
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39256453
71629
10.1038/s41598-024-71629-3
Article
Anti-liver tumor ingredient exploration and validation of Elephantopus tomentosus Linn. by combining in silico and in vitro experiments
Zeng Zhihao 12
Jia Canchao 12
Li Lingjie 45
Jia Dezheng 12
Tang Ruiyin 12
Li Yangxue 23
Xiao Guanlin 23
Jiang Jieyi 23
Xu Aili 23
Liu Yanchang 12
Cai Dake caidake@foxmail.com

4
Bi Xiaoli zyfxyjs@gzucm.edu.cn

23
1 https://ror.org/03qb7bg95 grid.411866.c 0000 0000 8848 7685 School of the Fifth Clinical Medicine, Guangzhou University of Chinese Medicine, Guangzhou, 510405 Guangdong China
2 Guangdong Province Engineering Technology Research Institute of Traditional Chinese Medicine, No. 60 Hengfu Road, Yuexiu District, Guangzhou, 510095 Guangdong China
3 grid.484195.5 Guangdong Provincial Key Laboratory of Research and Development in Traditional Chinese Medicine, Guangzhou, 510095 Guangdong China
4 grid.413405.7 0000 0004 1808 0686 Department of Pharmacy, Guangdong Provincial People’s Hospital, Guangdong Academy of Medical Sciences, #106, Zhongshan Er Road, Yuexiu District, Guangzhou, 510080 Guangdong China
5 grid.411866.c 0000 0000 8848 7685 Guangzhou University of Chinese Medicine, Guangzhou, 510405 China
10 9 2024
10 9 2024
2024
14 2108621 12 2023
29 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Elephantopus tomentosus (ET) Linn. was reported to be an anti-tumor plant. However, the chemical composition of ET and its anti-tumor compounds and potential mechanisms still unclear. In this paper, UPLC-Q-TOF–MS/MS was firstly used to identified the ingredients in ET and UPLC was used to determine the main compounds of ET. Network pharmacology was applied to predict the potential mechanisms of anti-liver cancer. Anti-tumor nuclear activate compounds and targets of ET were obtained and the anti-liver cancer effect was validated on HepG2. Finally, Molecule docking, RT-qPCR, and western blotting were used for verification of the relationship between nuclear activate compounds and nuclear targets and the potential anti-cancer mechanisms. The result showed that 42 compounds were identified in ET, which consisted of sesquiterpene lactones, flavonoids, and phenylpropanoid compounds. Scabertopin (ST), chlorogenic acid, Isochlorogenic acid B, Isochlorogenic acid A and Isochlorogenic acid C were identified as main compounds and were determined as 0.426%, 0.457%, 0.159%, 0.701%, and 0.103% respectively. 24 compounds showed high pharmacokinetics and good drug-likeness. 520 overlapping targets of the ET compounds and liver cancer were collected. The targets were used for KEGG and GO analysis. GO enrichment analysis suggested that the targets of 24 active compound closed related to promote apoptosis, inhibit proliferation, and regulate oxidative levels. KEGG enrichment analysis suggested that pathway in cancer was enriched most and p38 MAPK/p53 signaling pathway, which closely related to promoting apoptosis and inhibiting proliferation. Compounds-targets analysis based on the parameter of Betweenness, Closeness, Information, Eigenvector, Degree, and component content indicated that ST was the nucleus anti-tumor active compound of ET. HepG2 was first used to validated the anti-tumor effect of ST and the result showed that ST significantly inhibited HepG2 proliferation with a low IC50 less than 5 μM. Nucleus active compound targets, including TP53, CASP3, BCL2, EGFR, TNF-a, IL-1β, and IL-6 were enriched based on degree value of PPI analysis. Molecule docking suggested that ST showed a good combination to TGFBR1 with the combination energy less than − 5 kcal/mol. RT-qPCR result also suggested that ST significantly medicated the mRNA expression level of TP53, CASP3, BCL2, EGFR, TNF-a, IL-1β, and IL-6. Protein expression of p-p38/p38 and p-p53/p53 notable increased by ST treatment. In conclude, combining with UPLC-Q-TOF–MS/MS qualitative analysis, UPLC quantitative analysis, network pharmacology analysis, molecule docking, and in vitro experiments on HepG2, we suggest that ST is an anti-tumor ingredient of ET, which may target to TGFBR1 and promote apoptosis and inhibited proliferation of HepG2 by activating p38 MAPK/p53 signaling pathway. ST can be regarded as a quality marker of ET.

Keywords

Elephantopus tomentosus Linn.
UPLC-Q-TOF–MS/MS
Network pharmacology
Anti-tumor activity
HepG2
Scabertopin
Subject terms

Biochemistry
Cancer
Cell biology
Drug discovery
Immunology
Biomarkers
Diseases
Medical research
Molecular medicine
Scientific Research Project of Traditional Chinese Medicine Bureau of Guangdong Province20212120 Jia Canchao http://dx.doi.org/10.13039/501100007162 Guangdong Provincial Department of Science and Technology 2022A1515220171 Liu Yanchang issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Liver cancer is the sixth most malignancy all over the world and people die of liver cancer is second only to lung cancer. More seriously, incidence rate of liver cancer is getting higher and higher and it will be a societal burden and bring great health challenge to human beings1. Interaction between liver metabolic disease, such as obesity, fatty liver, and cirrhosis, and liver cancer make the treatment of liver cancer more complex2. Meanwhile, inflammatory responses, anomalies in the cell cycle, and immune dysfunction may cause liver cancer singly or in combination3. Current drugs were not satisfactory for liver cancer patients suffering from complex conditions and diverse etiologies disease. Therefore, exploring alternative treatment drugs and methods is still urgent.

Traditional Chinese medicine (TCM) played an important role in combating liver cancer and has attracted more and more attention all over the world. Traditional Chinese medicine adopts a dialectical approach to treatment, which highlights better therapeutic effects in the face of complex diseases. In addition, TCM attenuated toxic and side effects of chemotherapy and radiotherapy. Therefore, TCM was widely used in clinical practice4,5. Therefore, exploring anti-liver cancer drugs from TCM show a widely prospect.

Elephantopus tomentosus Linn (ET) is a traditional medicine similar to Elephantopus scaber Linn, which are widely used to treat cold, hepatitis, bronchitis, fever, the cough associated with pneumonia, and arthralgia in south of China, Hong Kong, Macao and Taiwan areas6,7. Previous research suggested that ET have anti-inflammatory, antibacterial, antiviral, and anticancer activities8–10. Since 1970s, American and Japanese scholars have successively discovered sesquiterpene lactones compounds from ET, which show obvious anti-tumor activity11,12. In recent years, more and more scholars played attention to ET and different kinds of compounds of ET has been found and identified and most of the compounds showed significant anti-cancer effect13. Therefore, in this study, the chemical components of ET were analyzed by UPLC-Q-TOF–MS/MS and the main compounds’ content was determined. Network pharmacology was applied to predict the potential mechanisms, nuclear activate compounds and targets of ET and validated on HepG2. Finally, Molecule docking and RT-qPCR were used for verification of the relationship between compounds and targets and the potential anti-cancer mechanisms. Our aim was to explore chemical composition of ET and its anti-liver cancer compounds and potential mechanisms, which finally provide alternative treatment options for liver cancer.

Materials and methods

Materials

Methanol, formic acid, and acetonitrile of MS grade were purchased from Thermo Fisher Scientific (Thermo, United States). Laboratory-deionized water was generated by a Milli-Q water purification system (Millipore, United States). The fresh whole plants of ET were contributed by the Medicinal Botanical Garden of Guangzhou University of Chinese Medicine (Guangzhou, China) in September 2022 and were identified as Elephantopus tomentosus Linn. by Professors Fajin Liu (Guangdong Provincial Engineering Technology Research Institute of Traditional Chinese Medicine, Guangdong, China). ET samples were dried at 45 °C until reaching a constant weight and the voucher specimen (No. ET2022091001) was deposited at Guangdong Province Engineering Technology Research Institute of Traditional Chinese Medicine, Guangzhou, China. The dried ET was grinded into fine powder and stored at – 20 °C before analysis. Primary anti-BCL-2, anti-CASP3, anti-p38, anti-p-p38 anti-p53, and anti-p-p53 were purchased from HuaBio (Hangzhou, China).

The preparation of ET sample solution and standard solution

1.0 g ET powder was accurately weighed and placed into a 150 flat-bottomed conical flask and immersed in 20 mL 70% methanol water. Then, ultrasound extraction was performed for 30 min. Last, ET sample was obtained by filtrating through a 0.22 μm filter membrane. All the standards (≥ 95% purity, HPLC), including, chlorogenic acid, sochlorogenic acid A, isochlorogenic acid B, isochlorogenic acid C, and ST were purchased from Chengdu Herbpurify Co., Ltd (Chengdu, China). The standards were weighted and dissolved in methanol (MS grade) for being analyzed.

UPLC-Q-TOF–MS/MS analysis conditions

Liquid chromatography analysis was performed on a SHIMADZU Exion LC system (Japan) with an Acquity BEH C18 column (100 × 2.1 mm, 1.7 μm, Waters, MA, USA) and the mobile phase consisted of 0.1% formic acid aqueous solution (A) and methanol (B) : 0 ~ 3 min, 5 ~ 20% B; 3 ~ 7 min, 20% ~ 45% B; 7 ~ 12 min, 45% ~ 55% B, 12 ~ 20 min, 55% ~ 70% B, 20 ~ 25 min, 70% ~ 88% B, 25 ~ 27 min, 88% ~ 100% B. The flow rate was 0.25 mL/min with the column temperature fixed at 40 °C and the injection volume was 1.0 μL.

The MS analysis was conducted by using an AB SCIEX X500R Q-TOF–MS/MS system (United States) with an electrospray ionization (ESI). The instrumental settings of Q-TOF–MS/MS were as follows: ion source gas 1 and gas 2 were both 50 psi, curtain gas was 35 psi, ion source temperature was 500 °C, an ion-spray voltage of + 5500/− 4500 V, a declustering potential voltage of 100/− 80 V and a collision energy of ± 35 V, collision energy spread was 15 V. ET Samples were analyzed in both negative and positive ionization modes with scanning mass-to-charge (m/z) range from 100 to 1500. Data was collected in information-dependent acquisition (IDA) mode.

UPLC analysis conditions

UPLC analysis was carried out on a UPLC (2695, Waters, American), connecting with a CORTECS UPLC C18 column (2.1 × 150 mm,1.6 µm, Waters, American). The mobile phase consisted of acetonitrile (B) and 0.1 formic acid aqueous solvent (D) as follows: 0 ~ 5 min, 10 ~ 15% B; 5 ~ 10 min, 15% ~ 20% B; 10 ~ 15 min, 20% ~ 25% B, 15 ~ 20 min, 25% ~ 35% B, 20 ~ 25 min, 35% ~ 95% B, 25 ~ 30 min, 95% ~ 95% B 30 ~ 35 min, 10% ~ 10% B. The flow rate was 0.20 mL/min and the volume temperature fixed at 30 °C. The injection volume was 1.0 µL and the detection wavelength was set at 240 nm.

Network pharmacology

Compounds identified with Pharmacokinetic properties Gatrointestinal absorption as High, and two of druglikeness (Lipinski filter, Ghose filter, Veber filter, Egan filter, and Muegge filter) as high in SwissADME (http://www.swissadme.ch/) or OB ≥ 30% and DL ≥ 0.18 in TCMSP (https://tcmsp-e.com/tcmsp.php) were saved as active ingredients. The active ingredients were submitted to TCMSP (https://tcmsp-e.com/tcmsp.php), HIT (http://www.badd-cao.net:2345/textmining), and SwissTargetPrediction (http://www.swisstargetprediction.ch/, the parameter of probability ≥ 0.10) to figured out the potential targets of ET. Liver cancer potential targets were collected from DisGeNET (https://www.disgenet.org/) database with the Score_gda ≥ 0.10, GeneCards (https://www.genecards.org/) database with relevance score ≥ 10.00, and OMIM (https://omim.org/) database and the union target was obtained for further study. The hub target of compound targets and disease targets was figure out by Venny 2.1.0 (https://bioinfogp.cnb.csic.es/tools/venny/) analysis. Hub targets were input to Cytoscape3.7.0 (https://github.com/cytoscape/cytoscape/releases/3.7.0/)14 to conduct compound-targets network and submitted to STRING (https://cn.string-db.org/) to create a protein–protein interaction (PPI) network. Hub targets were used for Kyto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment15–17 and construct Gene Ontology (GO) biological functions enrichment analysis on metascape (https://metascape.org/gp/) database with the conditions of p value less than 0.01, minimum count as 3, and enrichment factor > 1.5.

Nuclear ingredients and targets analysis

The overlapping compounds based on top 20 of Betweenness, Closeness, Information, Eigenvector, and Degree in compound-targets network and component content were regarded as nucleus active compound. Meanwhile, nucleus targets based on top 20 of Betweenness, Closeness, Information, Eigenvector, Degree, and Network in PPI network and Compound-targets network were figured out by venn analysis (https://www.bioinformatics.com.cn/).

Molecular docking analysis

The mol2 or PDB structure format files of the nuclear compounds were downloaded respectively from TCMSP (https://tcmsp-e.com/tcmsp.php) or PubChem (https://pubchem.ncbi.nlm.nih.gov/) database. PDB structure format files of the nuclear compounds were changed into mol2 structure format files by OpenBabel-3.1.1 (http://openbabel.org/). Mol2 structure format files of nuclear compounds were then input into AutoDock version 4.2.6 (https://autodock.scripps.edu/download-autodock4/) to add hydrogens, set as ligand, detect root, choose torsions, and save as “pdbqt” files. Meanwhile, PDB files of nuclear targets were downloaded from PDB database (https://www.rcsb.org/) and submitted to AutoDock version 4.2.6 to delete water, add hydrogens, choose as target, and save as “pdbqt” files. Nuclear compound and target in “pdbqt” files were input into AutoDock version 4.2.6 and a suitable grid box was set and then saved as “gpf” files. The “gpf” files was open in AutoDock version 4.2.6 and carried out “run autodrid”. After setting relevant parameter of docking, a “dpf” files was saved and finally carried out autodock running. 50 conformations were conducted in receptor–ligand interaction generation, and the best affinity was chosen as the final docking conformation and the binding energy ≤  − 5 kCal/mol was regarded as stable.

HepG2 cell culture and administrate

HepG2 cells were bought from National Collection of Authenticated Cell Culteres (China, Beijing) and cultured in MEM containing 10% fetal bovine serum (FBS, TransGen Biotech, China, Shanghai), 100 kU/L penicillin, and 100 mg/L streptomycin (TransGen Biotech, China, Shanghai) at 37 °C in a 5% CO2 humidified incubator. When HepG2 cells were in good condition, ST (5 μM) was added to the cell and incubated for 24 h.

HepG2 cell proliferation detection

HepG2 cells were seeded into 96-well plates at a density of 5000 cells/well. The effect of ST on cell viability was analyzed after treatment for 24 h at different concentration of 0, 1.25, 2.5, 5, and 10 μM. After treatment, 5% CCK8 (Solarbio, China, Beijing)/complete medium was added to the well and incubated for 1 h. Absorbance was measured at 490 nm using a microplate reader (Thermo scientific, United States) and proliferation inhibit ratio was calculated. The maximum safe concentration of the ST will be selected for the mechanism research.

Quantitative real-time PCR analysis

Total RNA was extracted from HepG2 cells using Trizol reagent (Thermo Fisher Scientific, United States). 0.5 μg total RNA was reverse transcribed into cDNA with the Evo M-MLV RT Premix for qPCR (Accurate Biology, China) kit. DNA amplification was conducted by using PerfectStayt Green qPCR SuperMix (TransGen Biotech, China) on a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific, United States). The primers sequences of nuclear genes were shown in Table 1. Relative mRNA levels were calculated by using 2−ΔΔct method and visualized by Graphpad Prism 7.0. (https://www.graphpad.com/scientific-software/prism/www.graphpad.com/scientific-software/prism/).Table 1 The primers sequences of nuclear genes.

Name	F	R	
TNF-α	GCTGCACTTTGGAGTGATCG	ATGAGGTACAGGCCCTCTGA	
IL-1β	TACCTGTCCTGCGTGTTGAAA	GGTGCTGATGTACCAGTTGGG	
IL-6	ATGAGGAGACTTGCCTGGTGAA	CTCTGGCTTGTTCCTCACTACTCTC	
TGF-β1	CCCACAACGAAATCTATGACAAG	GCTGAGGTATCGCCAGGAAT	
CASP3	TGGAAGCGAATCAATGGACTCT	TGAATGTTTCCCTGAGGTTTGC	
BCL2	GGAGGATTGTGGCCTTCTTTG	GCATCCCAGCCTCCGTTATC	
GAPDH	GGAAGCTTGTCATCAATGGAAATC	TGATGACCCTTTTGGCTCCC	

Western blotting analysis

HepG2 co-cultivated with ST were lysed by RIPA Buffer (Sigma, USA) and centrifuged with the condition of 4 °C, 12,000 rpm and 10 min. The protein content was measured using Pierce BCA Protein Assay Kit (Thermo, USA) and diluted with loading buffer (Beibokit, China) to 5 µg/μL. Protein in an equal amount were separated using SDS–polyacrylamide gel electrophoresis and transferred onto PVDF membranes (Bio-Rad, United States) integrally. PVDF membranes were cut open according to the target’s molecular mass based on the marker and then blocked with 5% skim milk and then washed by TBST (0.5% Tween-50), and incubated with various primary antibody at 4 °C overnight. Primary antibody was recovered and the membranes were incubated with anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:10,000 dilution, Abcam). After washing three times, the membranes were enhanced by chemiluminescence in the ECL reagents (Thermo Fisher Scientific, United States). The membranes were performed with the gel imaging analysis system (Tanon 5220 multi, China) and the image was acquired by Tanon Gis (Tanon 5220 multi, China). Some of the membranes were regenerated and incubated with another primary antibody and anti-rabbit horseradish peroxidase-conjugated secondary antibody and finally performed with the gel imaging analysis system. The gray value was determined with Image J 64-bit (https://imagej.net/ij/download.html)software and visualized by Graphpad Prism 7.0.

Statistical analysis

All experiments were performed independently at least three times and the results were recorded as the mean ± SEM. A one-way ANOVA in SPSS 20.0 software (https://www.ibm.com/support/pages/downloading-ibm-spss-statistics-20) was used to analyze the means between different groups. Differences were considered statistically significant when p < 0.05 in this study.

Results

Ingredient analysis and identification

The total ion chromatography (TIC) of ET in positive and negative ion modes was shown in Fig. 1. A total of 42 chemical constituents (shown in Table 2) were identified in ET by comparing to the reference standard, chromatographic elution behaviors, mass fragment patterns, and mass spectral data in Pubchem (https://pubchem.ncbi.nlm.nih.gov/), Scifinder (https://sso.cas.org/), and CNKI (https://www.cnki.net/).Fig. 1 The total ion chromatography (TIC) of ET in positive(A) and negative (B) ion modes.

Table 2 Chemical constituents of ET.

No.	Adduct/charge	Component name	Retention time	Formula	Found at mass	Mass error (ppm)	
1	[M−H]−	Quinic acid	1.166	C7H12O6	191.0559	− 1.1	
2	[M−H]−	l-Malic acid	1.310	C4H6O5	133.0140	− 1.6	
3	[M−H]−	Maleic acid	1.311	C4H4O4	115.0039	1.5	
4	[M + H]+ 	Piceatannol	1.737	C14H12O4	245.0774	− 14.0	
5	[M−H]−	2-Hydroxyadenosine	2.314	C10H13N5O5	282.0856	4.2	
6	[M−H]−	Guanosine	2.314	C10H13N5O5	282.0856	4.2	
7	[M−H]−	Protocatechuic acid	3.675	C7H6O4	153.0200	4.4	
8	[M−H]−	Neochlorogenic acid	4.052	C16H18O9	353.0874	− 1.1	
9	[M + H]+ 	Daphnetin	4.584	C9H6O4	179.0345	3.2	
10	[M−H]−	Protocatechuic aldehyde	4.600	C7H6O3	137.0246	1.3	
11	[M−H]−	Chlorogenic acid	5.326	C16H18O9	353.0872	− 1.7	
12	[M−H]−	Esculetin	5.583	C9H6O4	177.0195	0.9	
13	[M−H]−	Cryptochlorogenic acid	5.589	C16H18O9	353.0873	− 1.5	
14	[M + H]+ 	7-Hydroxycoumarine	5.593	C9H6O3	163.0389	− 0.3	
15	[M−H]−	Caffeic acid	5.834	C9H8O4	179.0351	0.9	
16	[M−H]−	Schaftoside	7.196	C26H28O14	563.1406	0.0	
17	[M−H]−	Isochlorogenic acid B	7.684	C25H24O12	515.1186	− 1.8	
18	[M−H]−	Isochlorogenic acid A	7.970	C25H24O12	515.1186	− 1.8	
19	[M + H]+ 	Aempferol-3-O-rutinoside	8.089	C27H30O15	595.1655	− 0.5	
20	[M−H]−	Luteolin-7-O-β-d-glucuronide	8.121	C21H18O12	461.0728	0.6	
21	[M−H]−	(−)-Syringaresinol 4-O-β-d-glucopyranoside	8.245	C28H36O13	579.2086	2.4	
22	[M−H]−	Isoquercitrin	8.316	C21H20O12	463.0886	3.2	
23	[M−H]−	Isochlorogenic acid C	8.685	C25H24O12	515.1186	− 1.8	
24	[M−H]−	Ferulic acid	8.722	C10H10O4	193.0514	9.8	
25	[M + H]+ 	Rhoifolin	8.731	C27H30O14	579.1726	3.0	
26	[M−H]−	Apigenin 7-O-β-d-glucuronide	8.843	C21H18O11	445.0778	0.3	
27	[M + H]+ 	Sophoricoside	8.848	C21H20O10	433.1143	3.3	
28	[M−H]−	Cosmosiin	8.850	C21H20O10	431.0995	2.7	
29	[M−H]−	Luteoloside	9.050	C21H20O11	447.0934	0.2	
30	[M + H]+ 	Elephantopin	9.291	C19H20O7	361.1291	2.4	
31	[M−H]−	Apigenin	9.967	C15H10O5	269.0463	2.8	
32	[M + H]+ 	Deoxyelephantopin	10.310	C19H20O6	345.1343	2.9	
33	[M + H]+ 	Quercetin	10.424	C15H10O7	303.0504	1.5	
34	[M−H]−	Molephantin	10.621	C19H22O6	345.2259	8.2	
35	[M + H]+ 	Isodeoxyelephantopin	10.658	C19H20O6	345.1339	1.7	
36	[M−H]−	Luteolin	10.960	C15H10O6	285.0399	− 2.0	
37	[M−H]−	Molephantinin	11.909	C20H24O6	359.1513	6.8	
38	[M + H]+ 	ST	11.942	C20H22O6	359.1495	1.5	
39	[M + H]+ 	IsoST	12.441	C20H22O6	359.1499	2.6	
40	[M−H]−	Tricin	12.590	C17H14O7	329.0675	5.7	
41	[M−H]−	Diosmetin	12.654	C16H12O6	299.0569	2.7	
42	[M + H]+ 	Linderane	15.030	C15H16O4	261.1127	2.1	

Quantification of 5 compounds in AT by UPLC

ST, chlorogenic acid, Isochlorogenic acid B, Isochlorogenic acid A and Isochlorogenic acid C were identified by reference standard and the content were determined by UPLC. UPLC (Fig. 2) exerted a good specificity between the mixed calibration solution and the sample solution. The results of the calibration curve (Supplementary Table 1) also exhibited a good linearity with correlation coefficient (R2) more than 0.999 and a wide concentration range. The precision, stability, repeatability and recovery represented as RSD values (Supplementary Table 2) were all less than 5.00%. All of the methodological validation results suggested that this method was accurate, reliable, sensitive, and considered suitable for accurately measuring the main compounds’ content in ET. The content of ST, chlorogenic acid, isochlorogenic acid B, isochlorogenic acid A, and isochlorogenic acid C in ET was measured as 0.426%, 0.457%, 0.159%, 0.701%, and 0.103% respectively.Fig. 2 UPLC of ET sample solution (A) and standard solution (B). 1 Chlorogenic acid. 2 Sochlorogenic acid B. 3 Sochlorogenic acid A. 4 Sochlorogenic acid C. 5 ST.

Screening of the active compounds

A total of 15 compounds showed high pharmacokinetic properties and drug likeness in SwissADME or OB ≥ 30% and DL ≥ 0.18 in TCMSP. These components were selected as the active components of ET. The detailed information of 15 active compounds was listed in Table 3.Table 3 15 active compounds of ET.

No.	Name	No.	Name	
1	Tricin	9	Diosmetin	
2	ST	10	Esculetin	
3	Quercetin	11	l-Malic	
4	Molephantinin	12	Maleic acid	
5	Luteolin	13	Protocatechuic aldehyde	
6	Isodeoxyelephantopin	14	Protocatechuic acid	
7	Elephantopin	15	7-Hydroxycoumarine	
8	Apigenin			

Compounds-targets network and PPI-network analysis

Compounds-targets Network and PPI-network Analysis were carried out to enrich the nuclear ingredients and nuclear targets. In this study, a total of 532 targets of the active ingredients were collected from TCMSP, HIT, and Swiss Target Prediction databases. Meanwhile, 19,091 target of liver cancer from GeneCards, DisGenet, and OMIM databases were obtained by searching with the key word “Liver cancer”. Then, 520 overlapping targets (Supplementary Table 3) of compound targets liver cancer related targets were analyzed by screened by Vene analysis (Fig. 3A) and the overlapping targets were regarded as hub targets. Compounds-targets Network was established (Fig. 3B). 7 nuclear compounds, including Quercetin, ST, Luteolin, Isodeoxyelephantopin, 7-Hydroxycoumarine, Elephantopin, and Esculetin were obtained by analyzing the top 10 parameter of Betweenness, Closeness, Information, and Degree (Fig. 3C). Meanwhile, 520 overlapping targets were submitted to STRING to conduct PPI-network (Fig. 3D). AKT1, TP53, TNF, IL6, ALB, SRC, EGFR, IL1B, BCL2, and CASP3 were the top 10 nuclear genes (Fig. 3E) based on the parameter of degree.Fig. 3 Network pharmacology analysis. (A) Overlapping targets collected by vene analysis. (B) Compounds-targets Network. (C) Nuclear compounds enrichment. (D) PPI-network. (E) Nuclear targets enrichment.

GO and KEGG pathway enrichment

GO and KEGG pathway enrichment analysis of the overlapping targets was carried out using Metascape. GO enrichment analysis suggested that a total of 166 molecular function (MF) terms (Supplementary Table 4), 1033 biological process (BP) terms (Supplementary Table 5), and 106 cellular component (CC) terms (Supplementary Table 6) were obtained. The GO functions related to the treatment of liver cancer included execution phase of apoptosis (GO:0097194), regulation of reactive oxygen species biosynthetic process (GO:1903426), oxidoreductase activity (GO:0016491), positive regulation of programmed cell death (GO:0043068), positive regulation of programmed cell death (GO:0043068), negative regulation of cell population proliferation (GO:0008285), response to oxygen levels (GO:0070482), response to decreased oxygen levels (GO:0036293), cellular response to oxygen levels (GO:0071453), cellular response to decreased oxygen levels (GO:0036294), mostly related to promote apoptosis, inhibit proliferation, and regulate oxidative levels. The top 20 entries were respectively selected from MF, BP, and CC, in order of − lg p value (Fig. 4A–C).Fig. 4 GO and KEGG enrichment. (A) MF enrichment. (B) BP enrichment. (C) CC enrichment. (D) KEGG enrichment15–17.

KEGG analysis explored 188 signaling pathways (Supplementary Table 7) related to the 520 overlapping targets. The top 50 entries were selected depending on the − lg p value and showed in Fig. 4D. Among them, pathway in cancer (hsa05200) was significantly enriched in top 1, indicating the potential for anti-cancer activity of ET. Meanwhile, promoting apoptosis and inhibiting proliferation related signaling pathways, such as p53 signaling pathway (hsa04115) and MAPK signaling pathway (hsa04010) also collected.

Molecular docking results

According to the result of quantitative analysis, ST is one of the main chemical compounds of ET. Moreover, ST is a nuclear compound in anti-liver cancer network pharmacology analysis of ET, which has been reported to show anti-cancer effect in vitro18,19. Therefore, ST was chosen for further anti-cancer mechanical study. TGFBR1 is a membrane receptor for TGF-β1. Coincidentally, the activity of TGFBR1 is closely related to p38 MAPK/P53 signaling pathway. To further explored the relationship between the nuclear compounds and p38 MAPK/P53 signaling pathway. Molecular docking was used to present the binding affinities of ST and TGFBR1. The result was showed that ST had good binding affinities to TGFBR1, with the binding affinity energy as − 9.3 kcal/mol, suggesting ST may mediate p38 MAPK/P53 signaling pathway by binding to TGFBR1.

ST promote the apoptosis of HepG2

The anti-liver cancer effect on HepG2 was validated in this study. The date revealed that the cell morphology of HepG2 significantly changed after co-culturing with ST at a concentration of 10 μM for 24 h (Fig. 5A–E). CCK8 results also indicated that ST notably inhibited the cell viability of HepG2 in 10 μM when compared with control group (Fig. 5F). Therefore, ST at a concentration of 5 μM and co-culturing for 24 h was chose for further mechanical study in HepG2. Cell morphology changing and cell viability decreasing indicated that ST showed anti-liver cancer effect by inducing cell apoptosis.Fig. 5 ST inhibited the proliferation of HepG2. (A) Cell morphology in control group (0 µM). (B) Cell morphology in 1.25 µM. (C) Cell morphology in 2.50 µM. (D) Cell morphology in 5.00 µM. (E) Cell morphology in 10.00 µM. (F) Cell viability of different doses of ET after treatment for 24. Data are shown as mean ± standard deviation from three independent experiments. *p < 0.05 versus the control.

ST regulated apoptosis related nuclear genes’ expression in mRNA level

Previous study indicated that abnormal expression of CASP320, TNF-α21, IL622, IL1β23, BCL224, and TP5325 in mRNA level closely related to the proliferation or apoptosis of cancer cells. Quantitative Real-Time PCR result reveal that ST downregulated BCL2, IL6, TNF-α, IL1β, and EGFR while upregulated CASP3 and TP53 in mRNA level when compared with control group (Fig. 6).Fig. 6 ST regulated apoptosis related nuclear genes’ expression in mRNA level. (A) The mRNA levels of TP53. (B) The mRNA levels of CASP3. (C) The mRNA levels of BCL2. (D) The mRNA levels of TNF-α. (E) The mRNA levels of IL-1β. (F) The mRNA levels of IL-6. GAPDH was used for normalization. *p < 0.05 versus the control.

ST promote apoptosis of HepG2 via p38 MAPK/p53 signaling pathway

Core proteins of p38 MAPK/p53 signaling pathway in HepG2 were detected by western blotting (Fig. 7). The result indicated that ST notably promoted the protein expression level of p-p38/p38 (p < 0.05) and p-p53/p53 (p < 0.05), indicating ST significantly active p38 MAPK/p53 signaling pathway in HepG2. Meanwhile, BCL-2 and CASP3, core targets of network pharmacology, closely related to cell apoptosis were inhibited and promoted respectively, indicating ST promote apoptosis of HepG2.Fig. 7 ST promote apoptosis of HepG2 via p38 MAPK/p53 signaling pathway. (A) The protein levels of p-p53, p53, p-p38, p38, CASP3, and BCL-2 in HepG2 cells treated with ST for 24 h were determined by Western blot analysis. (B) Quantitative analysis of BCL-2, CASP3, p-p38/p38, and p-p53/p53. GAPDH was used as the loading control. *p < 0.05 versus the control.

Discussion

Liver cancer is the fourth leading cause of cancer death all over the world26 with an estimated incidence of > 1 million cases by 202527. Nowadays, surgical interventions are regarded as the most effective approach for liver cancer. However, extrahepatic metastasis only suitable for limited patients28. Meanwhile, current liver cancer drugs, such as Sorafenib, usually exert limited effects but bring with many side effects and hepatotoxicity29. Therefore, excavating alternative treatment for liver cancer is still urgent needed.

Natural compounds may exert better outcomes in anti-cancer1. Moreover, taking traditional herb medicine with anti-cancer effect natural compounds show fewer side effects and lower systemic toxicity30. ET have long been used as a folk traditional medicine in south of China6. Sesquiterpene lactones from ET show significant anti-cancer activity6. Herein, UPLC-Q-TOF–MS/MS qualitative analysis, UPLC quantitative analysis and network pharmacology analysis by combining ET and liver-cancer were used to predict the anti-liver cancer ingredients in ET. The result indicated that ST, a sesquiterpene lactone compound, is a nuclear compound in anti-liver cancer.

Anti-liver cancer effect of ST was validated on HepG2 and ST significantly inhibited the proliferation of HepG2 in a concentration of 10 µM. Molecule docking, RT-qPCR, and western blotting were applied to explore the anti-liver cancer potential mechanism of ST. Molecule docking result indicated that ST showed a stable binding with TGFBR1, which is a cell membrane receptor and a key upstream protein of p38MAPK signaling pathway. RT-qPCR experiment also confirmed that TP53, the tumor suppressor gene25 and the core downstream gene of p38MAPK signaling pathway, was notably upregulated by ST treatment in HepG2, indicating that ST may bind to TGFBR1 and activate p38MAPK/p53 signaling pathway, which inhibited proliferation and promoted apoptosis31,32.

BCL-2 is an anti-apoptotic gene, which forms heterodimers with BAX. The BAX/BCL-2 ratio plays a role in the balance of apoptosis33. BAX is an important TP53 target34. Activating TP53 may in turn increases BAX protein expression, activates CASP3 protein expression and subsequently induces apoptosis35. In this study, we carried out in vitro experiment to demonstrate that ST promote apoptosis by upregulate TP53, CASP3 and downregulate BCL2 in mRNA and protein expression level, suggesting ST may induce apoptosis of HepG2 by activating TP53/CASP3 signaling pathway.

Hepatocellular carcinoma (HCC) is one of the most common liver cancer worldwide, which accounts for more than 80% of primary liver cancer36. It’s suggested that the inflammatory micro-environment promotes the stemness properties and metastatic potential of HCC37. Modulating the inflammatory microenvironment may provide an efficient therapy for cancer38. IL-1β, IL-6, and TNF-α are the crucial inflammatory cytokines and have been proved to influence the progression liver cancer39–41. In this study, nuclear inflammatory genes IL-1β, IL-6, and TNF-α were enriched via network pharmacology analysis. In vitro experiment indicated that the nuclear compound ST inhibited the mRNA expression level of IL-1β, IL-6, TNF-α and the cell proliferation of HepG2, verifying the prediction of network pharmacology analysis and the view that inhibiting inflammatory responses may be an important approach to inhibiting the tumor progression of liver cancer effect or HCC42.

We previous suggested that ST showed a significantly inhibition on A54918, and the anti-cancer effect of ST was also validated on bladder cancer cell43. In this study, we firstly validated the anti-cancer effect of ST on HepG2 and elucidated the potential mechanism. ST, the second main compound of ET, can be regarded as Q-marker of ET, deserving deep study on efficacy and mechanism in vivo and providing anti-liver cancer an alternative treatment.

Conclusion

In summary, we first explored the chemical composition using UPLC-Q-TOF–MS/MS and 42 compounds were identified. Among the compounds being identified, ST, chlorogenic acid, Isochlorogenic acid B, Isochlorogenic acid A and Isochlorogenic acid C were the main compounds. Network pharmacology analysis suggested that ST is the core anti-liver cancer compound and the effect of ST in inhibiting HepG2 proliferation was first validated. Molecule docking date indicated that ST have a stable bind to TGFBR1, which is the upstream protein of p38MAPK signaling pathway. In vitro experiment on HepG2 demonstrated that ST promoted apoptosis by p38MAPK/p53 signaling pathway (Fig. 8). ST can be regarded as Q-marker of ET in the field of anti-cancer. ST can be a potential drug for treating liver cancer and in vivo anti-tumor research should be carried out to validate the effectiveness of inhibiting liver tumor growth.Fig. 8 ST, an anti-liver tumor ingredient of Elephantopus tomentosus Linn., promote apoptosis of HepG2 via p38 MAPK/p53 signaling pathway.

The permissions statement of collecting Elephantopus tomentosus Linn.

Elephantopus tomentosus Linn. is not a specie at risk of extinction plant, which widely grow in southern China. Elephantopus tomentosus Linn. in this study was planted in Medicinal Botanical Garden of Guangzhou University of Chinese Medicine (Guangzhou, China) and was allowed to collect by Zhan Lu, who is the administrator of the Medicinal Botanical Garden of Guangzhou University of Chinese Medicine. All the collection of Elephantopus tomentosus Linn. comply with relevant institutional, national, and international guidelines and legislation of Convention on the Trade in Endangered Species of Wild Fauna and Flora and IUCN Policy Statement on Research Involving Species at Risk of Extinctio.

Supplementary Information

Supplementary Information 1.

Supplementary Information 2.

Abbreviations

ET Elephantopus tomentosus Linn.

BCL-2 B-cell lymphoma-2

CASP3 Caspase-3

ESI Electrospray ionization

GO Gene ontology

IDA Information-dependent acquisition

KEGG Kyto encyclopedia of genes and genomes

MS Mass spectrometry

PPI Protein-protein interaction

Q-TOF Quadrupole-time of flight

RT-qPCR Real-time quantitative polymerase chain reaction

ST Scabertopin

TCM Traditional Chinese medicine

TIC Total ion chromatography

UPLC Ultra performance liquid chromatography

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-71629-3.

Acknowledgements

This study was supported by the Scientific Research Project of Traditional Chinese Medicine Bureau of Guangdong Province, China (Grant No. 20222016 and 20212120); Guangdong Provincial Department of Science and Technology, China (Grant No. 2022A1515220171). The permissions statement of collecting Elephantopus tomentosus Linn. Elephantopus tomentosus Linn. is not a specie at risk of extinction plant, which widely grow in southern China. Elephantopus tomentosus Linn. in this study was planted in Medicinal Botanical Garden of Guangzhou University of Chinese Medicine (Guangzhou, China) and was allowed to collect by Zhan Lu, who is the administrator of the Medicinal Botanical Garden of Guangzhou University of Chinese Medicine. All the collection of Elephantopus tomentosus Linn. comply with relevant institutional, national, and international guidelines and legislation of Convention on the Trade in Endangered Species of Wild Fauna and Flora and IUCN Policy Statement on Research Involving Species at Risk of Extinctio.

Author contributions

Z.Z. and C.J. carried out most of the in vitro experiments, screened for active compound via Network pharmacology and molecular docking and wrote the original draft, contributed equally to this work. G.X. carried out the experiments of UPLC-Q-TOF-MS/MS. L.L., D.J., R.T., Y.L., J.J., A.X., and Y.L. assisted in compounds analysis or in vitro experiments. D.C., designed and supervised all the studies, and reviewed the manuscript. X.B., funding acquisition, designed and supervised all the studies.

Funding

This study was supported by the Scientific Research Project of Traditional Chinese Medicine Bureau of Guangdong Province, China (Grant No. 20222016 and 20212120); Guangdong Provincial Department of Science and Technology, China (Grant No. 2022A1515220171).

Data availability

All data generated or analyzed during this study are included in this published article and are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Zhihao Zeng and Canchao Jia.
==== Refs
References

1. Anwanwan D Singh SK Singh S Saikam V Singh R Challenges in liver cancer and possible treatment approaches Biochim. Biophys. Acta BBA Rev. Cancer. 2020 10.1016/j.bbcan.2019.188314
Anwanwan, D., Singh, S. K., Singh, S., Saikam, V. & Singh, R. Challenges in liver cancer and possible treatment approaches. Biochim. Biophys. Acta BBA Rev. Cancer.10.1016/j.bbcan.2019.188314 (2020).10.1016/j.bbcan.2019.188314
2. Marengo A Rosso C Bugianesi E Liver cancer: Connections with obesity, fatty liver, and cirrhosis Annu. Rev. Med. 2016 67 103 117 10.1146/annurev-med-090514-013832 26473416
Marengo, A., Rosso, C. & Bugianesi, E. Liver cancer: Connections with obesity, fatty liver, and cirrhosis. Annu. Rev. Med. 67, 103–117. 10.1146/annurev-med-090514-013832 (2016).26473416 10.1146/annurev-med-090514-013832
3. Singh AK Kumar R Pandey AK Hepatocellular carcinoma: Causes, mechanism of progression and biomarkers Curr. Chem. Genom. Transl. Med. 2018 12 9 26 10.2174/2213988501812010009 30069430
Singh, A. K., Kumar, R. & Pandey, A. K. Hepatocellular carcinoma: Causes, mechanism of progression and biomarkers. Curr. Chem. Genom. Transl. Med. 12, 9–26. 10.2174/2213988501812010009 (2018).30069430 10.2174/2213988501812010009
4. Liu Y Cellular senescence and cancer: Focusing on traditional Chinese medicine and natural products Cell Prolif. 2020 10.1111/cpr.12894 33382511
Liu, Y. et al. Cellular senescence and cancer: Focusing on traditional Chinese medicine and natural products. Cell Prolif.10.1111/cpr.12894 (2020).33382511 10.1111/cpr.12894
5. Xiang Y Guo Z Zhu P Chen J Huang Y Traditional Chinese medicine as a cancer treatment: Modern perspectives of ancient but advanced science Cancer Med. 2019 8 1958 1975 10.1002/cam4.2108 30945475
Xiang, Y., Guo, Z., Zhu, P., Chen, J. & Huang, Y. Traditional Chinese medicine as a cancer treatment: Modern perspectives of ancient but advanced science. Cancer Med. 8, 1958–1975. 10.1002/cam4.2108 (2019).30945475 10.1002/cam4.2108
6. Guo ZK Tomenphantadenine, an unprecedented germacranolide-adenine hybrid heterodimer from the medicinal plant Elephantopus tomentosus L Fitoterapia 2018 125 217 220 10.1016/j.fitote.2017.11.022 29197542
Guo, Z. K. et al. Tomenphantadenine, an unprecedented germacranolide-adenine hybrid heterodimer from the medicinal plant Elephantopus tomentosus L. Fitoterapia 125, 217–220. 10.1016/j.fitote.2017.11.022 (2018).29197542 10.1016/j.fitote.2017.11.022
7. Chen YL Flora Republicae Popularis Sinicae Sci. Press 1985 74 45
Chen, Y. L. Flora Republicae Popularis Sinicae. Sci. Press 74, 45 (1985).
8. Sim KY Lee HT Constituents of Elephantopus scaber (compositae) Phytochemistry 1969 8 933 934 10.1016/S0031-9422(00)85888-4
Sim, K. Y. & Lee, H. T. Constituents of Elephantopus scaber (compositae). Phytochemistry 8, 933–934. 10.1016/S0031-9422(00)85888-4 (1969).10.1016/S0031-9422(00)85888-4
9. Sung, C. Y. & Chi, H. C. The effect of thirteen medicinal plants used in Chinese traditional medicine and folk medicine on experimental arthritis in rats. Yao xue xue bao Acta Pharm. Sin. 10, 708–711 (1963).
10. Bai M HSQC-based small molecule accurate recognition technology discovery of diverse cytotoxic sesquiterpenoids from Elephantopus tomentosus L. and structural revision of molephantins A and B Phytochemistry 2023 206 113562 10.1016/j.phytochem.2022.113562 36526100
Bai, M. et al. HSQC-based small molecule accurate recognition technology discovery of diverse cytotoxic sesquiterpenoids from Elephantopus tomentosus L. and structural revision of molephantins A and B. Phytochemistry 206, 113562. 10.1016/j.phytochem.2022.113562 (2023).36526100 10.1016/j.phytochem.2022.113562
11. Kurokawa T Deoxyelephantopin and its interrelation with elephantopin Tetrahedron Lett. 1970 11 2863 2866 10.1016/s0040-4039(01)98359-5
Kurokawa, T. et al. Deoxyelephantopin and its interrelation with elephantopin. Tetrahedron Lett. 11, 2863–2866. 10.1016/s0040-4039(01)98359-5 (1970).10.1016/s0040-4039(01)98359-5
12. Wang B A new sesquiterpene lactone from Elephantopus tomentosus J. Asian Nat. Prod. Res. 2012 14 700 703 10.1080/10286020.2012.682153 22582752
Wang, B. et al. A new sesquiterpene lactone from Elephantopus tomentosus. J. Asian Nat. Prod. Res. 14, 700–703. 10.1080/10286020.2012.682153 (2012).22582752 10.1080/10286020.2012.682153
13. Bai M Highly oxidized germacranolides from Elephantopus tomentosus and the configurational revision of some previously reported analogues J. Nat. Prod. 2022 85 2433 2444 10.1021/acs.jnatprod.2c00630 36223633
Bai, M. et al. Highly oxidized germacranolides from Elephantopus tomentosus and the configurational revision of some previously reported analogues. J. Nat. Prod. 85, 2433–2444. 10.1021/acs.jnatprod.2c00630 (2022).36223633 10.1021/acs.jnatprod.2c00630
14. Shannon P Cytoscape: A software environment for integrated models of biomolecular interaction networks Genome Res. 2003 13 2498 2504 10.1101/gr.1239303 14597658
Shannon, P. et al. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 13, 2498–2504. 10.1101/gr.1239303 (2003).14597658 10.1101/gr.1239303
15. Kanehisa M Goto S KEGG: Kyoto encyclopedia of genes and genomes Nucleic Acids Res. 2000 28 27 30 10.1093/nar/28.1.27 10592173
Kanehisa, M. & Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30. 10.1093/nar/28.1.27 (2000).10592173 10.1093/nar/28.1.27
16. Kanehisa M Toward understanding the origin and evolution of cellular organisms Protein Sci. Publ. Protein Soc. 2019 28 1947 1951 10.1002/pro.3715
Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. Publ. Protein Soc. 28, 1947–1951. 10.1002/pro.3715 (2019).10.1002/pro.3715
17. Kanehisa M Furumichi M Sato Y Kawashima M Ishiguro-Watanabe M KEGG for taxonomy-based analysis of pathways and genomes Nucleic Acids Res. 2023 51 D587 d592 10.1093/nar/gkac963 36300620
Kanehisa, M., Furumichi, M., Sato, Y., Kawashima, M. & Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 51, D587-d592. 10.1093/nar/gkac963 (2023).36300620 10.1093/nar/gkac963
18. Jia C-C Zeng Z-H Tang R-Y Jia D-Z Yang M-J Qiu J-Y Li D-M Xie C-H Wu G-Y Li Y-X Jiang J-Y Huang H Xiao G-L Cai D-K Bi X-L Prediction and analysis of Q-markers of Elephantopus scaber based on its UPLC fingerprint, content determination of components, and in vitro a nti-tumor activity Zhongguo Zhong Yao Za Zhi 2023 48 16 4421 4428 10.19540/j.cnki.cjcmm.20230526.201 37802868
Jia, C.-C. et al. Prediction and analysis of Q-markers of Elephantopus scaber based on its UPLC fingerprint, content determination of components, and in vitro a nti-tumor activity. Zhongguo Zhong Yao Za Zhi 48(16), 4421–4428. 10.19540/j.cnki.cjcmm.20230526.201 (2023).37802868 10.19540/j.cnki.cjcmm.20230526.201
19. Xu G, L. Q., Gong Z, Yu W, He S, Xi L. Antitumor activities of the four sesquiterpene lactones from Elephantopus scaber L. Exp. Oncol. 28(2) (2006).
20. Ke H Effect of weimaining on apoptosis and Caspase-3 expression in a breast cancer mouse model J. Ethnopharmacol. 2021 10.1007/s13402-019-00489-1 34592340
Ke, H. et al. Effect of weimaining on apoptosis and Caspase-3 expression in a breast cancer mouse model. J. Ethnopharmacol.10.1007/s13402-019-00489-1 (2021).34592340 10.1007/s13402-019-00489-1
21. Cruceriu D Baldasici O Balacescu O Berindan-Neagoe I The dual role of tumor necrosis factor-alpha (TNF-α) in breast cancer: Molecular insights and therapeutic approaches Cell. Oncol. 2020 43 1 18 10.1007/s13402-019-00489-1
Cruceriu, D., Baldasici, O., Balacescu, O. & Berindan-Neagoe, I. The dual role of tumor necrosis factor-alpha (TNF-α) in breast cancer: Molecular insights and therapeutic approaches. Cell. Oncol. 43, 1–18. 10.1007/s13402-019-00489-1 (2020).10.1007/s13402-019-00489-1
22. Kumari N Dwarakanath BS Das A Bhatt AN Role of interleukin-6 in cancer progression and therapeutic resistance Tumor Biol. 2016 37 11553 11572 10.1007/s13277-016-5098-7
Kumari, N., Dwarakanath, B. S., Das, A. & Bhatt, A. N. Role of interleukin-6 in cancer progression and therapeutic resistance. Tumor Biol. 37, 11553–11572. 10.1007/s13277-016-5098-7 (2016).10.1007/s13277-016-5098-7
23. Malik A Kanneganti TD Function and regulation of IL-1α in inflammatory diseases and cancer Immunol. Rev. 2017 281 124 137 10.1111/imr.12615
Malik, A. & Kanneganti, T. D. Function and regulation of IL-1α in inflammatory diseases and cancer. Immunol. Rev. 281, 124–137. 10.1111/imr.12615 (2017).10.1111/imr.12615
24. Zhang Y Yang X Ge X Zhang F Puerarin attenuates neurological deficits via Bcl-2/Bax/cleaved caspase-3 and Sirt3/SOD2 apoptotic pathways in subarachnoid hemorrhage mice Biomed. Pharmacother. 2019 109 726 733 10.1016/j.biopha.2018.10.161 30551525
Zhang, Y., Yang, X., Ge, X. & Zhang, F. Puerarin attenuates neurological deficits via Bcl-2/Bax/cleaved caspase-3 and Sirt3/SOD2 apoptotic pathways in subarachnoid hemorrhage mice. Biomed. Pharmacother. 109, 726–733. 10.1016/j.biopha.2018.10.161 (2019).30551525 10.1016/j.biopha.2018.10.161
25. Wang H Guo M Wei H Chen Y Targeting p53 pathways: Mechanisms, structures, and advances in therapy Signal Transduct. Target. Ther. 2023 10.1038/s41392-023-01347-1 38155175
Wang, H., Guo, M., Wei, H. & Chen, Y. Targeting p53 pathways: Mechanisms, structures, and advances in therapy. Signal Transduct. Target. Ther.10.1038/s41392-023-01347-1 (2023).38155175 10.1038/s41392-023-01347-1
26. Liao X Bu Y Jia Q Traditional Chinese medicine as supportive care for the management of liver cancer: Past, present, and future Genes Dis. 2020 7 370 379 10.1016/j.gendis.2019.10.016 32884991
Liao, X., Bu, Y. & Jia, Q. Traditional Chinese medicine as supportive care for the management of liver cancer: Past, present, and future. Genes Dis. 7, 370–379. 10.1016/j.gendis.2019.10.016 (2020).32884991 10.1016/j.gendis.2019.10.016
27. Llovet JM Hepatocellular carcinoma Nat. Rev. Dis. Prim. 2021 7 6 10.1038/s41572-020-00240-3 33479224
Llovet, J. M. et al. Hepatocellular carcinoma. Nat. Rev. Dis. Prim. 7, 6. 10.1038/s41572-020-00240-3 (2021).33479224 10.1038/s41572-020-00240-3
28. Zhou Y Dietary natural products for prevention and treatment of liver cancer Nutrients. 2016 10.3390/nu8030156 28036059
Zhou, Y. et al. Dietary natural products for prevention and treatment of liver cancer. Nutrients.10.3390/nu8030156 (2016).28036059 10.3390/nu8030156
29. Chen J Potential molecular, cellular and microenvironmental mechanism of sorafenib resistance in hepatocellular carcinoma Cancer Lett. 2015 367 1 11 10.1016/j.canlet.2015.06.019 26170167
Chen, J. et al. Potential molecular, cellular and microenvironmental mechanism of sorafenib resistance in hepatocellular carcinoma. Cancer Lett. 367, 1–11. 10.1016/j.canlet.2015.06.019 (2015).26170167 10.1016/j.canlet.2015.06.019
30. Zhang X Qiu H Li C Cai P Qi F The positive role of traditional Chinese medicine as an adjunctive therapy for cancer BioSci. Trends 2021 15 283 298 10.5582/bst.2021.01318 34421064
Zhang, X., Qiu, H., Li, C., Cai, P. & Qi, F. The positive role of traditional Chinese medicine as an adjunctive therapy for cancer. BioSci. Trends 15, 283–298. 10.5582/bst.2021.01318 (2021).34421064 10.5582/bst.2021.01318
31. Hsieh TC Wong C John Bennett D Wu JM Regulation of p53 and cell proliferation by resveratrol and its derivatives in breast cancer cells: An in silico and biochemical approach targeting integrin αvβ3 Int. J. Cancer 2011 129 2732 2743 10.1002/ijc.25930 21225623
Hsieh, T. C., Wong, C., John Bennett, D. & Wu, J. M. Regulation of p53 and cell proliferation by resveratrol and its derivatives in breast cancer cells: An in silico and biochemical approach targeting integrin αvβ3. Int. J. Cancer 129, 2732–2743. 10.1002/ijc.25930 (2011).21225623 10.1002/ijc.25930
32. Wu GS The functional interactions between the MAPK and p53 signaling pathways Cancer Biol. Ther. 2014 3 156 161 10.4161/cbt.3.2.614
Wu, G. S. The functional interactions between the MAPK and p53 signaling pathways. Cancer Biol. Ther. 3, 156–161. 10.4161/cbt.3.2.614 (2014).10.4161/cbt.3.2.614
33. Cahyadi A Relationship between Bax and Bcl-2 protein expression and outcome of induction phase chemotherapy in pediatric acute lymphoblastic leukemia Asian Pac. J. Cancer Prev. 2022 23 1679 1685 10.31557/apjcp.2022.23.5.1679 35633553
Cahyadi, A. et al. Relationship between Bax and Bcl-2 protein expression and outcome of induction phase chemotherapy in pediatric acute lymphoblastic leukemia. Asian Pac. J. Cancer Prev. 23, 1679–1685. 10.31557/apjcp.2022.23.5.1679 (2022).35633553 10.31557/apjcp.2022.23.5.1679
34. Huang C-L Yokomise H Miyatake A Clinical significance of the p53 pathway and associated gene therapy in non-small cell lung cancers Future Oncol. 2007 3 83 93 10.2217/14796694.3.1.83 17280505
Huang, C.-L., Yokomise, H. & Miyatake, A. Clinical significance of the p53 pathway and associated gene therapy in non-small cell lung cancers. Future Oncol. 3, 83–93. 10.2217/14796694.3.1.83 (2007).17280505 10.2217/14796694.3.1.83
35. Zhang G Dioscin suppresses hepatocellular carcinoma tumor growth by inducing apoptosis and regulation of TP53, BAX, BCL2 and cleaved CASP3 Phytomedicine 2016 23 1329 1336 10.1016/j.phymed.2016.07.003 27765352
Zhang, G. et al. Dioscin suppresses hepatocellular carcinoma tumor growth by inducing apoptosis and regulation of TP53, BAX, BCL2 and cleaved CASP3. Phytomedicine 23, 1329–1336. 10.1016/j.phymed.2016.07.003 (2016).27765352 10.1016/j.phymed.2016.07.003
36. Pan GQ Yang CC Shang XL Dong ZR Li T The causal relationship between white blood cell counts and hepatocellular carcinoma: A Mendelian randomization study Eur. J. Med. Res. 2022 27 278 10.1186/s40001-022-00900-y 36471350
Pan, G. Q., Yang, C. C., Shang, X. L., Dong, Z. R. & Li, T. The causal relationship between white blood cell counts and hepatocellular carcinoma: A Mendelian randomization study. Eur. J. Med. Res. 27, 278. 10.1186/s40001-022-00900-y (2022).36471350 10.1186/s40001-022-00900-y
37. Zhao B Inflammatory micro-environment contributes to stemness properties and metastatic potential of HCC via the NF-κB/miR-497/SALL4 axis Mol. Ther. Oncolytics 2019 15 79 90 10.1016/j.omto.2019.08.009 31650028
Zhao, B. et al. Inflammatory micro-environment contributes to stemness properties and metastatic potential of HCC via the NF-κB/miR-497/SALL4 axis. Mol. Ther. Oncolytics 15, 79–90. 10.1016/j.omto.2019.08.009 (2019).31650028 10.1016/j.omto.2019.08.009
38. Lan T Chen L Wei X Inflammatory cytokines in cancer: Comprehensive understanding and clinical progress in gene therapy Cells. 2021 10.3390/cells10010100 34571869
Lan, T., Chen, L. & Wei, X. Inflammatory cytokines in cancer: Comprehensive understanding and clinical progress in gene therapy. Cells.10.3390/cells10010100 (2021).34571869 10.3390/cells10010100
39. Tiegs G Horst AK TNF in the liver: Targeting a central player in inflammation Semin. Immunopathol. 2022 44 445 459 10.1007/s00281-022-00910-2 35122118
Tiegs, G. & Horst, A. K. TNF in the liver: Targeting a central player in inflammation. Semin. Immunopathol. 44, 445–459. 10.1007/s00281-022-00910-2 (2022).35122118 10.1007/s00281-022-00910-2
40. Li H Long noncoding RNA lncGALM increases risk of liver metastasis in gallbladder cancer through facilitating N-cadherin and IL-1β-dependent liver arrest and tumor extravasation Clin. Transl. Med. 2020 10.1002/ctm2.201 33377664
Li, H. et al. Long noncoding RNA lncGALM increases risk of liver metastasis in gallbladder cancer through facilitating N-cadherin and IL-1β-dependent liver arrest and tumor extravasation. Clin. Transl. Med.10.1002/ctm2.201 (2020).33377664 10.1002/ctm2.201
41. Schmidt-Arras D Rose-John S IL-6 pathway in the liver: From physiopathology to therapy J. Hepatol. 2016 64 1403 1415 10.1016/j.jhep.2016.02.004 26867490
Schmidt-Arras, D. & Rose-John, S. IL-6 pathway in the liver: From physiopathology to therapy. J. Hepatol. 64, 1403–1415. 10.1016/j.jhep.2016.02.004 (2016).26867490 10.1016/j.jhep.2016.02.004
42. Yan L Xu F Dai CL Relationship between epithelial-to-mesenchymal transition and the inflammatory microenvironment of hepatocellular carcinoma J. Exp. Clin. Cancer Res. CR 2018 37 203 10.1186/s13046-018-0887-z 30157906
Yan, L., Xu, F. & Dai, C. L. Relationship between epithelial-to-mesenchymal transition and the inflammatory microenvironment of hepatocellular carcinoma. J. Exp. Clin. Cancer Res. CR 37, 203. 10.1186/s13046-018-0887-z (2018).30157906 10.1186/s13046-018-0887-z
43. Gao Y Scabertopin derived from Elephantopus scaber L. mediates necroptosis by inducing reactive oxygen species production in bladder cancer in vitro Cancers. 2022 10.3390/cancers14235976 36612194
Gao, Y. et al. Scabertopin derived from Elephantopus scaber L. mediates necroptosis by inducing reactive oxygen species production in bladder cancer in vitro. Cancers.10.3390/cancers14235976 (2022).36612194 10.3390/cancers14235976
