
==== Front
bioRxiv
BIORXIV
bioRxiv
2692-8205
Cold Spring Harbor Laboratory

39253446
10.1101/2024.08.27.609911
preprint
1
Article
A non-tethering role for the Drosophila Polθ linker domain in promoting damage resolution
http://orcid.org/0000-0002-9939-7700
Blanch Justin R. 1
http://orcid.org/0000-0001-8906-0533
Krishnamurthy Manan 12
http://orcid.org/0000-0001-8883-0188
McVey Mitch 1*
1 Department of Biology, Tufts University, Medford, Massachusetts, 02155, United States of America.
2 Icahn School of Medicine at Mount Sinai, New York City, New York, 10029, United States of America
Author Contributions

J.R.B. and M.M. conceptualized and managed the study. J.R.B designed the methodology, performed the experiments, analyzed the data, and validated reproducibility of the results. M.K. designed and created the polq3XFLAG,PBac{3XP3−DsRed} allele. J.R.B. wrote the paper. J.R.B., M.M., and M.K. reviewed the paper and provided edits.

* To whom correspondence should be addressed. Fax: +1 (617) 627-0309; mitch.mcvey@tufts.edu
27 8 2024
2024.08.27.609911https://creativecommons.org/licenses/by-nc-nd/4.0/ This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which allows reusers to copy and distribute the material in any medium or format in unadapted form only, for noncommercial purposes only, and only so long as attribution is given to the creator.
nihpp-2024.08.27.609911.pdf
DNA polymerase theta (Polθ) is an error-prone translesion polymerase that becomes crucial for DNA double-strand break repair when cells are deficient in homologous recombination or non-homologous end joining. In some organisms, Polθ also promotes tolerance of DNA interstrand crosslinks. Due to its importance in DNA damage tolerance, Polθ is an emerging target for treatment of cancer and disease. Prior work has characterized the functions of the Polθ helicase-like and polymerase domains, but the roles of the linker domain are largely unknown. Here, we show that the Drosophila melanogaster Polθ linker domain promotes egg development and is required for tolerance of DNA double-strand breaks and interstrand crosslinks. While a linker domain with scrambled amino acid residues is sufficient for DNA repair, replacement of the linker with part of the Homo sapiens Polθ linker or a disordered region from the FUS RNA-binding protein does not restore function. These results demonstrate that the linker domain is not simply a random tether between the helicase-like and polymerase domains. Furthermore, they suggest that intrinsic amino acid residue properties, rather than protein interaction motifs, are more critical for Polθ linker functions in DNA repair.

National Science FoundationMCB1716039 National Institutes of HealthR01GM125827
==== Body
pmcIntroduction

DNA double-strand breaks (DSBs) are harmful DNA lesions that can be induced by exogenous agents such as ionizing radiation (IR) or normal cellular processes such as DNA replication and transcription (1). To prevent genomic catastrophe, metazoans frequently use two pathways to repair DSBs: non-homologous end joining (NHEJ) and homologous recombination (HR). NHEJ is favored when DNA resection is inhibited, involves limited processing and ligation of DSB ends, and can result in small mutations (2–4). HR requires DNA resection, strand invasion and fill-in synthesis, and is typically error-free (5). Since NHEJ and HR account for the majority of DSB repair, deficiencies in either pathway can lead to cell death or pathogenic mutations.

HR or NHEJ-deficient cells often utilize an alternative pathway for DSB repair and survival called theta-mediated end joining (TMEJ) (6–11). The most essential factor in the TMEJ pathway is DNA polymerase theta (Polθ, POLQ). Like HR, TMEJ is promoted by DNA resection, but in contrast to HR, TMEJ regularly causes deletions and insertions in the genome (12–14). TMEJ-induced mutations and elevated levels of Polθ frequently occur in cancers and have been associated with poor prognoses for cancer patients (13,15–21).

Polθ possesses three domains: helicase-like, linker, and polymerase. The helicase-like and polymerase domains are largely conserved in metazoans, while linker domains are highly divergent (Figure 1A, Supplementary Figures S1 and S2). Prior work has shown that the helicase-like domain dissociates RAD51 and RPA from single-stranded DNA (ssDNA) and promotes microhomology synapsis needed for TMEJ (22–24). Following synapsis, the polymerase domain stabilizes synapsed ends and synthesizes new DNA to fill in gaps (25,26).

Mammalian cells deficient in Polθ demonstrate sensitivity to IR-induced DNA breaks (27,28). HR-deficient Drosophila require Polθ polymerase activity, but not helicase-like ATPase activity to resolve IR-induced breaks (29). In addition to repairing DSBs, Polθ promotes resolution of interstrand crosslinks (ICLs) in Mus musculus embryonic fibroblasts, Caenorhabditis elegans, Arabidopsis thaliana, and Drosophila melanogaster (30–35). In Drosophila, both polymerase and helicase-like ATPase activities are required for organismal resistance to interstrand crosslinks (29). The mechanism for how Polθ supports ICL tolerance is unknown, but in vitro evidence suggests Polθ facilitates bypass of ICLs (29), possibly to encourage processive synthesis during DNA replication.

Roles of the Polθ linker domain in DNA repair are largely unexplored. Previous reports showed that the Homo sapiens Polθ linker domain is not required for TMEJ in vitro (22), but phosphorylated serine residues within the linker promote a Polθ interaction with TOPBP1 and mitotic DSB repair in vivo (36). It is currently unclear how well the respective phosphorylation sites are conserved within Drosophila and other eukaryotes and if other regions in Polθ linker domains may also influence DNA repair in vivo.

Polθ linker domains contain intrinsically disordered regions (IDRs) (Figure 1B and Supplementary Figure S3). IDRs can encourage nuclear localization, cell cycle signaling, autoinhibition of protein activity, and protein-protein interactions (41,42). These functions are fine-tuned by post-translational modifications (PTMs) that alter domain architecture and respective enzyme activity or protein binding interfaces (43,44). Previous reports suggest IDRs influence the functions or recruitment of RAD52, p53, FUS, and several other DNA repair proteins (45–48). Accordingly, we postulated that the IDRs in the Polθ linker domain may also be important for DNA repair.

To test this hypothesis, we performed mutagen sensitivity assays, measured egg hatching, and explored linker sequence requirements for repair using replacement IDRs. We found that the Polθ linker domain is critical for repair of DNA double-strand breaks and tolerance to interstrand crosslinks and promotes normal Drosophila egg development. Interestingly, a randomly scrambled Drosophila linker, but not the Homo sapiens Polθ linker sequence or a disordered region from the FUS protein, is sufficient for DNA damage tolerance. Overall, our findings establish that the linker domain is required for Polθ-dependent repair of DNA damage in vivo and its functions are likely independent of amino acid residue arrangement.

Materials and Methods

Non-transgenic flies

All flies were raised at 25°C on a standard cornmeal diet with a 12:12 hour light/dark cycle. Wild-type flies were w1118 (BDSC 3605) unless otherwise noted.

The polq3XFLAG,PBac{3XP3−DsRed} null allele contains a piggyBac transposon inserted by CRISPR-mediated knock-in at the endogenous POLQ locus (technique described in https://flycrispr.org/scarless-gene-editing/) (49,50). An 825 bp homology arm containing most of the POLQ promoter and an 800 bp homology arm containing most of POLQ exon 1 were amplified by PCR and inserted into pHD-w+ (Addgene 80927, gift from Kate O’Connor-Giles) (NEBuilder HiFi Assembly). BbsI restriction overhangs were incorporated on the ends of an oligo template (5’ GAAACAGCACCTTAATGGCGC 3’) for a gRNA that targets the beginning of the POLQ coding sequence. The gRNA oligo was inserted into pU6-Bbs1_chiRNA (Addgene 45946, gift from Melissa Harrison, Kate O’Connor-Giles, and Jill Wildonger) (51). The respective gRNA PAM site was mutagenized in a POLQ homology arm within pHD-w+ by Q5 site-directed mutagenesis (New England BioLabs). Another fragment containing PBac{3XP3-DsRed} was amplified (Addgene 80820, gift from Kate O’Connor-Giles) and inserted in between POLQ homology arms in pHD-w+. pHD-w+ and pU6-Bbs1_chiRNA were injected into Cas9-expressing embryos (BDSC 51324) to generate a DsRed transformant (BestGene). The piggyBac insertion created an early stop codon at the beginning of the endogenous POLQ locus and the polq3XFLAG,PBac{3XP3−DsRed} allele was validated by PCR (Primers 1 and 2 in Supplementary Table S1).

The spn-A5 null mutant was made using CRISPR-induced mutagenesis. Cas9 (BDSC 79006) and a spn-A gRNA (BDSC 76440) were expressed in the male germline. In a male offspring, a four-nucleotide deletion and early stop codon were recovered at the beginning of the spn-A coding sequence. The spn-A5 allele was characterized by sequencing and validated in flies by PCR (Primers 3 and 4).

Transgenic flies

To make the polqΔL−untagged transgene, a 4.572 kb fragment, which included 1.287 kb upstream of the POLQ translation start site (endogenous POLQ promoter and 5’ UTR) and 3.252 kb downstream of the translation start site, was amplified using genomic DNA and primers containing BglII and NotI restriction sites. The restriction fragment was ligated into pattB (DGRC 1420). A 2.756 kb fragment, which included 2.329 kb upstream of the stop codon, 3’ UTR, and 242 bp downstream of the 3’ UTR, was ligated into pattB using primers with NotI and Acc65I restriction sites. 953 bp within exon 4 (the linker domain) were excluded from 5’ and 3’ POLQ restriction fragments. pattB-polqΔL-untagged was validated by sequencing and injected into ΦC31-expressing embryos (BestGene). Transgenes were inserted at ZH-68E-attP on chromosome 3L (BDSC 24485). polqΔL−untagged was validated in Drosophila by PCR (Primers 6 and 7).

To make the 3xFLAG-tagged polqΔL transgene, pattB-polqΔL-untagged and primers containing AvrII and SacI restriction sites were used to amplify 1.287 kb upstream of the POLQ translation start site. The restriction fragment was ligated into pAFW-Ago2 (Addgene 50554, gift from Yukihide Tomari) (52). Using pAFW-Ago2, a 1.395 kb fragment (promoter, 5’ UTR, Kozak sequence, and 3xFLAG) was amplified using primers with BamHI and BglII restriction sites and ligated into pattB. The polqΔL−untagged transgene was amplified downstream of the translation start site using pattB-polqΔL-untagged as a template and primers with BglII and Acc65I restriction sites, then ligated into pattB. pattB-polqΔL was validated by sequencing and polqΔL was validated in Drosophila by PCR (Primers 6 and 7).

pattB-POLQ+ was made in the same way as pattB-polqΔL except genomic DNA was used to amplify POLQ. pattB-POLQ+ was validated by sequencing and POLQ+ was validated in Drosophila by PCR (Primers 5 and 2).

To make replacement-linker transgenes, gBlocks (Integrated DNA Technologies) were inserted into pattB-polqΔL. The gBlocks coded for randomly scrambled Drosophila melanogaster linker residues 1,025–1,342, residues 1,483–1,800 from Homo sapiens Polθ, and residues 2–214 from Homo sapiens FUS (Supplementary Table S2). NotI restriction sites and adapters for sequence stabilization were added to gBlock ends. Sequences were codon optimized for Drosophila melanogaster (Integrated DNA Technologies). gBlocks were ligated into pminiT2.0 for propagation (New England BioLabs PCR Cloning) and digested by NotI for insertion into pattB-polqΔL to make pattB-polqSCR, pattB-polqHUM, and pattB-polqFUS. gBlock orientation and composition within each plasmid were validated by PCR and sequencing (Primers 6 and 7). Transgenes were validated in Drosophila by PCR (polqSCR: primers 8 and 7, polqHUM: 6 and 9, polqFUS: 10 and 7).

Quantitative PCR

To extract RNA, 9–15 second/third instar larvae or flies were homogenized in TRIzol (Thermo Fisher Scientific). The homogenate was vigorously mixed with chloroform and centrifuged (15 minutes, 12,000 × g at 4°C). RNA in the upper aqueous layer was removed, mixed with isopropanol, and incubated for 10 minutes at −20°C. After centrifugation (10 minutes, 12,000 × g at 4°C), the pellet was washed with 75% ethanol and allowed to dry. Pellets were resuspended in nuclease-free water and stored at −80°C.

A portion of each RNA sample was treated with DNase I in the respective buffer for 30 minutes at 37°. DNase I activity was inactivated in 4mM EDTA and by heating for 10 minutes at 72°C. DNaseI-treated 1 μg RNA aliquots were immediately used in cDNA synthesis and no-reverse transcriptase control (no-RT) reactions with random primers (New England BioLabs Protoscript II kit).

For qPCR reactions, cDNA and no-RT samples were diluted 1:3. The following reagents were loaded into each well: 10 μL of 2X SYBR Green Fast master mix (ABclonal), 0.4 μL of forward and reverse primers (0.2 μM of each), 7.2 μL of nuclease-free H2O, and 2 μL of the diluted sample. Biological replicates were run in triplicate for each genotype and primer set. One primer set amplified POLQ, but did not amplify polq3XFLAG,PBac{3XP3−DsRed} (Primers 11 and 12, Supplementary Figure S4 and Supplementary Table S3). The second primer set amplified an endogenous control gene, rp49 (Primers 13 and 14). No-template controls for both primer sets were run in triplicate. Samples were analyzed in a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems) using the following cycling conditions: 50°C for 2 minutes, 95°C for 6 minutes, (95°C for 15 seconds, 60°C for 20 seconds) × 40 cycles, and a continuous melt curve stage (95°C for 15 seconds, 60°C for 20 seconds, 95°C for 15 seconds). rp49 Ct triplicate averages were subtracted from POLQ Ct triplicate averages to calculate ΔCt for each biological replicate and calibrator ΔCt values were subtracted from biological replicate ΔCt values to calculate ΔΔCt and relative quantification (2−ΔΔCt).

RQmin and RQmax confidence intervals were calculated using the following adapted equations (Applied Biosystems): RQmin=2−(ΔΔCt+T×SE)

RQmax=2−(ΔΔCt−T×SE)

T=student’s two-tailed T factor for ΔCt mean where α=0.05 and DF=4.

SE=standard error of ΔCt mean=√(((Ct SD)POLQ3)2+((Ct SD)rp493)2) where Ct SD=triplicate standard deviation for a target.

Immunoprecipitation and western blotting

POLQ+, polqnull- or polqΔL, polqnull-homozygous flies were loaded into separate sets of 1.3-liter fly cages containing grape juice agar plates. 500 mg of embryos were collected for each genotype and frozen in liquid nitrogen. Embryos were suspended in lysis buffer (20 mM HEPES pH 7.6, 500 mM NaCl, 1.5 mM MgCl2, 10% glycerol, 0.1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, EDTA-free Pierce protease inhibitor (Thermo Fisher Scientific)) and sonicated for three 10 second bursts at 20% duty cycle with 10 second rests between bursts. Lysates were centrifuged to remove debris (4°C, 24,000 × g). For embryos carrying wild-type POLQ (BDSC 463), proteins were previously extracted using other established methods (53). Lysates were snap-frozen in liquid nitrogen and stored at −80°C.

For 3xFLAG immunoprecipitation, aliquots of ANTI-FLAG M2 Magnetic Beads (20 μL of packed gel volume per aliquot, MilliporeSigma) were washed twice with TBS (50 mM Tris-HCl, 150 mM NaCl) using a magnetic separator. 1 mL lysates were cleared by centrifugation (4°C, 14,000 × g) and added to the bead aliquots. Samples were rotated overnight at 4°C and supernatant was discarded. Beads were washed three times with TBS. FLAG-tagged protein was eluted twice using 100 μL of FLAG peptide (150 ng/μL, gift from Stephen Fuchs) during 30-minute rotations at 4°C.

Proteins were electrophoresed in a 4–20% SurePAGE gel and Tris-MOPS-SDS running buffer (GenScript). Proteins were transferred to a nitrocellulose membrane in wet conditions (25 mM Tris base, 25 mM bicine, 10% ethanol). The membrane was blocked (PBS, 5% non-fat milk) and probed with rabbit anti-DYDDDDK primary antibody (GenScript, 1:2,500 ; PBS-0.05% Tween 20, 1% non-fat milk) and rabbit IgG (HRP) secondary antibody (Abcam,1:10,000 ; PBS-0.05% Tween 20, 1% non-fat milk) with washes after antibody incubations (PBS-0.05% Tween 20). Horseradish peroxidase signal was induced using Prometheus ProSignal ECL (Genesee Scientific).

Mutagen sensitivity assays

In IR assays, each cross included 20–60 females from one stock and 10–30 males from a separately maintained stock that were heterozygous for the same alleles. Crosses were housed at 25°C in 100 mL cages that included grape juice agar plates coated with yeast paste. Grape juice agar plates were replaced in cages every 24 hours. Once third instar larvae emerged, plates were either treated with Ce-137 radiation in a Gammator 1000 irradiator or left untreated. Larvae were transferred to bottles containing standard cornmeal food. Eclosed flies in each bottle were scored as homozygous or heterozygous and relative survival was calculated: ((homozygotes/total flies)irradiated/(homozygotes/total flies)untreated×100). Progeny from 3–4 cross replicates were counted for each genotype. Crosses typically yielded hundreds of flies and not fewer than 32.

We anticipated that unmapped mutations, either randomly inherited during stock construction or caused by DNA repair deficiencies, could result in variable or misleading survival results in sensitivity assays. Accordingly, when possible, female and male parents were taken from separately constructed stocks of the same genotype to increase the likelihood that random mutations would be complemented in trans-heterozygous progeny. Reciprocal crosses, which contained reversed male and female stocks, were used to detect survival variation caused by uncomplemented random mutations on sex chromosomes in male progeny. Survival data for each reciprocal cross was analyzed separately (Supplementary Figure S6) before reciprocal data was combined for each genotype and dose (Figures 3 and 5).

In nitrogen mustard assays, each vial contained 5 females and 3 males heterozygous for specified alleles and followed the same complementation principles as IR assays. On day three, all crosses were transferred to a second set of vials. On day four, the first set of vials was treated with 0.007% nitrogen mustard. On day six, after flies were removed, the second set of vials was treated with water on day seven. Between 10 and 18 days after starting crosses, eclosed flies were scored as homozygous or heterozygous. Relative survival was not calculated for vials containing fewer than 10 flies. Progeny from 11–35 cross replicates were counted for each genotype.

Hatching assays

Crosses included 8–30 females and 3–15 males homozygous for specified alleles. Crosses followed the same complementation principles as sensitivity assays and were housed at 25°C in cages that contained grape juice agar plates coated with yeast paste. Females were allowed to lay eggs on each plate for 24 hours. Hatched and unhatched eggs were counted 48 hours after each plate was removed from a cage. Eggs were counted from 3–6 crosses for each genotype and each cross produced greater than 44 eggs.

Software

Graphs and statistical analyses were made using GraphPad Prism 10.1.2. Sequence analyses and alignments were made using Geneious Prime 2023.2.1. Accession numbers for alignment sequences are listed in Supplementary Table S4. Protein disorder graphs were made using IUPred3 (https://iupred3.elte.hu/).

Results

The Drosophila Polθ linker domain is needed for DNA double-strand break repair and tolerance to interstrand crosslinks

To determine if the Polθ linker domain promotes Drosophila resistance to DNA damage, we constructed a wild-type transgene and a polqΔL-mutant transgene in which most of the disordered linker domain is deleted (Figure 2A). We designed the ΔL mutation to avoid removing partially conserved sequences near the helicase-like and polymerase domains. Both transgenes included 1.195 kb of the endogenous POLQ promoter. The transgenes were separately integrated into the left arm of chromosome 3 to create polqΔL and POLQ+ fly stocks. Each transgene was recombined onto a chromosome containing a polqnull allele. polqΔL and POLQ+ transgenes are sufficiently expressed in larvae and adult flies relative to endogenous POLQ (Figure 2B, Supplementary Figure S4, and Supplementary Table S3) and the respective proteins can be detected via immunoprecipitation from Drosophila embryos (Figure 2C and Supplementary Figure S5).

We first analyzed roles of the linker domain in DSB repair. Previously, it was shown that HR-deficient Drosophila lacking the Rad51 ortholog, spn-A, depend on Polθ to repair IR-induced damage (54). Therefore, we put the Polθ transgenic flies into a spn-A mutant background and measured IR sensitivity. We found that the wild-type POLQ+ transgene provided similar tolerance to IR-induced DSBs as endogenous POLQ at doses of 50, 125, and 250 rads, but not 500 rads (Figure 3A, Supplementary Figure S6A, and Supplementary Table S5). Interestingly, polqΔL mutants were hypersensitive to IR relative to POLQ+ larvae and not significantly different from polqnull mutants. These findings demonstrate that the linker domain is required for Polθ-dependent DSB repair.

In HR-competent Drosophila, Polθ is critical for tolerance of ICLs induced by nitrogen mustard (29,30). We tested the ability of larvae lacking the Polθ linker domain to survive to adulthood following nitrogen mustard treatment. We found that polqΔL mutants were hypersensitive to nitrogen mustard and their survival was not significantly different from polqnull (Figure 3B and Supplementary Figure S6B), indicating that the linker domain is required for either bypass or repair of ICLs.

We also wondered whether the linker domain is required for repair of endogenously derived DNA damage in Drosophila. Drosophila eggs lacking POLQ have thin eggshells and severe hatching defects, likely because they are unable to repair DNA breaks produced during gene amplification of the DAFCs (Drosophila Amplicons in Follicle Cells) (55–57). To assess if the Polθ linker domain has a role in repair of these breaks, we measured hatching rates of eggs homozygous for polqΔL. We compared polqΔL eggs to POLQ+ eggs from a new cross (POLQ+2), since POLQ+ eggs had atypical hatching rates relative to other POLQ+ stocks, possibly caused by randomly accumulated mutations (Supplementary Figures S6 and S7). polqΔL eggs had substantially lower, albeit not significant, hatching frequencies than POLQ+2 eggs and significantly lower hatching frequencies than wild-type eggs (Figure 3C and Supplementary Figure S6C). Interestingly, polqΔL egg hatching rates were not significantly different from polqnull, suggesting that the linker domain promotes resolution of endogenously derived DNA breaks during egg development.

We were curious if the N-terminal 3xFLAG tag in PolθΔL reduced the fitness of polqΔL mutants in sensitivity and hatching assays. However, no significant differences were identified between polqΔL and polqΔL−untagged mutants (Supplementary Figure S7 and Supplementary Table S6). Taken together, our results strongly support that the linker domain is needed for Polθ-dependent repair of DNA damage.

Linker residue properties are important for Polθ functions in DNA repair and damage tolerance

Since Polθ linkers are not well-conserved among Drosophila species (Supplementary Figure S2), we hypothesized that amino acid residue properties may be more critical for linker functions than protein-binding motifs or catalytic subdomains. At the primary sequence level, Polθ linker domains are disordered and composed mostly of hydrophilic polar or charged residues (Table 1, Supplementary Figures S3 and S8).

To explore residue properties of the linker domain that are required for repair, we designed three replacement IDRs (Table 2 and Figure 4A). The first consists of randomly scrambled D. melanogaster linker residues. Length, disorder, overall charge, hydrophilic distribution, and residue composition are similar between the scrambled and wild-type linkers, while potential protein-binding motifs are likely interrupted in the scrambled sequence (Table 2 and Supplementary Figures S8, S9, and S10). The second includes part of the human Polθ linker domain that is also disordered and has a similar length, hydrophilic distribution, and residue composition as the Drosophila linker (Table 2 and Supplementary Figures S8, S9, and S10). Notably, the human linker has an overall negative charge that contrasts with the positive charge of the Drosophila linker. The third consists of the N-terminal low-complexity domain from Homo sapiens FUS, which promotes aggregation at DNA damage for NHEJ and HR repair (58–60). The FUS low-complexity domain is highly disordered (Supplementary Figure S10), but has fewer residues and is more polar and hydrophilic than the Drosophila linker (Table 2, Supplementary Figures S8 and S9).

Replacement linker DNA sequences were codon optimized for Drosophila and separately inserted at the deletion site in polqΔL to make new transgenes that were integrated into the same chromosomal location as the polqΔL transgene. Replacement-linker transgenes had similar expression patterns as polqΔL and POLQ+ transgenes (Figure 4B, Supplementary Figure S4, and Supplementary Table S3).

In a spn-A null mutant background, we observed that polqSCR and POLQ+ larvae had similar sensitivities to IR, while polqHUM and polqFUS mutants were hypersensitive (Figure 5A and Supplementary Table S7). Interestingly, polqSCR mutants were significantly more resistant than POLQ+ larvae at 250 rads and polqHUM and polqFUS mutants were significantly more sensitive than polqΔL mutants at 125 rads. These observations suggest that the scrambled linker promotes efficient Polθ-dependent DSB repair, while human and FUS linkers are not sufficient and may even inhibit DSB repair.

Following treatment with nitrogen mustard, the polqSCR transgene rescued survival relative to the polqΔL transgene, although not to the level of the wild-type transgene (Figure 5B). polqHUM and polqFUS mutants rarely survived and were not significantly different from polqnull mutants. This indicates that, in addition to DSB repair, the scrambled linker can promote tolerance to interstrand crosslinks, while the human and FUS linkers are unable to substitute for this function.

Lastly, we measured hatching rates of eggs homozygous for replacement-linker transgenes. Surprisingly, polqFUS-mutant hatching was not significantly different from POLQ+2 hatching while polqSCR and polqHUM eggs had low hatching frequencies (Figure 5C). These findings suggest that the scrambled domain sequence is unable to support normal egg development, while the FUS low-complexity domain may share properties with the Drosophila linker that are required for DNA repair during egg development.

Discussion

Polθ-mediated DNA repair is critical for genome maintenance and cellular survival. Polθ promotes tolerance of exogenously induced ICLs and is often required for resolution of DSBs in NHEJ- and HR-deficient cells. However, TMEJ frequently causes insertions and deletions in the genome that can elicit human disease. Cancer cells with a variety of genetic backgrounds require Polθ to survive, but comprehensive roles of Polθ domains in cell survival mechanisms are not entirely understood.

While prior investigations identified multiple functions for the Polθ helicase-like and polymerase domains, the linker domain has been largely ignored. In this study, we have shown that the Drosophila Polθ linker domain is required for DNA damage tolerance and has a specific sequence composition that promotes its functions. Importantly, flies possessing a deletion of the disordered linker region are unable to support any of the functions of wild-type Polθ that we tested, including DSB repair, ICL tolerance, and egg viability.

Functions of the linker domain in DSB and ICL repair

The importance of the linker domain in DSB repair was initially surprising, given it is disordered, mostly not conserved in Drosophila species, and the human linker domain is largely dispensable for in vitro (22) and in vivo DSB repair (61). Since Polθ linkers are mostly not conserved, we postulated that the linker functions may depend on residue composition instead of binding motifs or catalytic subdomains. We explored this hypothesis by designing replacement linkers that have similar properties to the Drosophila linker domain. Interestingly, the scrambled Drosophila melanogaster linker fully rescued DSB repair and substantially rescued ICL tolerance. In contrast, part of the human Polθ linker domain and the entire FUS low-complexity domain did not rescue survival in sensitivity assays. Since the human and FUS replacement linkers did not rescue repair, we think it is unlikely that the linker is simply acting as a nonspecific tether between the helicase-like and polymerase domains.

Damage tolerance promoted by the scrambled linker suggests that the ratio of linker residues is important, while linker-mediated protein interactions are unlikely needed for resolution of exogenously induced DNA damage in Drosophila. Prior work showed that the human Polθ linker interacts with TOPBP1 to promote mitotic DSB repair (36). It has also been reported that the human Polθ linker interacts with RAD51 to suppress HR (6), although this remains to be validated (35,62,63). At the moment, it is unclear if Drosophila Polθ linker domains interact with other proteins. Protein interactions may be more common in mammalian Polθ linker domains since they are more conserved than Drosophila linker domains (Supplementary Figure S1 and S2). However, some regions in Drosophila linker domains are partially conserved and may interact with proteins in specific DNA repair or developmental contexts to promote Polθ functions.

Based on our findings, we propose that the Drosophila Polθ linker could promote damage tolerance in at least two ways. First, the slightly positive, but overall neutral charge of the linker may allow interactions between the negatively charged N-terminus and positively charged polymerase domain (Supplementary Figure S11). These interactions could be critical for the helicase-like domain to be situated near the polymerase domain during microhomology synapsis and subsequent DNA synthesis. The scrambled linker may have rescued repair because it has the same overall charge and polarity as the Drosophila linker, while the strong negative charge of the human linker and strong polarity of the FUS linker could have disrupted Polθ termini interactions.

Second, the linker domain may regulate Polθ multimerization at DNA damage. When in vitro and not bound to DNA, the human linker suppresses Polθ from forming multimers that promote TMEJ (22). The wild-type and scrambled linkers may function similarly in vivo and prevent unnecessary Polθ multimerization prior to DNA damage.

Potential roles of the Polθ linker domain in Drosophila egg development

Re-replication of the DAFC genomic regions within Drosophila follicle cells is beneficial for eggshell development, but also causes DNA breaks, some of which require Polθ for repair (55,56). Like polqnull mutants in our study, polqΔL eggs had low hatching frequencies. Surprisingly, polqSCR and polqHUM eggs also had low hatching frequencies while the polqFUS transgene partially rescued hatching. Since the polqFUS transgene did not rescue tolerance in sensitivity assays, repair of re-replication-induced DNA damage and exogenously induced damage likely require different linker-mediated mechanisms.

The FUS low-complexity domain normally encourages FUS aggregation at DNA damage (58–60), which is promoted by PARylation and discouraged by phosphorylation (64,65). Thus, one possibility is that FUS PTMs mimic Drosophila linker PTMs, which are required for Polθ-mediated DNA repair during re-replication but are not sufficient to repair exogenously induced damage.

Conclusion

Overall, we establish that residue specificity plays an important role in how the linker domain regulates Polθ-dependent DNA damage tolerance in Drosophila. Our findings highlight that future studies should consider how the linker domain may influence overall Polθ functions and the efficacy of Polθ inhibitors for cancer treatment.

Supplementary Material

Supplement 1

Acknowledgements

We thank Anna Joseph for creating the spn-A5 mutant and Alice Miller for assistance with embryo lysis and fly counting.

Funding

This work was supported by the National Science Foundation (MCB1716039); and the National Institutes of Health (R01GM125827) to M.M.

Data Availability

Primary data that underlie the main and supplementary figures can be found in the supplementary Excel file.

Figure 1. The Polθ linker domain is mostly not conserved among metazoans and has a disordered structure. (A) Percent identity and similarity scores for pairwise alignments between Polθ domains (Needleman-Wunsch global alignments, Blosum62 cost matrix, penalties: gap open=12, gap extension=3, similarity threshold=1). Alignments with previously defined H. sapiens helicase-like (1–899) and polymerase (1,819–2,590) domains (37,38) were used to determine domain boundaries in D. melanogaster and C. elegans sequences: domain ends coincide with the end of grouped identical residues (not shown, Geneious global alignments with free end gaps, Blosum62 cost matrix, penalties: gap open=12, gap extension=3). (B) Prediction of D. melanogaster Polθ disorder using IUPred3 long disorder and strong smoothing tools (39). Residues with scores above the 0.5 threshold (horizontal line) are predicted to be disordered (40).

Figure 2. POLQ transgenes are expressed and their respective proteins are present in vivo. (A) Protein products from POLQ+ and polqΔL transgenes. Transgenes contain the endogenous POLQ promoter (not shown) and encode a N-terminal 3xFLAG tag. An in-frame deletion in polqΔL subtracts linker residues 1,025–1,342. Transgenes were integrated on chromosome 3L and flies carried an endogenous polqnull allele. (B) POLQ mRNA expression in larvae homozygous for endogenous POLQ (wild type) or POLQ+, polqnull or polqΔL, polqnull alleles. 1 and 2 represent separately derived biological samples. Quantification was computed relative to endogenous control, rp49 expression, and the calibrator sample, wild type 1. Error bars represent RQmin and RQmax confidence intervals (see methods). (C) Immunoprecipitated 3xFLAG-tagged Polθ and PolθΔL from Drosophila embryo lysates. Proteins were detected using an anti-FLAG primary antibody.

Figure 3. The linker domain is required for DNA damage tolerance and promotes egg hatching. (A) Survival of irradiated larvae to adulthood relative to untreated larvae. Each point represents mean relative survival from 3–4 replicate crosses and sample standard deviation is shown. Significance symbols denote comparisons between spn-Anull, polqnull, polqΔL and spn-Anull, polqnull, POLQ+ (two-way ANOVA and Sidak’s multiple comparisons test, all comparisons listed in Supplementary Table S5). (B) Mean relative survival of larvae treated with 0.007% nitrogen mustard from 11–35 crosses per genotype. Each point represents results for one cross. None=no transgene. Shown are sample standard deviation and comparisons using Kruskal-Wallis ANOVA and Dunn’s multiple comparisons test. (C) Mean egg hatching rates from 3–6 replicate crosses per homozygous genotype. Shown are standard deviations and statistical comparisons using Kruskal-Wallis ANOVA and Dunn’s multiple comparisons test. All panels: *p=0.01 to 0.05, **p=0.001 to 0.01, ****p<0.0001, ns=not significant.

Figure 4. polq-mutant transgenes with replacement linkers are expressed in vivo. (A) The deleted linker in PolθΔL was replaced with the D. melanogaster linker sequence scrambled in a random order (PolθSCR), or residues 1483–1800 from the linker domain of human Polθ (PolθHUM), or residues 2–214 from the N-terminal low-complexity domain of human FUS (PolθFUS) (58,59). Transgenes were integrated at the same chromosome 3 site as polqΔL and put into a polqnull background. (B) POLQ mRNA expression in wild-type larvae or those homozygous for a transgene and polqnull. 1 and 2 represent separately derived biological samples. The endogenous control, rp49 expression, and the calibrator sample, wild type 1, were used to calculate relative quantification. Error bars represent RQmin and RQmax. Wild-type, POLQ+, and polqΔL data are also shown in Figure 2B.

Figure 5. The scrambled linker rescues Polθ-dependent resolution of DNA damage and the FUS linker rescues egg hatching. (A) Relative survival of irradiated larvae to adulthood. Each point represents mean survival from 3–4 crosses and sample standard deviation is shown. Data for spn-Anull, polqnull, polqΔL and spn-Anull, polqnull, POLQ+ are also shown in Figure 3A. Significance symbols denote comparisons between spn-Anull, polqnull, POLQ+ and replacement-linker mutants (two-way ANOVA and Sidak’s multiple comparisons test, all comparisons shown in Supplementary Table S7). (B) Relative survival of larvae treated with 0.007% nitrogen mustard. Shown are mean survival from 12–35 crosses per genotype and sample standard deviation. Data for polqnull, POLQ+ and polqnull, polqΔL are also shown in Figure 3B. Nonsignificant comparisons are not shown (Kruskal-Wallis ANOVA and Dunn’s multiple comparisons test). (C) Mean hatching rates of eggs homozygous for transgenes and polqnull. Standard deviation is shown for 3–6 crosses per genotype. Each cross consisted of two parental fly stocks homozygous for a particular genotype, except for polqnull, polqHUM which was crossed with itself (see methods and Supplementary Figure S6). Data for polqnull, POLQ+2 and polqnull, polqΔL are also shown in Figure 3C. Most nonsignificant comparisons are not shown (Kruskal-Wallis ANOVA and Dunn’s multiple comparisons test). All panels: *p=0.01 to 0.05, **p=0.001 to 0.01, ***p=0.0001 to 0.001, ****p<0.0001, ns=not significant.

Table 1. Linker domain properties within Polθ homologs.

Organism	Predicted boundaries	Length (residues)	Overall charge	% Polar uncharged	% Charged	% Hydrophobic	
H. sapiens	900–1,818	919	−16	36	27	37	
R. norvegicus	898–1,777	880	−27	34	28	39	
M. musculus	896–1,773	878	−18	34	27	39	
D. rerio	1,101–1,827	727	−38	35	31	35	
C. elegans	822–1,021	200	−23	26	36	39	
A. thaliana	1,320–1,601	282	−7	31	25	46	
D. melanogaster	1,008–1,407	400	+2	35	26	39	
D. melanogaster helicase-like	214–1,007	794	+1	25	25	51	
D. melanogaster polymerase	1,408–2,059	652	+14	29	25	47	
Pairwise alignments with human helicase-like and polymerase domains were used to predict linker boundaries. D. melanogaster Polθ helicase-like and polymerase domains are listed for comparison to disordered linker domains. Properties were calculated in Geneious Prime. Charge was determined at pH 7.

Table 2. Replacement-linker properties.

D. melanogaster Polθ linker	Length (residues)	Overall charge	% Polar uncharged	% Charged	% Hydrophobic	
Wild type (deleted in ΔL mutant)	318	+7	35	27	39	
Scrambled (SCR)	324	+7	34	26	40	
Human (HUM)	324	−26	33	27	40	
FUS (FUS)	220	−4	63	3	35	

Supplementary Data

Supplementary Data are available at NAR Online.

Conflict of interest statement. None declared.
==== Refs
References

1. Cannan W.J. and Pederson D.S . (2016) Mechanisms and Consequences of Double-Strand DNA Break Formation in Chromatin. J Cell Physiol, 231 , 3–14.26040249
2. Bhargava R. , Sandhu M. , Muk S. , Lee G. , Vaidehi N. and Stark J.M . (2018) C-NHEJ without indels is robust and requires synergistic function of distinct XLF domains. Nat Commun, 9 , 2484.29950655
3. Chapman J.R. , Barral P. , Vannier J.B. , Borel V. , Steger M. , Tomas-Loba A. , Sartori A.A. , Adams I.R. , Batista F.D. and Boulton S.J . (2013) RIF1 is essential for 53BP1-dependent nonhomologous end joining and suppression of DNA double-strand break resection. Mol Cell, 49 , 858–871.23333305
4. Stinson B.M. , Moreno A.T. , Walter J.C. and Loparo J.J . (2020) A Mechanism to Minimize Errors during Non-homologous End Joining. Mol Cell, 77 , 1080–1091 e1088.31862156
5. Scully R. , Panday A. , Elango R. and Willis N.A . (2019) DNA double-strand break repair-pathway choice in somatic mammalian cells. Nat Rev Mol Cell Biol, 20 , 698–714.31263220
6. Ceccaldi R. , Liu J.C. , Amunugama R. , Hajdu I. , Primack B. , Petalcorin M.I. , O’Connor K.W. , Konstantinopoulos P.A. , Elledge S.J. , Boulton S.J. (2015) Homologous-recombination-deficient tumours are dependent on Poltheta-mediated repair. Nature, 518 , 258–262.25642963
7. Feng W. , Simpson D.A. , Carvajal-Garcia J. , Price B.A. , Kumar R.J. , Mose L.E. , Wood R.D. , Rashid N. , Purvis J.E. , Parker J.S. (2019) Genetic determinants of cellular addiction to DNA polymerase theta. Nat Commun, 10 , 4286.31537809
8. Mateos-Gomez P.A. , Gong F. , Nair N. , Miller K.M. , Lazzerini-Denchi E. and Sfeir A . (2015) Mammalian polymerase theta promotes alternative NHEJ and suppresses recombination. Nature, 518 , 254–257.25642960
9. Schimmel J. , Kool H. , van Schendel R. and Tijsterman M . (2017) Mutational signatures of non-homologous and polymerase theta-mediated end-joining in embryonic stem cells. EMBO J, 36 , 3634–3649.29079701
10. Wyatt D.W. , Feng W. , Conlin M.P. , Yousefzadeh M.J. , Roberts S.A. , Mieczkowski P. , Wood R.D. , Gupta G.P. and Ramsden D.A . (2016) Essential Roles for Polymerase Theta-Mediated End Joining in the Repair of Chromosome Breaks. Mol Cell, 63 , 662–673.27453047
11. Zhou J. , Gelot C. , Pantelidou C. , Li A. , Yucel H. , Davis R.E. , Farkkila A. , Kochupurakkal B. , Syed A. , Shapiro G.I. (2021) A first-in-class Polymerase Theta Inhibitor selectively targets Homologous-Recombination-Deficient Tumors. Nat Cancer, 2 , 598–610.34179826
12. Carvajal-Garcia J. , Cho J.E. , Carvajal-Garcia P. , Feng W. , Wood R.D. , Sekelsky J. , Gupta G.P. , Roberts S.A. and Ramsden D.A . (2020) Mechanistic basis for microhomology identification and genome scarring by polymerase theta. Proc Natl Acad Sci U S A, 117 , 8476–8485.32234782
13. Luedeman M.E. , Stroik S. , Feng W. , Luthman A.J. , Gupta G.P. and Ramsden D.A . (2022) Poly(ADP) ribose polymerase promotes DNA polymerase theta-mediated end joining by activation of end resection. Nat Commun, 13 , 4547.35927262
14. Truong L.N. , Li Y. , Shi L.Z. , Hwang P.Y. , He J. , Wang H. , Razavian N. , Berns M.W. and Wu X . (2013) Microhomology-mediated End Joining and Homologous Recombination share the initial end resection step to repair DNA double-strand breaks in mammalian cells. Proc Natl Acad Sci U S A, 110 , 7720–7725.23610439
15. Allera-Moreau C. , Rouquette I. , Lepage B. , Oumouhou N. , Walschaerts M. , Leconte E. , Schilling V. , Gordien K. , Brouchet L. , Delisle M.B. . (2012) DNA replication stress response involving PLK1, CDC6, POLQ, RAD51 and CLASPIN upregulation prognoses the outcome of early/mid-stage non-small cell lung cancer patients. Oncogenesis, 1 , e30.23552402
16. Davies H. , Glodzik D. , Morganella S. , Yates L.R. , Staaf J. , Zou X. , Ramakrishna M. , Martin S. , Boyault S. , Sieuwerts A.M. (2017) HRDetect is a predictor of BRCA1 and BRCA2 deficiency based on mutational signatures. Nat Med, 23 , 517–525.28288110
17. Higgins G.S. , Harris A.L. , Prevo R. , Helleday T. , McKenna W.G. and Buffa F.M . (2010) Overexpression of POLQ confers a poor prognosis in early breast cancer patients. Oncotarget, 1 , 175–184.20700469
18. Kawamura K. , Bahar R. , Seimiya M. , Chiyo M. , Wada A. , Okada S. , Hatano M. , Tokuhisa T. , Kimura H. , Watanabe S. (2004) DNA polymerase theta is preferentially expressed in lymphoid tissues and upregulated in human cancers. Int J Cancer, 109 , 9–16.14735462
19. Lemee F. , Bergoglio V. , Fernandez-Vidal A. , Machado-Silva A. , Pillaire M.J. , Bieth A. , Gentil C. , Baker L. , Martin A.L. , Leduc C. (2010) DNA polymerase theta up-regulation is associated with poor survival in breast cancer, perturbs DNA replication, and promotes genetic instability. Proc Natl Acad Sci U S A, 107 , 13390–13395.20624954
20. Pillaire M.J. , Selves J. , Gordien K. , Gourraud P.A. , Gentil C. , Danjoux M. , Do C. , Negre V. , Bieth A. , Guimbaud R. (2010) A ‘DNA replication’ signature of progression and negative outcome in colorectal cancer. Oncogene, 29 , 876–887.19901968
21. Shinmura K. , Kato H. , Kawanishi Y. , Yoshimura K. , Tsuchiya K. , Takahara Y. , Hosokawa S. , Kawase A. , Funai K. and Sugimura H . (2019) POLQ Overexpression Is Associated with an Increased Somatic Mutation Load and PLK4 Overexpression in Lung Adenocarcinoma. Cancers, 11 .
22. Black S.J. , Ozdemir A.Y. , Kashkina E. , Kent T. , Rusanov T. , Ristic D. , Shin Y. , Suma A. , Hoang T. , Chandramouly G. (2019) Molecular basis of microhomology-mediated end-joining by purified full-length Pol theta. Nat Commun, 10 , 4423.31562312
23. Mateos-Gomez P.A. , Kent T. , Deng S.K. , McDevitt S. , Kashkina E. , Hoang T.M. , Pomerantz R.T. and Sfeir A . (2017) The helicase domain of Pol theta counteracts RPA to promote alt-NHEJ. Nat Struct Mol Biol, 24 , 1116–1123.29058711
24. Schaub J.M. , Soniat M.M. and Finkelstein I.J . (2022) Polymerase theta-helicase promotes end joining by stripping single-stranded DNA-binding proteins and bridging DNA ends. Nucleic Acids Res, 50 , 3911–3921.35357490
25. Arana M.E. , Seki M. , Wood R.D. , Rogozin I.B. and Kunkel T.A . (2008) Low-fidelity DNA synthesis by human DNA polymerase theta. Nucleic Acids Res, 36 , 3847–3856.18503084
26. Maga G. , Shevelev I. , Ramadan K. , Spadari S. and Hubscher U . (2002) DNA polymerase theta purified from human cells is a high-fidelity enzyme. J Mol Biol, 319 , 359–369.12051913
27. Higgins G.S. , Prevo R. , Lee Y.F. , Helleday T. , Muschel R.J. , Taylor S. , Yoshimura M. , Hickson I.D. , Bernhard E.J. and McKenna W.G . (2010) A small interfering RNA screen of genes involved in DNA repair identifies tumor-specific radiosensitization by POLQ knockdown. Cancer Res, 70 , 2984–2993.20233878
28. Yousefzadeh M.J. , Wyatt D.W. , Takata K. , Mu Y. , Hensley S.C. , Tomida J. , Bylund G.O. , Doublie S. , Johansson E. , Ramsden D.A. (2014) Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. PLoS Genet, 10 , e1004654.25275444
29. Beagan K. , Armstrong R.L. , Witsell A. , Roy U. , Renedo N. , Baker A.E. , Schärer O.D. and McVey M . (2017) Drosophila DNA polymerase theta utilizes both helicase-like and polymerase domains during microhomology-mediated end joining and interstrand crosslink repair. PLoS Genet, 13 , e1006813.28542210
30. Boyd J.B. , Sakaguchi K. and Harris P.V . (1990) mus308 mutants of Drosophila exhibit hypersensitivity to DNA cross-linking agents and are defective in a deoxyribonuclease. Genetics, 125 , 813–819.2397884
31. Inagaki S. , Suzuki T. , Ohto M.A. , Urawa H. , Horiuchi T. , Nakamura K. and Morikami A . (2006) Arabidopsis TEBICHI, with helicase and DNA polymerase domains, is required for regulated cell division and differentiation in meristems. Plant Cell, 18 , 879–892.16517762
32. Muzzini D.M. , Plevani P. , Boulton S.J. , Cassata G. and Marini F . (2008) Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways. DNA Repair (Amst), 7 , 941–950.18472307
33. Ramsden D.A. , Carvajal-Garcia J. and Gupta G.P . (2022) Mechanism, cellular functions and cancer roles of polymerase-theta-mediated DNA end joining. Nat Rev Mol Cell Biol, 23 , 125–140.34522048
34. Schrempf A. , Slyskova J. and Loizou J.I . (2021) Targeting the DNA Repair Enzyme Polymerase theta in Cancer Therapy. Trends Cancer, 7 , 98–111.33109489
35. Wood R.D. and Doublie S . (2022) Genome Protection by DNA Polymerase theta. Annu Rev Genet, 56 , 207–228.36028228
36. Gelot C. , Kovacs M.T. , Miron S. , Mylne E. , Haan A. , Boeffard-Dosierre L. , Ghouil R. , Popova T. , Dingli F. , Loew D. (2023) Pol theta is phosphorylated by PLK1 to repair double-strand breaks in mitosis. Nature, 621 , 415–422.37674080
37. Newman J.A. , Cooper C.D.O. , Aitkenhead H. and Gileadi O . (2015) Structure of the Helicase Domain of DNA Polymerase Theta Reveals a Possible Role in the Microhomology-Mediated End-Joining Pathway. Structure, 23 , 2319–2330.26636256
38. Zahn K.E. , Averill A.M. , Aller P. , Wood R.D. and Doublie S . (2015) Human DNA polymerase theta grasps the primer terminus to mediate DNA repair. Nat Struc Mol Biol, 22 , 304–311.
39. Erdos G. , Pajkos M. and Dosztanyi Z . (2021) IUPred3: prediction of protein disorder enhanced with unambiguous experimental annotation and visualization of evolutionary conservation. Nucleic Acids Res, 49 , W297–W303.34048569
40. Dosztanyi Z. , Csizmok V. , Tompa P. and Simon I . (2005) The pairwise energy content estimated from amino acid composition discriminates between folded and intrinsically unstructured proteins. J Mol Biol, 347 , 827–839.15769473
41. Cermakova K. and Hodges H.C . (2023) Interaction modules that impart specificity to disordered protein. Trends Biochem Sci, 48 , 477–490.36754681
42. Wright P.E. and Dyson H.J . (2015) Intrinsically disordered proteins in cellular signalling and regulation. Nat Rev Mol Cell Biol, 16 , 18–29.25531225
43. Altmeyer M. , Neelsen K.J. , Teloni F. , Pozdnyakova I. , Pellegrino S. , Grofte M. , Rask M.D. , Streicher W. , Jungmichel S. , Nielsen M.L. (2015) Liquid demixing of intrinsically disordered proteins is seeded by poly(ADP-ribose). Nat Commun, 6 , 8088.26286827
44. Bah A. and Forman-Kay J.D . (2016) Modulation of Intrinsically Disordered Protein Function by Post-translational Modifications. J Biol Chem, 291 , 6696–6705.26851279
45. Kamagata K. , Kanbayashi S. , Honda M. , Itoh Y. , Takahashi H. , Kameda T. , Nagatsugi F. and Takahashi S . (2020) Liquid-like droplet formation by tumor suppressor p53 induced by multivalent electrostatic interactions between two disordered domains. Sci Rep, 10 , 580.31953488
46. Levone B.R. , Lenzken S.C. , Antonaci M. , Maiser A. , Rapp A. , Conte F. , Reber S. , Mechtersheimer J. , Ronchi A.E. , Muhlemann O. (2021) FUS-dependent liquid-liquid phase separation is important for DNA repair initiation. J Cell Biol, 220 .
47. Oshidari R. , Huang R. , Medghalchi M. , Tse E.Y.W. , Ashgriz N. , Lee H.O. , Wyatt H. and Mekhail K . (2020) DNA repair by Rad52 liquid droplets. Nat Commun, 11 , 695.32019927
48. Spegg V. and Altmeyer M . (2021) Biomolecular condensates at sites of DNA damage: More than just a phase. DNA Repair (Amst), 106 , 103179.34311273
49. Gratz S.J. , Goel P. , Bruckner J.J. , Hernandez R.X. , Khateeb K. , Macleod G.T. , Dickman D. and O’Connor-Giles K.M . (2019) Endogenous Tagging Reveals Differential Regulation of Ca(2+) Channels at Single Active Zones during Presynaptic Homeostatic Potentiation and Depression. J Neurosci, 39 , 2416–2429.30692227
50. Bruckner J.J. , Zhan H. , Gratz S.J. , Rao M. , Ukken F. , Zilberg G. and O’Connor-Giles K.M . (2017) Fife organizes synaptic vesicles and calcium channels for high-probability neurotransmitter release. J Cell Biol, 216 , 231–246.27998991
51. Gratz S.J. , Cummings A.M. , Nguyen J.N. , Hamm D.C. , Donohue L.K. , Harrison M.M. , Wildonger J. and O’Connor-Giles K.M . (2013) Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics, 194 , 1029–1035.23709638
52. Iwasaki S. , Kobayashi M. , Yoda M. , Sakaguchi Y. , Katsuma S. , Suzuki T. and Tomari Y . (2010) Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes. Mol Cell, 39 , 292–299.20605501
53. Yang L. , Paul S. , DuBois-Coyne S. , Kyriakakis P. and Veraksa A . (2017) Medium-scale Preparation of Drosophila Embryo Extracts for Proteomic Experiments. J Vis Exp.
54. Chan S.H. , Yu A.M. and McVey M . (2010) Dual roles for DNA polymerase theta in alternative end-joining repair of double-strand breaks in Drosophila. PLoS Genet, 6 , e1001005.20617203
55. Alexander J.L. , Barrasa M.I. and Orr-Weaver T.L . (2015) Replication fork progression during re-replication requires the DNA damage checkpoint and double-strand break repair. Curr Biol, 25 , 1654–1660.26051888
56. Alexander J.L. , Beagan K. , Orr-Weaver T.L. and McVey M . (2016) Multiple mechanisms contribute to double-strand break repair at rereplication forks in Drosophila follicle cells. Proc Natl Acad Sci U S A, 113 , 13809–13814.27849606
57. Claycomb J.M. and Orr-Weaver T.L . (2005) Developmental gene amplification: insights into DNA replication and gene expression. Trends Genet, 21 , 149–162.15734574
58. Mastrocola A.S. , Kim S.H. , Trinh A.T. , Rodenkirch L.A. and Tibbetts R.S . (2013) The RNA-binding protein fused in sarcoma (FUS) functions downstream of poly(ADP-ribose) polymerase (PARP) in response to DNA damage. J Biol Chem, 288 , 24731–24741.23833192
59. Murray D.T. , Kato M. , Lin Y. , Thurber K.R. , Hung I. , McKnight S.L. and Tycko R . (2017) Structure of FUS Protein Fibrils and Its Relevance to Self-Assembly and Phase Separation of Low-Complexity Domains. Cell, 171 , 615–627 e616.28942918
60. Singatulina A.S. , Hamon L. , Sukhanova M.V. , Desforges B. , Joshi V. , Bouhss A. , Lavrik O.I. and Pastre D . (2019) PARP-1 Activation Directs FUS to DNA Damage Sites to Form PARG-Reversible Compartments Enriched in Damaged DNA. Cell Rep, 27 , 1809–1821 e1805.31067465
61. Fijen C. , Drogalis Beckham L. , Terino D. , Li Y. , Ramsden D.A. , Wood R.D. , Doublie S. and Rothenberg E . (2024) Sequential requirements for distinct Pol theta domains during theta-mediated end joining. Mol Cell, 84 , 1460–1474 e1466.38640894
62. Hwang T. , Reh S. , Dunbayev Y. , Zhong Y. , Takata Y. , Shen J. , McBride K.M. , Murnane J.P. , Bhak J. , Lee S. (2020) Defining the mutation signatures of DNA polymerase theta in cancer genomes. NAR Cancer, 2 , zcaa017.32885167
63. Zelensky A.N. , Schimmel J. , Kool H. , Kanaar R. and Tijsterman M . (2017) Inactivation of Pol theta and C-NHEJ eliminates off-target integration of exogenous DNA. Nat Commun, 8 , 66.28687761
64. Monahan Z. , Ryan V.H. , Janke A.M. , Burke K.A. , Rhoads S.N. , Zerze G.H. , O’Meally R. , Dignon G.L. , Conicella A.E. , Zheng W. (2017) Phosphorylation of the FUS low-complexity domain disrupts phase separation, aggregation, and toxicity. EMBO J, 36 , 2951–2967.28790177
65. Rulten S.L. , Rotheray A. , Green R.L. , Grundy G.J. , Moore D.A. , Gomez-Herreros F. , Hafezparast M. and Caldecott K.W . (2014) PARP-1 dependent recruitment of the amyotrophic lateral sclerosis-associated protein FUS/TLS to sites of oxidative DNA damage. Nucleic Acids Res, 42 , 307–314.24049082
