
==== Front
BMC Genomics
BMC Genomics
BMC Genomics
1471-2164
BioMed Central London

39251938
10757
10.1186/s12864-024-10757-6
Research
Genome-wide identification, characterization, and expression analysis of the transient receptor potential gene family in mandarin fish Siniperca chuatsi
Li Chuanrui
Qin Xiaowei
Liang Mincong
Luo Zhiyong
Zhan Zhipeng
Weng Shaoping
http://orcid.org/0000-0003-3223-6176
Guo Changjun gchangj@mail.sysu.edu.cn

He Jianguo
grid.12981.33 0000 0001 2360 039X School of Marine Sciences, State Key Laboratory for Biocontrol / Southern Marine Science and Engineering Guangdong Laboratory (Zhuhai), Guangdong Province Key Laboratory of Aquatic Economic Animals & Guangdong Provincial Observation and Research Station for Marine Ranching of the Lingdingyang Bay, Sun Yat-sen University, 135 Xingang Road West, Guangzhou, 510275 PR China
9 9 2024
9 9 2024
2024
25 84825 7 2024
2 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Temperature is a crucial environmental determinant for the vitality and development of teleost fish, yet the underlying mechanisms by which they sense temperature fluctuations remain largely unexplored. Transient receptor potential (TRP) proteins, renowned for their involvement in temperature sensing, have not been characterized in teleost fish, especially regarding their temperature-sensing capabilities.

Results

In this study, a genome-wide analysis was conducted, identifying a total of 28 TRP genes in the mandarin fish Siniperca chuatsi. These genes were categorized into the families of TRPA, TRPC, TRPP, TRPM, TRPML, and TRPV. Despite notable variations in conserved motifs across different subfamilies, TRP family members shared common structural features, including ankyrin repeats and the TRP domain. Tissue expression analysis showed that each of these TRP genes exhibited a unique expression pattern. Furthermore, examination of the tissue expression patterns of ten selected TRP genes following exposure to both high and low temperature stress indicated the expression of TRP genes were responsive to temperatures changes. Moreover, the expression profiles of TRP genes in response to mandarin fish virus infections showed significant upregulation for most genes after Siniperca chuatsi rhabdovirus, mandarin fish iridovirus and infectious spleen and kidney necrosis virus infection.

Conclusions

This study characterized the TRP family genes in mandarin fish genome-wide, and explored their expression patterns in response to temperature stress and virus infections. Our work will enhance the overall understanding of fish TRP channels and their possible functions.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12864-024-10757-6.

Keywords

Transient receptor potential protein
Siniperca chuatsi
Gene family
Temperature
http://dx.doi.org/10.13039/501100012166 National Key Research and Development Program of China 2022YFE0203900 http://dx.doi.org/10.13039/501100010203 Agriculture Research System of China CARS-46 Guangdong Key Research and Development Program2022B1111030001 Guangdong Province Basic and Applied Basic Research Fund Project2023A1515110395 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Temperature is a crucial environmental variable that profoundly shapes the physiological characteristics of both aquatic and terrestrial animals [1]. As poikilotherms, teleost fish heavily depend on ambient water temperature for their developmental processes, respiratory metabolism, and immune function [2, 3]. In the current era of global warming and increasingly frequent climate extremes, teleost fish are consistently subjected to temperature fluctuations during their breeding and cultivation cycles. Gaining insights into the mechanisms underlying how fish sense and respond to temperature variations could provide invaluable theoretical guidance for the scientific management of aquaculture. However, these mechanisms remain largely unexplored.

Transient receptor potential (TRP) proteins are identified as important temperature sensors in mammals and insects [4]. These proteins share a distinctive architectural blueprint, consisting of six transmembrane helical segments and diverse intracellular amino and carboxy terminal cytosolic domains. Central to their functionality, the pore region located between TM5 and TM6 grants most TRP proteins their non-selective cation properties and high Ca2+ permeability [5]. There are nine TRP subfamilies in animals. namely TRPA, TRPC, TRPN, TRPM, TRPS, TRPV, TRPVL, TRPP, and TRPML, among which six are found in mammals. TRP subfamilies in mammals can be broadly categorized into two major groups. Group 1 includes TRPA, TRPC, TRPM and TRPV subfamilies, while Group 2 comprises TRPP and TRPML subfamilies [5]. Among them, the TRPA, TRPV and TRPC subfamilies are characterized by their varying numbers of ankyrin repeats at the amino terminus, which are instrumental in ligand and protein interactions [6]. TRPC and TRPM proteins harbor a WKxxR motif, commonly referred to as the TRP domain or TRP box, in their carboxy terminals of the TM domain, which is instrumental for protein activation [7]. Moreover, other structural domains, including the coiled-coil domain, nudix hydrolase domain, and EF hand, also contribute significantly to modulating the function of TRP proteins [8]. The types of structural domains vary among different TRP proteins, reflecting their unique physiological roles and responses to environmental stress.

Mandarin fish, Siniperca chuatsi, is a highly commercially valuable teleost species that has undergone extensive artificial propagation and cultivation. Previous researches have indicated that numerous environmental factors, such as temperature, dissolved oxygen, and salinity, can influence the metabolism and immune response of mandarin fish [9–12]. Recently, the mandarin fish aquaculture industry has incurred significant losses due to viral diseases, notably infectious spleen and kidney necrosis virus (ISKNV), mandarin fish iridovirus (MRV), and Siniperca chuatsi rhabdovirus (SCRV), under high-density farming practices coupled with intense fluctuations in environmental temperature [13]. In this context, the identification of the TRP proteins and their roles in mandarin fish holds significant importance for enhancing aquaculture health, as well as for viral disease prevention and control.

In the present study, the identification, characterization, and expression of TRP family members in mandarin fish genome-wide were investigated, with the aim of understanding the roles of TRP protein families in teleost fish.

Materials and methods

Animals, cells and viruses

Mandarin fish (S. chuatsi) of approximately 50 ± 5 g were sourced from a farm in Foshan, Guangdong province, China. Prior to their use in the study, they were acclimatized for a two-week period at a temperature of 27 °C, as previously described [14]. Following this, six fish per group were randomly selected for pathogen detection, while five fish per group were selected for tissue expression analysis. Prior to handling, the fish were sedated using a solution of MS-222 (Sigma-Aldrich, USA) at a concentration of 40 to 50 mg/L in water. Mandarin fish fry (MFF-1) cells were cultured in Dulbecco’s Modified Eagle’s Medium (Gibco, USA), supplemented with 10% fetal bovine serum (HyClone, USA), and incubated at 27 °C in a humidified incubator with a 5% CO2 atmosphere [15]. ISKNV strain NH-2005 (GenBank: OP896201.1), MRV strain NH-1609 (GenBank: MG941005.3), and SCRV strain NH-2103 (GenBank: PQ066876.1) were separated and stored in our laboratory [16]. For virus infection, cells were infected with the respective viruses at a MOI of 1. After 4 h of adsorption, the inoculum was removed, and the cells were washed twice with PBS. Fresh Dulbecco’s Modified Eagle’s Medium (10% fetal bovine serum) was then added. All the cells were harvested at different time points post infection for total RNA extraction [17] .

Gene identification and phylogenetic tree construction

To identify all TRP genes in mandarin fish, the genome and transcriptome database (GenBank: GCA_020085105.1, RefSeq: GCF_020085105.1) were utilized. The hidden Markov model profile of TRPs ( Pfam: PF00917, PF02176) was downloaded from the Pfam database (http://pfam.xfam.org/) and used to search for TRP genes in the mandarin fish genome database. To construct the phylogenetic tree, TRP sequences were retrieved from human (Homo sapiens), mouse (Mus musculus), medaka (Oryzias latipes), fugu (Takifugu rubripes), spotted gar (Lepisosteus oculatus) and stickleback (Gasterosteus aculeatus) from the NCBI (https://www.ncbi.nlm.nih.gov/) and Ensemble (http://www.ensembl.org) as query sequences (accession numbers of NCBI Reference Sequence or GenBank listed in Supplementary Material 1). Subsequently, TBLASTN was performed to the transcriptome database of S. chuatsi with an e-value of e− 10 to collect target genes (accession numbers of NCBI Reference Sequence listed in Supplementary Material 2). Phylogenetic trees were constructed via the Molecular Evolutionary Genetics Analysis (MEGA) v10.0 software, utilizing 1000 bootstrap replicates, as previously described [18].

Gene characteristics, structure and conserved motif analyses

Physical parameters of putative proteins, including the lengths of amino acid sequences, mRNA sequences and molecular weights, were calculated using the ExPASy tool (http://www.expasy.org). To gain insights into the characteristics of TRP sequences in the S. chuatsi genome, a multiple sequence alignment of 28 TRP proteins was performed using Jalview software v2.10.5, followed by realignment with ClustalW2 v2.1 [19]. The exon-intron structures were visualized using the gene structure display server program (https://gsds.gao-lab.org/) by aligning of the CDSs of individual TRPs. The conserved motif domains within the S. chuatsi TRP proteins were identified by utilizing the MEME suite tool (https://meme.nbcr.net/). lastly, TBtools was employed to visualize patterns of gene structure, protein domain, and conserved motifs [20].

Chromosomal localization of TRP genes

The chromosome locations of 28 TRP genes from the S. chuatsi transcriptome were derived. By aligning TRPs paralogs using the BLAST program, duplicate gene pairs were identified. Using the MCScanX toolkit [21], gene duplications and collinearity relationships among the TRP genes were investigated. Hypothetical gene duplication events were postulated when both the coverage and similarity of the aligned genes exceeded the 75% threshold [21]. Tandem duplications were recognized as genes duplicated on a solitary chromosome with less than one intervening gene; conversely, they were classified as segmental repeats in this investigation. Leveraging the TBtools software, a physical map of the TRP genes was generated, depicting their distribution across different mandarin fish chromosomes.

Temperature stress in mandarin fish and MFF-1 cells

The fish were randomly allocated to three treatment groups, each consisting of five biological replicates, and exposed to distinct temperature conditions (17 ± 0.5 °C, 27 ± 0.5 °C, 37 ± 0.5 °C) [22]. On the seventh day post-stimulation, the tissues were collected from each group and promptly frozen in liquid nitrogen, then subsequently at − 80 °C pending further analysis [22]. MFF-1 cells were counted to attain a concentration of 5 × 107 cells/mL and seeded in cell culture 12-well plates, with a final volume of 1 ml per plate. Following overnight culture, the plates were divided into three groups and incubated at different temperatures: 17 °C, 27 °C and 32 °C. Samples were collected at 0, 4, 8, 12, 24 and 48 h, followed by the isolation of total RNA.

RT − qPCR

RNAs isolations were carried out using a total RNA extraction kit (Promega, Beijing, China) following the manufacturer’s protocol. Subsequently, the RNA samples were reverse transcribed into cDNA using a PrimeScript reverse transcription (RT) reagent kit (TaKaRa, China) [23]. The RT − qPCR reactions were performed with a SYBR premix ExTaq™ (Takara, Tokyo, Japan) on a LightCycler® 480 instrument (Roche Diagnostics, Switzerland) as previously described [24]. The gene-specific primers used for each gene are listed in Table 1.

Table 1 Primers used for qRT − PCR

Genes	Primers	Sequences (5′–3′)	Primer efficiency	
sctrpm3	Forward

Reverse

	CATCGCTTACATCTTTACCAACG

TCCAGGACGGGTCTTCATTAG

	0.96	
sctrpm4a	Forward

Reverse

	CATACGACCCTCGCCTTGA

ATGGTTTCCCACGTCATTAGTC

	0.98	
sctrpm6	Forward

Reverse

	AATTAACAGGATCAGAGCCACAG

GCCATCACTCGCCGCATA

	0.98	
sctrpm7	Forward

Reverse

	ACTCGGATGTGAAGGTGGGT

CCTGCTTGATGCGTGGGT

	0.99	
sctrpv1	Forward

Reverse

	CGGCAGTGACATTCCTAACC

CGGCTGTCCGTCCTTCTTA

	0.96	
sctrpml1a	Forward

Reverse

	GGCCATTCGCAGGAAGTTGA

CGGCGTAGAAGATGTGGTCGT

	0.97	
sctrpml1b	Forward

Reverse

	AACAATGAAATCCCTGACTGCTACAC

GCAGACAGACGAACGCCACC

	0.98	
scpkd1a	Forward

Reverse

	AGCCATACATCACAGCCTACCTTC

GACCCTTGTTGTCATGCCAAAT

	0.96	
scpkd2	Forward

Reverse

	TGGGACTACTGCCAATGTGAC

CCTGAGGTTTTGCACTTCGC

	0.97	
sctrpc1	Forward

Reverse

	AGCCCTCCATTGCTAAACTGA

CGTAGTTGTTCCTGTGGGCT

	0.97	
scβ-actin	Forward

Reverse

	CCCTCTGAACCCCAAAGCCA

CAGCCTGGATGGCAACGTACA

	0.98	

Statistical analysis

Statistical analysis was conducted using GraphPad Prism software. The data were normalized and presented as means ± standard deviations. All experiments were conducted in triplicate, unless otherwise specified. Group comparisons were assessed using a two-tailed, unpaired Student’s t test. P values less than 0.05 (denoted by a single asterisk (*) in the figures) were considered significant.

Results

Identification of TRP genes in mandarin fish

Using a homology-based prediction approach via BLASTP, we identified 28 TRP genes in mandarin fish. Upon further analysis of their structural specificity and conservation, we classified these genes into the following six categories: 1 TRPA (trpa1b), 8 TRPC (trpc1, trpc2, trpc4a, trpc4b, trpc5a, trpc6a, trpc6b, and trpc7), 8 TRPM (trpm1, trpm2, trpm3, trpm4a, trpm4b, trpm5, trpm6, and trpm7), 5 TRPML (trpml1a, trpml1b, trpml2, trpml3a, and trpml3b), 3 TRPP (pkd1a, pkd2, and pkd2l1), and 3 TRPV (trpv1, trpv4, and trpv6) (Supplementary Material 2). The number of identified TRP genes was comparable to that observed in other teleost fish species, such as Danio rerio (32 genes) and Oryzias latipes (36 genes).

Based on the TRP proteins from five vertebrate species (Homo sapiens, Mus musculus, Gallus gallus, D. rerio, and O. latipes), we constructed the phylogenetic tree of the TRP family (Fig. 1). Our analysis revealed six monophyletic subfamilies: TRPA, TRPC, TRPM, TRPML, TRPP and TRPV. Among these, the TRPM subfamily had the highest gene count, whereas the TRPA subfamily had the lowest. Within each subfamily branch, the TRP proteins of teleost fish formed monophyletic clusters, indicating sister-group relationships with the corresponding TRP proteins in other vertebrates. Specifically, within mandarin fish TRPA subfamily, TRPA1b formed a sister-group relationship with the TRPA1 of O. latipes. The TRPC subfamily included TRPC1, TRPC2, TRPC4a, TRPC4b, TRPC5a, TRPC6a, TRPC6b, and TRPC7. TRPC4a formed a clade with the TRPC of D. rerio, while the others formed sister-groups with O. latipes. The TRPM subfamily consisted of TRPM1 to TRPM7. Among them, TRPM1, TRPM4a, TRPM4b formed sister-groups with D. rerio, while the rest were sister to O. latipes. All members of the mandarin fish TRPML, TRPV, and TRPP subfamilies, excluding Pkd2, formed a sister-group relationship with those of O. latipes. With the exception for TRPM, most of the mandarin fish TRP subfamilies were more closely related to O. latipes, suggesting a relatively conserved gene structure within the TRP family between S. chuatsi and O. latipes.

Fig. 1 Phylogenetic analysis of TRP proteins in S. chuatsi and other vertebrates. The tree was constructed using Mega v10.0 with 1000 bootstrap replicates based on the Maximum likelihood method. The different sizes of solid circles on branches denotes different levels of bootstrap support. Species abbreviations are Hs, H. sapiens, Mm, M. musculus, Gg, G. gallus, Dr, D. rerio, Ol, O. latipes, Sc, S. chuatsi

Gene characteristics, structure and conserved motif analyses

To enhance our understanding of the TRP family in mandarin fish, a series of bioinformatics analyses were conducted. Through full-length alignments, we categorized the TRP family in mandarin fish into six subfamilies as previously mentioned (Fig. 2A), thereby illustrating the evolutionary divergence and functional specialization within the broader TRP superfamily. To understand the potential function of these TRP subfamilies, we conducted a detailed motif analysis (Fig. 2B). Our results showed that closely related members shared common motifs, especially within the TRPC, TRPM, and TRPML subfamilies, although conserved motifs across different subfamilies exhibited notable variations. To gain a comprehensive understanding of the domain architecture of TRP proteins, we conducted a thorough analysis of their structures. Our analysis revealed the presence of critical domains, including ankyrin repeats and the TRP domains (Fig. 2C), which are essential for the functioning of TRP proteins [6, 7]. Furthermore, we observed variations in additional domains across the subfamilies, indicating their specialized functional roles. For instance, the LSDAT_euk domain, presumed to act as a ligand sensor and participate in a wide range of nucleotide-related activities [25], is conserved among all members of the TRPM subfamily. Each member of the TRPML subfamily uniquely possesses an ELD domain, which forms a tight tetramer crucial for full-length TRPML assembly and localization [26]. To delve into the transcriptional regulation and splicing diversity of TRP genes, we further investigated their exon-intron organization. Our results showed disparities in the exon-intron patterns among the subfamilies, particularly evident in trpc genes, which exhibit a more intricate structure compared to trpml genes (Fig. 2D). These observations contribute to an enhanced understanding of the genetic basis of TRP family genes.

Fig. 2 Evolutionary relationships, motif patterns, conserved domains and gene structure of transient receptor potential family in mandarin fish. (A) Phylogenetic tree of 28 TRP proteins. (B) Motif pattern of TRP proteins. Ten presumptive motifs are indicated with boxes marked in different colors. (C) Distributions of conserved domains in TRP proteins. (D) The exon-intron architecture of TRP genes

Chromosome distribution of TRP Genes

By examining the physical positioning of genes within the genome of the mandarin fish (GCF_020085105.1), we were able to map the chromosomal locations of the TRP genes (Fig. 3). The results showed that the 28 TRP genes of mandarin fish were unevenly distributed across its fifteen chromosomes, with a significant portion of the TRPs localized in regions of high gene density. It is worth noting that Chr14 contained the highest number of TRP genes, with harboring four TRP genes. Moreover, Chr01, Chr03 and Chr05 were found to have three TRP gene members, while the rest chromosomes consisted of only 1–2 TRP genes. To gain deeper insights into the amplification and evolution of the TRP genes, we conducted an analysis of S. chuatsi gene duplication events using MCScanX. This analysis only revealed 2 duplication pairs, indicating that the presence of TRP genes in S. chuatsi is highly conserved in terms of gene duplication and tandem repetition.

Fig. 3 Distribution and covariance of TRP genes on S. chuatsi genomic chromosomes. The red line indicates the collinearity between the TRP genes and that they are replication genes. The color gradient of chromosomes from white to blue represent gene density from low to high, the red line charts also represent the gene density of each respective chromosome

Relative expression of TRP family members in different tissue

To further investigate the potential functions of TRPs, we conducted an analysis of their expression profiles across 14 tissues, using RT − qPCR data obtained from mandarin fish. Our results revealed distinct expression patterns of TRPs (Fig. 4A). The majority of TRPs exhibited a constitutive expression pattern, with the exception of muscle; however, trpml1b was noted to be expressed at low levels ubiquitously, similar to its homology in zebrafish [27]. Furthermore, we found that trpm3 and pkd2 were highly expressed in a majority of the tissues examined. It is worth mentioning that tissue-specific expression patterns were also identified for certain TRPs, with trpc1 being highly expressed exclusively in the brain, whereas trpml1a showed elevated expression in blood, spleen, and liver.

Further research has indicated that the transcription levels of these genes can vary in response to temperature alterations (Fig. 4B–K). For example, trpml1a is transcribed at significantly elevated levels at 17 °C compared to 27 °C in most tissues, achieving statistically significant at the P < 0.05 level (Fig. 4G). Conversely, a majority of the genes, including trpm6, trpml2, pkd1a, pkd2, and trpv1 (Fig. 4E and I − K), were significantly higher transcribed at 32 °C compared to 27 °C. Moreover, the expression patterns of certain genes, such as trpm3, trpm4a and trpm7 (Fig. 4C − D, and F), are influenced by temperature variations, with their transcription levels being upregulated in response to both increasing and decreasing temperatures, suggestive of a complex regulatory mechanism. These transcription levels may regulate the function of these genes and their roles in temperature-mediated processes. These observations provide insights into the regulation of gene expression by temperature changes and their potential roles in biological processes.

Fig. 4 Relative expression of TRP family members in S. chuatsi, including trpc, trpm, trpp and trpv genes. (A) Tissue distribution heatmap of the TRP genes mentioned above. The color gradient from blue to red signifies the gene relative expression level from low to high. (B − K) Relative expression levels of TRP family members in different tissues under temperature stress. The data is presented as the average ± standard error of the three independent biological replicates. A single asterisk (*) denotes a P-value below 0.05

Expression of TRP family members under temperature stress

To further obtain an understanding of the temporal dynamics of TRP gene expression influenced by temperature stress (17 °C, 27 °C, and 32 °C), in vitro experiments were conducted using MFF-1 cells. When comparing gene expression levels across different temperature treatments, distinct patterns emerged for each gene. Specifically, the expression of the trpml2, pkd1a, pkd2 was significantly downregulated at 17 °C and upregulated at 32 °C in most of the time within 4–24 h after temperature change (Fig. 5G − I), whereas the expression of the trpm6 was oppositely regulated under the same conditions (Fig. 5C). Variations in expression levels were also observed for other TRP genes, including trpc1, trpm4a, trpm7, trpml1a, trpml1b, trpv1 (Fig. 5A − B, D − F and J), under different temperature treatments, indicating their potential involvement in temperature-mediated responses. These results suggest that TRP genes play distinct roles in temperature-dependent regulation. Given the significant roles of the TRP proteins in pain perception, lysosome function, renal function, and other aspects [27–30], the observed alterations in gene expression levels may have significant implications for elucidating the molecular mechanisms underlying temperature-mediated processes and diseases.

Fig. 5 Relative expression levels of TRP family members in cells under temperature stress. (A–J) Relative expression levels of TRP family members in MFF-1 cells after temperature stress. The data is presented as the average ± standard error of the three independent biological replicates. A single asterisk (*) denotes a P-value below 0.05

Expression patterns of TRP family members in response to fish virus

The TRP family members, as polymodal ion channels, possess a unique function in integrating diverse environmental stresses [31]. Upon activation, these TRP genes regulate the release of immunomodulatory neuropeptides, such as substance P and calcitonin gene-related peptide, through various pathways, thereby eliciting immunomodulatory effects on multiple levels [32]. Previous research indicates that the expression level of TRP proteins can also be influenced by multiple factors, including pathogenic or inflammatory stimuli, temperature and other environmental stresses [33–36]. Furthermore, variations in expression levels can have comparable effects to their activation or inhibition [37–39]. To investigate the role of TRP family proteins in the replication process of fish viruses, cells were infected with three distinct viruses (ISKNV, MRV, SCRV), and subsequent alterations in TRP gene expression levels were analyzed over time. Our results showed that TRP genes exhibited both upregulation and downregulation in response to these viral infections. MRV infection induced the most profound changes in gene expression (Fig. 6B), with a greater number of genes being significantly upregulated compared to SCRV (Fig. 6A) and ISKNV (Fig. 6C). SCRV infection had a relatively moderate impact on gene expression, with fewer genes being significantly altered compared to MRV (Fig. 6A). ISKNV infection exhibited the lowest impact on gene expression, with five of the eight genes showing significant changes (Fig. 6C). The experiments demonstrated that the expression levels of trpm7, trpml1a, pkd1a and trpv1 were all changed in response to the infection of all three fish viruses. This observation indicates that these genes may possibly be involved in the complex interplay between the viruses and mandarin fish, potentially contributing to the host’s defense mechanisms against viral infection or enhancing the replication ability of the viruses. These results suggest differential modulation of TRP genes in response to fish virus infections, implying their role in immune response, particularly trpm7, trpml1a, pkd1a and trpv1, which were consistently upregulated across all three viral infections.

Fig. 6 Relative expression level of TRP genes in vitro at different time points after three specific mandarin fish viruses. (A) SCRV, (B) MRV, (C) ISKNV. Data are presented as the mean ± standard deviation of two independent biological replicates. A single asterisk (*) denotes a P-value below 0.05

Discussion

In the current era of global warming and the increasing frequency of extreme climate events, global aquaculture productivity faces mounting challenges posed by rising temperature, infectious diseases, salinity intrusion, and other factors [40, 41]. The mandarin fish, an important and valuable native species in China’s aquaculture industry, has experienced significant losses due to fish disease and thus confronts a grave threat from climate change [12, 42]. Given that the TRP protein can sense changes in environmental conditions and plays a regulatory role in various downstream pathways [31], identifying the TRP genes and its expression patterns in response to temperature variation and pathogen invasion is crucial for enhancing aquaculture health and infectious disease prevention and control.

In this study, we identified and characterized 28 TRP genes in mandarin fish, with nine belonging to the TRPC subfamily, eight to TRPM, five to TRPML, three to TRPP, three to TRPV and one to TRPA. The categories and numbers of TRP family protein members in mandarin fish are remarkably similar to those of its close relatives among bony and cartilaginous fish, particularly in the TRPC, TRPML, TRPM, and TRPV subfamilies. However, compared with mammals like humans and mice, the mandarin fish lacks trpv2, trpv3 and trpv5 in the TRPV subfamily and holds more paralogs in the TRPC (trpc4a and trpc4b, trpc6a and trpc6b) and TRPML (trpml1a and trpml1b, trpml3a and trpml3b) subfamilies, akin to other teleost fish [43]. As TRPML is known for its role in regulating lysosomal function and inflammation [44, 45], fish appear to mount a more robust immune response upon pathogen invasion. While trpv2 and trpv3 are crucial for temperature perception [46], the lack of certain TRPV genes in fish indicates a potentially slower perception and response to environmental shifts compared to mammals. We hypothesize that this may be the result of adaptive evolution in animals to maintain body temperature.

TRP proteins are unique among protein families due to their remarkable diversity in cation selectivities and specific activation mechanisms. They play critical roles in the responses to all major classes of external stimuli, such as light, sound, chemicals, temperature, and touch, highlighting their essential function in sensory perception [47]. In the mandarin fish, various TRP family members display significantly different patterns of tissue distribution and temperature response modes, reflecting the specific and diverse physiological roles within the organism. Notably, trpc1 is highly expressed in the brain, yet its response to temperature is not significant. Given its homology in zebrafish is also highly expressed in the brain, retina, and inner ear [48], it seems that fish trpc1 plays a role in various sensory organs and in the transmission and processing of sensory signals. However, the specific functions of trpc1 remain unclear in current studies [31, 49].

Besides temperature responsiveness, we also investigated the expression patterns of TRP genes in the mandarin fish under pathogenic stimulation. Our results showed the temporal impact of three different viruses (SCRV, MRV, and ISKNV) on gene expression in the MFF-1 cells. We found that MRV infection elicits broad relative expression changes within the TRP family genes, whereas the changes induced by ISKNV infection within the TRP family are notably less pronounced, despite both MRV and ISKNV belonging to the family Iridoviridae and causing a fatality rate higher than 90% in the mandarin fish [50, 51]. SCRV infection also caused a broad response, with the upregulation of TRP family genes occurring approximately 12 h later compared to MRV infection. Contrary to the close genetic relationship between MRV and ISKNV, SCRV is an RNA virus that belongs to the Rhabdoviridae family. Given that SCRV also exhibits a high fatality rate and causes a rapid onset of illness [52], it is speculated that the differences in TRPs response patterns are possibly associated with the distinct pathogenic mechanisms between these two viruses. Furthermore, it was detected that the expression levels of trpm7, trpml1a, pkd1a and trpv1 were all changed under the invasion of all three viruses. This suggested that these genes might be involved in the complex interplay between the viruses and mandarin fish [53, 54].

Conclusion

This study provides insightful perspectives on the functions of TRP proteins in the immune responses and adaptation mechanisms of mandarin fish to environmental stressors. The identification of TRP genes and the elucidation of their expression patterns in response to temperature variations and viral infections reveal the complexity and specificity of their physiological functions. These findings enhance our understanding of fish antiviral responses and viral pathogenesis, potentially laying the groundwork for developing effective strategies to combat fish virus diseases and enhancing aquaculture productivity. Further investigation into the functional attributes of TRP genes and their interplay with other cellular components is poised to yield a deeper comprehension of their involvement in fish immunology and disease resistance mechanisms.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Acknowledgements

Not applicable.

Author contributions

CRL, and XWQ conducted the experiments. SPW, and JGH provided the mandarin fish and virus samples. CRL, ZYL, MCL, and ZPZ performed the data and laboratory analyses. CJG, and CRL wrote the article. CJG conceived the study. CJG, and JGH provided Funding acquisition. All authors contributed to the discussion of the results and provided feedback on the manuscript.

Funding

This work was funded by the National Key Research and Development Program of China (grant no. 2022YFE0203900), the China Agriculture Research System (grant no. CARS-46), the Guangdong Key Research and Development Program (grant no. 2022B1111030001) and Guangdong Province Basic and Applied Basic Research Fund Project (grant no. 2023A1515110395).

Data availability

The authors confirm that no new genes or proteins were generated in this study and all analyses were based on existing data in the databases. The data underlying the findings of this study are presented in the article and its supplementary materials. The accession numbers of NCBI Reference Sequence or GenBank for the vertebrate TRP proteins used in this study are provided in Supplementary Material 1, while those for the mandarin fish TRP proteins are listed in Supplementary Material 2.

Declarations

Ethics approval and consent to participate

All animal experiments were permitted by the Ethics Committee of Sun Yat-sen University (Approval No. 2023051701) and performed in accordance with the guide for the Care and Use of Laboratory Animals of Sun Yat-sen University. We have complied with all relevant ethical regulations for animal use.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

TRP Transient receptor potential

ISKNV Infectious spleen and kidney necrosis virus

MRV Mandarin fish iridovirus

SCRV Siniperca chuatsi rhabdovirus

MEGA Molecular Evolutionary Genetics Analysis

RT − qPCR Reverse transcription quantitative PCR

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Chuanrui Li and Xiaowei Qin contributed equally to this work.
==== Refs
References

1. Le Morvan C Troutaud D Deschaux P Differential effects of temperature on specific and nonspecific immune defences in fish J Exp Biol 1998 201 Pt 2 165 8 10.1242/jeb.201.2.165 9405298
Le Morvan C, Troutaud D, Deschaux P. Differential effects of temperature on specific and nonspecific immune defences in fish. J Exp Biol. 1998;201(Pt 2):165–8.9405298 10.1242/jeb.201.2.165
2. Killen SS Growth trajectory influences temperature preference in fish through an effect on metabolic rate J Anim Ecol 2014 83 6 1513 22 10.1111/1365-2656.12244 24806155
Killen SS. Growth trajectory influences temperature preference in fish through an effect on metabolic rate. J Anim Ecol. 2014;83(6):1513–22.24806155 10.1111/1365-2656.12244
3. Johnston IA Dunn J Temperature acclimation and metabolism in ectotherms with particular reference to teleost fish Symp Soc Exp Biol 1987 41 67 93 3332497
Johnston IA, Dunn J. Temperature acclimation and metabolism in ectotherms with particular reference to teleost fish. Symp Soc Exp Biol. 1987;41:67–93.3332497
4. Rosenbaum T Morales-Lazaro SL Islas LD TRP channels: a journey towards a molecular understanding of pain Nat Rev Neurosci 2022 23 10 596 610 10.1038/s41583-022-00611-7 35831443
Rosenbaum T, Morales-Lazaro SL, Islas LD. TRP channels: a journey towards a molecular understanding of pain. Nat Rev Neurosci. 2022;23(10):596–610.35831443 10.1038/s41583-022-00611-7
5. Himmel NJ, Cox DN. Transient receptor potential channels: current perspectives on evolution, structure, function and nomenclature. Proc Biol Sci, 2020. 287(1933): p. 20201309.
6. Peng G Shi X Kadowaki T Evolution of TRP channels inferred by their classification in diverse animal species Mol Phylogenet Evol 2015 84 145 57 10.1016/j.ympev.2014.06.016 24981559
Peng G, Shi X, Kadowaki T. Evolution of TRP channels inferred by their classification in diverse animal species. Mol Phylogenet Evol. 2015;84:145–57.24981559 10.1016/j.ympev.2014.06.016
7. Zheng W Direct binding between Pre-S1 and TRP-like domains in TRPP channels mediates gating and functional regulation by PIP2 Cell Rep 2018 22 6 1560 73 10.1016/j.celrep.2018.01.042 29425510
Zheng W, et al. Direct binding between Pre-S1 and TRP-like domains in TRPP channels mediates gating and functional regulation by PIP2. Cell Rep. 2018;22(6):1560–73.29425510 10.1016/j.celrep.2018.01.042
8. Owsianik G Structure-function relationship of the TRP channel superfamily Rev Physiol Biochem Pharmacol 2006 156 61 90 16634147
Owsianik G, et al. Structure-function relationship of the TRP channel superfamily. Rev Physiol Biochem Pharmacol. 2006;156:61–90.16634147
9. Zhao Y Effects of chloride, sulfate, and bicarbonate stress on mortality rate, gill tissue morphology, and gene expression in mandarin fish (Siniperca chuatsi) Environ Sci Pollut Res Int 2023 30 44 99440 53 10.1007/s11356-023-29411-x 37612552
Zhao Y, et al. Effects of chloride, sulfate, and bicarbonate stress on mortality rate, gill tissue morphology, and gene expression in mandarin fish (Siniperca chuatsi). Environ Sci Pollut Res Int. 2023;30(44):99440–53.37612552 10.1007/s11356-023-29411-x
10. Liu J Cui Y Liu J Resting metabolism and heat increment of feeding in mandarin fish (Siniperca chuatsi) and Chinese snakehead (Channa argus) Comp Biochem Physiol Mol Integr Physiol 2000 127 2 131 8 10.1016/S1095-6433(00)00246-4
Liu J, Cui Y, Liu J. Resting metabolism and heat increment of feeding in mandarin fish (Siniperca chuatsi) and Chinese snakehead (Channa argus). Comp Biochem Physiol Mol Integr Physiol. 2000;127(2):131–8.10.1016/S1095-6433(00)00246-4
11. Ding W Transcriptomic responses of the liver of mandarin fish (Siniperca chuatsi) under hypoxic stress J Fish Biol 2023 103 1 44 58 10.1111/jfb.15399 37024433
Ding W, et al. Transcriptomic responses of the liver of mandarin fish (Siniperca chuatsi) under hypoxic stress. J Fish Biol. 2023;103(1):44–58.37024433 10.1111/jfb.15399
12. Zhang W Widespread outbreaks of the emerging mandarinfish ranavirus (MRV) both in natural and ISKNV-FKC vaccinated mandarinfish Siniperca chuatsi in Guangdong, South China, 2017 Aquaculture 2020 520 734989 10.1016/j.aquaculture.2020.734989
Zhang W, et al. Widespread outbreaks of the emerging mandarinfish ranavirus (MRV) both in natural and ISKNV-FKC vaccinated mandarinfish Siniperca chuatsi in Guangdong, South China, 2017. Aquaculture. 2020;520:734989.10.1016/j.aquaculture.2020.734989
13. Luo Z Interaction of Teleost Fish TRPV4 with DEAD Box RNA helicase 1 regulates Iridovirus Replication J Virol 2023 97 6 e0049523 10.1128/jvi.00495-23 37289063
Luo Z, et al. Interaction of Teleost Fish TRPV4 with DEAD Box RNA helicase 1 regulates Iridovirus Replication. J Virol. 2023;97(6):e0049523.37289063 10.1128/jvi.00495-23
14. Liang M Hypermethylated genome of a fish vertebrate iridovirus ISKNV plays important roles in viral infection Commun Biol 2024 7 1 237 10.1038/s42003-024-05919-x 38413759
Liang M, et al. Hypermethylated genome of a fish vertebrate iridovirus ISKNV plays important roles in viral infection. Commun Biol. 2024;7(1):237.38413759 10.1038/s42003-024-05919-x
15. Dong C Development of a mandarin fish Siniperca chuatsi fry cell line suitable for the study of infectious spleen and kidney necrosis virus (ISKNV) Virus Res 2008 135 2 273 81 10.1016/j.virusres.2008.04.004 18485510
Dong C, et al. Development of a mandarin fish Siniperca chuatsi fry cell line suitable for the study of infectious spleen and kidney necrosis virus (ISKNV). Virus Res. 2008;135(2):273–81.18485510 10.1016/j.virusres.2008.04.004
16. Liu W et al. Oxygen-sensing protein cysteamine dioxygenase from Mandarin Fish involved in the Arg/N-Degron pathway and Siniperca chuatsi Rhabdovirus infection. Viruses, 2023. 15(8).
17. Li ZM Mandarin fish Von Hippel-Lindau protein regulates the NF-kappaB signaling pathway via interaction with IkappaB to promote fish ranavirus replication Zool Res 2024 45 5 990 1000 10.24272/j.issn.2095-8137.2023.392 39147714
Li ZM, et al. Mandarin fish Von Hippel-Lindau protein regulates the NF-kappaB signaling pathway via interaction with IkappaB to promote fish ranavirus replication. Zool Res. 2024;45(5):990–1000.39147714 10.24272/j.issn.2095-8137.2023.392
18. Yu Y et al. Molecular characterization and Functional Analysis of Hypoxia-Responsive Factor Prolyl Hydroxylase Domain 2 in Mandarin Fish (Siniperca chuatsi). Anim (Basel), 2023. 13(9).
19. Wilkins MR Protein identification and analysis tools in the ExPASy server Methods Mol Biol 1999 112 531 52 10027275
Wilkins MR, et al. Protein identification and analysis tools in the ExPASy server. Methods Mol Biol. 1999;112:531–52.10027275
20. Chen C TBtools: an integrative Toolkit developed for interactive analyses of big Biological Data Mol Plant 2020 13 8 1194 202 10.1016/j.molp.2020.06.009 32585190
Chen C, et al. TBtools: an integrative Toolkit developed for interactive analyses of big Biological Data. Mol Plant. 2020;13(8):1194–202.32585190 10.1016/j.molp.2020.06.009
21. Wang Y MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity Nucleic Acids Res 2012 40 7 e49 10.1093/nar/gkr1293 22217600
Wang Y, et al. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012;40(7):e49.22217600 10.1093/nar/gkr1293
22. Saravia J Effects of temperature on the innate immune response on Antarctic and sub-antarctic fish Harpagifer antarcticus and Harpagifer bispinis challenged with two immunostimulants, LPS and poly I:C: in vivo and in vitro approach Fish Shellfish Immunol 2022 130 391 408 10.1016/j.fsi.2022.09.025 36126838
Saravia J, et al. Effects of temperature on the innate immune response on Antarctic and sub-antarctic fish Harpagifer antarcticus and Harpagifer bispinis challenged with two immunostimulants, LPS and poly I:C: in vivo and in vitro approach. Fish Shellfish Immunol. 2022;130:391–408.36126838 10.1016/j.fsi.2022.09.025
23. Qin XW The roles of mandarin fish STING in innate immune defense against infectious spleen and kidney necrosis virus infections Fish Shellfish Immunol 2020 100 80 9 10.1016/j.fsi.2020.02.062 32135344
Qin XW, et al. The roles of mandarin fish STING in innate immune defense against infectious spleen and kidney necrosis virus infections. Fish Shellfish Immunol. 2020;100:80–9.32135344 10.1016/j.fsi.2020.02.062
24. Zeng R Development of a gene-deleted live attenuated candidate vaccine against fish virus (ISKNV) with low pathogenicity and high protection iScience 2021 24 7 102750 10.1016/j.isci.2021.102750 34278259
Zeng R, et al. Development of a gene-deleted live attenuated candidate vaccine against fish virus (ISKNV) with low pathogenicity and high protection. iScience. 2021;24(7):102750.34278259 10.1016/j.isci.2021.102750
25. Burroughs AM Comparative genomic analyses reveal a vast, novel network of nucleotide-centric systems in biological conflicts, immunity and signaling Nucleic Acids Res 2015 43 22 10633 54 10.1093/nar/gkv1267 26590262
Burroughs AM, et al. Comparative genomic analyses reveal a vast, novel network of nucleotide-centric systems in biological conflicts, immunity and signaling. Nucleic Acids Res. 2015;43(22):10633–54.26590262 10.1093/nar/gkv1267
26. Lev S Constitutive activity of the human TRPML2 channel induces cell degeneration J Biol Chem 2010 285 4 2771 82 10.1074/jbc.M109.046508 19940139
Lev S, et al. Constitutive activity of the human TRPML2 channel induces cell degeneration. J Biol Chem. 2010;285(4):2771–82.19940139 10.1074/jbc.M109.046508
27. Benini A Characterization and expression analysis of mcoln1.1 and mcoln1.2, the putative zebrafish co-orthologs of the gene responsible for human mucolipidosis type IV Int J Dev Biol 2013 57 1 85 93 10.1387/ijdb.120033gb 23585356
Benini A, et al. Characterization and expression analysis of mcoln1.1 and mcoln1.2, the putative zebrafish co-orthologs of the gene responsible for human mucolipidosis type IV. Int J Dev Biol. 2013;57(1):85–93.23585356 10.1387/ijdb.120033gb
28. Chubanov V TRPM channels in health and disease Nat Rev Nephrol 2024 20 3 175 87 10.1038/s41581-023-00777-y 37853091
Chubanov V, et al. TRPM channels in health and disease. Nat Rev Nephrol. 2024;20(3):175–87.37853091 10.1038/s41581-023-00777-y
29. Bevan S Quallo T Andersson DA TRPV1 Handb Exp Pharmacol 2014 222 207 45 10.1007/978-3-642-54215-2_9 24756708
Bevan S, Quallo T, Andersson DA. TRPV1 Handb Exp Pharmacol. 2014;222:207–45.24756708 10.1007/978-3-642-54215-2_9
30. Nauli SM Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells Nat Genet 2003 33 2 129 37 10.1038/ng1076 12514735
Nauli SM, et al. Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nat Genet. 2003;33(2):129–37.12514735 10.1038/ng1076
31. Ramsey IS Delling M Clapham DE AN INTRODUCTION TO TRP CHANNELS Annu Rev Physiol 2006 68 1 619 47 10.1146/annurev.physiol.68.040204.100431 16460286
Ramsey IS, Delling M, Clapham DE, AN INTRODUCTION TO TRP CHANNELS. Annu Rev Physiol. 2006;68(1):619–47.16460286 10.1146/annurev.physiol.68.040204.100431
32. Spekker E, Kortesi T, Vecsei L, Channels TRP. Recent Development in Translational Research and potential therapeutic targets in Migraine. Int J Mol Sci, 2022. 24(1).
33. Mao F et al. Identification, characterization and expression analysis of TRP Channel Genes in the Vegetable Pest, Pieris rapae. Insects, 2020. 11(3).
34. Qian Y Identification of transient receptor potential channel genes from the swimming crab, Portunus Trituberculatus, and their expression profiles under acute temperature stress BMC Genomics 2024 25 1 72 10.1186/s12864-024-09973-x 38233779
Qian Y, et al. Identification of transient receptor potential channel genes from the swimming crab, Portunus Trituberculatus, and their expression profiles under acute temperature stress. BMC Genomics. 2024;25(1):72.38233779 10.1186/s12864-024-09973-x
35. Sadowska A Inflammaging in cervical and lumbar degenerated intervertebral discs: analysis of proinflammatory cytokine and TRP channel expression Eur Spine J 2018 27 3 564 77 10.1007/s00586-017-5360-8 29204735
Sadowska A, et al. Inflammaging in cervical and lumbar degenerated intervertebral discs: analysis of proinflammatory cytokine and TRP channel expression. Eur Spine J. 2018;27(3):564–77.29204735 10.1007/s00586-017-5360-8
36. Boltana S The expression of TRPV channels, prostaglandin E2 and pro-inflammatory cytokines during behavioural fever in fish Brain Behav Immun 2018 71 169 81 10.1016/j.bbi.2018.03.023 29574261
Boltana S, et al. The expression of TRPV channels, prostaglandin E2 and pro-inflammatory cytokines during behavioural fever in fish. Brain Behav Immun. 2018;71:169–81.29574261 10.1016/j.bbi.2018.03.023
37. Kunka A TRPA1 up-regulation mediates oxidative stress in a pulpitis model in vitro Br J Pharmacol 2024 181 17 3246 62 10.1111/bph.16386 38744683
Kunka A, et al. TRPA1 up-regulation mediates oxidative stress in a pulpitis model in vitro. Br J Pharmacol. 2024;181(17):3246–62.38744683 10.1111/bph.16386
38. Wang W Up-regulation of lysosomal TRPML1 channels is essential for lysosomal adaptation to nutrient starvation Proc Natl Acad Sci U S A 2015 112 11 E1373 81 10.1073/pnas.1419669112 25733853
Wang W, et al. Up-regulation of lysosomal TRPML1 channels is essential for lysosomal adaptation to nutrient starvation. Proc Natl Acad Sci U S A. 2015;112(11):E1373–81.25733853 10.1073/pnas.1419669112
39. Kameda T et al. Expression and activity of TRPA1 and TRPV1 in the Intervertebral Disc: Association with inflammation and Matrix Remodeling. Int J Mol Sci, 2019. 20(7).
40. Yadav NK Climate change effects on aquaculture production and its sustainable management through climate-resilient adaptation strategies: a review Environ Sci Pollut Res Int 2024 31 22 31731 51 10.1007/s11356-024-33397-5 38652188
Yadav NK, et al. Climate change effects on aquaculture production and its sustainable management through climate-resilient adaptation strategies: a review. Environ Sci Pollut Res Int. 2024;31(22):31731–51.38652188 10.1007/s11356-024-33397-5
41. Ahmed N Thompson S Glaser M Global aquaculture Productivity, Environmental sustainability, and Climate Change adaptability Environ Manage 2019 63 2 159 72 10.1007/s00267-018-1117-3 30460481
Ahmed N, Thompson S, Glaser M. Global aquaculture Productivity, Environmental sustainability, and Climate Change adaptability. Environ Manage. 2019;63(2):159–72.30460481 10.1007/s00267-018-1117-3
42. Xiao M GC-MS metabolomics reveals metabolic differences of the farmed Mandarin fish Siniperca chuatsi in recirculating ponds aquaculture system and pond Sci Rep 2020 10 1 6090 6090 10.1038/s41598-020-63252-9 32269294
Xiao M, et al. GC-MS metabolomics reveals metabolic differences of the farmed Mandarin fish Siniperca chuatsi in recirculating ponds aquaculture system and pond. Sci Rep. 2020;10(1):6090–6090.32269294 10.1038/s41598-020-63252-9
43. Zhang M TRP (transient receptor potential) ion channel family: structures, biological functions and therapeutic interventions for diseases Signal Transduct Target Ther 2023 8 1 261 10.1038/s41392-023-01464-x 37402746
Zhang M, et al. TRP (transient receptor potential) ion channel family: structures, biological functions and therapeutic interventions for diseases. Signal Transduct Target Ther. 2023;8(1):261.37402746 10.1038/s41392-023-01464-x
44. Zeevi DA Frumkin A Bach G TRPML and lysosomal function Biochim Biophys Acta 2007 1772 8 851 8 10.1016/j.bbadis.2007.01.004 17306511
Zeevi DA, Frumkin A, Bach G. TRPML and lysosomal function. Biochim Biophys Acta. 2007;1772(8):851–8.17306511 10.1016/j.bbadis.2007.01.004
45. Spix B TRPML cation channels in inflammation and immunity Front Immunol 2020 11 225 10.3389/fimmu.2020.00225 32184778
Spix B, et al. TRPML cation channels in inflammation and immunity. Front Immunol. 2020;11:225.32184778 10.3389/fimmu.2020.00225
46. Karki T, Tojkander S. TRPV protein family-from mechanosensing to Cancer Invasion. Biomolecules, 2021. 11(7).
47. Venkatachalam K Montell C TRP channels Annu Rev Biochem 2007 76 387 417 10.1146/annurev.biochem.75.103004.142819 17579562
Venkatachalam K, Montell C. TRP channels. Annu Rev Biochem. 2007;76:387–417.17579562 10.1146/annurev.biochem.75.103004.142819
48. Von Niederhausern V Phylogeny and expression of canonical transient receptor potential (TRPC) genes in developing zebrafish Dev Dyn 2013 242 12 1427 41 10.1002/dvdy.24041 24038627
Von Niederhausern V, et al. Phylogeny and expression of canonical transient receptor potential (TRPC) genes in developing zebrafish. Dev Dyn. 2013;242(12):1427–41.24038627 10.1002/dvdy.24041
49. Wang H TRPC channels: structure, function, regulation and recent advances in small molecular probes Pharmacol Ther 2020 209 107497 10.1016/j.pharmthera.2020.107497 32004513
Wang H, et al. TRPC channels: structure, function, regulation and recent advances in small molecular probes. Pharmacol Ther. 2020;209:107497.32004513 10.1016/j.pharmthera.2020.107497
50. Dong C Occurrence of a lethal ranavirus in hybrid mandarin (Siniperca Scherzeri x Siniperca chuatsi) in Guangdong, South China Vet Microbiol 2017 203 28 33 10.1016/j.vetmic.2017.02.006 28619157
Dong C, et al. Occurrence of a lethal ranavirus in hybrid mandarin (Siniperca Scherzeri x Siniperca chuatsi) in Guangdong, South China. Vet Microbiol. 2017;203:28–33.28619157 10.1016/j.vetmic.2017.02.006
51. Zhou Y The dynamic immune responses of Mandarin fish (Siniperca chuatsi) to ISKNV in early infection based on full-length transcriptome analysis and weighted gene co-expression network analysis Fish Shellfish Immunol 2022 122 191 205 10.1016/j.fsi.2022.02.017 35158068
Zhou Y, et al. The dynamic immune responses of Mandarin fish (Siniperca chuatsi) to ISKNV in early infection based on full-length transcriptome analysis and weighted gene co-expression network analysis. Fish Shellfish Immunol. 2022;122:191–205.35158068 10.1016/j.fsi.2022.02.017
52. Lijuan Z An avirulent Micropterus salmoides rhabdovirus vaccine candidate protects Chinese perch against rhabdovirus infection Fish Shellfish Immunol 2018 77 474 80 10.1016/j.fsi.2018.03.047 29604344
Lijuan Z, et al. An avirulent Micropterus salmoides rhabdovirus vaccine candidate protects Chinese perch against rhabdovirus infection. Fish Shellfish Immunol. 2018;77:474–80.29604344 10.1016/j.fsi.2018.03.047
53. Santoni G Involvement of the TRPML Mucolipin channels in viral infections and anti-viral innate Immune responses Front Immunol 2020 11 739 10.3389/fimmu.2020.00739 32425938
Santoni G, et al. Involvement of the TRPML Mucolipin channels in viral infections and anti-viral innate Immune responses. Front Immunol. 2020;11:739.32425938 10.3389/fimmu.2020.00739
54. Orsini EM Stretching the function of Innate Immune cells Front Immunol 2021 12 767319 10.3389/fimmu.2021.767319 34795674
Orsini EM, et al. Stretching the function of Innate Immune cells. Front Immunol. 2021;12:767319.34795674 10.3389/fimmu.2021.767319
