016/j.scitotenv.2022.154857.35351510 10.1016/j.scitotenv.2022.154857
29. Asong GM Voshavar C Amissah F Bricker B Lamango NS Ablordeppey SY An evaluation of the anticancer properties of SYA014, a homopiperazine-oxime analog of haloperidol in triple negative breast cancer cells Cancers (Basel) 2022 10.3390/cancers14246047 36551533
Asong GM, Voshavar C, Amissah F, Bricker B, Lamango NS, Ablordeppey SY. An evaluation of the anticancer properties of SYA014, a homopiperazine-oxime analog of haloperidol in triple negative breast cancer cells. Cancers (Basel). 2022. 10.3390/cancers14246047.36551533 10.3390/cancers14246047
30. Jain TK Richey J Strand M Leslie-Pelecky DL Flask CA Labhasetwar V Magnetic nanoparticles with dual functional properties: drug delivery and magnetic resonance imaging Biomaterials 2008 10.1016/j.biomaterials.2008.07.004 18649936
Jain TK, Richey J, Strand M, Leslie-Pelecky DL, Flask CA, Labhasetwar V. Magnetic nanoparticles with dual functional properties: drug delivery and magnetic resonance imaging. Biomaterials. 2008. 10.1016/j.biomaterials.2008.07.004.18649936 10.1016/j.biomaterials.2008.07.004
31. Sahadev N Anappara AA Photothermal effect in solid-state MWCNT: possible signatures of thermal anisotropy J Appl Phys 2018 10.1063/1.5030461
Sahadev N, Anappara AA. Photothermal effect in solid-state MWCNT: possible signatures of thermal anisotropy. J Appl Phys. 2018. 10.1063/1.5030461.10.1063/1.5030461
32. Yudianti R Onggo H Sudirman Saito Y Iwata T Azuma JI Analysis of functional group sited on multi-wall carbon nanotube surface Open Mater Sci J 2011 10.2174/1874088X01105010242
Yudianti R, Onggo H, Sudirman, Saito Y, Iwata T, Azuma JI. Analysis of functional group sited on multi-wall carbon nanotube surface. Open Mater Sci J. 2011. 10.2174/1874088X01105010242.10.2174/1874088X01105010242
33. Guadagno L Raimondo M Vertuccio L Naddeo C Barra G Longo P Lamberti P Spinelli G Nobile MR Morphological, rheological and electrical properties of composites filled with carbon nanotubes functionalized with 1-pyrenebutyric acid Compos Part B Eng 2018 10.1016/j.compositesb.2018.04.036
Guadagno L, Raimondo M, Vertuccio L, Naddeo C, Barra G, Longo P, Lamberti P, Spinelli G, Nobile MR. Morphological, rheological and electrical properties of composites filled with carbon nanotubes functionalized with 1-pyrenebutyric acid. Compos Part B Eng. 2018. 10.1016/j.compositesb.2018.04.036.10.1016/j.compositesb.2018.04.036
34. Lim YJ Park MY Lee SK Lee WK Jo NJ Polyaniline and multi-walled carbon nanotube composite electrode for rechargeable battery Trans Nonferrous Met Soc China (Engl Ed) 2012 10.1016/S1003-6326(12)61793-2
Lim YJ, Park MY, Lee SK, Lee WK, Jo NJ. Polyaniline and multi-walled carbon nanotube composite electrode for rechargeable battery. Trans Nonferrous Met Soc China (Engl Ed). 2012. 10.1016/S1003-6326(12)61793-2.10.1016/S1003-6326(12)61793-2
35. Hartmann J Voigt P Reichling M Matthias E Photothermal measurement of thermal anisotropy in pyrolytic graphite Appl Phys B Lasers Opt 1996 10.1007/BF01081049
Hartmann J, Voigt P, Reichling M, Matthias E. Photothermal measurement of thermal anisotropy in pyrolytic graphite. Appl Phys B Lasers Opt. 1996. 10.1007/BF01081049.10.1007/BF01081049
36. Hayashi H Ikuta T Nishiyama T Takahashi K Enhanced anisotropic heat conduction in multi-walled carbon nanotubes J Appl Phys 2013 10.1063/1.4772612
Hayashi H, Ikuta T, Nishiyama T, Takahashi K. Enhanced anisotropic heat conduction in multi-walled carbon nanotubes. J Appl Phys. 2013. 10.1063/1.4772612.10.1063/1.4772612
37. Kathi J Rhee KY Lee JH Effect of chemical functionalization of multi-walled carbon nanotubes with 3-aminopropyltriethoxysilane on mechanical and morphological properties of epoxy nanocomposites Compos Part A Appl Sci Manuf 2009 10.1016/j.compositesa.2009.04.001
Kathi J, Rhee KY, Lee JH. Effect of chemical functionalization of multi-walled carbon nanotubes with 3-aminopropyltriethoxysilane on mechanical and morphological properties of epoxy nanocomposites. Compos Part A Appl Sci Manuf. 2009. 10.1016/j.compositesa.2009.04.001.10.1016/j.compositesa.2009.04.001
38. Rogel-Hernández E, Alonso-Nuñez G, Camarena JP, Espinoza-Gómez H, Aguirre G, Paraguay-Delgado F, Somanathan R. Side-wall functionalization of multi-walled carbon nanotubes with t-butyl Diazoacetate. J. Mex. Chem. Soc. 2011
39. Seo JW Shin US Preparation of positively and negatively charged carbon nanotube-collagen hydrogels with PH sensitive characteristic J Korean Chem Soc 2016 10.5012/jkcs.2016.60.3.187
Seo JW, Shin US. Preparation of positively and negatively charged carbon nanotube-collagen hydrogels with PH sensitive characteristic. J Korean Chem Soc. 2016. 10.5012/jkcs.2016.60.3.187.10.5012/jkcs.2016.60.3.187
40. Ma PC Siddiqui NA Mäder E Kim JK Correlation between electrokinetic potential, dispersibility, surface chemistry and energy of carbon nanotubes Compos Sci Technol 2011 10.1016/j.compscitech.2011.07.014
Ma PC, Siddiqui NA, Mäder E, Kim JK. Correlation between electrokinetic potential, dispersibility, surface chemistry and energy of carbon nanotubes. Compos Sci Technol. 2011. 10.1016/j.compscitech.2011.07.014.10.1016/j.compscitech.2011.07.014
41. Chen Y Zhou F Wang C Hu L Guo P Nanostructures as photothermal agents in tumor treatment Molecules 2023 10.3390/molecules28010277 38202811
Chen Y, Zhou F, Wang C, Hu L, Guo P. Nanostructures as photothermal agents in tumor treatment. Molecules. 2023. 10.3390/molecules28010277.38202811 10.3390/molecules28010277
42. Wang X Jing Y Zhang G Zuo Z Preparation of magnetic carbon nanotubes and their application in tumor cell photothermal therapy and magnetic resonance imaging Fuhe Cailiao Xuebao/Acta Mater. Compos. Sin. 2023 10.13801/j.cnki.fhclxb.20230728.001
Wang X, Jing Y, Zhang G, Zuo Z. Preparation of magnetic carbon nanotubes and their application in tumor cell photothermal therapy and magnetic resonance imaging. Fuhe Cailiao Xuebao/Acta Mater Compos Sin. 2023. 10.13801/j.cnki.fhclxb.20230728.001.10.13801/j.cnki.fhclxb.20230728.001
43. Yin M Wang M Miao F Ji Y Tian Z Shen H Jia N Water-dispersible multiwalled carbon nanotube/iron oxide hybrids as contrast agents for cellular magnetic resonance imaging Carbon N Y 2012 10.1016/j.carbon.2012.01.026
Yin M, Wang M, Miao F, Ji Y, Tian Z, Shen H, Jia N. Water-dispersible multiwalled carbon nanotube/iron oxide hybrids as contrast agents for cellular magnetic resonance imaging. Carbon N Y. 2012. 10.1016/j.carbon.2012.01.026.10.1016/j.carbon.2012.01.026
44. Nasiłowska B Bogdanowicz Z Hińcza K Mierczyk Z Góźdź S Djas M Kowiorski K Bombalska A Kowalik A Graphene oxide aerosol deposition and its influence on cancer cells. Preliminary results Materials (Basel) 2020 10.3390/ma13194464 33050094
Nasiłowska B, Bogdanowicz Z, Hińcza K, Mierczyk Z, Góźdź S, Djas M, Kowiorski K, Bombalska A, Kowalik A. Graphene oxide aerosol deposition and its influence on cancer cells. Preliminary results. Materials (Basel). 2020. 10.3390/ma13194464.33050094 10.3390/ma13194464
45. Marydasan B Nair RR Saneesh Babu PS Ramaiah D Asha Nair S Picolyl porphyrin nanostructures as a functional drug entrant for photodynamic therapy in human breast cancers ACS Omega 2019 10.1021/acsomega.9b01380 31460405
Marydasan B, Nair RR, Saneesh Babu PS, Ramaiah D, Asha Nair S. Picolyl porphyrin nanostructures as a functional drug entrant for photodynamic therapy in human breast cancers. ACS Omega. 2019. 10.1021/acsomega.9b01380.31460405 10.1021/acsomega.9b01380
46. Tang L Xiao Q Mei Y He S Zhang Z Wang R Wang W Insights on functionalized carbon nanotubes for cancer theranostics J Nanobiotechnol 2021 10.1186/s12951-021-01174-y
Tang L, Xiao Q, Mei Y, He S, Zhang Z, Wang R, Wang W. Insights on functionalized carbon nanotubes for cancer theranostics. J Nanobiotechnol. 2021. 10.1186/s12951-021-01174-y.10.1186/s12951-021-01174-y
47. Ghoderao P, Sahare S, Kulkarni AA, Bhave T. Paclitaxel conjugated magnetic carbon nanotubes induce apoptosis in breast cancer cells and breast cancer stem cells in vitro. In: Paclitaxel: sources, chemistry, anticancer actions, and current biotechnology; 2021. 10.1016/B978-0-323-90951-8.00001-1
48. Luo X Xie D Su J Hu J Inflammatory genes associated with pristine multi-walled carbon nanotubes-induced toxicity in ocular cells Int J Nanomed 2023 10.2147/IJN.S394694
Luo X, Xie D, Su J, Hu J. Inflammatory genes associated with pristine multi-walled carbon nanotubes-induced toxicity in ocular cells. Int J Nanomed. 2023. 10.2147/IJN.S394694.10.2147/IJN.S394694
49. Guo Z Liu X Lin Y Sang Z Chen D Hyaluronic acid modified carbon nanotubes using for photothermal therapy by promoting apoptosis of nasopharyngeal carcinoma cells Front Bioeng Biotechnol 2023 10.3389/fbioe.2023.1229852 38292303
Guo Z, Liu X, Lin Y, Sang Z, Chen D. Hyaluronic acid modified carbon nanotubes using for photothermal therapy by promoting apoptosis of nasopharyngeal carcinoma cells. Front Bioeng Biotechnol. 2023. 10.3389/fbioe.2023.1229852.38292303 10.3389/fbioe.2023.1229852
50. He Y Sun MM Zhang GG Yang J Chen KS Xu WW Li B Targeting PI3K/Akt signal transduction for cancer therapy Signal Transduct Target Ther 2021 10.1038/s41392-021-00828-5 34952899
He Y, Sun MM, Zhang GG, Yang J, Chen KS, Xu WW, Li B. Targeting PI3K/Akt signal transduction for cancer therapy. Signal Transduct Target Ther. 2021. 10.1038/s41392-021-00828-5.34952899 10.1038/s41392-021-00828-5
51. Elgueta R Benson MJ De Vries VC Wasiuk A Guo Y Noelle RJ Molecular mechanism and function of CD40/CD40L engagement in the immune system Immunol Rev 2009 10.1111/j.1600-065X.2009.00782.x 19426221
Elgueta R, Benson MJ, De Vries VC, Wasiuk A, Guo Y, Noelle RJ. Molecular mechanism and function of CD40/CD40L engagement in the immune system. Immunol Rev. 2009. 10.1111/j.1600-065X.2009.00782.x.19426221 10.1111/j.1600-065X.2009.00782.x
52. Rodriguez-Perdigon M Haeni L Rothen-Rutishauser B Rüegg C Dual CSF1R inhibition and CD40 activation demonstrates anti-tumor activity in a 3D macrophage- HER2+ breast cancer spheroid model Front Bioeng Biotechnol 2023 10.3389/fbioe.2023.1159819 37346794
Rodriguez-Perdigon M, Haeni L, Rothen-Rutishauser B, Rüegg C. Dual CSF1R inhibition and CD40 activation demonstrates anti-tumor activity in a 3D macrophage- HER2+ breast cancer spheroid model. Front Bioeng Biotechnol. 2023. 10.3389/fbioe.2023.1159819.37346794 10.3389/fbioe.2023.1159819
53. Chen J Wei Y Yang W Huang Q Chen Y Zeng K Chen J IL-6: the link between inflammation, immunity and breast cancer Front Oncol 2022 10.3389/fonc.2022.903800 37078004
Chen J, Wei Y, Yang W, Huang Q, Chen Y, Zeng K, Chen J. IL-6: the link between inflammation, immunity and breast cancer. Front Oncol. 2022. 10.3389/fonc.2022.903800.37078004 10.3389/fonc.2022.903800
54. Felcher CM Bogni ES Kordon EC IL-6 cytokine family: a putative target for breast cancer prevention and treatment Int J Mol Sci 2022 10.3390/ijms23031809 35163731
Felcher CM, Bogni ES, Kordon EC. IL-6 cytokine family: a putative target for breast cancer prevention and treatment. Int J Mol Sci. 2022. 10.3390/ijms23031809.35163731 10.3390/ijms23031809
55. Dill EA Dillon PM Bullock TN Mills AM IDO expression in breast cancer: an assessment of 281 primary and metastatic cases with comparison to PD-L1 Mod Pathol 2018 10.1038/s41379-018-0061-3 29802358
Dill EA, Dillon PM, Bullock TN, Mills AM. IDO expression in breast cancer: an assessment of 281 primary and metastatic cases with comparison to PD-L1. Mod Pathol. 2018. 10.1038/s41379-018-0061-3.29802358 10.1038/s41379-018-0061-3
56. Hu C Liu Y Cao W Li N Gao S Wang Z Gu F Efficacy and mechanism of a biomimetic nanosystem carrying doxorubicin and an IDO inhibitor for treatment of advanced triple-negative breast cancer Int J Nanomed 2024 10.2147/IJN.S440332
Hu C, Liu Y, Cao W, Li N, Gao S, Wang Z, Gu F. Efficacy and mechanism of a biomimetic nanosystem carrying doxorubicin and an IDO inhibitor for treatment of advanced triple-negative breast cancer. Int J Nanomed. 2024. 10.2147/IJN.S440332.10.2147/IJN.S440332
57. Yang Q Li X Zhang L Wang G Chen G Lin D Xing B Dispersion and stability of multi-walled carbon nanotubes in water as affected by humic acids J Mol Liq 2019 10.1016/J.MOLLIQ.2019.01.143
Yang Q, Li X, Zhang L, Wang G, Chen G, Lin D, Xing B. Dispersion and stability of multi-walled carbon nanotubes in water as affected by humic acids. J Mol Liq. 2019. 10.1016/J.MOLLIQ.2019.01.143.10.1016/J.MOLLIQ.2019.01.143
