
==== Front
Discov Oncol
Discov Oncol
Discover Oncology
2730-6011
Springer US New York

39254762
1289
10.1007/s12672-024-01289-2
Research
Modulation of esophageal squamous cell carcinoma progression: the impact of CCR7 on JAK2/STAT3 signaling pathway
Zhang Xuewen 11
An Yuji 12
Mai Dongmei 1
Huang Wan 1
Zeng Weian zengweian_sysucc@163.com

1
1 https://ror.org/0400g8r85 grid.488530.2 0000 0004 1803 6191 Department of Anesthesiology, Sun Yat-Sen University Cancer Center, Guangzhou, 510060 China
2 grid.410638.8 0000 0000 8910 6733 Five Wards of Oncology Department, The Third Affiliated Hospital of Shandong First Medical University, Jinan, 250031 China
10 9 2024
10 9 2024
12 2024
15 42125 6 2024
29 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Existing studies have already revealed the involvement of C–C chemokine receptor type 7 (CCR7) in diverse human cancers, including esophageal cell squamous carcinoma (ESCA). Our current study, aims to explore the relevant mechanisms implicated.

Methods

ESCA cell lines were collected for CCR7 expression quantification using western blot. Following the transfection, the viability, migration and invasion of ESCA cells were evaluated via cell counting kit-8 and Transwell assays. The specific molecular mechanisms underlying the effects of CCR7 in ESCA cells were explored via calculating the expressions of proteins related to metastasis and Janus kinase 2/signal transduction and transcription activation 3 (JAK2/STAT3) signaling pathway via western blot. The correlation between CCR7 and metastasis-related proteins was explored via Pearson’s correlation test.

Results

CCR7 was high-expressed in ESCA cells and CCR7 knockdown repressed the viability, migration and invasion of ESCA cells, concurrent with the increased expression of E-cadherin (E-cad, which was also known as CDH1 and lowly expressed in ESCA cells) and the decreased expressions of vimentin (Vim, which was highly expressed in ESCA cells) and matrix metalloproteinase-9 (MMP-9, which was also highly expressed in ESCA cells). Meanwhile, CCR7 was positively correlated with Vim and MMP-9 yet negatively correlated with E-cad in ESCA cells, which indicated that CCR7 has a role in promoting tumor progression in ESCA cells. Besides, the phosphorylation of STAT3 and JAK2 in ESCA cells was elevated, which was diminished following CCR7 knockdown.

Conclusion

This study proves the modulation of CCR7 on ESCA in vitro, which was achieved via JAK2/STAT3 signaling pathway. Our discovery will provide new therapeutic basis and insights for ESCA.

Keywords

Esophageal cell squamous carcinoma
C–C chemokine receptor 7
Migration
Invasion
JAK2/STAT3 signaling pathway
issue-copyright-statement© Springer Science+Business Media, LLC 2024
==== Body
pmcIntroduction

As one of the major categories of esophageal cancer, esophageal cancer (ESCA) is a prevalent malignancy in the developing world and carries significant morbidity and mortality, with significant alcohol and tobacco use as the major risk factors [1, 2]. ESCA primarily consists of two separate diseases from an epidemiological and pathological standpoint: esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC). Notably, ESCC makes up about 90% of these cases [3]. ESCC is a rapidly growing, aggressive cancer with a high rate of lymph node metastasis that often impacts the upper two-thirds of the esophagus [4]. Dysphagia and cervical lymph node enlargement typically do not present until the disease has advanced significantly, leading to a poor prognosis and a 5-year survival rate that remains low [5]. Over the past few decades, there has been a significant amount of research conducted on the molecular processes responsible for ESCC pathogenesis [6, 7]. Genetic factors, such as mutations in TP53 and NFE2L2 tumor suppressor genes [8, 9], alongside epigenetic changes like DNA methylation and non-coding RNAs [10, 11], have been identified as crucial contributors to the initiation and progression of ESCC. The complex imbalance in gene expression, including amplification of proto-oncogenes, mutations, deletions, and epigenetic alterations, may act collectively to sustain the malignant biological features of ESCC [9, 12]. Nonetheless, the comprehension of ESCC's oncogenic process continues to be elusive, thereby restricting the development of effective therapy.

Chemokines release their effects through binding to the cell surface chemokine receptors that belong to the highly druggable class A G-protein coupled receptor (GPCR) family [13]. As a member of the chemokine receptor family, C–C chemokine receptor type 7 (CCR7) has been already discussed in various biological processes including cancer [13, 14]. For instance, cervical lymph node metastasis of tongue squamous cell carcinoma (TSCC) could be promoted by CCR7, which therefore has the potential to serve as a biomarker for TSCC [15]. Also, CCR7 overexpression causes cetuximab resistance by cross-talking with Epidermal Growth Factor receptor (EGFR) in colorectal cancer [16]. Besides, CCR7 signaling could promote microglia/macrophage recruitment and chemotherapy resistance in glioblastoma [17]. A review on the biomarkers has addressed the involvement of CCR7 in ESCC, whilst the detailed mechanisms have not been expounded, which will be uncovered in this study [18].

Janus kinase 2/signal transduction and transcription activation 3 (JAK2/STAT3) signaling pathway is a downstream of the JAK/STAT pathway and its dysfunction has been demonstrated to assist the progression and development of cancer [19]. Certain scientists have suggested that this specific pathway is responsible for nearly all immune regulation processes, including those related to the identification of tumor cells and the evasion of the immune system by tumors [20]. The activation of both STAT1 and STAT2 plays a crucial role in generating immune responses against tumors through the production of type I and type II interferons (IFNs) and the subsequent enhancement of IFN-related activities. On the contrary, STAT3 has been widely associated with tumor cell survival, immune system suppression, and persistent inflammation within the tumor environment [21, 22]. The identification of reciprocal regulatory mechanisms, modification of proteins after translation, and alternative methods of signal transmission have increased the complexity of the control exerted by JAK-STAT on the initiation and advancement of tumors [20, 23]. An integrated bulk and single-cell gene expression profile has identified Chemokine C–C motif ligand 18 (CCL18) could promote ESCC cell proliferation via JAK2/STAT3 pathway [24]. The activation of JAK2/STAT3 pathway and malignant transformation of ESCA could be induced by sex‑determining region Y box 12 (SOX12) [25]. Besides, B7-H4 promotes the proliferation of ESCC cells via JAK2/STAT3 pathway [26]. Additionally, CCR7 regulates squamous cell carcinoma of the head and neck cells via JAK2/STAT3 pathway [27]. Nonetheless, such interaction has not been explored in ESCC so far, which brings this study about. Here, we utilized ESCC cell lines to validate the expression of CCR7, and knocked down CCR7 in order to assess its effect on cancer cell function. Finally, the phosphorylation levels of JAK2 and STAT3 in ESCC cells were detected by the western blotting to further explore the mechanism of action of CCR7. In conclusion, our study provides new ideas for the clinical diagnosis and treatment of ESCC.

Materials and methods

Cell culture

Human ESCC cell lines (KYSE410, KYSE510, KYSE520 and KYSE150) and normal esophageal epithelial cell line HEEC were purchased from the American Type Culture Collection (ATCC). We used high-sugar Dulbecco's Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin mixture to culture all cells. The medium was changed every 2–3 days in a humidified incubator at 37°C with 5% CO2, and the cells were passaged at appropriate times according to their growth. Prior to the experiments, the cells need to reach the logarithmic growth phase, and serum starvation can be performed as needed to synchronize the cell cycle or reduce the basal metabolic level. These detailed culture methods ensure that the cells grow under optimal conditions and lay the foundation for subsequent experiments.

Cell transfection

The small interfering RNAs (siRNAs) against CCR7 (si-CCR7 #1 and si-CCR7#2) and the negative control siRNAs were synthesized and ordered from RiboBio. These siRNAs were transfected into ESCC cells following the protocol for Lipofectamine 2000 reagent (Invitrogen) provided by Invitrogen. Cells were inoculated in six-well plates the day before transfection to ensure that the cell density reached 50% confluence the next day. During transfection, siRNA and Lipofectamine 2000 were diluted with serum-free medium Opti-MEM, respectively, and left to stand for 5 min before being mixed and incubated at room temperature for 20 min to form siRNA-Lipofectamine complexes. Subsequently, the complex was added to the cell culture medium and gently shaken. After transfection, the cells were incubated in an incubator at 37 °C with 5% CO2 for 6 h, after which they were replaced with normal medium containing 10% FBS. All cells were harvested 48 h after transfection and used for subsequent analysis in various experiments.

Cell counting kit-8 (CCK-8) assay

In the CCK-8 assay, logarithmically growing ESCC cells were seeded at a density of 5 × 103 cells per well in 96-well plates containing serum and cultured for 12, 24, 36, and 48 h. Subsequently, 20 μL of CCK-8 solution (Beyotime Institute of Biotechnology) was added to each well, and the cells were incubated for an additional 4 h. The WST-8 in the CCK-8 solution is reduced by dehydrogenases in living cells to produce a soluble orange formazan product. The absorbance at 450 nm, which reflects cell proliferation, was measured using a microplate reader (Bio-Rad Laboratories, Inc.).

Transwell assay

The migration and invasion of ESCC cells were determined via Transwell assay. In detail, the Transwell chamber coated with or without Matrigel (Corning) was applied in invasion or migration assay. 5 × 104 cells within 200 μL non-serum medium was added to the upper chamber and the complete serum (600 μL) was added to the corresponding lower chamber. Following the incubation for 48 h, migrated and invaded cells were fixed in 4% fixative (Beyotime Institute of Biotechnology) for 15 min and dyed using 0.1% crystal violet (Beyotime Institute of Biotechnology). Images of cells were taken from a light microscope (Olympus).

Reverse-transcription quantitative PCR

The total RNA extraction from cells was carried out via TriZol reagent (Invitrogen) and the PrimeScript™ RT Reagent Kit (Takara Bio, Inc.) was used to reverse-transcribe the extracted RNA into complementary DNA. Hereafter, Fast SYBR™ Green Master Mix (ThermoFisher Scientific) was applied for the PCR assay. The relative expression of genes was finally quantified via 2−ΔΔCT method with GAPDH as the normalization control [28, 29]. See Table 1 for the primers used.Table 1 Sequences of primers

Gene	Identified ID	Primers (5ʹ-3ʹ)	
Forward	Reverse	
CCR7	NM_001838.4	CAACATCACCAGTAGCACCTGTG	TGCGGAACTTGACGCCGATGAA	
CDH1	NM_004360.5	GCCTCCTGAAAAGAGAGTGGAAG	TGGCAGTGTCTCTCCAAATCCG	
Vim	NM_003380.5	AGGCAAAGCAGGAGTCCACTGA	ATCTGGCGTTCCAGGGACTCAT	
MMP-9	NM_004994.3	GCCACTACTGTGCCTTTGAGTC	CCCTCAGAGAATCGCCAGTACT	
GAPDH	NM_002046.7	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA	

Western blot

Radioimmunoprecipitation assay lysis buffer (P0013B, Beyotime Institute of Biotechnology) was applied to lyse the total protein from cells. Subsequently, following the determination on the concentration via BCA method, the protein sample (30 μg) was separated by SDS-PAGE and moved onto the PVDF membrane. TBST containing 5% defatted milk was used for blocking non-specific binding during 1-h incubation at room temperature. The relevant primary and secondary antibodies were applied for further incubation at 4 ℃ overnight (with primary antibodies) and at room temperature for 1 h (with secondary antibodies). The signals were developed via ECL chemiluminescence assay kit (P0018S, Beyotime Institute of Biotechnology) and the results were evaluated via Quantity One 4.6.6 (Bio-Rad Laboratories, Inc.). Antibodies used were listed in Table 2.Table 2 Information of antibodies

Identifier	Host species	Dilution ratio	Molecular weight (kDa)	Manufacturer	
CCR7 antibody	Rabbit	1/2000	40	Biorbyt	
Recombinant Anti-E Cadherin antibody [rCDH1/1525]	Mouse	1/2000	130	Abcam	
Vimentin (D21H3) XP® Rabbit mAb	Rabbit	1/1000	57	CST	
Anti-JAK2 antibody	Rabbit	1/10000	133	Abcam	
Anti-JAK2 (phospho Y1007) antibody	Rabbit	1/2000	133	Abcam	
Recombinant Anti-STAT3 antibody [EPR787Y]	Rabbit	1/2000	88	Abcam	
Recombinant Anti-STAT3 (phospho Y705) antibody [EPR23968-52]	Rabbit	1/1000	88	Abcam	
Recombinant Anti-GAPDH antibody [EPR16891]—Loading Control	Rabbit	1/10000	36	Abcam	
Goat Anti-Rabbit IgG H&L (HRP)	Goat	1/2000	N/A	Abcam	
Goat Anti-Mouse IgG H&L (HRP)	Goat	1/2000	N/A	Abcam	

Statistical analyses

All data from independent triplicates were shown in the form of as mean ± standard deviation and analyzed in GraphPad Prism 8.0.2. Independent samples t test were performed for two-group data comparison. The correlation between CCR7 and metastasis-related proteins was explored via Pearson’s correlation test. The data were deemed as statistically significant when the P-value was lower than 0.05.

Results

Higher expression of CCR7 in ESCC

With the aim to determine the involvement of CCR7 in ESCA, 4 ESCA cells lines were collected and the levels of CCR7 in these cells were quantified, where an increased CCR7 expression in 4 ESCC cells lines was seen (Fig. 1A-B,  P < 0.001). Of note, the expression of CCR7 was relatively higher in KYSE410 and KYSE520 cells; Thus, these two cells were applied for subsequent assays. This is mainly due to the fact that stable expression of such genes enables subsequent findings to be easily detected and analyzed.Fig. 1 Higher expression of CCR7 in ESCC. A, B CCR7 expression level in ESCA cells (KYSE410, KYSE510, KYSE520 and KYSE150) and normal esophageal epithelial cells (HEEC). The results from independent triplicates were expressed as mean ± standard deviation and the data with P < 0.05 were deemed to be statistically significant. ns non-significant; ***P < 0.001, ****P < 0.0001

Silencing CCR7 represses ESCA cell viability, migration and invasion

To be able to explore the potential effects of CCR7 on ESCC development and progression, we validated the changes in ESCC cells after knocking down CCR7 expression. Hereafter, CCR7 level was forced to be knocked down using the relevant siRNAs and the decreased CCR7 level in these two aforementioned ESCA cells confirmed the successful intervention. In other words, knockdown of CCR7 expression was followed by significant changes in CCR7 in ESCC cells (Fig. 2A–D,  P < 0.001). In addition, the results of CCK-8 assay showed that the silencing of CCR7 could repress the viability of ESCC cells KYSE410 and KYSE520, as reflected by the reduced optical density (OD) value in these two cells (Fig. 2E, F, P < 0.001).Fig. 2 Silencing CCR7 represses the viability of ESCC cells. A-D Validation on the knockdown efficiency of si-CCR7 #1 and si-CCR7#2 in ESCC cells KYSE410 (A, B) and KYSE520 (C, D). E, F CCK-8 assay results showing the effects of CCR7 silencing on the viability of KYSE410 (E) and KYSE520 (F) cells. The results from independent tripli7cates were expressed as mean ± standard deviation and the data with P < 0.05 were deemed to be statistically significant. ***P < 0.001, ****P < 0.0001

In the meantime, the data from Transwell assay showed that silencing CCR7 reduced the quantity of invaded and migrated cells at 48 h (Fig. 3A-D,   P < 0.001). Further exploration on the molecular mechanisms was then initiated. We focused on E-cadherin (E-cad), Vimentin (Vim) and MMP-9, all of which have been addressed to be the metastasis-related proteins in cancers. In ESCC cells and HEEC, we found higher expressions of Vim and MMP-9 yet lower expression of (CDH1) in ESCC cells (Fig. 4A-B, P < 0.0001). The subsequent Pearson’s correlation analysis in ESCA cells has additionally proven the negative correlation between CCR7 and CDH1 (Fig. 4C) yet the positive correlation between CCR7 and Vim as well as CCR7 and MMP9 (Fig. 4D, E). These results further emphasize the ability of CCR7 to enhance migration and invasion of ESCC cells, which may be accomplished through the regulation of E-cad, Vim, and MMP-9.Fig. 3 Silencing CCR7 inhibits the migration and invasion of ESCC cells. A–D Transwell assay results demonstrating the migration (A, C) and invasion (B, D) of ESCC cells KYSE410 and KYSE520. Scale bar: 50 μm. The results from independent triplicates were expressed as mean ± standard deviation and the data with P < 0.05 were deemed to be statistically significant. ***P < 0.001, ****P < 0.0001

Fig. 4 Exploration on the mechanisms underlying the effects of CCR7 in ESCC. A, B Quantification on the levels of E-cadherin (E-cad, CDH1), Vimentin (Vim) and matrix metalloproteinase-9 (MMP-9) in ESCC cells KYSE410 and KYSE520 and HEEC. C–E Analysis on the correlation between CCR7 and CDH1 (C), Vim (D) and MMP-9 in ESCC cells (E). F, G Expression levels of E-cad, Vim and MMP-9 in ESCA cells KYSE410 (F) and KYSE520 (G). The results from independent triplicates were expressed as mean ± standard deviation and the data with P < 0.05 were deemed to be statistically significant. ns non-significant; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Following the silencing of CCR7, the expression levels of these proteins in ESCC cells were further quantified, an increased CDH1 mRNA level and decreased levels of Vim and MMP-9 were additionally seen in both KYSE410 and KYSE520 cells transfected with CCR7-specific siRNAs (Fig. 4F, G,   P < 0.05). Altogether, it could be concluded that CCR7 silencing could repress ESCA cell proliferation, migration and invasion in vitro.

Determination on JAK2/STAT3 pathway and its relationship with CCR7 in ESCC

Finally, we shifted our attention to JAK2/STAT3 pathway, since its involvement in ESCC has been already addressed. Increased phosphorylation of STAT3 and JAK2 in ESCC cells KYSE410 and KYSE520 has been witnessed (Fig. 5A–D,   P < 0.05), hinting the activation status of JAK2/STAT3 pathway in ESCC.Fig. 5 Determination on JAK2/STAT3 pathway and its relationship with CCR7 in ESCC. A–D Quantification on the phosphorylation of JAK2/STAT3 in ESCC cells KYSE410 (A, C) and KYSE520 (B, D). E–H Effects of CCR7 silencing on the phosphorylation of JAK2/STAT3 in ESCC cells KYSE410 (E, G) and KYSE520 (F, H). The results from independent triplicates were expressed as mean ± standard deviation and the data with P < 0.05 were deemed to be statistically significant. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

With the purpose of exploring the association between CCR7 and JAK2/STAT3 pathway in ESCC, the phosphorylation levels of JAK2/STAT3 in ESCC cells KYSE410 and KYSE520 were additionally quantified, unveiling a sharp reduction on the phosphorylation of JAK2 and STAT3 (Fig. 5E-H, P < 0.001). Therefore, it could be hinted that CCR7 could target JAK2/STAT3 pathway in ESCA cells.

Discussion

Cancer is one of the deadliest diseases and its cure is far from being discovered and only a few patients respond to the treatments [30, 31]. Esophageal cancer is a common malignant disease of esophageal epithelium, which can be categorized into two primary histological subtypes including ESCC [32, 33]. A review has addressed the efficacy of CCR7 as a biomarker in ESCC, whilst the detailed mechanisms have not been expounded [18]. Here, we validated the exploration of the potential mechanism of action of CCR7 on cancer progression based on an in vitro ESCC cell model. We first evaluated the expression of CCR7 in esophageal squamous cell carcinoma cells and its effects on cell proliferation, migration and invasion by Western blot, CCK-8 and transwell assays. Subsequently, the specific mechanisms by which CCR7 regulates the JAK2/STAT3 signaling pathway in these processes were explored by correlation analysis and signaling pathway studies.

CCR7 was known as a GPCR containing 7 transmembrane domains expressed on a variety of cells like central memory T cells, natural killer cells, naïve T/B cells, regulatory T cells, immature/mature dendritic cells, and even a minority of tumor cells [34]. Aberrant expression of CCR7 in some tumor types has already been detected and was linked to pro-survival and invasive pathways [35]. The involvement of CCR7 in some tumors has been addressed already, like TSCC [15], colorectal cancer [16] and glioblastoma [17]. When examining the relevant molecular mechanisms underlying the pro-survival effects of CCR7, it has been shown that CCR7 could promote the proliferation and strengthen the migration and invasion of prostate cancer cells T24 via increasing the expression of MMP-9 (an extracellular matrix (ECM) protein widely discovered to the pathology of cancers) [36, 37]. Another study on breast cancer has demonstrated the cancer-promoting effects of CCR7, together with its repressive effects on E-cad (a calcium-dependent adhesion molecule and one of the most crucial molecules for the metastasis of tumor cells) [38, 39]. Lung cancer cell migration and invasion could be initiated via epithelial-to-mesenchymal transition (EMT, of which Vim is a key biomarker and a type III intermediate filament that has an upregulated expression during cancer metastasis) [40, 41].

Considering the dim molecular mechanisms of CCR7 in ESCC, we, in addition to the observation and determination on the effects of CCR7 on the proliferation, migration and invasion of ESCC cells via the relevant assays like CCK-8 and Transwell, further quantified the levels of these three proteins (E-cad, MMP-9 and Vim) of interest. It was observable in the results of this study that E-cad was lowly expressed yet MMP-9 and Vim were highly expressed in ESCC cells and the silencing of CCR7 increased the expression of E-cad (which was negatively correlated with CCR7) and decreased the levels of Vim and MMP-9 (which was positively correlated with CCR7) in ESCC cells. After conducting a thorough analysis of bioinformatics data, Zhang and colleagues discovered that MMP-9 was overexpressed in the majority of malignant tumors. Additionally, they observed a significant correlation between MMP-9 expression and the clinical outcomes of cancer patients. This extensive examination across various cancer types highlights the potential utility of MMP-9 as a valuable biomarker for targeted therapy [42]. Specifically, research has shown that activation of CCR7 by its particular ligand, external chemokine ligand 19 (CCL19), was linked to a notable linear rise. The RT-qPCR and Western blot revealed that CCL19/CCR7 markedly increased MMP9 expression, a gene associated with metastasis [43]. In addition, Guo et al. revealed that CCR7 favors chemotaxis and migration of squamous cell carcinoma of the head and neck cell line, upregulates MMP-9 protein, stimulates MMP-9 protein activity, and induces reorganization of the actin cytoskeleton [44]. These findings collectively indicate that MMP-9 plays a crucial role in mediating the pro-tumorigenic effects of CCR7, particularly in enhancing tumor metastasis and invasion. Of note, there exist some other proteins that may be accountable for the pro-ESCC effects of CCR7, like N-cadherin [45], MMP-2 [46]. Whether CCR7 could exert its cancer-promoting effects via positively modulating the expressions of these proteins, despite not being addressed here, will be covered in our future study.

The JAK protein was originally known as “Just another kinase” is a family of non-membrane receptor tyrosine kinases (TYKs) which possess catalytic domains, while the STAT proteins are those playing crucial roles in signal transduction and gene expression activation [47]. As a downstream of JAK/STAT pathway, signals from the extracellular could be transduced to the intercellular domain of specific cell surface receptors by JAK2/STAT3 pathway, which has multiple biological functions including cell apoptosis, proliferation, and differentiation [48, 49]. The abnormal activation status and the promoting effects of JAK2/STAT3 in ESCC have been addressed [24–26]. So far as we are concerned, the interplay between C–C chemokine receptor family and JAK2/STAT3 signaling pathway has been addressed in some other diseases like subarachnoid hemorrhage [50, 51]. To our surprise, CCR7, the interested C–C chemokine receptor family member, can promote the ETM and stemness of oral squamous cell carcinoma via JAK2/STAT3 signaling pathway, as reflected by the evidently increased phosphorylation of JAK2 and STAT3 [52]. Similar results were also seen in our current study, where the phosphorylation of JAK2 and STAT3 was proven to be increased in ESCC cells, whilst CCR7 knockdown led to the decreased level of phosphorylation. This further emphasizes the impact of CCR7 on ESCC and reveals the mechanism of CCR7 in influencing ESCC progression through the JAK2/STAT3 signaling pathway.

To consolidate such result of our study, this requires a comprehensive understanding of the limitations that exist in the study. First, the small variety of cell lines used in this study is not fully representative of the biology of all ESCAs. Therefore, more ESCC cell lines from different sources and with different characteristics should be added in subsequent studies to improve the breadth and representativeness of the results. Second, future studies will also need to add in vivo experiments, such as using mouse xenograft models to validate the role of CCR7 in vivo. Finally, this study focused on the JAK2/STAT3 signaling pathway, but tumor progression is usually the result of multiple signaling pathways acting together. Studying only one signaling pathway may not be able to fully reveal the mechanism of CCR7's role in ESCA. Future studies should expand the scope of the study to explore other signaling pathways that may be regulated by CCR7 and perform multi-pathway cross-analysis to fully understand the function of CCR7.

Conclusion

Collectively, the results showed the abnormally higher levels of CCR7 and JAK2/STAT3 pathway in ESCC and it could be concluded from the current study that CCR7 silencing could diminish the phosphorylation of JAK2/STAT3 and the malignant behaviors of ESCA cells.

Abbreviations

ESCC Esophageal squamous cell carcinoma

EAC Esophageal adenocarcinoma

GPCR G-protein coupled receptor

CCR7 C-C chemokine receptor type 7

TSCC Tongue squamous cell carcinoma

EGFR Epidermal Growth Factor receptor

JAK2/STAT3 Janus kinase 2/signal transduction and transcription activation 3

CCL18 Chemokine C–C motif ligand 18

SOX12 Sex‑determining region Y box 12

ECM Extracellular matrix

E-cad E-cadherin

Vim Vimentin

TYKs Tyrosine kinases

Acknowledgements

None.

Author contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by [XWZ] and [YJA]. The first draft of the manuscript was written by [DMM], [WAZ] and [WH], and the revised version was conducted by [XWZ] and [YJA]. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

Funding

The authors declare that they have received no funding.

Data availability

All data included in this study are available upon request by contact with the corresponding authors. Available at Weian Zeng: zengweian_sysucc@163.com.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

The study required neither patient nor informed consent for the review of patients’ images and medical records.

Competing interests

The authors have no conflicts of interest to declare.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xuewen Zhang and Yuji An have contributed equally to this work.
==== Refs
References

1. Codipilly DC Wang KK Squamous cell carcinoma of the esophagus Gastroenterol Clin N Am 2022 51 3 457 484 10.1016/j.gtc.2022.06.005
Codipilly DC, Wang KK. Squamous cell carcinoma of the esophagus. Gastroenterol Clin N Am. 2022;51(3):457–84.10.1016/j.gtc.2022.06.005
2. Rogers JE Esophageal cancer: emerging therapeutics Expert Opin Ther Targets 2022 26 2 107 117 10.1080/14728222.2022.2036718 35119973
Rogers JE, et al. Esophageal cancer: emerging therapeutics. Expert Opin Ther Targets. 2022;26(2):107–17.35119973 10.1080/14728222.2022.2036718
3. Smyth EC Oesophageal cancer Nat Rev Dis Primers 2017 3 17048 10.1038/nrdp.2017.48 28748917
Smyth EC, et al. Oesophageal cancer. Nat Rev Dis Primers. 2017;3:17048.28748917 10.1038/nrdp.2017.48
4. Morgan E The global landscape of esophageal squamous cell carcinoma and esophageal adenocarcinoma incidence and mortality in 2020 and projections to 2040: new estimates from GLOBOCAN 2020 Gastroenterology 2022 163 3 649 658.e2 10.1053/j.gastro.2022.05.054 35671803
Morgan E, et al. The global landscape of esophageal squamous cell carcinoma and esophageal adenocarcinoma incidence and mortality in 2020 and projections to 2040: new estimates from GLOBOCAN 2020. Gastroenterology. 2022;163(3):649-658.e2.35671803 10.1053/j.gastro.2022.05.054
5. Zhang R Endoscopic diagnosis and treatment of esophageal squamous cell carcinoma Methods Mol Biol 2020 2129 47 62 10.1007/978-1-0716-0377-2_5 32056169
Zhang R, et al. Endoscopic diagnosis and treatment of esophageal squamous cell carcinoma. Methods Mol Biol. 2020;2129:47–62.32056169 10.1007/978-1-0716-0377-2_5
6. Wu C Joint analysis of three genome-wide association studies of esophageal squamous cell carcinoma in Chinese populations Nat Genet 2014 46 9 1001 1006 10.1038/ng.3064 25129146
Wu C, et al. Joint analysis of three genome-wide association studies of esophageal squamous cell carcinoma in Chinese populations. Nat Genet. 2014;46(9):1001–6.25129146 10.1038/ng.3064
7. Zhang B TSPAN15 interacts with BTRC to promote oesophageal squamous cell carcinoma metastasis via activating NF-κB signaling Nat Commun 2018 9 1 1423 10.1038/s41467-018-03716-9 29650964
Zhang B, et al. TSPAN15 interacts with BTRC to promote oesophageal squamous cell carcinoma metastasis via activating NF-κB signaling. Nat Commun. 2018;9(1):1423.29650964 10.1038/s41467-018-03716-9
8. Hao JJ Spatial intratumoral heterogeneity and temporal clonal evolution in esophageal squamous cell carcinoma Nat Genet 2016 48 12 1500 1507 10.1038/ng.3683 27749841
Hao JJ, et al. Spatial intratumoral heterogeneity and temporal clonal evolution in esophageal squamous cell carcinoma. Nat Genet. 2016;48(12):1500–7.27749841 10.1038/ng.3683
9. Cui Y Whole-genome sequencing of 508 patients identifies key molecular features associated with poor prognosis in esophageal squamous cell carcinoma Cell Res 2020 30 10 902 913 10.1038/s41422-020-0333-6 32398863
Cui Y, et al. Whole-genome sequencing of 508 patients identifies key molecular features associated with poor prognosis in esophageal squamous cell carcinoma. Cell Res. 2020;30(10):902–13.32398863 10.1038/s41422-020-0333-6
10. Cao W Multi-faceted epigenetic dysregulation of gene expression promotes esophageal squamous cell carcinoma Nat Commun 2020 11 1 3675 10.1038/s41467-020-17227-z 32699215
Cao W, et al. Multi-faceted epigenetic dysregulation of gene expression promotes esophageal squamous cell carcinoma. Nat Commun. 2020;11(1):3675.32699215 10.1038/s41467-020-17227-z
11. Xu WW Genome-wide identification of key regulatory lncRNAs in esophageal cancer metastasis Signal Transduct Target Ther 2021 6 1 88 10.1038/s41392-021-00476-9 33637684
Xu WW, et al. Genome-wide identification of key regulatory lncRNAs in esophageal cancer metastasis. Signal Transduct Target Ther. 2021;6(1):88.33637684 10.1038/s41392-021-00476-9
12. Talukdar FR Genome-wide DNA methylation profiling of esophageal squamous cell carcinoma from global high-incidence regions identifies crucial genes and potential cancer markers Cancer Res 2021 81 10 2612 2624 10.1158/0008-5472.CAN-20-3445 33741694
Talukdar FR, et al. Genome-wide DNA methylation profiling of esophageal squamous cell carcinoma from global high-incidence regions identifies crucial genes and potential cancer markers. Cancer Res. 2021;81(10):2612–24.33741694 10.1158/0008-5472.CAN-20-3445
13. Salem A CCR7 as a therapeutic target in cancer Biochim Biophys Acta Rev Cancer 2021 1875 1 188499 10.1016/j.bbcan.2020.188499 33385485
Salem A, et al. CCR7 as a therapeutic target in cancer. Biochim Biophys Acta Rev Cancer. 2021;1875(1): 188499.33385485 10.1016/j.bbcan.2020.188499
14. Mishan MA Ahmadiankia N Bahrami AR CXCR4 and CCR7: two eligible targets in targeted cancer therapy Cell Biol Int 2016 40 9 955 967 10.1002/cbin.10631 27248053
Mishan MA, Ahmadiankia N, Bahrami AR. CXCR4 and CCR7: two eligible targets in targeted cancer therapy. Cell Biol Int. 2016;40(9):955–67.27248053 10.1002/cbin.10631
15. Wang Q CCR7-CCL21 axis promotes the cervical lymph node metastasis of tongue squamous cell carcinoma by up-regulating MUC1 J Craniomaxillofac Surg 2021 49 7 562 569 10.1016/j.jcms.2021.02.027 33966967
Wang Q, et al. CCR7-CCL21 axis promotes the cervical lymph node metastasis of tongue squamous cell carcinoma by up-regulating MUC1. J Craniomaxillofac Surg. 2021;49(7):562–9.33966967 10.1016/j.jcms.2021.02.027
16. Gao L CCR7 high expression leads to cetuximab resistance by cross-talking with EGFR pathway in PI3K/AKT signals in colorectal cancer Am J Cancer Res 2019 9 11 2531 2543 31815051
Gao L, et al. CCR7 high expression leads to cetuximab resistance by cross-talking with EGFR pathway in PI3K/AKT signals in colorectal cancer. Am J Cancer Res. 2019;9(11):2531–43.31815051
17. Geraldo LH CCL21-CCR7 signaling promotes microglia/macrophage recruitment and chemotherapy resistance in glioblastoma Cell Mol Life Sci 2023 80 7 179 10.1007/s00018-023-04788-7 37314567
Geraldo LH, et al. CCL21-CCR7 signaling promotes microglia/macrophage recruitment and chemotherapy resistance in glioblastoma. Cell Mol Life Sci. 2023;80(7):179.37314567 10.1007/s00018-023-04788-7
18. Goto M Liu M Chemokines and their receptors as biomarkers in esophageal cancer Esophagus 2020 17 2 113 121 10.1007/s10388-019-00706-8 31773415
Goto M, Liu M. Chemokines and their receptors as biomarkers in esophageal cancer. Esophagus. 2020;17(2):113–21.31773415 10.1007/s10388-019-00706-8
19. Kohal R Targeting JAK2/STAT3 for the treatment of cancer: a review on recent advancements in molecular development using structural analysis and SAR investigations Bioorg Chem 2024 143 107095 10.1016/j.bioorg.2023.107095 38211548
Kohal R, et al. Targeting JAK2/STAT3 for the treatment of cancer: a review on recent advancements in molecular development using structural analysis and SAR investigations. Bioorg Chem. 2024;143: 107095.38211548 10.1016/j.bioorg.2023.107095
20. Owen KL Brockwell NK Parker BS JAK-STAT signaling: a double-edged sword of immune regulation and cancer progression Cancers (Basel) 2019 10.3390/cancers11122002 31842362
Owen KL, Brockwell NK, Parker BS. JAK-STAT signaling: a double-edged sword of immune regulation and cancer progression. Cancers (Basel). 2019. 10.3390/cancers11122002.31842362 10.3390/cancers11122002
21. Kim HS STAT1 deficiency redirects IFN signalling toward suppression of TLR response through a feedback activation of STAT3 Sci Rep 2015 5 13414 10.1038/srep13414 26299368
Kim HS, et al. STAT1 deficiency redirects IFN signalling toward suppression of TLR response through a feedback activation of STAT3. Sci Rep. 2015;5:13414.26299368 10.1038/srep13414
22. Jiang S MicroRNA-155 functions as an OncomiR in breast cancer by targeting the suppressor of cytokine signaling 1 gene Cancer Res 2010 70 8 3119 3127 10.1158/0008-5472.CAN-09-4250 20354188
Jiang S, et al. MicroRNA-155 functions as an OncomiR in breast cancer by targeting the suppressor of cytokine signaling 1 gene. Cancer Res. 2010;70(8):3119–27.20354188 10.1158/0008-5472.CAN-09-4250
23. Schindler C Levy DE Decker T JAK-STAT signaling: from interferons to cytokines J Biol Chem 2007 282 28 20059 20063 10.1074/jbc.R700016200 17502367
Schindler C, Levy DE, Decker T. JAK-STAT signaling: from interferons to cytokines. J Biol Chem. 2007;282(28):20059–63.17502367 10.1074/jbc.R700016200
24. Sui X Integrative analysis of bulk and single-cell gene expression profiles to identify tumor-associated macrophage-derived CCL18 as a therapeutic target of esophageal squamous cell carcinoma J Exp Clin Cancer Res 2023 42 1 51 10.1186/s13046-023-02612-5 36850011
Sui X, et al. Integrative analysis of bulk and single-cell gene expression profiles to identify tumor-associated macrophage-derived CCL18 as a therapeutic target of esophageal squamous cell carcinoma. J Exp Clin Cancer Res. 2023;42(1):51.36850011 10.1186/s13046-023-02612-5
25. Li C SOX12 contributes to the activation of the JAK2/STAT3 pathway and malignant transformation of esophageal squamous cell carcinoma Oncol Rep 2021 45 1 129 138 10.3892/or.2020.7863 33416144
Li C, et al. SOX12 contributes to the activation of the JAK2/STAT3 pathway and malignant transformation of esophageal squamous cell carcinoma. Oncol Rep. 2021;45(1):129–38.33416144 10.3892/or.2020.7863
26. Chen X B7–H4 facilitates proliferation of esophageal squamous cell carcinoma cells through promoting interleukin-6/signal transducer and activator of transcription 3 pathway activation Cancer Sci 2016 107 7 944 954 10.1111/cas.12949 27088889
Chen X, et al. B7–H4 facilitates proliferation of esophageal squamous cell carcinoma cells through promoting interleukin-6/signal transducer and activator of transcription 3 pathway activation. Cancer Sci. 2016;107(7):944–54.27088889 10.1111/cas.12949
27. Liu FY CCR7 regulates cell migration and invasion through JAK2/STAT3 in metastatic squamous cell carcinoma of the head and neck Biomed Res Int 2014 2014 415375 10.1155/2014/415375 25405202
Liu FY, et al. CCR7 regulates cell migration and invasion through JAK2/STAT3 in metastatic squamous cell carcinoma of the head and neck. Biomed Res Int. 2014;2014: 415375.25405202 10.1155/2014/415375
28. Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 2001 25 4 402 408 10.1006/meth.2001.1262 11846609
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.11846609 10.1006/meth.2001.1262
29. Sindhuja S, Amuthalakshmi S, Nalini CN. A review on PCR and POC-PCR - a boon in the diagnosis of COVID-19. Curr Pharm Anal. 2022;18(8):745–64. 10.2174/1573412918666220509032754.
30. Roque N The interface of cancer, their microenvironment and nanotechnology Oncologie 2022 24 3 371 411 10.32604/oncologie.2022.024035
Roque N, et al. The interface of cancer, their microenvironment and nanotechnology. Oncologie. 2022;24(3):371–411.10.32604/oncologie.2022.024035
31. Lu S A novel biological nano confinement inhibits cancer metastasis Oncologie 2022 24 3 591 597 10.32604/oncologie.2022.025144
Lu S, et al. A novel biological nano confinement inhibits cancer metastasis. Oncologie. 2022;24(3):591–7.10.32604/oncologie.2022.025144
32. Ai H Wang Y Gu H Effect of cluster nursing mode combined with blood pressure regulation on surgical tolerance of patients with esophageal cancer and hypertension Oncologie 2021 23 2 185 193 10.32604/Oncologie.2021.016420
Ai H, Wang Y, Gu H. Effect of cluster nursing mode combined with blood pressure regulation on surgical tolerance of patients with esophageal cancer and hypertension. Oncologie. 2021;23(2):185–93.10.32604/Oncologie.2021.016420
33. Alsina M Moehler M Lorenzen S Immunotherapy of esophageal cancer: current status, many trials and innovative strategies Oncol Res Treat 2018 41 5 266 271 10.1159/000488120 29705786
Alsina M, Moehler M, Lorenzen S. Immunotherapy of esophageal cancer: current status, many trials and innovative strategies. Oncol Res Treat. 2018;41(5):266–71.29705786 10.1159/000488120
34. Ma X Leveraging a disulfidptosis/ferroptosis-based signature to predict the prognosis of lung adenocarcinoma Cancer Cell Int 2023 23 1 267 10.1186/s12935-023-03125-z 37946181
Ma X, et al. Leveraging a disulfidptosis/ferroptosis-based signature to predict the prognosis of lung adenocarcinoma. Cancer Cell Int. 2023;23(1):267.37946181 10.1186/s12935-023-03125-z
35. Mburu YK CCR7 mediates inflammation-associated tumor progression Immunol Res 2006 36 1–3 61 72 10.1385/IR:36:1:61 17337767
Mburu YK, et al. CCR7 mediates inflammation-associated tumor progression. Immunol Res. 2006;36(1–3):61–72.17337767 10.1385/IR:36:1:61
36. Mo M CCL21/CCR7 enhances the proliferation, migration, and invasion of human bladder cancer T24 cells PLoS ONE 2015 10 3 e0119506 10.1371/journal.pone.0119506 25798926
Mo M, et al. CCL21/CCR7 enhances the proliferation, migration, and invasion of human bladder cancer T24 cells. PLoS ONE. 2015;10(3): e0119506.25798926 10.1371/journal.pone.0119506
37. Huang H Matrix metalloproteinase-9 (MMP-9) as a cancer biomarker and MMP-9 biosensors: recent advances Sensors (Basel) 2018 10.3390/s18103249 30598039
Huang H. Matrix metalloproteinase-9 (MMP-9) as a cancer biomarker and MMP-9 biosensors: recent advances. Sensors (Basel). 2018. 10.3390/s18103249.30598039 10.3390/s18103249
38. Xu B CCR7 mediates human breast cancer cell invasion, migration by inducing epithelial-mesenchymal transition and suppressing apoptosis through AKT pathway Cancer Med 2017 6 5 1062 1071 10.1002/cam4.1039 28378417
Xu B, et al. CCR7 mediates human breast cancer cell invasion, migration by inducing epithelial-mesenchymal transition and suppressing apoptosis through AKT pathway. Cancer Med. 2017;6(5):1062–71.28378417 10.1002/cam4.1039
39. Petrova YI Schecterson L Gumbiner BM Roles for E-cadherin cell surface regulation in cancer Mol Biol Cell 2016 27 21 3233 3244 10.1091/mbc.E16-01-0058 27582386
Petrova YI, Schecterson L, Gumbiner BM. Roles for E-cadherin cell surface regulation in cancer. Mol Biol Cell. 2016;27(21):3233–44.27582386 10.1091/mbc.E16-01-0058
40. Zhong G Chemokine (C-C motif) ligand 21/C-C chemokine receptor type 7 triggers migration and invasion of human lung cancer cells by epithelial-mesenchymal transition via the extracellular signal-regulated kinase signaling pathway Mol Med Rep 2017 15 6 4100 4108 10.3892/mmr.2017.6534 28487957
Zhong G, et al. Chemokine (C-C motif) ligand 21/C-C chemokine receptor type 7 triggers migration and invasion of human lung cancer cells by epithelial-mesenchymal transition via the extracellular signal-regulated kinase signaling pathway. Mol Med Rep. 2017;15(6):4100–8.28487957 10.3892/mmr.2017.6534
41. Usman S Vimentin is at the heart of epithelial mesenchymal transition (EMT) mediated metastasis Cancers (Basel) 2021 10.3390/cancers13194985 34638469
Usman S, et al. Vimentin is at the heart of epithelial mesenchymal transition (EMT) mediated metastasis. Cancers (Basel). 2021. 10.3390/cancers13194985.34638469 10.3390/cancers13194985
42. Zhang J Pan-cancer analysis of the prognostic and immunological role of matrix metalloproteinase 9 Medicine (Baltimore) 2023 102 30 e34499 10.1097/MD.0000000000034499 37505149
Zhang J, et al. Pan-cancer analysis of the prognostic and immunological role of matrix metalloproteinase 9. Medicine (Baltimore). 2023;102(30): e34499.37505149 10.1097/MD.0000000000034499
43. Zhang W Matrix metalloproteinase-9 is up-regulated by CCL19/CCR7 interaction via PI3K/Akt pathway and is involved in CCL19-driven BMSCs migration Biochem Biophys Res Commun 2014 451 2 222 228 10.1016/j.bbrc.2014.07.112 25086360
Zhang W, et al. Matrix metalloproteinase-9 is up-regulated by CCL19/CCR7 interaction via PI3K/Akt pathway and is involved in CCL19-driven BMSCs migration. Biochem Biophys Res Commun. 2014;451(2):222–8.25086360 10.1016/j.bbrc.2014.07.112
44. Guo N Chemokine receptor 7 enhances cell chemotaxis and migration of metastatic squamous cell carcinoma of head and neck through activation of matrix metalloproteinase-9 Oncol Rep 2014 32 2 794 800 10.3892/or.2014.3242 24912620
Guo N, et al. Chemokine receptor 7 enhances cell chemotaxis and migration of metastatic squamous cell carcinoma of head and neck through activation of matrix metalloproteinase-9. Oncol Rep. 2014;32(2):794–800.24912620 10.3892/or.2014.3242
45. Mrozik KM N-cadherin in cancer metastasis, its emerging role in haematological malignancies and potential as a therapeutic target in cancer BMC Cancer 2018 18 1 939 10.1186/s12885-018-4845-0 30285678
Mrozik KM, et al. N-cadherin in cancer metastasis, its emerging role in haematological malignancies and potential as a therapeutic target in cancer. BMC Cancer. 2018;18(1):939.30285678 10.1186/s12885-018-4845-0
46. Kwon Y Multi-layered proteogenomic analysis unravels cancer metastasis directed by MMP-2 and focal adhesion kinase signaling Sci Rep 2021 11 1 17130 10.1038/s41598-021-96635-7 34429501
Kwon Y, et al. Multi-layered proteogenomic analysis unravels cancer metastasis directed by MMP-2 and focal adhesion kinase signaling. Sci Rep. 2021;11(1):17130.34429501 10.1038/s41598-021-96635-7
47. Mengie Ayele T Role of JAK2/STAT3 signaling pathway in the tumorigenesis, chemotherapy resistance, and treatment of solid tumors: a systemic review J Inflamm Res 2022 15 1349 1364 10.2147/JIR.S353489 35241923
Mengie Ayele T, et al. Role of JAK2/STAT3 signaling pathway in the tumorigenesis, chemotherapy resistance, and treatment of solid tumors: a systemic review. J Inflamm Res. 2022;15:1349–64.35241923 10.2147/JIR.S353489
48. Kiu H Nicholson SE Biology and significance of the JAK/STAT signalling pathways Growth Factors 2012 30 2 88 106 10.3109/08977194.2012.660936 22339650
Kiu H, Nicholson SE. Biology and significance of the JAK/STAT signalling pathways. Growth Factors. 2012;30(2):88–106.22339650 10.3109/08977194.2012.660936
49. Park SY The JAK2/STAT3/CCND2 axis promotes colorectal cancer stem cell persistence and radioresistance J Exp Clin Cancer Res 2019 38 1 399 10.1186/s13046-019-1405-7 31511084
Park SY, et al. The JAK2/STAT3/CCND2 axis promotes colorectal cancer stem cell persistence and radioresistance. J Exp Clin Cancer Res. 2019;38(1):399.31511084 10.1186/s13046-019-1405-7
50. Tian Q Inhibition of CCR1 attenuates neuroinflammation via the JAK2/STAT3 signaling pathway after subarachnoid hemorrhage Int Immunopharmacol 2023 125 Pt A 111106 10.1016/j.intimp.2023.111106 37925951
Tian Q, et al. Inhibition of CCR1 attenuates neuroinflammation via the JAK2/STAT3 signaling pathway after subarachnoid hemorrhage. Int Immunopharmacol. 2023;125(Pt A): 111106.37925951 10.1016/j.intimp.2023.111106
51. Lin J CCL5/CCR5-mediated peripheral inflammation exacerbates blood–brain barrier disruption after intracerebral hemorrhage in mice J Transl Med 2023 21 1 196 10.1186/s12967-023-04044-3 36918921
Lin J, et al. CCL5/CCR5-mediated peripheral inflammation exacerbates blood–brain barrier disruption after intracerebral hemorrhage in mice. J Transl Med. 2023;21(1):196.36918921 10.1186/s12967-023-04044-3
52. Chen Y CCL21/CCR7 interaction promotes EMT and enhances the stemness of OSCC via a JAK2/STAT3 signaling pathway J Cell Physiol 2020 235 9 5995 6009 10.1002/jcp.29525 32017846
Chen Y, et al. CCL21/CCR7 interaction promotes EMT and enhances the stemness of OSCC via a JAK2/STAT3 signaling pathway. J Cell Physiol. 2020;235(9):5995–6009.32017846 10.1002/jcp.29525
