
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39256554
72099
10.1038/s41598-024-72099-3
Article
The order of green and red LEDs irradiation affects the neural differentiation of human umbilical cord matrix-derived mesenchymal cells
Sheikhbahaei Fatemeh 1
Shams Parisa 1
Seyyedin Sajad 1
Shojaei Mohammad 2
Nematollahi-Mahani Seyed Noureddin nnematollahi@kmu.ac.ir

13
1 https://ror.org/02kxbqc24 grid.412105.3 0000 0001 2092 9755 Department of Anatomical Sciences, Afzalipour School of Medicine, Kerman University of Medical Sciences, Kerman, Iran
2 Afzal Research Institute, Kerman, Iran
3 https://ror.org/02kxbqc24 grid.412105.3 0000 0001 2092 9755 Kerman Neuroscience Research Center (KNRC), Institute of Neuropharmacology, Kerman University of Medical Sciences, Somayeh Cross, Avicenna St., Kerman, 76198-13159 Iran
10 9 2024
10 9 2024
2024
14 2110721 3 2024
3 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Different wavelengths emitted from light-emitting diodes (LEDs) are known as an influential factor in proliferation and differentiation of various cell types. Since human umbilical cord matrix-derived mesenchymal cells (hUCMs) are ideal tools for human regenerative medicine clinical trials and stem cell researches, in the present study we investigated the neurogenesis effects of single and intermittent green and red LED irradiation on hUCM cells. Exposure of hUCMs to single and intermittent green (530 nm, 1.59 J/cm2) and red (630 nm, 0.318 J/cm2) lights significantly increased the expression of specific genes including nestin, β-tubulin III and Olig2. Additionally, immunocytochemical analysis confirmed the expression of specific neural-related proteins including nestin, β-tubulin III, Olig2 and GFAP. Also, alternating exposure of hUCM cells to green and red lights increased the expression of some neural markers more than either light alone. Further research are required to develop the application of LED irradiation as a useful tool for therapeutic purposes including neural repair and regeneration.

Keywords

Green light-emitting diode
Red light-emitting diode
Human umbilical cord mesenchymal cells
Retinoic acid
Neural differentiation
Subject terms

Neurogenesis
Lasers, LEDs and light sources
Biophysics
Mesenchymal stem cells
http://dx.doi.org/10.13039/501100004621 Kerman University of Medical Sciences IR.KMU.REC.1400.049 Nematollahi-Mahani Seyed Noureddin issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

In the recent years, light irradiation emitted from light-emitting diodes (LEDs), are introduced as a potential factor for the proliferation of various cell types1–3. Studies have shown that LEDs have opened up new perspectives as an effective light source in medical treatments, especially phototherapy4. The use of LED irradiation has effective benefits in a wide range of clinical disorders such as pain, skin injuries, rheumatological diseases, muscle devastating diseases, and infections4,5. Compared to lasers, LEDs have some advantages such as greater safety, lower cost, ease of use, and more flexibility in the irradiated area size6. It has been proven that LED irradiations enhance cell proliferation and cytokine secretion in a number of cells, which leads to an increase in the rate of proliferation of fibroblasts and keratinocytes, as well as an increase of growth-factor synthesis, collagen production, and angiogenesis7. This LED potential was confirmed by Li et al. study that reported increased proliferation of human bone marrow mesenchymal stem cells following LED irradiation8. Dehghani-Soltani et al. reported that LED irradiation with or without retinoic acid (RA) pretreatment enhanced the neural differentiation of hUCM cells. Their findings demonstrated that red light irradiation, and more effectively, green light irradiation, stimulated hUCMs to differentiate into neural lineage cells9.

Human umbilical cord (hUC) Wharton’s jelly has been proposed as an appropriate source of mesenchymal stromal cells (MSCs) about 2 decades ago10, and is of great interest in human regenerative medicine clinical trials and stem cell researches11. These cells possess several advantages over other adult stem cells. For instance, these cells embedded in Wharton’s jelly of the umbilical cord have no ethical concern and are considered biological waste and are usually discarded after birth. They can be easily harvested and propagated in cell culture units and can successfully differentiate into adipogenic, osteogenic and chondrogenic lineages as well as neural cells12–14.

Recent researches have shown that red and green light affect various cellular biological activities differently, leading to change in cell proliferation and differentiation15,16. Light absorption by cytochrome c oxidase (CCO) in the mitochondrial respiratory chain is a key molecular process triggered by red LED irradiation. CCO acts as the principal cellular chromophore for light absorption17. Intracellular levels of ATP, cAMP and ROS elevate after increased activity of the CCO. Subsequently, the mentioned signaling molecules trigger a chain of events that lead to cell proliferation and differentiation18. In the case of green light, activation of a number of photoreceptors called opsins (OPNs) is considered as one of the main underlying mechanisms for its biological effects19. Increased expression of OPNs has been reported to be associated with the activation of transient receptor potential (TRP) channels, which in turn increases the intracellular calcium and ROS. Then, the activation of the MAPK signaling pathway will lead to the effects of green LED on stem cells20.

Although studies have been conducted to introduce the appropriate energy density of LEDs for neural lineage differentiation, it is still unclear which energy density or which sequence and combination of exposure is the most effective strategy for optimal neural differentiation of mesenchymal stem cells. Since green and red lights affect mesenchymal stem cells through different mechanisms, earlier activation of one pathway may influence the other pathway and results in different biological effects. Therefore, in this study, we investigated the effects of green and red lights emitted from LEDs as well as the order of their exposure on the neural differentiation of hUCM cells.

Results

Adipogenic and osteogenic differentiation of hUCM cells

Adipogenic differentiation of mesenchymal cells was assessed after 21 days of adipogenic induction. A collection of lipid vacuoles was detected in the cytoplasm of induced cells after Oil Red O staining. Additionally, the formation of calcium deposits in the extracellular matrix of hUCMs was confirmed using Alizarin Red S staining. In the control groups, neither Oil Red O nor Alizarin red-positive cells were detected (Fig. 1).Fig. 1 Adipogenic and osteogenic differentiation of hUCM cells. Oil Red O staining showed no lipid droplets in non-induced cells, and a collection of lipid-containing vacuoles was observed in the induced (adipogenic) cells. No Alizarin Red S-positive cells were observed in non-induced cells, while the calcium deposits were detected by Alizarin Red S staining in the osteogenic-induced cells. The image of non-induced cells of adipogenic differentiation of hUCMs has been used by taking permission from the study entitled “Effects of green light-emitting diode on neural differentiation of human umbilical cord matrix-derived mesenchymal cells; Involvement of MAPK pathway” by Seyyedin et al.16.

Expression of neural marker genes

Expression of genes involved in neural differentiation of hUCM cells, including nestin, β-tubulin III, and Olig2 was analyzed by qRT-PCR on days 7, 14 and 21 after LED irradiation in different treated groups as well as the control group. The results indicated that following the exposure of hUCM cells to green and red LEDs, nestin expression was significantly (P < 0.001) increased on day 7 compared to the control group and remained significantly (P < 0.05) elevated by day 14. On day 21, it reached to the highest level (about 100 folds compared with the control group, P < 0.001) in the green group, but decreased to a non-significant level in the red group. Sequential exposure of hUCM cells to red and green LED lights led to a significant (P < 0.05 and P < 0.001 for days 7 and 14, respectively) increase in nestin expression on days 7 and 14 but not on day 21 in the red/green group; however, no significant difference was observed between the green/red group and the control group in none of the days (Fig. 2A). The expression of β-tubulin III was comparable between the different groups except for the green/red group, which was significantly (P < 0.05) higher than the control group on day 7. hUCM cells in all irradiated groups demonstrated significantly (P < 0.05) increased β-tubulin III expression compared to the control group on day 14. LED irradiation decreased the expression of β-tubulin III in all treated groups except the hUCM cells exposed to red LED light compared to the control group on day 21. In addition, the expression of β-tubulin III in cells with RA was significantly (P < 0.05) increased on day 14 compared to the control group. However, the expression of the aforementioned marker was significantly decreased (P < 0.05) in RA-treated cells on day 21 compared to non-treated cells (Fig. 2B). Red LED irradiation induced hUCM cells to express significantly (P < 0.001) higher levels of Olig2 gene, while there was no significant change in other treated groups at day 7. On days 14 and 21, the expression of Olig2 was significantly (P < 0.05) higher in the green group than in the control group, and no statistically significant difference was observed between the control group and other treatment groups (Fig. 2C).Fig. 2 Histograms represent the expression of nestin (A), β-tubulin III (B) and Olig2 (C) genes in red, green, red/green, green/red and RA groups relative to the control group on days 7, 14 and 21 after the beginning of treatments. Results are expressed as mean ± SD of three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001).

Analysis of neural proteins by immunocytochemistry

The effect of various treatments on the expression levels of neural lineage proteins including nestin, β-tubulin III, GFAP, and Olig2 was evaluated by immunocytochemistry on day 14 (Fig. 3). The expression level of nestin, as a neural progenitor cell marker was significantly (P < 0.05) increased in red, green and red/green groups compared to the control group (Fig. 4A). The immunoreactivity of β-tubulin III, an intermediate filament found in mature neuron-like cells, was significantly (P < 0.01) higher in all experimental groups (except the red group) than in the control group, with a sharp significant (P < 0.001) increase in the red/green group (Fig. 4B). GFAP, an intermediate filament specific to glial cells, was also significantly (P < 0.05) more abundant in red/green, green/red, and RA groups than in the control group (Fig. 4C). Similar to β-tubulin III, the highest expression of GFAP was observed in the red/green group. The expression of Olig2 as a specific marker of oligodendrocytes was significantly (P < 0.05) higher in red, green, green/red and RA groups compared to the control group. Furthermore, the highest expression rate was detected in the green/red group (Fig. 4D).Fig. 3 Representative immunofluorescence images of nestin, β-tubulin III, GFAP and Olig2 proteins following neural differentiation of hUCMs. Nuclei were visualized with Hoechst.

Fig. 4 Fold change in fluorescence intensity of nestin (A), β-tubulin III (B), GFAP (C) and Olig2 (D) markers in red, green, red/green, green/red and RA groups relative to the control group on days 7, 14 and 21. Results are the mean ± SD of three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001).

Discussion

Among physical stimuli, the use of LEDs has led to promising effects for the differentiation of MSCs into neural lineages16,21. In the present study, the effects of single and intermittent green and red lights emitted from LEDs on the differentiation of human umbilical cord matrix-derived mesenchymal stem cells (hUCMs) into neural-like cells were investigated. As a well-established signaling molecule, RA is involved in several functions including early embryo development, neuronal patterning, neural differentiation, as well as maintenance of the differentiated state of adult neurons22. It is widely used as an inducer of neural differentiation of MSCs and therefore, this compound was chosen as a chemical inducer in the present study3,23. Our findings demonstrated that treatment of hUCMs with RA resulted in a significant (P < 0.01) increase in the expression of β-tubulin III, GFAP and Olig2 proteins compared to untreated hUCMs. These results are in line with previous studies that reported the beneficial effects of RA on the neural differentiation of MSCs24,25.

By comparing the nestin gene expression level with the nestin protein expression level on day 14, it was shown that red LED irradiation resulted in the higher expression of nestin gene, while nestin protein was strongly expressed after red, green and red/green LED irradiation. By comparing β-tubulin III gene expression level with β-tubulin III protein expression level on day 14, it was shown that exposure of hUCM cells to red, green, red/green and green/red led to higher expression of β-tubulin III gene, while β-tubulin III protein was highly expressed in the red/green group followed by green and green/red groups. Comparison of Olig2 gene expression level with Olig2 protein expression level on day 14 indicated that exposure of hUCM cells to green LED light led to higher Olig2 gene expression, while Olig2 protein was highly expressed in green/red, then red and green groups. Intermittent LED irradiation synergistically induced neural differentiation of hUCM cells, indicated by increased expression of some neural markers. Also, it was shown that red (630 nm) and green light (530 nm) irradiation, in the absence of retinoic acid, stimulates neural lineage differentiation of hUCM cells. Furthermore, exposure of hUCMs to intermittent red and green irradiation increased the expression level of some neural genes and proteins. This finding is in agreement with a previous study conducted by Dehghani et al. that represented the beneficial effect of green and red LED light stimulation on neural differentiation of hUCM cells. They also pointed that red and, more specifically, green light (530 nm) irradiation stimulates neural lineage differentiation of hUCM cells in the absence of retinoic acid9. A recent study reported involvement of ERK 1/2, JNK and p38 phosphorylation in differentiation of hUCMs into neuron-like cells following exposure to green LED light16. Although there are several assumptions regarding the cellular mechanism of action of LED irradiation, the most accepted hypothesis is that the biochemical reactions start with the absorption of light by cytochrome c oxidase activation, mitochondrial electron transport chain element, then intracellular reactive oxygen species (ROS) production, resulting in a proton gradient across the cell and mitochondrial membrane. The combination of these factors leads to an increased ATP and change in the Ca2+‏ ion flux which trigger a cascade of events that lead to the activation of transcription factors responsible for cell proliferation and differentiation16,19,20,26. Wong-Riley demonstrated that NIR light applications, especially at the wavelengths of 670 and 830-nm, increase the activity of cytochrome c oxidase followed by an increase in the activity of energy metabolism in neuronal cells27. Another accepted assumption about the mechanism of light absorption by cytochrome c oxidase and increasing the activity of this enzyme through light is related to the blockade of nitric oxide (NO) between the copper and heme centers of cytochrome c oxidase. Thus, NO release is another important indicator of photobiomodulation therapy28.

Nestin is expressed earlier compared to other specific markers of neurons, acting as a migration guide during neuronal differentiation29,30. Nestin was significantly expressed in hUCMs after exposure to intermittent red and green LED lights in the absence of retinoic acid. Efekhar-Vaghefi et al. reported an increase in nestin expression following the exposure of hUCMs to different concentrations of retinoic acid from the first day of exposure31. On the other hand, Dehghani et al. observed an increase in nestin gene expression following irradiation with green LED, especially on day 7 after irradiation9. We also observed a significant increase in the expression of nestin following exposure of cells to alternating red/green light on days 7 and 14, but not on day 21. It is unclear what the nature of these differences are following different induction strategies, which requires further investigations.

In our study, the highest expression level of β-tubulin III was observed on days 14 and 21 after LED irradiation. In addition, exposure of hUCMs to red (on day 7) and green (on days 14 and 21) LED lights significantly increased Olig2 expression compared to the control group. Interestingly, immunocytochemical analysis confirmed that the induction of hUCM cells by light irradiation improved glial cell differentiation via an increase in the expression of specific markers including Olig2 and GFAP proteins. This finding is in agreement with a previous study conducted by our team that investigated the effects of green LED irradiation on gene expression and protein production in neural differentiation, and involved molecular pathways. We showed that treatment of hUCMs with green LED irradiation and RA alone, and also their combination improved the neural differentiation of hUCMs through the MAPK pathway16.

The results of our study indicated that dual irradiation of red and green LEDs could successfully enhance neurogenic differentiation of hUCM cells and especially, the application of dual irradiation led to an increase in the expression of a number of neural markers. When the order of exposure changed from red/green to green/red, the expression of neural markers changed accordingly, which is of concern in future researches. Due to the dose-dependent nature of light stimulation and the variable penetration capacity of light beams in various tissues, it is not possible to directly apply in vitro results to in vivo settings. However, since LED irradiation is inexpensive, safe, and simple to use, our results suggest LED irradiation as a useful tool for therapeutic purposes including neural repair and regeneration.

Materials and methods

Design of the study and grouping

All methods were performed in accordance with relevant guidelines and regulations of Kerman University of Medical Sciences. The protocols of this study were also approved by the ethical committee at Kerman University of Medical Sciences, Kerman, Iran (approval code: IR.KMU.REC.1400.049). Frozen-thawed hUCM cells were cultured in 35 mm culture dishes and divided into the following groups: control group without intervention, retinoic acid-treated (RA) group that received 10 μM retinoic acid, green group that received green LED irradiation for 5 min, red group that received red LED irradiation for 2.5 min, green/red group that received green LED irradiation for 5 min followed by 2.5 min red LED irradiation, and red/green group that received red LED irradiation for 2.5 min followed by 5 min green light irradiation (Fig. 5). Materials were purchased from Sigma Co. (Sigma-Aldrich Co., MO, USA) unless otherwise stated.Fig. 5 Graphical diagram representing the overall design of the study and various experimental groups.

Culture of hUCM cells

Written consent has been obtained from the mothers undergoing cesarean section for the use of umbilical cord. We used frozen batches of hUCMs stored in the cell bank of Anatomy department at Kerman University of Medical Science16. The frozen vial was thawed in a 37 °C water bath and its contents were diluted and cultured in DMEM/F12 supplemented with 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin and 2.5 mg/ml amphotericin B. After 80–90% confluence, proliferated cells were sub-cultured and used at passage 3 to 4 for experiments. These cells were examined for the presence of mesenchymal stem cell markers including CD73, CD90 and CD105 and the absence of CD34 as hematopoietic CD marker32,33.

Adipogenic and osteogenic differentiation of hUCM cells

To assess differentiation capacity of the frozen/thawed cells, third passage hUCM cells at a density of 2.5 × 104 cells/cm2 were seeded onto glass slides with DMEM/F12 supplemented either with adipogenic (50 μg/ml indomethacin and 100nM dexamethasone) or osteogenic (10nM dexamethasone, 10 mM β-glycerophosphate and 50 μg/ml ascorbic acid,) differentiation medium for 21 days. Half of the culture medium was replaced with fresh medium every 3 days. Adipocyte-like cells and osteoblast-like cells were stained using Oil Red O and Alizarin Red S staining, respectively34.

Light irradiation

In this study, a handmade LED device was used as the light source. It contained either red (630 nm, 10 nm bandwidth) or green (530 nm, 20 nm bandwidth) lights (SE Electronics, China). The power density and distribution of LED radiation were adjusted to 5.3 mW/cm2 for green and 2.12 mW/cm2 for red light using an appropriate power meter (Melles-Griot, US). The LED array was designed to fit into standard 3.5 cm cell culture dishes, and the spectrum of the LEDs was checked by the spectrometer (Avantes, The Netherlands). The culture dishes were divided into control and treatment groups (green, red, green/red, red/green, RA)9. The irradiation energies of 1.59 J/cm2 and 0.318 J/cm2 were related to green and red lights, respectively. The energy density for green and red lights were calculated based on the following formula: power density (W/cm2) × time (s). All irradiations were conducted inside a CO2 incubator (37 °C, 5% CO2) under the same conditions as the non-irradiated cells (control). In order not to interfere with the irradiation of the treated groups, when the culture dishes were irradiated, the other culture dishes were covered by dark designed plastic masks. The trials were repeated at least 3 times under the same conditions. Experiments were terminated at 7, 14 and 21 days after treatment to analyze the results of outcome of interventions.

Isolation of RNA and qRT-PCR

Total RNA was extracted from hUCM cells of different groups on days 7, 14 and 21 of treatment using the RNeasy kit (Qiagen, Crawley, UK) according to the manufacturer's instructions. RNA integrity was evaluated and cDNA was synthesized using the script RT Kit (Qiagen). Quantitative real time PCR was performed using a MIC (Magnetic Induction Cycler, BMS, Australia) instrument. On each cDNA sample, quantitative polymerase chain reactions (qRT-PCR) were performed in triplicate. The amplification conditions were 15 min at 95 °C for initial denaturation followed by 40 cycles of denaturation (23 s at 95 °C), annealing (30 s at 60 °C) and extension (30 s at 72 °C). A negative control (no cDNA) was used in all experiments. The relative gene expression data were analyzed using the 2−ΔΔCT method16,35. The primers used in this study are shown in Table 1.Table 1 List of primers used for qRT-PCR.

Gene	Forward primer sequence (5′–3′)	Reverse primer sequence (5′–3′)	
Nestin	CTGCTACCCTTGAGACACCTG	GGGCTCTGATCTCTGCATCTAC	
β-Tubulin III	AACCAGATCGGGGCCAAGTT	AGGCACGTACTTGTGAGAAGAG	
Olig2	TGGCTTCAAGTCATCCTCGTC	ATGGCGATGTTGAGGTCGTG	
GAPDH	CTGGGCTACACTGAGCACC	AAGTGGTCGTTGAGGGCAATG	

Immunocytochemistry

In the third passage, the hUCM cells were seeded onto glass coverslips at a density of 1 × 104 cells per coverslip. In a preliminary study, we evaluated the most appropriate time to harvest known proteins which was 14 days after the beginning of the treatment. So, on the 14th day after the start of treatment, the expression of neural proteins was assessed by immunocytochemistry. After washing the slides with PBS, the cells were fixed in 4% paraformaldehyde for 35 min and then washed 3 times with PBS. Cells were permeabilized with PBS containing 0.1% Triton X-100, 1% bovine serum albumin, and 10% normal goat serum for 40 min. The samples were then washed with PBS before being incubated overnight at 4 °C with anti-nestin (1/200), anti-β-tubulin III (1/200), anti-GFAP (1/200), and anti-Olig2 (1/200) antibodies (Santa Cruz, USA). Cells were then washed with PBS and incubated for 90 min at room temperature with donkey anti-mouse IgG-FITC. Cells were stained with Hoechst to visualize the nuclei. A negative control group was not incubated with primary antibodies and served to evaluate the process of ICC16. Finally, the stained samples were examined by an inverted fluorescent microscope (Olympus IX71, Japan) equipped with a digital camera (DP71). The fluorescent intensity of different markers was calculated using ImageJ software. Ten fields were selected from each sample and then, five region of interests (ROI) were chosen from each field to calculate their integrated density.

Statistical analysis

Data were expressed as the mean ± SD. Statistical analyses were performed using GraphPad Prism software version 8.4 (GraphPad Software, San Diego, CA, USA). The significance of differences was assessed via One-way ANOVA followed by Tukey post hoc test and a P ≤ 0.05 was considered statistically significant.

Author contributions

F.S: collection of data, data analysis and interpretation, manuscript writing. P.S: collection of data, data analysis and interpretation, manuscript writing. S.S: collection of data, data analysis and interpretation, manuscript writing. M.S: Conception and design, provision of study materials, data analysis and interpretation. S.N.N.M: Conception and design, administrative support, data analysis and interpretation, manuscript writing, final approval of manuscript.

Funding

This study was funded by Kerman University of Medical Sciences (No. IR.KMU.REC.1400.049).

Data availability

The data sets generated for this study are available upon request to the corresponding author.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Agha R Beeson W Beeson WH In vitro comparison of light-emitting diodes and carnosic acid effects on keratinocyte proliferation and wound healing Am. J. Cosmet. Surg. 2012 29 30 37 10.5992/AJCS-D-11-00003.1
Agha, R., Beeson, W. & Beeson, W. H. In vitro comparison of light-emitting diodes and carnosic acid effects on keratinocyte proliferation and wound healing. Am. J. Cosmet. Surg. 29, 30–37 (2012).10.5992/AJCS-D-11-00003.1
2. Vinck EM Cagnie BJ Cornelissen MJ Declercq HA Cambier DC Increased fibroblast proliferation induced by light emitting diode and low power laser irradiation Lasers Med. Sci. 2003 18 95 99 10.1007/s10103-003-0262-x 12928819
Vinck, E. M., Cagnie, B. J., Cornelissen, M. J., Declercq, H. A. & Cambier, D. C. Increased fibroblast proliferation induced by light emitting diode and low power laser irradiation. Lasers Med. Sci. 18, 95–99 (2003).12928819 10.1007/s10103-003-0262-x
3. Seyyedin S Ezzatabadipour M Nematollahi-Mahani SN The role of various factors in neural differentiation of human umbilical cord mesenchymal stem cells with a special focus on the physical stimulants Curr. Stem Cell Res. Ther. 2024 19 166 177 10.2174/1574888x18666230124151311 36734908
Seyyedin, S., Ezzatabadipour, M. & Nematollahi-Mahani, S. N. The role of various factors in neural differentiation of human umbilical cord mesenchymal stem cells with a special focus on the physical stimulants. Curr. Stem Cell Res. Ther. 19, 166–177. 10.2174/1574888x18666230124151311 (2024).36734908 10.2174/1574888x18666230124151311
4. Yeh NG Wu C-H Cheng TC Light-emitting diodes—Their potential in biomedical applications Renew. Sustain. Energy Rev. 2010 14 2161 2166 10.1016/j.rser.2010.02.015
Yeh, N. G., Wu, C.-H. & Cheng, T. C. Light-emitting diodes—Their potential in biomedical applications. Renew. Sustain. Energy Rev. 14, 2161–2166 (2010).10.1016/j.rser.2010.02.015
5. Dong J Xiong D Applications of light emitting diodes in health care Ann. Biomed. Eng. 2017 45 2509 2523 10.1007/s10439-017-1930-5 28948402
Dong, J. & Xiong, D. Applications of light emitting diodes in health care. Ann. Biomed. Eng. 45, 2509–2523 (2017).28948402 10.1007/s10439-017-1930-5
6. Mansano BSDM Enhancing the therapeutic potential of mesenchymal stem cells with light-emitting diode: Implications and molecular mechanisms Oxid. Med. Cell. Longev. 2021 2021 6663539 10.1155/2021/6663539 33623634
Mansano, B. S. D. M. et al. Enhancing the therapeutic potential of mesenchymal stem cells with light-emitting diode: Implications and molecular mechanisms. Oxid. Med. Cell. Longev. 2021, 6663539 (2021).33623634 10.1155/2021/6663539
7. Li W-T Leu Y-C Wu J-L Red-light light-emitting diode irradiation increases the proliferation and osteogenic differentiation of rat bone marrow mesenchymal stem cells Photomed. Laser Surg. 2010 28 S-157 S-165 10.1089/pho.2009.2540 20583914
Li, W.-T., Leu, Y.-C. & Wu, J.-L. Red-light light-emitting diode irradiation increases the proliferation and osteogenic differentiation of rat bone marrow mesenchymal stem cells. Photomed. Laser Surg. 28, S-157-S−165 (2010).20583914 10.1089/pho.2009.2540
8. Li W Chen H Wang C Effect of light emitting diode irradiation on proliferation of human bone marrow mesenchymal stem cells J. Med. Biol. Eng. 2006 26 35
Li, W., Chen, H. & Wang, C. Effect of light emitting diode irradiation on proliferation of human bone marrow mesenchymal stem cells. J. Med. Biol. Eng. 26, 35 (2006).
9. Dehghani-Soltani S Shojaee M Jalalkamali M Babaee A Nematollahi-Mahani SN Effects of light emitting diode irradiation on neural differentiation of human umbilical cord-derived mesenchymal cells Sci. Rep. 2017 7 9976 10.1038/s41598-017-10655-w 28855704
Dehghani-Soltani, S., Shojaee, M., Jalalkamali, M., Babaee, A. & Nematollahi-Mahani, S. N. Effects of light emitting diode irradiation on neural differentiation of human umbilical cord-derived mesenchymal cells. Sci. Rep. 7, 9976 (2017).28855704 10.1038/s41598-017-10655-w
10. Stefańska K Human Wharton's jelly-cellular specificity, stemness potency, animal models, and current application in human clinical trials J. Clin. Med. 2020 10.3390/jcm9041102 32878323
Stefańska, K. et al. Human Wharton’s jelly-cellular specificity, stemness potency, animal models, and current application in human clinical trials. J. Clin. Med.10.3390/jcm9041102 (2020).32878323 10.3390/jcm9041102
11. Taghizadeh RR Cetrulo KJ Cetrulo CL Wharton’s Jelly stem cells: Future clinical applications Placenta 2011 32 S311 S315 10.1016/j.placenta.2011.06.010 21733573
Taghizadeh, R. R., Cetrulo, K. J. & Cetrulo, C. L. Wharton’s Jelly stem cells: Future clinical applications. Placenta 32, S311–S315. 10.1016/j.placenta.2011.06.010 (2011).21733573 10.1016/j.placenta.2011.06.010
12. Watson N Discarded Wharton jelly of the human umbilical cord: A viable source for mesenchymal stromal cells Cytotherapy 2015 17 18 24 10.1016/j.jcyt.2014.08.009 25442786
Watson, N. et al. Discarded Wharton jelly of the human umbilical cord: A viable source for mesenchymal stromal cells. Cytotherapy 17, 18–24 (2015).25442786 10.1016/j.jcyt.2014.08.009
13. Saben J Distinct adipogenic differentiation phenotypes of human umbilical cord mesenchymal cells dependent on adipogenic conditions Exp. Biol. Med. (Maywood) 2014 239 1340 1351 10.1177/1535370214539225 24951473
Saben, J. et al. Distinct adipogenic differentiation phenotypes of human umbilical cord mesenchymal cells dependent on adipogenic conditions. Exp. Biol. Med. (Maywood) 239, 1340–1351. 10.1177/1535370214539225 (2014).24951473 10.1177/1535370214539225
14. Persson M Osteogenic differentiation of human mesenchymal stem cells in a 3D woven scaffold Sci. Rep. 2018 8 10457 10.1038/s41598-018-28699-x 29993043
Persson, M. et al. Osteogenic differentiation of human mesenchymal stem cells in a 3D woven scaffold. Sci. Rep. 8, 10457. 10.1038/s41598-018-28699-x (2018).29993043 10.1038/s41598-018-28699-x
15. Karahuseyinoglu S Biology of stem cells in human umbilical cord stroma: In situ and in vitro surveys Stem Cells 2007 25 319 331 10.1634/stemcells.2006-0286 17053211
Karahuseyinoglu, S. et al. Biology of stem cells in human umbilical cord stroma: In situ and in vitro surveys. Stem Cells 25, 319–331. 10.1634/stemcells.2006-0286 (2007).17053211 10.1634/stemcells.2006-0286
16. Seyyedin S Shojaei M Fallah H Khosravi A Nematollahi-Mahani SN Effects of green light-emitting diode irradiation on neural differentiation of human umbilical cord matrix-derived mesenchymal cells; Involvement of MAPK pathway Biochem. Biophys. Res. Commun. 2022 637 259 266 10.1016/j.bbrc.2022.11.028 36410275
Seyyedin, S., Shojaei, M., Fallah, H., Khosravi, A. & Nematollahi-Mahani, S. N. Effects of green light-emitting diode irradiation on neural differentiation of human umbilical cord matrix-derived mesenchymal cells; Involvement of MAPK pathway. Biochem. Biophys. Res. Commun. 637, 259–266 (2022).36410275 10.1016/j.bbrc.2022.11.028
17. Zein R Selting W Hamblin MR Review of light parameters and photobiomodulation efficacy: Dive into complexity J. Biomed. Opt. 2018 23 1 17 10.1117/1.Jbo.23.12.120901 30550048
Zein, R., Selting, W. & Hamblin, M. R. Review of light parameters and photobiomodulation efficacy: Dive into complexity. J. Biomed. Opt. 23, 1–17. 10.1117/1.Jbo.23.12.120901 (2018).30550048 10.1117/1.Jbo.23.12.120901
18. de Freitas LF Hamblin MR Proposed mechanisms of photobiomodulation or low-level light therapy IEEE J. Sel. Top. Quantum Electron. 2016 10.1109/jstqe.2016.2561201 28070154
de Freitas, L. F. & Hamblin, M. R. Proposed mechanisms of photobiomodulation or low-level light therapy. IEEE J. Sel. Top. Quantum Electron.10.1109/jstqe.2016.2561201 (2016).28070154 10.1109/jstqe.2016.2561201
19. Serrage H Under the spotlight: Mechanisms of photobiomodulation concentrating on blue and green light Photochem. Photobiol. Sci. 2019 18 1877 1909 10.1039/c9pp00089e 31183484
Serrage, H. et al. Under the spotlight: Mechanisms of photobiomodulation concentrating on blue and green light. Photochem. Photobiol. Sci. 18, 1877–1909. 10.1039/c9pp00089e (2019).31183484 10.1039/c9pp00089e
20. Wang Y Huang YY Wang Y Lyu P Hamblin MR Photobiomodulation (blue and green light) encourages osteoblastic-differentiation of human adipose-derived stem cells: Role of intracellular calcium and light-gated ion channels Sci. Rep. 2016 6 33719 10.1038/srep33719 27650508
Wang, Y., Huang, Y. Y., Wang, Y., Lyu, P. & Hamblin, M. R. Photobiomodulation (blue and green light) encourages osteoblastic-differentiation of human adipose-derived stem cells: Role of intracellular calcium and light-gated ion channels. Sci. Rep. 6, 33719. 10.1038/srep33719 (2016).27650508 10.1038/srep33719
21. Chang S-Y Carpena NT Kang BJ Lee MY Effects of photobiomodulation on stem cells important for regenerative medicine Med. Lasers Eng. Basic Res. Clin. Appl. 2020 9 134 141
Chang, S.-Y., Carpena, N. T., Kang, B. J. & Lee, M. Y. Effects of photobiomodulation on stem cells important for regenerative medicine. Med. Lasers Eng. Basic Res. Clin. Appl. 9, 134–141 (2020).
22. Maden M Retinoic acid in the development, regeneration and maintenance of the nervous system Nat. Rev. Neurosci. 2007 8 755 765 10.1038/nrn2212 17882253
Maden, M. Retinoic acid in the development, regeneration and maintenance of the nervous system. Nat. Rev. Neurosci. 8, 755–765. 10.1038/nrn2212 (2007).17882253 10.1038/nrn2212
23. Hernández R Differentiation of human mesenchymal stem cells towards neuronal lineage: Clinical trials in nervous system disorders Biomol. Ther. (Seoul) 2020 28 34 44 10.4062/biomolther.2019.065 31649208
Hernández, R. et al. Differentiation of human mesenchymal stem cells towards neuronal lineage: Clinical trials in nervous system disorders. Biomol. Ther. (Seoul) 28, 34–44. 10.4062/biomolther.2019.065 (2020).31649208 10.4062/biomolther.2019.065
24. Jin W Xu YP Yang AH Xing YQ In vitro induction and differentiation of umbilical cord mesenchymal stem cells into neuron-like cells by all-trans retinoic acid Int. J. Ophthalmol. 2015 8 250 256 10.3980/j.issn.2222-3959.2015.02.07 25938036
Jin, W., Xu, Y. P., Yang, A. H. & Xing, Y. Q. In vitro induction and differentiation of umbilical cord mesenchymal stem cells into neuron-like cells by all-trans retinoic acid. Int. J. Ophthalmol. 8, 250–256. 10.3980/j.issn.2222-3959.2015.02.07 (2015).25938036 10.3980/j.issn.2222-3959.2015.02.07
25. Salehinejad P Neural differentiation of human umbilical cord matrix-derived mesenchymal cells under special culture conditions Cytotechnology 2015 67 449 460 10.1007/s10616-014-9703-6 25344875
Salehinejad, P. et al. Neural differentiation of human umbilical cord matrix-derived mesenchymal cells under special culture conditions. Cytotechnology 67, 449–460. 10.1007/s10616-014-9703-6 (2015).25344875 10.1007/s10616-014-9703-6
26. de Freitas LF Hamblin MR Proposed mechanisms of photobiomodulation or low-level light therapy IEEE J. Sel. Top. Quantum Electron. 2016 22 348 364 10.1109/JSTQE.2016.2561201
de Freitas, L. F. & Hamblin, M. R. Proposed mechanisms of photobiomodulation or low-level light therapy. IEEE J. Sel. Top. Quantum Electron. 22, 348–364 (2016).10.1109/JSTQE.2016.2561201
27. Wong-Riley MT Photobiomodulation directly benefits primary neurons functionally inactivated by toxins: Role of cytochrome c oxidase J. Biol. Chem. 2005 280 4761 4771 10.1074/jbc.M409650200 15557336
Wong-Riley, M. T. et al. Photobiomodulation directly benefits primary neurons functionally inactivated by toxins: Role of cytochrome c oxidase. J. Biol. Chem. 280, 4761–4771 (2005).15557336 10.1074/jbc.M409650200
28. Topaloglu N Bakay E Mechanistic approaches to the light-induced neural cell differentiation: Photobiomodulation vs low-dose photodynamic therapy Photodiagn. Photodyn. Ther. 2022 37 102702 10.1016/j.pdpdt.2021.102702
Topaloglu, N. & Bakay, E. Mechanistic approaches to the light-induced neural cell differentiation: Photobiomodulation vs low-dose photodynamic therapy. Photodiagn. Photodyn. Ther. 37, 102702 (2022).10.1016/j.pdpdt.2021.102702
29. Bernal A Arranz L Nestin-expressing progenitor cells: Function, identity and therapeutic implications Cell. Mol. Life Sci. 2018 75 2177 2195 10.1007/s00018-018-2794-z 29541793
Bernal, A. & Arranz, L. Nestin-expressing progenitor cells: Function, identity and therapeutic implications. Cell. Mol. Life Sci. 75, 2177–2195. 10.1007/s00018-018-2794-z (2018).29541793 10.1007/s00018-018-2794-z
30. Park D Nestin is required for the proper self-renewal of neural stem cells Stem Cells 2010 28 2162 2171 10.1002/stem.541 20963821
Park, D. et al. Nestin is required for the proper self-renewal of neural stem cells. Stem Cells 28, 2162–2171. 10.1002/stem.541 (2010).20963821 10.1002/stem.541
31. Eftekhar-Vaghefi SH Zahmatkesh L Salehinejad P Totonchi S Shams-Ara A Evaluation of neurogenic potential of human umbilical cord mesenchymal cells; A time-and concentration-dependent manner Iran. Biomed. J. 2015 19 82 25864812
Eftekhar-Vaghefi, S. H., Zahmatkesh, L., Salehinejad, P., Totonchi, S. & Shams-Ara, A. Evaluation of neurogenic potential of human umbilical cord mesenchymal cells; A time-and concentration-dependent manner. Iran. Biomed. J. 19, 82 (2015).25864812
32. Sheikhbahaei F Khazaei M Nematollahi-Mahani SN Teucrium polium extract enhances the anti-angiogenesis effect of tranilast on human umbilical vein endothelial cells Adv. Pharm. Bull. 2018 8 131 10.15171/apb.2018.016 29670848
Sheikhbahaei, F., Khazaei, M. & Nematollahi-Mahani, S. N. Teucrium polium extract enhances the anti-angiogenesis effect of tranilast on human umbilical vein endothelial cells. Adv. Pharm. Bull. 8, 131 (2018).29670848 10.15171/apb.2018.016
33. Babaee A Nematollahi-Mahani SN Dehghani-Soltani S Shojaei M Ezzatabadipour M Photobiomodulation and gametogenic potential of human Wharton's jelly-derived mesenchymal cells Biochem. Biophys. Res. Commun. 2019 514 239 245 10.1016/j.bbrc.2019.04.059 31029424
Babaee, A., Nematollahi-Mahani, S. N., Dehghani-Soltani, S., Shojaei, M. & Ezzatabadipour, M. Photobiomodulation and gametogenic potential of human Wharton’s jelly-derived mesenchymal cells. Biochem. Biophys. Res. Commun. 514, 239–245. 10.1016/j.bbrc.2019.04.059 (2019).31029424 10.1016/j.bbrc.2019.04.059
34. Babaee A Nematollahi-Mahani SN Shojaei M Dehghani-Soltani S Ezzatabadipour M Effects of polarized and non-polarized red-light irradiation on proliferation of human Wharton's jelly-derived mesenchymal cells Biochem. Biophys. Res. Commun. 2018 504 871 877 10.1016/j.bbrc.2018.09.010 30219226
Babaee, A., Nematollahi-Mahani, S. N., Shojaei, M., Dehghani-Soltani, S. & Ezzatabadipour, M. Effects of polarized and non-polarized red-light irradiation on proliferation of human Wharton’s jelly-derived mesenchymal cells. Biochem. Biophys. Res. Commun. 504, 871–877 (2018).30219226 10.1016/j.bbrc.2018.09.010
35. Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method Methods 2001 25 402 408 10.1006/meth.2001.1262 11846609
Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–408. 10.1006/meth.2001.1262 (2001).11846609 10.1006/meth.2001.1262
