
==== Front
BMC Microbiol
BMC Microbiol
BMC Microbiology
1471-2180
BioMed Central London

39251908
3469
10.1186/s12866-024-03469-0
Research
Genomic portraits of methicillin-resistant staphylococci (MRS) from food fish unveiled the genes associated with staphylococcal food poisoning (SFP), virulence and antimicrobial resistance
Hamza Muneeb 12
Sivaraman Gopalan Krishnan gkshivraman@gmail.com

2
Mothadaka Mukteswar Prasad mm.prasad@icar.gov.in

3
1 https://ror.org/00a4kqq17 grid.411771.5 0000 0001 2189 9308 Faculty of Science, Cochin University of Science and Technology, Cochin-682022, India
2 grid.418368.0 0000 0000 9748 4830 Microbiology Fermentation and Biotechnology (MFB) Division, ICAR- Central Institute of Fisheries Technology (ICAR-CIFT), Matsyapuri P.O., Willingdon, Cochin 682029, India
3 https://ror.org/049skhf47 grid.411381.e 0000 0001 0728 2694 Visakhapatnam Research Centre of ICAR-CIFT, Andhra University P.O., Ocean View Layout, Pandurangapuram, Visakhapatnam, Andhra Pradesh, 530 003 India
10 9 2024
10 9 2024
2024
24 3346 12 2023
19 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Characteristics of non-clinical strains of methicillin-resistant Staphylococcus aureus (MRSA) especially from fishery environment are poorly understood. This research, in addition to comprehensive characterisation, sought to delineate the genetic relatedness between the MRSA strains originating from clinical as well as non-clinical settings. Out of 39 methicillin-resistant staphylococcal isolates from 197 fish samples, 6 (Three each of methicillin-resistant S. haemolyticus (MRSH) and MRSA) with distinct resistance profiles were selected for whole-genome sequencing. Using respective bioinformatics tools, MRSA genomes were comprehensively characterized for resistome, virulomes, molecular epidemiology and phylogenetic analysis. Simultaneously, MRSH genomes were specifically examined to characterize antimicrobial resistance genes (ARGs), owing to the fact that MRSH is often recognized as a reservoir for resistance determinants.

Results

Three MRSA clones identified in this study include ST672-IVd/t13599 (sequence type-SCCmec type/spa type), ST88-V/t2526, and ST672-IVa/t1309. Though, the isolates were phenotypically vancomycin-sensitive, five of the six genomes carried vancomycin resistance genes including the VanT (VanG cluster) or VanY (VanM cluster). Among the three MRSA, only one harbored the gene encoding Panton-Valentine Leukocidin (PVL) toxin, while staphylococcal enterotoxin (SEs) genes such as sea and seb, associated with staphylococcal food poisoning were identified in two other MRSA. Genomes of MRSH carried a composite of type V staphylococcal cassette chromosome mec (SCCmec) elements (5C2 & 5). This finding may be explained by the inversion and recombination events that may facilitate the integration of type V elements to the SCC elements of S. aureus with a methicillin-susceptible phenotype. Phylogenetically, MRSA from a non-clinical setting displayed a considerable relatedness to that from clinical settings.

Conclusion

This study highlights the genetic diversity and resistance profiles of MRSA and MRSH, with non-clinical MRSA showing notable relatedness to clinical strains. Future research should explore resistance gene transfer mechanisms and environmental reservoirs to better manage MRSA spread.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-024-03469-0.

Keywords

Antimicrobial resistance
Multilocus sequence typing
MRSA genome
ST672
ST88
SCCmec typing
Staphylococcal food poisoning
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Quality of the food is determined by various factors encompassing nutritional contents, health benefits, and importantly food hygiene. However, food safety could be compromised if proper sanitary procedures are not followed while handling, preparation and storage of food [1]. Such an ominous situation has the potential to result in foodborne diseases caused by a wide range of biological and chemical contaminants such as viruses, bacteria, parasites, chemical toxins, heavy metals, allergens, etc. [2]. Staphylococcal food poisoning (SFP), caused by staphylococcal enterotoxins, is a global common foodborne illness among various types of foodborne diseases (FBD). In the United States alone, nearly 0.24 million cases of SFP are reported every year [3]. According to a report, more than 100 individuals, including children and adults in India, exhibited symptoms of SFP and were hospitalized after consuming contaminated food. Therein, microbiological evaluation of the food revealed the occurrence of enterotoxigenic Staphylococcus aureus, capable of producing enterotoxins SEB and SED [4]. While the food poisoning caused by S. aureus remains unresolved on one hand, on the other, the pathogen is developing antibiotic resistance, creating significant challenges for control measures.

The molecular mechanisms underlying the evolution of staphylococci with adaptability towards various challenges have been a longstanding scientific paradox. To solve the mystery, plethora of studies were conducted over the years, resulting in staphylococci becoming one of the most studied pathogens. In the staphylococci, particularly coagulase-positive S. aureus, occasionally changing from commensal to pathogen, antimicrobial resistance (AMR) is a pressing clinical concern [5]. Virulence factors of methicillin-resistant S. aureus (MRSA) include the Panton-Valentine Leukocidin (PVL) toxin, which damages immune cells and contributes to severe infections, and surface proteins like Protein A, which help evade immune detection. Enzymes such as coagulase and hyaluronidase facilitate tissue invasion. These factors collectively enhance MRSA’s ability to colonize, invade tissues, and resist host immune responses, leading to serious and often resistant infections [6]. Notably, public health is critical in managing MRSA due to its potential for widespread transmission and severe infections. Multidrug-resistant MRSA phenotypes complicate treatment options and heighten the need for effective infection control strategies. Besides, clonal divergence and genetic heterogeneity among the S. aureus that are evident from the fact that the total S. aureus population belonged to 10 clonal complexes (CCs) comprised of 8455 sequence types (STs) [7]. Among the varying CCs, CC1, CC5, CC8, CC15, CC22, CC30, CC45, CC93, CC97, and CC121 are 10 major ones, with CC5 having the highest number STs (1138 STs) and CC93 having the fewest, only 18. However, CC8 is the lineage of the first MRSA or archaic clone (ST250-MRSA-IV) and one of the most pathogenic clones USA300 (ST8-MRSA-IV) which constantly displays the catastrophic nature of the infection. Apart from this, 2836 STs are not even included in any of the CCs; rather exist as single, independent lineages.

At global scale dissemination of MRSA clones described the correlation between geographical location and the lineage, reflecting the varied nature of clonality from region to region [8]. For instance, USA300 clones are predominantly found in the American continent, whereas, the Bengal Bay clone (ST772-MRSA) is in Asian countries, particularly in India. This theory, however, is no longer valid because the USA300 has now been isolated from a tertiary hospital in India [9]. Similarly, other clones of MRSA, the occurrence of which was previously assumed to be restricted to specific areas, have been isolated from different regions of the world. The Bengal Bay clone of the CC1 is the sporadically detected MRSA clone in India, which has been associated with multiple cases of life-threatening infections in the Indian population [10]. In addition to the Bengal Bay clone, an ST672 MRSA clone with an immune evasion cluster distinct from ST772 was isolated from an outpatient in India with an ocular infection [11]. Apart from clinical isolation settings, the occurrence of ST672 clones was observed later from retail market fishes (non-clinical), epitomizing its transboundary spread [12]. Although clinical MRSA characteristics have been described, few research attempts have described phenotypes and genotypes from non-clinical settings such as retail market fishes, seafood products, aquaculture farms etc. [12, 13]. The genomes of non-clinical strains of MRSA (n = 3) and methicillin-resistant S. haemolyticus (MRSH; n = 3) isolated from commercial fish outlets were employed in this study to explain the distinctive features concerning ARGs, virulent determinants, and molecular epidemiology, followed by a genome comparison to shed the light on evolutionary aspects.

Methods

Bacterial isolates and the determination of their resistance profile

As a part of molecular surveillance study, 197 fish samples were collected from three major districts of Assam (Garchuk, Silagrant, and North Guwahati) using convenience sampling method. The fish samples were obtained from commercial retail markets, and they were already deceased at the time of collection. Consequently, no euthanasia procedures were necessary. To prevent contamination during transport, collected samples were brought to the lab in a sterile polythene bag under chilled condition. From the samples collected, staphylococci were isolated using the standard protocol [12]. Ten gram of fish meat (edible portion) was aseptically collected and triturated in a sterile pestle and mortar. A portion of 100 ml of sterile enrichment broth was added and the mixture was transferred to a sterile flask containing the remaining enrichment broth. The flask was then incubated further to facilitate the isolation of staphylococci. The Tryptic Soy broth (BD Difco, USA) supplemented with 1% (w/v) sodium pyruvate (Himedia, India) and 10% (w/v) sodium chloride (Himedia, India) was employed for enrichment. Presumptive staphylococcal colonies were selected using mannitol salt agar (MSA, BD Difco, USA). One hundred and ninety-seven samples yielded 39 methicillin-resistant isolates comprising of S. aureus (n = 23) and S. haemolyticus (n = 16), molecular identification were achieved using species-specific multiplex PCR. Of 39 isolates, six were selected based on the antibiogram and considered for whole-genome sequencing. During sampling, ethnographic information regarding the source was obtained from the local fish merchants. The isolates of this study were referred to as MRS 1 (MRSA), MRS 2 (MRSH), MRS 3 (MRSA), MRS 4 (MRSA), MRS 5 (MRSH), and MRS 6 (MRSH), and the terms were used interchangeably throughout the text.

Preliminary screening for methicillin resistance was performed using a spot inoculation test, which involved transferring 10 µl of overnight grown bacterial cultures to Muller-Hinton agar (MHA, BD Difco, USA) plates containing 6 µg/mL oxacillin (a surrogate antibiotic for methicillin) and 4% sodium chloride [14]. Cultures grown on the plate at 37 °C for 24 h incubation were considered as methicillin-resistance phenotypes. This was followed by the bacterial identification and determination of resistance pattern against 20 antibiotics that encompass 13 classes using BD Phoenix M50 instrument [15]. Multiple antibiotic resistance (MAR) index of each isolate is also calculated based on the phenotypic resistance profile [16]. Molecular identity of the isolates was confirmed by applying a multiplex PCR using the primers 23 S rRNA (F- AGCGAGTCTGAATAGGGCGTTT; R- CCCATCACAGCTCAGCCTTAAC) and sodA (F: CAAATTAAATTCTGCAGTTGAGG; R- GGCCTCTTATAGAGACCACATGTTA) for MRSA and MRSH, respectively, as per the cyclic conditions described elsewhere [17].

Genome sequencing

The total genome sequences (paired end) of the isolates were generated using the Illumina HiSeq 2500 platform in the MicrobesNG lab in Birmingham, UK. The FastQC tool was employed to evaluate the quality of the sequencing reads, followed by trimming the adapters with Trimmomatic. Quality check passed reads were assembled to contigs using SPAdes v 1.13.4 [18] and annotated using RAST tool kit (RASTtk) with default parameters [19]. A Quality Assessment Tool (QUAST) report on the genomes was generated to evaluate the quality of genome assembly [20]. Finally, annotated genomes were mapped to respective S. aureus and S. haemolyticus reference genomes using a progressive mauve alignment tool. The assembled genomes (n = 6) were deposited in the Sequence Read Archive (SRA) of NCBI under the BioProject PRJNA932747 and the accession numbers SRX19312967 (MRS 1), SRX19312968 (MRS 2), SRX19312969 (MRS 3), SRX19312970 (MRS 4), SRX19312971 (MRS 5), and SRX19312972 (MRS 6).

In silico genome analysis

By using the ResFinder 4.1, and the Resistance gene identified (RGI) available in Comprehensive Antimicrobial Resistance Database (CARD), major resistance phenotypes and associated resistance genes (ARGs) were predicted [21, 22]. Similarly, virulence determinants and toxin genes were identified using VirulenceFinder 2.0 and ABRIcate-VFDB tools [23, 24]. PlasmidFinder 2.1 was employed after choosing a Gram-positive database to identify the plasmids in the genome [25]. The presence of mobile genetics elements (MGE) was identified with the assistance of Mobile Element Finder v1.0.3 [26]. The genes involved in the secondary metabolite biosynthetic pathway and the production of bacteriocin were identified by using antiSMASH 5.0 [27]. Molecular epidemiology of the isolates was recognized employing staphylococcal cassette chromosome (SCC) mec-typing, spa-typing (S. aureus (n = 3) only), and multilocus sequence typing (MLST; S. aureus) that used SCCmecFinder 1.2 [28], spaTyper 1.0 [29], and MLST 2.0 [30], respectively. The accessory gene regulators (agr) types of three MRSA genomes were determined using appropriate primers [31] by an In-silico PCR method [32].

Genome comparison and phylogeny

For the genome-wide comparison of two ST672 MRSA clones (MRS 1 and MRS 4) following clinical ST672 strains were used; ST672-IVd (JAJTJT000000000, [33]), AMRF2 (JASM00000000, [34]), GR1 (AJLX00000000, [35]), VB12268 (LXWS00000000, [36]), and VBV169 (LWMG00000000, [36]). According to the corresponding reference literature, ST672-IVd, AMRF2, GR1, VB12688, and VBV169 clones were isolated from a male patient (tertiary health care center, Kerala), ocular infection, blood septicemia, skin and soft tissue infection (SSTI), and sepsis, respectively. Similarly, MRS 3 (ST88) was compared with 15 previously reported ST88 MRSA strains. Detailed information on the source, country and year of isolation, etc. of reference genomes provided in Supplementary material 1. A genome-based phylogenetic tree was constructed using the Type/Strain Genome Sever (TYGS) with the genome of Escherichia coli as outgroup [37]. The tree was annotated using the interactive Tree of Life (iTOL) v6.8 [38]. The average nucleotide identity (ANI) was calculated based on Blast + for the ST672 and ST88 MRSA genome of this study against the respective reference genomes using the JSpeciesWS webserver [39].

Results

Ethnographic research

In this study, fish samples from which the isolates have been identified were either river-caught or intra country imported from other states namely Andhra Pradesh or Kolkata of India. Detailed information on the sample sources is shown in Table 1. Sampling area was selected based on the ethnographic information that the chosen sites were within the proximity of hospitals and factories. According to the local residents, the rural waste management system is poorly regulated in Assam. Therefore, it is assumed that medical wastes and industrial effluents are discharged directly to the vicinities of aquatic resources. This may eventually lead to the selection of AMR bacterial pathogens, which could be one of the main reasons why water resources are the epicentre for the propagation of AMR.

Table 1 Details of sources of sampling

SL No	Isolate ID	Sample source	Organism identified	Location	Latitude and Longitude	Imported/Farm-raised/River-caught#	
Local name*	Scientific name	
1	MRS 1	Bhangan	Labeo boga	Staphylococcus aureus	Gauripur, Silagrant	26°13ʹ19.7ʹʹ N: 91°41ʹ50.9ʹʹ E	Brought from Ghograpar, Nalbari District)	
2	MRS 2	Catla	Catla catla	S. haemolyticus	Jaiguru Market, Amingaon, Silagrant	26°12ʹ31.7ʹʹ N: 91°41ʹ8.5ʹʹ E	Brought from Rangiya, Kamrup District	
3	MRS 3	Kuri mas	Labeo gonius	S. aureus	Near Ayursundra Hospital, Garchuk	26°6ʹ25.3ʹʹ N: 91°43ʹ11.2ʹʹ E	River-caught (from a lake in Hajo villiage)	
4	MRS 4	Bhangan	Labeo boga	S. aureus	Near Ayursundra Hospital, Garchuk	26°6ʹ25.3ʹʹ N: 91°43ʹ11.2ʹʹ E	River-caught (from a lake in Hajo villiage)	
5	MRS 5	Rupchanda	Pygocentrus nattereri	S. haemolyticus	Gauripur, Silagrant	26°13ʹ2.3ʹʹ N: 91°42ʹ6.3ʹʹ E	Imported from Kolkata	
6	MRS 6	Shrimp	Penaeus sp.	S. haemolyticus	IIT Guwahati Campus fish market, Silagrant	26°11ʹ42.7ʹʹ N: 91°41ʹ17.2ʹʹ E	Imported from Andhra Pradesh	
*Local name is collected from the fish merchants

# According to the information provided by the fish vendors

Bacterial strains and their phenotypic resistance

The BD Phoenix instrument identified three of the six isolates as S. aureus and the remaining three as S. haemolyticus. The multiplex PCR yielded the amplicons of 894 bp (n = 3) and 531 bp (n = 3) which corresponds to S. aureus and S. haemolyticus, respectively. Furthermore, resistance patterns revealed that all six isolates (100%) have multidrug-resistance (MDR) phenotype which means, they were resistant to at least one antibiotic from three or more classes. Notably, MRSA (n = 3) showed almost identical resistance patterns regardless of the source of isolation, except for MRS 1 which exhibited additional resistance to trimethoprim/sulfamethoxazole (SXT) antibiotic. As a result, MRS 1 had the highest MAR index (0.4), while the other five isolates had 0.35. The resistance profile of individual isolates is given in Table 2.

Table 2 Bacterial isolates and their resistance phenotypes

SL No	Isolate ID	Organism	Resistance profile*	MAR index = A/B#	Secondary metabolites	
1	MRS 1	Staphylococcus aureus	AMP-CFZ-FOX-GEN-NOR-OXA-PEN-SXT	8/20 = 0.4	aureusimine, staphyloferrin A	
2	MRS 2	S. haemolyticus	AMP-CFZ-FOX-GEN-OXA-PEN-TET	7/20 = 0.35	staphyloferrin A	
3	MRS 3	S. aureus	AMP-CFZ-FOX-GEN-NOR—OXA-PEN	7/20 = 0.35	aureusimine, staphyloferrin A	
4	MRS 4	S. aureus	AMP-CFZ-FOX-GEN-NOR-OXA-PEN	7/20 = 0.35	aureusimine, staphyloferrin A	
5	MRS 5	S. haemolyticus	AMP-CFZ-FOX-GEN-OXA-PEN-SXT	7/20 = 0.35	staphyloferrin A	
6	MRS 6	S. haemolyticus	AMP-CFZ-FOX-ERY-GEN-OXA-PEN	7/20 = 0.35	staphyloferrin A	
* Antibiotics and abbreviations: AMP-ampicillin; CFZ-cefazolin; FOX-cefoxitin; ERY-erythromycin; GEN-gentamicin; NOR-norfloxacin; OXA-oxacillin; PEN-penicillin; SXT-trimethoprim-/sulfamethoxazole; TET-tetryacycline

# Multiple antibiotic resistance (MAR); ‘A’ is the number of antibiotics to which isolates were resistant; ‘B’ is the total number of antibiotics to which isolates were exposed

Resistance and virulence genotypes

The circular map of two representative genomes is shown in Fig. 1, and the remaining circular maps are depicted in Supplementary Material 2. Genomic features of six staphylococcal isolates are provided in Table 3. A representative mauve alignment of the MRS 1 genome against the S. aureus reference genome is illustrated in Fig. 2. Screening for resistance and virulence determinants revealed that all three MRSA isolates were equipped with an extensive array of ARGs and toxin genes, while MRSH isolates carried a handful of ARGs. Based on the distribution of resistance genes, six genomes were divided into two clades namely clade1 (comprising of three MRSA genomes) and clade 2 (including three MRSH genomes) (Fig. 3a). Even though all the isolates were phenotypically sensitive to vancomycin, all the isolates except MRS 2 harboured either VanT gene in the VanG cluster or the VanY gene in the VanM cluster which usually confer resistance to glycopeptides. In addition to the ARGs, genes encoding efflux machinery (sepA) that pumps out the antiseptics and disinfectants of the cell are also identified in most of the isolates. The incompatibility plasmid Inc18 (rep16 family) and Rep3 (rep5a family) were the plasmids found in all the MRSA isolates with ISSau5 as the commonly found MGE. In the case of MRSH, RepL (rep10 family) was found in both MRS 5 and MRS 6, while MRS 5 and MRS 6 additionally carried RepA_N (rep39 family) and Rep-Trans (rep7a family), respectively. All the MRSH isolates carried ISSha1 while MRS 5 and MRS 6 further carried IS256.

Fig. 1 Circular map of representative methicillin-resistantStaphylococcus aureus(MRSA): (a) and methicillin-resistant S. haemolyticus (MRSH) (b) genomes highlighting the major resistance genes and mobile genetic elements (MGE)

Table 3 Genomic features of Staphylococci

	MRS 1	MRS 2	MRS 3	MRS 4	MRS 5	MRS 6	
# contigs ( > = 0 bp)	68	115	100	179	464	39	
# contigs ( > = 1000 bp)	17	44	22	56	67	13	
Total length ( > = 0 bp)	2,803,340	2,455,896	2,836,797	2,535,664	2,672,354	2,800,965	
Total length ( > = 1000 bp)	2,787,016	2,435,085	2,818,396	2,499,296	2,497,610	2,793,338	
# contigs	22	52	25	67	159	15	
Largest contig	572,671	322,121	1,325,285	271,310	222,407	1,050,538	
Total length	2,790,446	2,440,623	2,820,448	2,506,864	2,556,093	2,795,165	
GC (%)	32.72	32.71	32.64	32.73	33.04	32.71	
N50	318,982	117,454	278,962	78,337	65,019	564,525	
N90	85,303	25,325	92,366	22,038	17,293	123,253	
auN	332289.1	156388.4	720852.2	109077.4	87579.2	608026.4	
L50	4	6	2	10	11	2	
L90	9	22	8	31	40	6	
# N’s per 100 Kbp	0.00	0.00	0.00	0.00	0.00	0.00	

Fig. 2 Progressive mauve alignment: Genome mapping of methicillin-resistant Staphylococcus aureus (MRSA) of this study against the reference genome using progressive mauve alignment

Fig. 3 Distribution of major antimicrobial resistance genes (ARGs) virulence determinants: a: Identification of ARGs and clustering of methicillin-resistant staphylococci (n = 6) based on the presence and absence of ARGs. b: Virulence determinants distributed among three methicillin-resistant Staphylococcus aureus (MRSA) strains. In both the figures, red colour indicates the presence of genes whereas blue denotes the absence

When it comes to virulence determinants, all the three MRSA isolates carried an extensive battery of virulence factors, whereas the coagulase-negative MRSH yielded no results during genome analysis. Among the three MRSA, one isolate (MRS 3) carried gene coding for Panton-Valentine Leukocidin toxin (PVL) i.e., lukS-lukF PV locus, while the other two carried only lukF component. Identification of icaADBC operon along with certain other biofilm-associated genes such as clfA, fnbpA, fnbpB, etc. in all three MRSA isolates justified the PIA-dependent biofilm-production. Virulence determinants identified in each MRSA genome are showed in Fig. 3b. The antiSMASH screening revealed the presence of the secondary metabolite aureusimine in three MRSA isolates, while the staphyloferrin A locus was found in all six genomes, including MRSA and MRSH (Table 1). Similarly, staphylobactin was found in all three MRSA isolates, but the sequence similarity was only 87%.

Molecular epidemiology of MRSA and MRSH isolates

Of three MRSA, two isolates (MRS 1 & MRS 4) belonged to the same ST i.e., ST672 with an allelic profile of arcC-4; aroE-3; glpF-1; gmk-1; pta-11; tpi-72; yqiL-11 but, two different spa types such as t13599 (MRS 1; repeat succession: 26-22-17-16-16) and t1309 (MRS 4; repeat succession: 26-22-17-20-17-12-17-17-16-16). Whereas the remaining MRSA belonged to sequence type ST88 (22-1-14-23-12-4-31), and spa type t2526 (7-12-21-17-13-13-13-34-33-13). Similarly, MRS 2 and MRS 6 S. haemolyticus isolates belonged to ST8 with allelic profile of RiboseABC-4; SH1431-2; SH1200-5; arcC-1; cfx-1; hemH-1, leuB-1 while the MRS 5 S. haemolyticus belonged to ST21 (4-5-5-1-1-6-1). Of three MRSA, MRS 1 (ST672-MRSA-t13599) carried type IVd (2B) SCCmec elements whereas, MRS 3 (ST88-MRSA-t2526) and MRS 4 (ST672-MRSA-t1309) carried type IVb (2B) and type V (5C2), respectively. Besides, all three MRSH isolates had the composite type V (5C2 & 5) SCCmec elements. According to agr typing of MRSA isolates, MRS 1 and MRS 4 belonged to agr type I, while MRS 3 to agr type III.

Genetic relatedness among the MRSA strains

Results from the ANI (based on blast) revealed that the three MRSA strains used in this study had the highest level of resemblance to the respective ST672 and ST88 reference groups. The MRS 3 (ST88) strain shared the highest nucleotide identity of 99.88% with the HST-105 strain isolated from the human sample (Supplementary material 3). Similar results were obtained by MRS 1 and MRS 4, which both displayed 99.96% identity with VBV169 (isolated from sepsis) and 99.92% similarity to the reference genome ST672-IVd (isolated from a pus sample), respectively. The circular comparison between the query and reference genomes, accomplished by BRIG analysis supported the ANI findings that the genome of this study demonstrated a high level of similarity with the clinical MRSA strains which were used as the reference genomes (Fig. 4a and b). The gaps in the concentric rings of the BRIG image denote the sequences present in the reference but missing in the query, indicating the draft nature of the genome of this study. Based on the phylogenetic analysis, two MRSA clades namely the ST672 clade and ST88 clade, and a singleton (ST672/t13599) were identified (Fig. 5). The ST88 clade encompassed all the MRSA that belonged to ST88 and the ST672 clade comprised all ST672 MRSA except MRS 1 which existed as a singleton.

Fig. 4 Blast Ring Image Generator (BRIG) analysis of the genomes of this study against the clinical reference genomes: a: BRIG output of ST672 MRSA; b: BRIG output of ST88 MRSA. The gaps (white area) in the concentric ring represent the absence of genes in query sequences which are present in reference genome (draft nature)

Fig. 5 Phylogeny of clinical and non-clinical MRSA strains: Genetic relatedness among the methicillin-resistant Staphylococcus aureus (MRSA) isolates of the present study and selected clinical reference genomes. Label with blue bold characters are the genomes of the present study, isolated from fish samples

Discussions

MRSA is an unpredictable pathogen that undergoes several episodes of genomic rearrangements to improve its adaptability and survival. Owing to the inappropriate use of antibiotics, the prevalence of MRSA in hospitals and healthcare settings is not uncommon. However, special consideration should be given to its occurrence in the fishery environment, which is a non-clinical setting. Evidence from previous studies mounting that, multiple entrances is available for the AMR pathogens to infiltrate into the fishery environment [40]. The rationale behind isolating and characterizing MRSA from fishery environment lies in the potential implications for public health and the understanding of antibiotic resistance in diverse environments. Fishery environments can serve as reservoirs for various bacteria, including MRSA, due to the use of antibiotics in aquaculture practices. Similarly, MRSA is a known human pathogen, and its presence in retail market fishes raises concerns about the potential transmission to humans through direct contact or consumption of contaminated seafood. Understanding the prevalence and characteristics of MRSA in aquaculture can aid in assessing the associated health risks. According to information provided by local vendors and fish merchants, for significant percentage of the Assamese population fish constitutes one of the important food items. It is also true that despite the high cost of fish, the Assamese are very particular about including fish in their quotidian consumption. They consume not only river-caught (indigenous) fishes but, a wide variety of fishes of intra-country imports originating from different marine coastal states, in addition to the farm-raised fishes being cultured in neighboring areas of Assam.

One of the advantages of globalization is that transboundary transportation of men and materials that include fish-based food stuffs wherein the contents sourced from different nations in shortest periods of time [41]. The flip side is facilitation of mobility of AMR containing microbes with same pace are posing serious threat to wellbeing not just animals, plants and humans but the environment too is seeking refuge in approach of “One Health” as ultimate remedy. Out of a total of 193 countries in the world 77% (148) of them share two rivers, 15% (30) three rivers 0.047% (9) through four and 0.067% (13) through five or more countries. Contaminated waters, untreated effluents in the form of rivers transmit number of diseases is serious negative externality the countries must deal with [42]. In the absence of proper containment procedures that are pragmatic in nature the economic loss due to microbial infections from the environment and foods coupled with antimicrobial resistance is enormous [43].

Analogous to the health care settings, imprudent use of antibiotics becomes the leading cause of AMR in the fisheries. Antibiotics when mixed with fish feeds, the indigestible and/or unabsorbed antibiotics can reach the water bodies through faeces and their prolonged persistence can exert a selection pressure of the antibiotics [44]. When pathogens develop resistance, it is much easier to transfer resistance determinants because most of the acquired ARGs in bacteria are carried on mobile genetic elements. When it comes to commercial fish outlets, hygienic practices to be followed by the fish handlers play a crucial part in the spread of AMR. In this study, MRSA and MRSH isolates are identified from local fish markets of Assam, and this is inviting to assume that the fish samples are contaminated by either improper fish handling or water and ice that are used for their preservation. A similar study by Sivaraman and his team reported the occurrence of MRSA in retail market fishes and processed seafood products from Veraval, India [45]. According to their findings, it is crucial to practice impeccable hygiene when handling fish to prevent contamination, which perfectly align with findings of this study that following good fish-handling practices throughout the supply chain is indispensable.

The presence of ARGs in the isolates was consistent with their phenotypic resistance profiles, with the exception that all the isolates were sensitive to vancomycin despite the presence of VanT/VanY genes. Since the percentage identity of VanT/VantY matching regions was lower than usual, this finding was given less significance. Besides, our findings recorded that the expression of efflux pump encoding genes (arlS, norC, norA, etc.) can confer resistance to fluoroquinolones. Aside from the aacA-aphD locus, which confers resistance to aminoglycosides by modifying the antibiotics, kdpD genes found in MRSA genomes also confer resistance through the efflux mechanism. The relation between mobile genetic elements and ARG transfer is well established. In this study also, it has been noted that all six genomes carried at least one MGE. When the insertion sequence (IS) was examined, ISSau5 was the MGE found in MRSA isolates, while ISSha1 and IS256 were in MRSH isolates. Previously, IS256 was identified in nosocomial S. epidermidis isolates and the study specifically discussed the association of IS256 with aminoglycoside resistance and biofilm formation [46]. Similarly, ISSha1 is typically identified in S. haemolyticus. However, Li et al. (2011) observed that the ISSha1 was integrated into J1 (junk region) of type X SCCmec elements of the S. aureus genome, which is speculated to have been transferred from S. haemolyticus, which highlights the importance of insertion sequences in gene transfer and acquisition [47]. In this context, ISs are omnipresent in prokaryotes which take part in genome evolution. Despite being small and genetically compact, ISs form a part of transposon yet, do not encode any functional proteins other than those involved in the gene transference. Notably, studies suggested that several ISs are clustered within the plasmid genomes in a region called ‘islands’ and play a pivotal role in plasmid integration and excision [48].

S. aureus can produce a plethora of virulence factors such as enterotoxins, exfoliative toxins, leukotoxins, hemolysin, etc. However, gene-level expression of these toxins is regulated by an accessory gene regulator (agr) system with the help of a communication molecule namely autoinducing peptides (AIP) [49]. Staphylococcal enterotoxins (SEs) are bifunctional toxins having the role of gastrointestinal toxins and super antigens that are structurally located in two different domains [50]. Among the several classical-SEs and SE-like toxins reported so far, staphylococcal enterotoxin A (SEA) and SEB are the major classical-SEs, and SEG and SEI are the two SE-like SEs identified in the current study. Previous studies have illustrated the SEA as the most common toxin associated with food poisoning whereas the SEG and SEI also play a minor role in foodborne illnesses [51]. Importantly, the strains used in this study were isolated from retail market fishes, and they can produce toxins having a significant role in foodborne illness. It is noteworthy that SEs are significantly resistant to heat (heat stable) and may hold some of their biological functions even after pasteurization, which uses extremely high temperatures (121 °C for 28 min) [52]. In this case, question remains whether the consumption of fishes, though properly cooked, however, is contaminated with enterotoxins will pose health hazard? Accumulating evidence proved that inappropriate refrigeration and inadequate pasteurization are the two major drivers of staphylococcal food poisoning, the second most frequently encountered food-borne illness [53]. Biofilm producing capacity of S. aureus represents yet another virulence property. The agr system governs the transition from planktonic to biofilm lifestyle in the same manner that it regulates toxins gene expression. Even though biofilm is beneficial in dealing with various hostile conditions, there is an interplay between biofilm production and antimicrobial resistance. A study has proved that the penetration of certain antibiotics such as oxacillin, cefotaxime, and vancomycin has been reduced by the S. aureus and S. epidermidis biofilm [54]. This implies that, in addition to the various resistance genes identified, biofilm production by the MRSA isolates of this study may also contribute to reduced susceptibility to conventional antibiotics. Another distinguishing feature of biofilm development is the progression of infection in the host, in which the bacterial cells detach from the biofilm and migrate to uninfected areas of the host to initiate a nascent biofilm formation, resembling the migration of metastatic cancer cells [55]. As a result, the identification of biofilm-producing S. aureus in non-clinical, retail market fish samples call for increased molecular surveillance.

Understanding the molecular epidemiology of MRSA may define the risk elements associated with its infections and assist to design successful therapeutic approaches. Among the various bacterial typing methods, agr typing, spa typing, MLST, and SCCmec typing offer advantages for distinguishing MRSA, with SCCmec typing also applicable to coagulase-negative staphylococci (CoNS). Previously, S. haemolyticus belonging to ST8 and ST21 have been reported from various infections and clinical settings [56, 57]. However, our findings were paramount since the ST8 and ST21 MRSH were identified from a non-clinical setting i.e., commercial fish outlet. The current study is therefore more likely to be the first to report these two MRSH clones from an environment beyond clinical and infection cases. Although only six genomes were examined, our findings indicated that the number of clones was higher, particularly in the case of MRSA where three isolates were distinct from each other. Earlier research identified the ST672 MRSA as an emerging disease clone predominantly found in India [11, 58]. On the contrary, a high prevalence of ST672 MRSA was observed in Kuwait hospitals [59]. In this context, the contribution of international travel to the global spread of MRSA cannot be overstated. A comprehensive review of the globalization of MRSA has documented the occurrence of ST772 MRSA (also known as Bengal Bay clone) which was assumed to be prevalent in Asia, in various countries such as Germany, United Kingdom, and Malaysia through international travel [60]. Similarly, owing to its high prevalence in African countries, ST88 MRSA was previously considered to be established as an ‘African’ community-associated (CA)-MRSA clone [61], but has now been identified in India and China recently [12, 62]. Once introduced to a country, MRSA spread within the community is highly facilitated by various factors majorly direct contact with patients or objects. Apart from this, transference of methicillin resistance from resistant to susceptible staphylococci plays a pivotal role in the local and transboundary transmission of MRSA and it is greatly influenced by the occurrence of SCCmec. MRSA in this study belonged to either type V or type IV, which were previously thought to be CA-MRSA markers, but subsequent studies discovered overlapping of typical characteristics, indicating that such classification of MRSA is not significant. Conversely, our findings of MRSH genomes carrying the composite type V SCCmec elements (5C2 & 5) coincided with a previous finding wherein the ST672 MRSA belonged to the same category [35]. Perhaps, the integration of type V elements to already existing SCCmec in methicillin-susceptible S. aureus (MSSA) could be a possible reason for the presence of the composite elements. The question of how closely genetically related MRSA isolates from non-clinical settings are to those from clinical settings was one of the main goals of creating a phylogenetic tree. To address this, in addition to the three MRSA genomes examined, this study also included 20 reference genomes, including ST88 (n = 15) and ST672 (n = 5) isolated from clinical settings. Our findings demonstrated that all the MRSA clones from this study displayed considerable homology with the reference genomes, regardless of country and source of isolation (Fig. 4). However, MRS 1 was distinct from other clinical ST672 MRSA strains even though it belonged to the same ST672 subgroup. Besides, MRS 3 was closely related to the Lebanon and Denmark MRSA strains with all of them harbouring the pvl gene. Even though only two STs were identified in this study, most of the genomes were genetically diverged based on the spa types, 15 different spa types were identified among 23 genomes (including references).

Conclusions

In summary, isolation and characterization of MRSA from commercial fish outlets is motivated by the need to assess the potential hazards to human health, monitor antibiotic resistance patterns, adopt a One Health perspective, investigate environmental reservoirs, and understand the ecological implications. This research contributes to the broader efforts to mitigate the spread of antibiotic resistance and promote the sustainable and safe practices in aquaculture. While the ST88 and ST672 MRSA strains have been reported previously in clinical settings, their occurrence in non-clinical setting such as retail market fish raises serious concerns. Our description of these two MRSA strains shed light on the genomic portraits of emergence and adaptation in the non-clinical settings. Since the MRSA isolates of this study carried genes (sea/seb) encoding thermo-stable staphylococcal enterotoxins, risk of MRSA as the food-borne pathogens are dangerously high. Besides, the genetic similarity between MRSA from clinical and non-clinical settings were prompting to hypothesize that these two lineages descended from a single ancestor, highlighting the transboundary spread of MRSA. While reporting the occurrence and characteristics of MRSA in commercial fish outlets, the present findings emphasized the urgent need for a large-scale surveillance encompassing a range of settings from humans to animals, food, environment, and other related sectors, etc.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Acknowledgements

Authors acknowledge Dr. Lesly Augustine, Assistant professor, Sacred Heart College, Cochin, India and Dr. Sayuj Koyyappurath, Assistant professor, Department of Biotechnology, Cochin University of Science and Technology, Cochin, India, for their timely support during the genome analysis. Authors thank Director of ICAR-CIFT, Cochin for providing the facilities at MFB division in successful completion of this work.

Author contributions

MH: Conceptualization, data curation, formal analysis, investigation, methodology, software, writing original draft. GKS: Conceptualization, funding acquisition, project administration. MPM: Conceptualization, formal analysis, funding acquisition, project administration, resources, supervision, writing-review and editing.All the authors critically reviewed, modified and approved the final version of the manuscript.

Funding

This work was supported by the Department of Biotechnology (DBT), Government of India, under the project Northeast India One health Study on Transmission Dynamics of Antimicrobial Resistance (NEOSTAR) (BT/IN/Indo-UK/AMR/06/2018–2019).

Data availability

The genome sequences of the isolates used in this study are available at SRA-NCBI under the BioProject PRJNA932747 (https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA932747).

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Freitas JKGR de Assis CF de Oliveira TRM Maia CM de Sousa M de Medeiros BJ Prevalence of staphylococcal toxin in food contaminated by Staphylococcus spp.: protocol for a systematic review with meta-analysis PLoS ONE 2023 18 e0282111 10.1371/journal.pone.0282111 36809532
Freitas JKGR, de Assis CF, de Oliveira TRM, Maia CM, de Sousa M, de Medeiros BJ, et al. Prevalence of staphylococcal toxin in food contaminated by Staphylococcus spp.: protocol for a systematic review with meta-analysis. PLoS ONE. 2023;18:e0282111.36809532 10.1371/journal.pone.0282111
2. Havelaar AH Kirk MD Torgerson PR Gibb HJ Hald T Lake RJ World Health Organization Global Estimates and Regional comparisons of the Burden of Foodborne Disease in 2010 PLOS Med 2015 12 e1001923 10.1371/journal.pmed.1001923 26633896
Havelaar AH, Kirk MD, Torgerson PR, Gibb HJ, Hald T, Lake RJ, et al. World Health Organization Global Estimates and Regional comparisons of the Burden of Foodborne Disease in 2010. PLOS Med. 2015;12:e1001923.26633896 10.1371/journal.pmed.1001923
3. Doyle ME Hartmann FA Lee Wong AC Methicillin-resistant staphylococci: implications for our food supply? Anim Heal Res Rev 2012 13 157 80 10.1017/S1466252312000187
Doyle ME, Hartmann FA, Lee Wong AC. Methicillin-resistant staphylococci: implications for our food supply? Anim Heal Res Rev. 2012;13:157–80.10.1017/S1466252312000187
4. Nema V Agrawal R Kamboj DV Goel AK Singh L Isolation and characterization of heat resistant enterotoxigenic Staphylococcus aureus from a food poisoning outbreak in Indian subcontinent Int J Food Microbiol 2007 117 29 35 10.1016/j.ijfoodmicro.2007.01.015 17477998
Nema V, Agrawal R, Kamboj DV, Goel AK, Singh L. Isolation and characterization of heat resistant enterotoxigenic Staphylococcus aureus from a food poisoning outbreak in Indian subcontinent. Int J Food Microbiol. 2007;117:29–35.17477998 10.1016/j.ijfoodmicro.2007.01.015
5. Holden MTG Feil EJ Lindsay JA Peacock SJ Day NPJ Enright MC Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance Proc Natl Acad Sci 2004 101 9786 91 10.1073/pnas.0402521101 15213324
Holden MTG, Feil EJ, Lindsay JA, Peacock SJ, Day NPJ, Enright MC, et al. Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance. Proc Natl Acad Sci. 2004;101:9786–91.15213324 10.1073/pnas.0402521101
6. Hsieh RC Liu R Burgin DJ Otto M Understanding mechanisms of virulence in MRSA: implications for antivirulence treatment strategies Expert Rev Anti-infective Therapy 2023 21 911 28 10.1080/14787210.2023.2242585 37501364
Hsieh RC, Liu R, Burgin DJ, Otto M. Understanding mechanisms of virulence in MRSA: implications for antivirulence treatment strategies. Expert Rev Anti-infective Therapy. 2023;21:911–28.37501364 10.1080/14787210.2023.2242585
7. PubMLST-Public databases. for molecular typing and microbial genome diversity. https://pubmlst.org/organisms/staphylococcus-aureus
8. Turner NA Sharma-Kuinkel BK Maskarinec SA Eichenberger EM Shah PP Carugati M Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research Nat Rev Microbiol 2019 17 203 18 10.1038/s41579-018-0147-4 30737488
Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, et al. Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research. Nat Rev Microbiol. 2019;17:203–18.30737488 10.1038/s41579-018-0147-4
9. Rajan V Schoenfelder SMK Ziebuhr W Gopal S Genotyping of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) in a tertiary care centre in Mysore, South India: ST2371-SCCmec IV emerges as the major clone Infect Genet Evol 2015 34 230 5 10.1016/j.meegid.2015.05.032 26044198
Rajan V, Schoenfelder SMK, Ziebuhr W, Gopal S. Genotyping of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) in a tertiary care centre in Mysore, South India: ST2371-SCCmec IV emerges as the major clone. Infect Genet Evol. 2015;34:230–5.26044198 10.1016/j.meegid.2015.05.032
10. Steinig EJ, Duchene S, Robinson DA, Monecke S, Yokoyama M, Laabei M et al. Evolution and global transmission of a Multidrug-Resistant, Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from the Indian subcontinent. MBio. 2019;10.
11. Khedkar S Prabhakara S Loganathan RM Gowda SC Arakere M Draft genome sequence of Staphylococcus aureus ST672, an emerging disease clone from India J Bacteriol 2012 194 6946 7 10.1128/JB.01868-12 23209210
Khedkar S, Prabhakara S, Loganathan RM, Gowda SC, Arakere M. Draft genome sequence of Staphylococcus aureus ST672, an emerging disease clone from India. J Bacteriol. 2012;194:6946–7.23209210 10.1128/JB.01868-12
12. Sivaraman GK Muneeb KH Sudha S Shome B Cole J Holmes M Prevalence of virulent and biofilm forming ST88-IV-t2526 methicillin-resistant Staphylococcus aureus clones circulating in local retail fish markets in Assam, India Food Control 2021 127 108098 10.1016/j.foodcont.2021.108098
Sivaraman GK, Muneeb KH, Sudha S, Shome B, Cole J, Holmes M. Prevalence of virulent and biofilm forming ST88-IV-t2526 methicillin-resistant Staphylococcus aureus clones circulating in local retail fish markets in Assam, India. Food Control. 2021;127:108098.10.1016/j.foodcont.2021.108098
13. Murugadas V, Joseph TC, Reshmi K, Lalitha KV. Prevalence of methicillin resistant Staphylococcus aureus in selected seafood markets and aquaculture farms in Kerala, south-west coast of India. Indian J Fish. 2016;63.
14. CLSI Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; CLSI document M100 2020 30 Wayne, PA CLSI
CLSI. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; CLSI document M100. 30th ed. Wayne, PA: CLSI; 2020.
15. Hong JS Kim D Kang DY Park BY Yang S Yoon E-J Evaluation of the BD Phoenix M50 Automated Microbiology System for Antimicrobial susceptibility testing with clinical isolates in Korea Microb Drug Resist 2019 25 1142 8 10.1089/mdr.2018.0370 31161952
Hong JS, Kim D, Kang DY, Park BY, Yang S, Yoon E-J, et al. Evaluation of the BD Phoenix M50 Automated Microbiology System for Antimicrobial susceptibility testing with clinical isolates in Korea. Microb Drug Resist. 2019;25:1142–8.31161952 10.1089/mdr.2018.0370
16. Krumperman PH Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods Appl Environ Microbiol 1983 46 165 70 10.1128/aem.46.1.165-170.1983 6351743
Krumperman PH. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl Environ Microbiol. 1983;46:165–70.6351743 10.1128/aem.46.1.165-170.1983
17. Shome BR, Das Mitra S, Bhuvana M, Krithiga N, Velu D, Shome R Multiplex PCR assay for species identification of bovine mastitis pathogens. J Appl Microbiol., Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J Comput Biol. 2012;19:455–77.
18. Bankevich A Nurk S Antipov D Gurevich AA Dvorkin M Kulikov AS SPAdes: a New Genome Assembly Algorithm and its applications to single-cell sequencing J Comput Biol 2012 19 455 77 10.1089/cmb.2012.0021 22506599
Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a New Genome Assembly Algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.22506599 10.1089/cmb.2012.0021
19. Brettin T Davis JJ Disz T Edwards RA Gerdes S Olsen GJ RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes Sci Rep 2015 5 8365 10.1038/srep08365 25666585
Brettin T, Davis JJ, Disz T, Edwards RA, Gerdes S, Olsen GJ, et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci Rep. 2015;5:8365.25666585 10.1038/srep08365
20. Gurevich A Saveliev V Vyahhi N Tesler G QUAST: quality assessment tool for genome assemblies Bioinformatics 2013 29 1072 5 10.1093/bioinformatics/btt086 23422339
Gurevich A, Saveliev V, Vyahhi N, Tesler G. QUAST: quality assessment tool for genome assemblies. Bioinformatics. 2013;29:1072–5.23422339 10.1093/bioinformatics/btt086
21. Bortolaia V Kaas RS Ruppe E Roberts MC Schwarz S Cattoir V ResFinder 4.0 for predictions of phenotypes from genotypes J Antimicrob Chemother 2020 75 3491 500 10.1093/jac/dkaa345 32780112
Bortolaia V, Kaas RS, Ruppe E, Roberts MC, Schwarz S, Cattoir V, et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J Antimicrob Chemother. 2020;75:3491–500.32780112 10.1093/jac/dkaa345
22. Alcock BP Huynh W Chalil R Smith KW Raphenya AR Wlodarski MA CARD 2023: expanded curation, support for machine learning, and resistome prediction at the Comprehensive Antibiotic Resistance Database Nucleic Acids Res 2023 51 D690 9 10.1093/nar/gkac920 36263822
Alcock BP, Huynh W, Chalil R, Smith KW, Raphenya AR, Wlodarski MA, et al. CARD 2023: expanded curation, support for machine learning, and resistome prediction at the Comprehensive Antibiotic Resistance Database. Nucleic Acids Res. 2023;51:D690–9.36263822 10.1093/nar/gkac920
23. Chen L Yang J Yu J Yao Z Sun L Shen YJQ VFDB: a reference database for bacterial virulence factors Nucleic Acids Res 2004 33 325 8 10.1093/nar/gki008
Chen L, Yang J, Yu J, Yao Z, Sun L, Shen YJQ. VFDB: a reference database for bacterial virulence factors. Nucleic Acids Res. 2004;33:325–8. Database issue:D.10.1093/nar/gki008
24. Malberg Tetzschner AM, Johnson JR, Johnston BD, Lund O, Scheutz F. In Silico Genotyping of Escherichia coli isolates for Extraintestinal virulence genes by Use of whole-genome sequencing data. J Clin Microbiol. 2020;58.
25. Carattoli A Zankari E García-Fernández A Voldby Larsen M Lund O Villa L In Silico Detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing Antimicrob Agents Chemother 2014 58 3895 903 10.1128/AAC.02412-14 24777092
Carattoli A, Zankari E, García-Fernández A, Voldby Larsen M, Lund O, Villa L, et al. In Silico Detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob Agents Chemother. 2014;58:3895–903.24777092 10.1128/AAC.02412-14
26. Johansson MHK Bortolaia V Tansirichaiya S Aarestrup FM Roberts AP Petersen TN Detection of mobile genetic elements associated with antibiotic resistance in Salmonella enterica using a newly developed web tool: MobileElementFinder J Antimicrob Chemother 2021 76 101 9 10.1093/jac/dkaa390 33009809
Johansson MHK, Bortolaia V, Tansirichaiya S, Aarestrup FM, Roberts AP, Petersen TN. Detection of mobile genetic elements associated with antibiotic resistance in Salmonella enterica using a newly developed web tool: MobileElementFinder. J Antimicrob Chemother. 2021;76:101–9.33009809 10.1093/jac/dkaa390
27. Blin K Shaw S Augustijn HE Reitz ZL Biermann F Alanjary M antiSMASH 7.0: new and improved predictions for detection, regulation, chemical structures and visualisation Nucleic Acids Res 2023 51 W46 50 10.1093/nar/gkad344 37140036
Blin K, Shaw S, Augustijn HE, Reitz ZL, Biermann F, Alanjary M, et al. antiSMASH 7.0: new and improved predictions for detection, regulation, chemical structures and visualisation. Nucleic Acids Res. 2023;51:W46–50.37140036 10.1093/nar/gkad344
28. IWG-SCC Classification of Staphylococcal Cassette chromosome mec (SCC mec): guidelines for reporting novel SCC mec elements Antimicrob Agents Chemother 2009 53 4961 7 10.1128/AAC.00579-09 19721075
IWG-SCC. Classification of Staphylococcal Cassette chromosome mec (SCC mec): guidelines for reporting novel SCC mec elements. Antimicrob Agents Chemother. 2009;53:4961–7.19721075 10.1128/AAC.00579-09
29. Bartels MD Petersen A Worning P Nielsen JB Larner-Svensson H Johansen HK Comparing whole-genome sequencing with Sanger sequencing for spa typing of Methicillin-Resistant Staphylococcus aureus J Clin Microbiol 2014 52 4305 8 10.1128/JCM.01979-14 25297335
Bartels MD, Petersen A, Worning P, Nielsen JB, Larner-Svensson H, Johansen HK, et al. Comparing whole-genome sequencing with Sanger sequencing for spa typing of Methicillin-Resistant Staphylococcus aureus. J Clin Microbiol. 2014;52:4305–8.25297335 10.1128/JCM.01979-14
30. Centre for Genomic Epidemiology-MLST 2.0. https://cge.food.dtu.dk/services/MLST/
31. Gilot P Lina G Cochard T Poutrel B Analysis of the genetic variability of genes encoding the RNA III-Activating components agr and TRAP in a Population of Staphylococcus aureus strains isolated from cows with Mastitis J Clin Microbiol 2002 40 4060 7 10.1128/JCM.40.11.4060-4067.2002 12409375
Gilot P, Lina G, Cochard T, Poutrel B. Analysis of the genetic variability of genes encoding the RNA III-Activating components agr and TRAP in a Population of Staphylococcus aureus strains isolated from cows with Mastitis. J Clin Microbiol. 2002;40:4060–7.12409375 10.1128/JCM.40.11.4060-4067.2002
32. Bikandi J Millán RS Rementeria A Garaizar J In silico analysis of complete bacterial genomes: PCR, AFLP–PCR and endonuclease restriction Bioinformatics 2004 20 798 9 10.1093/bioinformatics/btg491 14752001
Bikandi J, Millán RS, Rementeria A, Garaizar J. In silico analysis of complete bacterial genomes: PCR, AFLP–PCR and endonuclease restriction. Bioinformatics. 2004;20:798–9.14752001 10.1093/bioinformatics/btg491
33. John J Narendrakumar L Thomas S Nelson-Sathi S Hybrid genome assembly and annotation of multidrug-resistant Staphylococcus aureus genotype ST672-SCCmec type IVd (2B) J Glob Antimicrob Resist 2023 32 74 7 10.1016/j.jgar.2022.12.011 36708767
John J, Narendrakumar L, Thomas S, Nelson-Sathi S. Hybrid genome assembly and annotation of multidrug-resistant Staphylococcus aureus genotype ST672-SCCmec type IVd (2B). J Glob Antimicrob Resist. 2023;32:74–7.36708767 10.1016/j.jgar.2022.12.011
34. Velusamy N, Prakash L, Sivakumar N, Antony A, Prajna L, Mohankumar V et al. Draft genome sequences of Staphylococcus aureus AMRF1 (ST22) and AMRF2 (ST672), ocular methicillin-resistant isolates. Genome Announc. 2014;2.
35. Balakuntla J Prabhakara S Arakere G Novel rearrangements in the Staphylococcal Cassette chromosome mec type V elements of Indian ST772 and ST672 Methicillin Resistant Staphylococcus aureus strains PLoS ONE 2014 9 e94293 10.1371/journal.pone.0094293 24722327
Balakuntla J, Prabhakara S, Arakere G. Novel rearrangements in the Staphylococcal Cassette chromosome mec type V elements of Indian ST772 and ST672 Methicillin Resistant Staphylococcus aureus strains. PLoS ONE. 2014;9:e94293.24722327 10.1371/journal.pone.0094293
36. Yamuna DB Francis YI Priya Doss G Balaji V Molecular characterization of Panton-Valentine leukocidin (PVL) toxin–encoding phages from South India New Microbes New Infect 2017 20 34 8 10.1016/j.nmni.2017.08.005 29158906
Yamuna DB, Francis YI, Priya Doss G, Balaji V. Molecular characterization of Panton-Valentine leukocidin (PVL) toxin–encoding phages from South India. New Microbes New Infect. 2017;20:34–8.29158906 10.1016/j.nmni.2017.08.005
37. Meier-Kolthoff JP Göker M TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy Nat Commun 2019 10 2182 10.1038/s41467-019-10210-3 31097708
Meier-Kolthoff JP, Göker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat Commun. 2019;10:2182.31097708 10.1038/s41467-019-10210-3
38. Letunic I Bork P Interactive tree of life (iTOL) v5: an online tool for phylogenetic tree display and annotation Nucleic Acids Res 2021 49 W293 6 10.1093/nar/gkab301 33885785
Letunic I, Bork P. Interactive tree of life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021;49:W293–6.33885785 10.1093/nar/gkab301
39. Richter M Rosselló-Móra R Oliver Glöckner F Peplies J JSpeciesWS: a web server for prokaryotic species circumscription based on pairwise genome comparison Bioinformatics 2016 32 929 31 10.1093/bioinformatics/btv681 26576653
Richter M, Rosselló-Móra R, Oliver Glöckner F, Peplies J. JSpeciesWS: a web server for prokaryotic species circumscription based on pairwise genome comparison. Bioinformatics. 2016;32:929–31.26576653 10.1093/bioinformatics/btv681
40. Watts J Schreier H Lanska L Hale M The Rising Tide of Antimicrobial Resistance in Aquaculture: sources, sinks and solutions Mar Drugs 2017 15 158 10.3390/md15060158 28587172
Watts J, Schreier H, Lanska L, Hale M. The Rising Tide of Antimicrobial Resistance in Aquaculture: sources, sinks and solutions. Mar Drugs. 2017;15:158.28587172 10.3390/md15060158
41. Vaiyapuri M Joseph TC Rao BM Lalitha KV Prasad MM Methicillin-Resistant Staphylococcus aureus in Seafood: Prevalence, Laboratory Detection, Clonal Nature, and control in Seafood Chain J Food Sci 2019 84 3341 51 10.1111/1750-3841.14915 31769517
Vaiyapuri M, Joseph TC, Rao BM, Lalitha KV, Prasad MM. Methicillin-Resistant Staphylococcus aureus in Seafood: Prevalence, Laboratory Detection, Clonal Nature, and control in Seafood Chain. J Food Sci. 2019;84:3341–51.31769517 10.1111/1750-3841.14915
42. Hayward C Brown MH Whiley H Hospital water as the source of healthcare-associated infection and antimicrobial-resistant organisms Curr Opin Infect Dis 2022 35 339 45 10.1097/QCO.0000000000000842 35849524
Hayward C, Brown MH, Whiley H. Hospital water as the source of healthcare-associated infection and antimicrobial-resistant organisms. Curr Opin Infect Dis. 2022;35:339–45.35849524 10.1097/QCO.0000000000000842
43. Nadella RK Ezhil Nilavan S Mothadaka MP Economic impact of Antimicrobial Resistance and projected future trends Handbook on Antimicrobial Resistance 2023 Singapore Springer Nature Singapore 1 16
Nadella RK, Ezhil Nilavan S, Mothadaka MP. Economic impact of Antimicrobial Resistance and projected future trends. Handbook on Antimicrobial Resistance. Singapore: Springer Nature Singapore; 2023. pp. 1–16.
44. Cabello FC Godfrey HP Tomova A Ivanova L Dölz H Millanao A Antimicrobial use in aquaculture re-examined: its relevance to antimicrobial resistance and to animal and human health Environ Microbiol 2013 15 1917 42 10.1111/1462-2920.12134 23711078
Cabello FC, Godfrey HP, Tomova A, Ivanova L, Dölz H, Millanao A, et al. Antimicrobial use in aquaculture re-examined: its relevance to antimicrobial resistance and to animal and human health. Environ Microbiol. 2013;15:1917–42.23711078 10.1111/1462-2920.12134
45. Sivaraman GK Gupta SS Visnuvinayagam S Muthulakshmi T Elangovan R Perumal V Prevalence of S. Aureus and/or MRSA from seafood products from Indian seafood products BMC Microbiol 2022 22 233 10.1186/s12866-022-02640-9 36183083
Sivaraman GK, Gupta SS, Visnuvinayagam S, Muthulakshmi T, Elangovan R, Perumal V, et al. Prevalence of S. Aureus and/or MRSA from seafood products from Indian seafood products. BMC Microbiol. 2022;22:233.36183083 10.1186/s12866-022-02640-9
46. Kozitskaya S Cho S-H Dietrich K Marre R Naber K Ziebuhr W The bacterial insertion sequence element IS 256 occurs preferentially in Nosocomial Staphylococcus epidermidis isolates: Association with Biofilm formation and resistance to Aminoglycosides Infect Immun 2004 72 1210 5 10.1128/IAI.72.2.1210-1215.2004 14742578
Kozitskaya S, Cho S-H, Dietrich K, Marre R, Naber K, Ziebuhr W. The bacterial insertion sequence element IS 256 occurs preferentially in Nosocomial Staphylococcus epidermidis isolates: Association with Biofilm formation and resistance to Aminoglycosides. Infect Immun. 2004;72:1210–5.14742578 10.1128/IAI.72.2.1210-1215.2004
47. Li S Skov RL Han X Larsen AR Larsen J Sørum M Novel types of Staphylococcal Cassette chromosome mec elements identified in Clonal Complex 398 Methicillin-resistant Staphylococcus aureus strains Antimicrob Agents Chemother 2011 55 3046 50 10.1128/AAC.01475-10 21422209
Li S, Skov RL, Han X, Larsen AR, Larsen J, Sørum M, et al. Novel types of Staphylococcal Cassette chromosome mec elements identified in Clonal Complex 398 Methicillin-resistant Staphylococcus aureus strains. Antimicrob Agents Chemother. 2011;55:3046–50.21422209 10.1128/AAC.01475-10
48. Bukhari AI, Shapiro JA. DNA insertion elements, plasmids, and episomes. DNA insertions meeting. Cold Spring Harb Lab; 1976.
49. Boles BR, Horswill AR. Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog. 2008;4.
50. Ortega E Abriouel H Lucas R Gálvez A Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to Antibiotic Resistance Toxins (Basel) 2010 2 2117 31 10.3390/toxins2082117 22069676
Ortega E, Abriouel H, Lucas R, Gálvez A. Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to Antibiotic Resistance. Toxins (Basel). 2010;2:2117–31.22069676 10.3390/toxins2082117
51. Chen T-R Chiou C-S Tsen H-Y Use of novel PCR primers specific to the genes of staphylococcal enterotoxin G, H, I for the survey of Staphylococcus aureus strains isolated from food-poisoning cases and food samples in Taiwan Int J Food Microbiol 2004 92 189 97 10.1016/j.ijfoodmicro.2003.10.002 15109796
Chen T-R, Chiou C-S, Tsen H-Y. Use of novel PCR primers specific to the genes of staphylococcal enterotoxin G, H, I for the survey of Staphylococcus aureus strains isolated from food-poisoning cases and food samples in Taiwan. Int J Food Microbiol. 2004;92:189–97.15109796 10.1016/j.ijfoodmicro.2003.10.002
52. Rall VLM Vieira FP Rall R Vieitis RL Fernandes A Candeias JMG PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk Vet Microbiol 2008 132 408 13 10.1016/j.vetmic.2008.05.011 18572331
Rall VLM, Vieira FP, Rall R, Vieitis RL, Fernandes A, Candeias JMG, et al. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk. Vet Microbiol. 2008;132:408–13.18572331 10.1016/j.vetmic.2008.05.011
53. Scherrer D Corti S Muehlherr J Zweifel C Stephan R Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep Vet Microbiol 2004 101 101 7 10.1016/j.vetmic.2004.03.016 15172692
Scherrer D, Corti S, Muehlherr J, Zweifel C, Stephan R. Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep. Vet Microbiol. 2004;101:101–7.15172692 10.1016/j.vetmic.2004.03.016
54. Singh R Ray P Das A Sharma M Penetration of antibiotics through Staphylococcus aureus and Staphylococcus epidermidis biofilms J Antimicrob Chemother 2010 65 1955 8 10.1093/jac/dkq257 20615927
Singh R, Ray P, Das A, Sharma M. Penetration of antibiotics through Staphylococcus aureus and Staphylococcus epidermidis biofilms. J Antimicrob Chemother. 2010;65:1955–8.20615927 10.1093/jac/dkq257
55. Archer NK Mazaitis MJ Costerton JW Leid JG Powers ME Shirtliff ME Staphylococcus aureus biofilms Virulence 2011 2 445 59 10.4161/viru.2.5.17724 21921685
Archer NK, Mazaitis MJ, Costerton JW, Leid JG, Powers ME, Shirtliff ME. Staphylococcus aureus biofilms. Virulence. 2011;2:445–59.21921685 10.4161/viru.2.5.17724
56. Bouchami O de Lencastre H Miragaia M Impact of insertion sequences and recombination on the Population structure of Staphylococcus haemolyticus PLoS ONE 2016 11 e0156653 10.1371/journal.pone.0156653 27249649
Bouchami O, de Lencastre H, Miragaia M. Impact of insertion sequences and recombination on the Population structure of Staphylococcus haemolyticus. PLoS ONE. 2016;11:e0156653.27249649 10.1371/journal.pone.0156653
57. Panda S Jena S Sharma S Dhawan B Nath G Singh DV Identification of Novel sequence types among Staphylococcus haemolyticus isolated from Variety of infections in India PLoS ONE 2016 11 e0166193 10.1371/journal.pone.0166193 27824930
Panda S, Jena S, Sharma S, Dhawan B, Nath G, Singh DV. Identification of Novel sequence types among Staphylococcus haemolyticus isolated from Variety of infections in India. PLoS ONE. 2016;11:e0166193.27824930 10.1371/journal.pone.0166193
58. Shambat S Nadig S Prabhakara S Bes M Etienne J Arakere G Clonal complexes and virulence factors of Staphylococcus aureus from several cities in India BMC Microbiol 2012 12 64 10.1186/1471-2180-12-64 22548694
Shambat S, Nadig S, Prabhakara S, Bes M, Etienne J, Arakere G. Clonal complexes and virulence factors of Staphylococcus aureus from several cities in India. BMC Microbiol. 2012;12:64.22548694 10.1186/1471-2180-12-64
59. Sarkhoo E, Udo EE, Boswihi SS, Monecke S, Mueller E, Ehricht R. The dissemination and molecular characterization of Clonal Complex 361 (CC361) methicillin-resistant Staphylococcus aureus (MRSA) in Kuwait hospitals. Front Microbiol. 2021;12.
60. Zhou YP Wilder-Smith A Hsu L The role of International Travel in the spread of Methicillin‐Resistant Staphylococcus aureus J Travel Med 2014 21 272 81 10.1111/jtm.12133 24894491
Zhou YP, Wilder-Smith A, Hsu L. The role of International Travel in the spread of Methicillin‐Resistant Staphylococcus aureus. J Travel Med. 2014;21:272–81.24894491 10.1111/jtm.12133
61. Kpeli G Buultjens AH Giulieri S Owusu-Mireku E Aboagye SY Baines SL Genomic analysis of ST88 community-acquired methicillin resistant Staphylococcus aureus in Ghana PeerJ 2017 5 e3047 10.7717/peerj.3047 28265515
Kpeli G, Buultjens AH, Giulieri S, Owusu-Mireku E, Aboagye SY, Baines SL, et al. Genomic analysis of ST88 community-acquired methicillin resistant Staphylococcus aureus in Ghana. PeerJ. 2017;5:e3047.28265515 10.7717/peerj.3047
62. Wang W, Li H, Li M, Dong Y, Bai Y, Li F et al. Molecular evolution and genomic insights into community-acquired methicillin-resistant Staphylococcus aureus sequence type 88. Microbiol Spectr. 2022;10.
