
==== Front
Cell Mol Gastroenterol Hepatol
Cell Mol Gastroenterol Hepatol
Cellular and Molecular Gastroenterology and Hepatology
2352-345X
Elsevier

S2352-345X(24)00132-2
10.1016/j.jcmgh.2024.101377
101377
Original Research
DDR2/STAT3 Positive Feedback Loop Mediates the Immunosuppressive Microenvironment by Upregulating PD-L1 and Recruiting MDSCs in Oxaliplatin-Resistant HCC
Liu Wenfeng 123∗
Zhang Feng 12∗
Quan Bing 12∗
Yao Fan 12
Chen Rongxin 12
Ren Zhenggang 12
Dong Ling dong.ling@zs-hospital.sh.cn
3§∗
Yin Xin yin.xin@zs-hospital.sh.cn
12§∗
1 Liver Cancer Institute, Zhongshan Hospital, Fudan University, Shanghai, China
2 National Clinical Research Center for Interventional Medicine, Shanghai, China
3 Department of Gastroenterology and Hepatology, Zhongshan Hospital, Fudan University, Shanghai, China
∗ Correspondence Address correspondence to: Xin Yin, PhD, Liver Cancer Institute, Zhongshan Hospital, Fudan University, 136 Yi Xue Yuan Road, Shanghai 200032, China. yin.xin@zs-hospital.sh.cn
∗ Ling Dong, PhD, Department of Gastroenterology and Hepatology, Zhongshan Hospital, Fudan University, 136 Yi Xue Yuan Road, Shanghai 200032, China. dong.ling@zs-hospital.sh.cn
∗ Authors share co-first authorship.

§ Authors share co-senior authorship.

03 7 2024
2024
03 7 2024
18 4 1013779 4 2023
28 6 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Background and Aims

Transcriptome sequencing revealed high expression of DDR2 in oxaliplatin-resistant hepatocellular carcinoma (HCC). This study aimed to explore the role of DDR2 in oxaliplatin resistance and immune evasion in HCC.

Methods

Oxaliplatin-resistant HCC cell lines were established. The interaction between DDR2 and STAT3 was investigated, along with the mechanisms involved in DDR2/STAT3-mediated PD-L1 upregulation and polymorphonuclear myeloid-derived suppressor cells (PMN-MDSCs) accumulation both in vitro and in vivo.

Results

DDR2 was found to induce the phosphorylation of STAT3, leading to its nuclear translocation. Conversely, the activation of STAT3 enhanced DDR2 expression. A positive feedback loop involving DDR2/STAT3 was identified in oxaliplatin-resistant HCC, which was associated with PD-L1 upregulation and PMN-MDSCs accumulation. Knockdown of DDR2 and STAT3 sensitized oxaliplatin-resistant HCC cells to oxaliplatin and resulted in decreased PMN-MDSCs and increased CD8+ T cells in the tumor microenvironment. Enzyme-linked immunosorbent array and MDSC transwell migration assays indicated that oxaliplatin-resistant HCC cells recruited PMN-MDSCs through CCL20. Dual luciferase reporter assays demonstrated that STAT3 can directly enhance the transcription of PD-L1 and CCL20. Furthermore, treatment with a PD-L1 antibody in combination with CCL20 blockade had significant antitumor effects on oxaliplatin-resistant HCC.

Conclusions

Our findings revealed a positive feedback mechanism involving DDR2 and STAT3 that mediates the immunosuppressive microenvironment and promotes oxaliplatin resistance and immune evasion via PD-L1 upregulation and PMN-MDSC recruitment. Targeting the DDR2/STAT3 pathway may be a promising therapeutic strategy to overcome immune escape and chemoresistance in HCC.

Graphical abstract

Keywords

DDR2
STAT3
PD-L1 Upregulation
MDSCs
Hepatocellular Carcinoma
Abbreviations used in this paper

ELISA enzyme-linked immunosorbent assay

HCC hepatocellular carcinoma

IC50 median inhibitory concentration

MDSC myeloid-derived suppressor cell

mRNA messenger RNA

PMN-MDSC polymorphonuclear myeloid-derived suppressor cell

qPCR quantitative polymerase chain reaction

shRNA short hairpin RNA

WT wild-type
==== Body
pmc Summary

This study dissects the mechanisms underlying the immune evasion of oxaliplatin-resistant hepatocellular carcinoma. Anti-PD-L1 antibody combined with CCL20 blockade exhibited significant antitumor effects in oxaliplatin-resistant hepatocellular carcinoma.

Cancer poses a significant threat to human health worldwide. According to the Global Caner Statistics 2022, hepatocellular carcinoma (HCC) is among the most prevalent cancers, contributing to 8.2% of the total number of cancer-related mortality.1 China, in particular, is home to more than 50% of the world's liver cancer patients, making it the country with the highest incidence of this disease and earning HCC the rank of second deadliest cancer within its borders.2,3 Primary liver cancer is characterized by high malignancy, rapid progression, extensive metastasis, and a high recurrence rate and presents a formidable challenge to medical science. The treatment modalities available for HCC include surgical excision, liver transplantation, interventional therapy, targeted drugs, immunotherapy, and systemic chemotherapy.4, 5, 6, 7 Unfortunately, by the time of diagnosis, most HCC patients present with advanced stage disease and have thus missed the window for curative resection. This leaves treatments such as transarterial chemoembolization and hepatic arterial infusion chemotherapy as the chief options for these patients. However, the problem of chemotherapy resistance continues to be a significant hurdle to overcome. Oxaliplatin is the cornerstone of various chemotherapeutic regimens, yet clinical practice has seen an increasing trend toward resistance. Consequently, elucidating the molecular mechanisms underlying oxaliplatin resistance is profoundly important, as it has the potential to significantly improve the clinical management of HCC.

In a previous study, we performed RNA sequencing to compare oxaliplatin-resistant cell lines with conventional cell lines, revealing significant differences in gene expression, particularly that of DDR2. As a member of the receptor tyrosine kinase family, DDR2 is phosphorylated at tyrosine residues, thereby activating downstream signaling molecules and enabling signal transduction through cascading amplification.8 Historically, immunohistochemical analysis has demonstrated that DDR2 is overexpressed in various cancer tissues, including bladder cancer, testicular cancer, lung cancer, kidney cancer, prostate cancer, stomach cancer, and nasopharyngeal cancer tissues.9, 10, 11 DDR2 also plays a pivotal role in cell adhesion, proliferation, migration, and matrix remodeling. Moreover, heightened DDR2 expression often correlates with more aggressive tumor phenotypes. For example, in breast cancer, DDR2 protein was found to be upregulated in 55.6% of invasive carcinomas—a trend associated with high tumor grade, low tumor differentiation, and poor survival prognosis.12 What’s more, DDR2 plays a vital role in signal alteration during the epithelial-mesenchymal transition, functioning to integrate extracellular signals into migration and invasion phenotypes.13,14 DDR2 can regulate Snail expression in an SRC-dependent manner, thereby preserving the mesenchymal cell fate and invasion abilities.15,16 After repeated chemotherapy, chemotherapeutic-resistant tumor cells in residual cancer persistently foster a local tumor immune tolerance microenvironment via self-transformation. This ensures evasion from the immune system's destructing capabilities. Hence, acquired immune tolerance is a characteristic of chemotherapy-resistant tumor cells and serves as an important predictor of tumor progression, metastasis, and poor prognosis.17 However, the specific role and underlying mechanisms through which DDR2 mediates chemotherapy resistance and immune evasion in HCC have yet to be clearly defined.

To achieve a more comprehensive comprehension between oxaliplatin resistance and DDR2 in HCC, we examined the DDR2 expression in normal and oxaliplatin-resistant HCC cell lines. We also investigated the effect of DDR2 inhibition on oxaliplatin resistance. Moreover, we focused on elucidating the mechanisms by which abnormally upregulated DDR2 contributes to the malignant phenotype and immune escape in HCC.

Results

DDR2 Was Highly Expressed in Oxaliplatin-Resistant HCC Cells and Was Involved in Cell Proliferation

We established Hep3B-OXA, MHCC97H-OXA, and Hepa1-6-OXA cell lines following the methods described previously.18 The expression of DDR2 was evaluated by quantitative polymerase chain reaction (qPCR) and Western blotting. Compared with those in Hep3B, MHCC97H, and Hepa1-6 cells, DDR2 expression in Hep3B-OXA, MHCC97H-OXA, and Hepa1-6-OXA cells was increased (Figure 1A–C). To explore the function of DDR2, we transfected DDR2 short hairpin RNA (shRNA) lentiviruses or blank viruses into cells, and stable DDR2 knockdown cells were established. After knockdown of DDR2, messenger RNA (mRNA) and protein expression of DDR2 was reduced in oxaliplatin-resistant HCC cells (Figure 1D and E). Through CCK-8 array, we observed that silencing DDR2 remarkably reduced cell viability (Figure 1F and G). Median inhibitory concentration (IC50) was evaluated by the CCK-8 method. We found a significant decrease in the IC50 value of oxaliplatin in both the parental nonresistant cells and oxaliplatin-resistant cells following DDR2 knockdown (Figure 1H and I).Figure 1 DDR2 was highly expressed in oxaliplatin-resistant HCC cells and was involved in cell proliferation. (A) RNA sequencing data between MHCC97H and MHCC97H-OXA cells. (B, C) DDR mRNA and protein expression in HCC cells and oxaliplatin-resistant HCC cells. (D) Hep3B-OXA, MHCC97H, and Hepa1-6-OXA cells were transfected with shRNA targeting the DDR2 gene using lentiviral vectors. The downregulation of DDR2 was confirmed by qPCR. (E) The downregulation of DDR2 was confirmed by Western blot. (F, G) The inhibitory effect of DDR2 silencing on proliferation was confirmed by CCK8 assays in HCC cells. (H, I) The IC50 values of oxaliplatin in HCC cells transfected with DDR2 shRNA were significantly lower than those of HCC cells transfected with control lentiviral vectors. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001, ∗∗∗∗P < .0001.

DDR2 Interacted With STAT3 and Promoted the Phosphorylation of STAT3

Several signaling pathways were altered in oxaliplatin-resistant cell lines. In this study, we showed that STAT3 was activated in oxaliplatin-resistant strains (Figure 2A). A previous study revealed that DDR2, which contains a discoidin domain, is a potentially targetable regulator of STAT3 through kinase and phosphatase small interfering RNA screening.19 Therefore, we investigated whether DDR2 may be involved in HCC progression by modulating the STAT3 pathway. Western blot analysis revealed that DDR2 knockdown decreased STAT3 phosphorylation in all 3 cell lines (Figure 2B). Additionally, STAT3 silencing significantly reduced DDR2 mRNA and protein expression (Figure 2C and D). Upon activation, STAT3 translocates into the nucleus and binds to DNA, which it acts as a transcription factor. Therefore, we postulated that DDR2 is a downstream target gene of STAT3. To investigate the potential binding sites between STAT3 and DDR2 in the promoter region, we utilized the JASPAR database (http://jaspar.genereg.net/) for prediction. Next, a luciferase assay was utilized to test the binding of STAT3 to the DDR2 promoter. STAT3 overexpression promoted the activity of the wild-type (WT) DDR2/Luc reporter but had no effect on the mutant DDR2/Luc reporter (Figure 2E). Co-immunoprecipitation revealed that DDR2 was co-immunoprecipitated with STAT3 in Hep3B-OXA and MHCC7H-OXA cells (Figure 2F). Thus, for the first time, we identified a DDR2/STAT3 positive feedback loop in HCC.Figure 2 DDR2 interacted with STAT3 and promoted the phosphorylation of STAT3. (A) STAT3 and p-STAT3 protein levels were examined in HCC cells and oxaliplatin-resistant HCC cells. (B) STAT3 and p-STAT3 proteins were examined in HCC cells transfected with scramble lentiviral vector or shRNA targeting the DDR2 gene. (C) DDR2 and STAT3 mRNA levels were examined in cells transfected with scramble lentiviral vector or shSTAT3. (D) DDR2 and STAT3 protein levels were examined in cells transfected with scramble lentiviral vector or shSTAT3. (E) Dual luciferase reporter assay to analyze the activity of the WT and mutant DDR2 (–1798 to –3bp)/Luc promoter constructs in HEK-293 cells. Relative luciferase activities are shown (n = 3). (F) Co-immunoprecipitation was used to determine the relationship between DDR2 and STAT3. ∗∗∗P < .001, ∗∗∗∗P < .0001. IP, immunoprecipitation; MT, mutant; NC, normal control; OE, overexpression.

DDR2 Promoted the Proliferation and Oxaliplatin Resistance of HCC cells via STAT3

To further elucidate the potential role of DDR2 in HCC progression via STAT3 regulation, we carried out a series of experiments. Western blot analysis revealed a significant reduction in DDR2 protein levels in cells transfected with shRNA, and the silencing of DDR2 inhibited the expression of p-STAT3 (Figure 3A). Decreased expression of Bcl2 and increased expression of Bax were detected in shDDR2 HCC cells. Then, the lentivirus carrying STAT3 plasmid was transfected into cells with DDR2 silencing, which was found to rescue the expression of p-STAT3. The results also displayed that STAT3 overexpression eliminated the impact of DDR2 knockdown on the influence of Bcl2 and Bax. To further explore the function of DDR2/STAT3 in HCC, we established a transplanted tumor model using C57BL/6J mice. One week later, oxaliplatin was injected into the mice twice a week (5 mg/kg). We found that STAT3 silencing markedly reduced tumor volume and weight, whereas DDR2 overexpression reversed the effect of STAT3 silencing on tumor volume and weight (Figure 3B–D). Moreover, immunohistochemical analysis revealed that STAT3 silencing inhibited Ki67 expression and promoted apoptosis, whereas DDR2 overexpression attenuated these changes (Figure 3E and F). Thus, DDR2 promoted the proliferation and oxaliplatin resistance of HCC cells via STAT3.Figure 3 DDR2 promoted the proliferation and oxaliplatin resistance of HCC cells via STAT3. (A) Stable control or shDDR2-transfected HCC cells were generated. Then lentivirus-packaged STAT3 plasmids were transfected into cell with DDR2 silencing. DDR2, STAT3, p-STAT3, Bcl2, and Bax proteins were examined. (B) Stably transfected Hepa1-6-OXA cells were subcutaneously injected into the right flanks of the C57BL/6J mice. Mice were treated with oxaliplatin (5 mg/kg, intraperitoneal, twice weekly). (C) Tumor size was monitored with a caliper and tumor growth curves were plotted. (D) Tumor weight was analyzed after sacrifice. (E, F) Representative images of immunohistochemical staining using Ki67 and TUNEL as markers of proliferation and apoptosis in the tumor tissues∗∗P < .01, ∗∗∗P < .001, ∗∗∗∗P < .0001.

STAT3 Promoted HCC by Increasing DDR2 Expression

To investigate the role of the STAT3/DDR2 loop in HCC, we established stable HCC cell lines transfected with either STAT3 or control vectors. Western blot analysis revealed a significant increase in STAT3 protein levels in cells transfected with STAT3 plasmids, as well as an increase in DDR2 expression (Figure 4A). Higher expression of the Bcl2 and lower expression of Bax were found in STAT3-overexpressing HCC cells. Then, shDDR2 lentivirus was transfected into cells with STAT3 overexpression, which was found to attenuate the expression of p-STAT3. It was also demonstrated that DDR2 knockdown eliminated the influence of STAT3 on the expression of Bcl2 and Bax. In vivo, the overexpression of STAT3 resulted in a significant increase in tumor weight compared with that in the control group (Figure 4B–D). Additionally, STAT3 increased Ki67 expression and decreased TUNEL staining, suggesting a promoting effect of STAT3 on HCC proliferation (Figure 4E and F). However, DDR2 knockdown eliminated the influence of STAT3 on tumor growth. Therefore, STAT3 promoted HCC progression and oxaliplatin resistance by regulating DDR2 expression.Figure 4 STAT3 promoted HCC by increasing DDR2 expression. (A) Stable control or lentivirus-packaged STAT3 plasmid transfected HCC cells were constructed. Then, lentivirus-packaged DDR2 shRNA was transfected into STAT3- expressing cells. DDR2, STAT3, p-STAT3, Bcl2, and Bax proteins were examined. (B) Stably transfected Hepa1-6-OXA cells were subcutaneously injected into the right flanks of the C57BL/6J mice. Mice were treated with oxaliplatin (5 mg/kg, intraperitoneal, twice weekly). (C) Tumor size was monitored with a caliper and tumor growth curves were plotted. (D) Tumor weight was analyzed after sacrifice. (E, F) Representative images of immunohistochemical staining using Ki67 and TUNEL as markers of proliferation and apoptosis in the tumor tissues. ∗∗∗P < .001.

DDR2/STAT3 Regulated the Expression of PD-L1 and CD155 in HCC

STAT3, a crucial transcription factor, can regulate downstream genes by directly activating gene transcription.20 Consequently, we speculated that STAT3 may directly control the transcription of the PD-L1 and CD155 genes. In our prior study, we observed abnormally increased PD-L1 expression in oxaliplatin-resistant HCC cells.18 In the current study, increased CD155 expression was also detected in oxaliplatin-resistant HCC cells (Figure 5A and B). CD155, referred to as the poliovirus receptor, is considered one of the ligands that interacts with TIGIT. CD155/TIGIT can promote immune escape in a variety of tumors. After STAT3 knockdown, both the mRNA and protein levels of PD-L1 and CD155 were all significantly decreased (Figure 5C and D). Furthermore, the percentages of GranB+CD8+ T cells were elevated following cocultivation with oxaliplatin-resistant HCC cells in which STAT3 was knocked down (Figure 5E). In addition, our findings showed that the downregulation of DDR2/STAT3 increased the susceptibility of oxaliplatin-resistant HCC cells to T cell–mediated cytotoxicity (Figure 5F). To better show the involvement of DDR2/STAT3 in the overexpression of PD-L1 and CD155, DDR2 was knocked down in oxaliplatin-resistant cells. When DDR2 was knocked down in oxaliplatin-resistant cells, PD-L1 and CD155 expression was significantly reduced, and further rescue experiments revealed that STAT3 overexpression restored PD-L1 and CD155 expression (Figure 5G and H). In a previous study, it had been reported that STAT3 can directly bind to the PD-L1 promoter.21 Here, we investigated the binding site between STAT3 and the CD155 promoter. First, we utilized the Jaspar and PROMO databases to predict possible transcription factor-binding sites. Luciferase reporting tests were then performed to confirm this hypothesis. The STAT3-expressing plasmid was simultaneously transfected with the WT CD155 (–1798 to +187 bp)/Luc promoter or the mutant CD155 (–1798 to +187 bp)/Luc promoter. Our findings indicated that while STAT3 overexpression boosted the activity of the WT CD155 reporter gene, it did not enhance the activity of the mutant CD155 promoter (Figure 5I). This indicated that STAT3 can directly bind to the CD155 promoter and enhance the transcription of CD155.Figure 5 DDR2/STAT3 regulated the expression of PD-L1 and CD155 in HCC. (A, B) The expression of PD-L1 and CD155 in HCC cells and oxaliplatin-resistant HCC cells. (C, D) The expression of PD-L1 and CD155 was detected in oxaliplatin-resistant HCC cells transfected with scramble lentivirus or lentiviral vectors with shRNA targeting STAT3. (E) Flow cytometry analysis of the percentages of GranB+CD8+ T cells after cocultured with oxaliplatin-resistant HCC cells. (F) T cell–mediated tumor-killing array. The number of living HCC cells was measured by a CCK-8 array. (G, H) The mRNA and protein expression levels of PD-L1 and CD155 in the indicated groups. (I) Dual luciferase reporter assay to analyze the activity of the WT and mutant CD155 (–1798 to +187 bp)/Luc promoter constructs in HEK-293 cells (n = 3). ∗P < .05, ∗∗P < .01, ∗∗∗P < .001, ∗∗∗∗P < .0001.

DDR2/STAT3 Regulated CCL20 Secretion

Migration of myeloid-derived suppressor cells (MDSCs) is regulated by a variety of chemokines. After the knockdown of STAT3, the ability of the supernatant to promote the chemotaxis of MDSCs significantly decreased. To reveal the specific factors involved in STAT3-induced PMN-MDSC recruitment, we used an enzyme-linked immunosorbent assay (ELISA) array to measure the expression of a group of cytokines in the supernatant of both Hepa1-6-OXA-control and Hepa1-6-OXA-shSTAT3 cells. Among all the factors examined, CCL20 exhibited the most pronounced alterations compared with other factors regulated by STAT3 (Figure 6A). In fact, high CCL20 expression was linked to inferior overall survival in HCC patients (Figure 6B). qPCR and ELISA confirmed that CCL20 was induced and regulated by DDR2/STAT3 in oxaliplatin-resistant HCC cells (Figure 6C–E). Luciferase reporter assays were then performed to confirm the direct regulatory relationship between STAT3 and CCL20. The results showed that STAT3 can directly interact with the CCL20 promoter and promote CCL20 expression (Figure 6F). In addition, we explored the influence of CCL20 on the chemotactic ability of PMN-MDSCs via a transwell array. After DDR2/STAT3 knockdown or treatment with a CCL20 neutralizing antibody, the chemotactic ability of MDSCs in the supernatant was significantly weakened (Figure 6G and H). Notably, we revealed for the first time that HCC-derived CCL20 played a key role in the mobilization of PMN-MDSCs.Figure 6 DDR2/STAT3 regulated CCL20 secretion. (A) ELISA array was performed to identify STAT3-regulated chemokines. CCL20 was one of the most dramatically changed chemokines. (B) Overall survival of HCC patients with high CCL20 and low CCL20 expression in the TCGA dataset. (C) CCL20 mRNA levels were examined in HCC cells and oxaliplatin-resistant HCC cells. (D) CCL20 mRNA expression was detected in oxaliplatin-resistant HCC cells transfected with scramble lentivirus or with shRNA targeting STAT3 or DDR2. (E) CCL20 protein levels in conditioned media from HCC cells were measured by ELISA. (F) Dual luciferase reporter assay to analyze the activity of the WT and mutant CCL20 (–1915 to +63 bp)/Luc promoter constructs in HEK-293 cells (n = 3). (G, H) MDSC migration assays were performed by using conditioned media from the indicated groups. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001, ∗∗∗∗P < .0001.

DDR2/STAT3 Signaling Drove PMN-MDSC Recruitment and Facilitated Oxaliplatin-Resistant HCC Progression In Vivo

C57BL/6 mice were injected with Hepa1-6-OXA cells. Following oxaliplatin treatment, the tumor growth and weight of the Hepa1-6-OXA control group were notably greater than those of the Hepa1-6-OXA-shDDR2 and Hepa1-6-OXA-shSTAT3 groups (Figure 7A–D). Increasing evidence suggests that MDSCs play a crucial role in mediating the immunosuppression of HCC. Flow cytometry analysis confirmed that knockdown of STAT3 in oxaliplatin-resistant HCC cells resulted in a decrease in PMN-MDSCs but an increase in CD8+ T cells in the tumor microenvironment. Further, in Hepa1-6-OXA-shSTAT3 tumors, the percentage of GranB+CD8+ T cells was elevated, while the percentages of CLTA4+CD8+ T cells, TIM3+CD8+T cells, and TIGIT+CD8+ T cells were reduced (Figure 7E). Consequently, DDR2/STAT3 silencing inhibited PMN-MDSC infiltration and enhanced CD8+ T cell–mediated antitumor immune responses in oxaliplatin-resistant HCC.Figure 7 DDR2/STAT3 signaling drove PMN-MDSC recruitment and facilitated oxaliplatin-resistant HCC progression. (A, C) Hepa1-6-OXA-control and Hepa1-6-OXA-DDR2 or Hepa1-6-OXA-shSTAT3 cells (5 × 106) were inoculated into mice subcutaneously in the right flank. Mice were treated with oxaliplatin (5 mg/kg, intraperitoneal, twice weekly). (B, D) Tumor size was monitored with a caliper and tumor growth curves were plotted. (E) The harvested tumors were dissociated and the percentages of different kinds of cells were determined. The representative CD11b+Ly6G+ PMN-MDSCs were significantly decreased, while the changes in CD11b+Ly6C+ monocytic-MDSCs (M-MDSCs) were not statistically significant. The frequency of CD3+CD8+ T cells was greater in the Hepa1-6-OXA-shSTAT3 group. The proportions of GranB, Perforin, CTLA4, TIM3, and TIGIT in CD8+ T cells are shown. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001. ns, not significant.

Blocking PMN-MDSCs With CCL20 Antibody Exerted Antitumor Effects on Oxaliplatin-Resistant HCC

Our study have shown that the DDR2/STAT3 pathway induced the recruitment of PMN-MDSCs and inhibited CD8+ T cell–mediated antitumor immunity. In addition, CCL20 antibody was shown to inhibit PMN-MDSC migration in vitro. We further used the CCL20 antibody for in vivo studies. Hepa1-6-OXA-control and Hepa1-6-OXA-DDR2 or Hepa1-6-OXA-STAT3 cells were injected into C57BL/6J mice, and CCL20 antibody or isotype control was intratumorally injected once every 2 days. The findings indicated that the CCL20 antibody effectively suppressed the growth of Hepa1-6-OXA-control, Hepa1-6-OXA-DDR2, and Hepa1-6-OXA-STAT3 tumors (Figure 8A–D). In addition, we noted a significant decrease in the frequency of PMN-MDSCs in the group upon administration of the anti-CCL20 antibody. However, there was no impact on monocytic-MDSCs (M-MDSCs) infiltration. Additionally, CCL20 antibody administration led to a notable increase in the percentage of CD8+ T cells in tumor-bearing mice (Figure 8E).Figure 8 Blocking PMN-MDSCs with CCL20 antibody exerted antitumor effects on oxaliplatin-resistant HCC. (A, C) Hepa1-6-OXA cells were inoculated into mice subcutaneously in the right flank and treated with anti-CCL20 antibody (50 μg/mouse) or phosphate-buffered saline every 3 days from day 6. Mice were treated with oxaliplatin (5 mg/kg, intraperitoneal, twice weekly). (B, D) Tumor size was monitored with a caliper and tumor growth curves were plotted. (E) The frequency of CD8+ T cells was greater in the group treated with CCL20 antibody. The number of representative PMN-MDSCs was significantly decreased after treated with CCL20 antibody, while the difference in the number of monocytic-MDSCs (M-MDSCs) was not statistically significant. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001. ns, not significant.

CCL20 Blockade Enhanced the Antitumor Effect of anti-PD-L1 Treatment in Oxaliplatin-Resistant HCC

Our research had demonstrated that the CCL20 antibody inhibited the chemotaxis of PMN-MDSCs in vitro, and oxaliplatin-resistant HCC cells also exhibited upregulated PD-L1, which impaired the effect of cytotoxic T cells. Hence, the subsequent step involved exploring the potential for synergistic enhancement of the antitumor immune response through combined PD-L1 blockade and CCL20 antibody treatment. Mice were inoculated with Hepa1-6-OXA cells or Hepa1-6-STAT3 cells and then were administered either the PD-L1 antibody alone or in combination with the CCL20 antibody. Although the PD-L1 antibody alone slowed the progression of HCC, the antitumor impact was more pronounced in mice treated with both antibodies (Figure 9A–D). The combination of anti-PD-L1 and anti-CCL20 significantly reduced the infiltration of PMN-MDSCs and increased the frequency of CD8+ T cells (Figure 9E). Furthermore, mice treated with combined anti-PD-L1 and anti-CCL20 antibodies exhibited a significant increase in the proportion of GranB+CD8+ T cells and Perforin+CD8+ T cells and a decrease in the CTLA4+CD8+ T cells (Figure 9E).Figure 9 CCL20 blockade enhanced the antitumor effect of anti-PD-L1 treatment in oxaliplatin-resistant HCC. (A, C) Hepa1-6 and Hepa1-6-OXA cells were inoculated into mice subcutaneously in the right flank and treated with anti-PD-L1 (200 μg/mouse), anti-PD-L1 plus anti-CCL20 antibody (50 μg/mouse), or isotype control every 3 days from day 6. Mice were treated with oxaliplatin (5 mg/kg, intraperitoneal, twice weekly). (B, D) Tumor size was monitored with a caliper and tumor growth curves were plotted. (E) The proportions of PMN-MDSCs, M-MDSCs, CD8+ T cells, GranB+CD8+ T cells, Perforin+CD8+ T cells, and CTLA4+CD8+ T cells are displayed. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001. ns, not significant.

The Overexpression of DDR2 Was Correlated With High Levels of PD-L1 in HCC and Indicated Poor Survival

Publicly available datasets and clinical samples were used to validate the relationships between DDR2, STAT3, PD-L1, and CD155 expression.. The findings demonstrated a positive correlation between DDR2 and STAT3, PD-L1, and CD155 (Figure 10A–C). Additionally, a positive correlation was found between DDR2 and PD-L1 protein expression in clinical samples (Figure 10D and E). Notably, among HCC patients, those with elevated DDR2 expression exhibited a worse prognosis (Figure 10F).Figure 10 The overexpression of DDR2 correlated with high levels of PD-L1 in HCC and indicated poor survival. (A) Correlation analysis between DDR2 and CD274 (PD-L1) using gene expression data from The Cancer Genome Atlast dataset. (B) Correlation analysis between DDR2 and STAT3 expression. (C) Correlation analysis between DDR2 and poliovirus receptor (CD155). (D) Representative pictures of immunohistochemistry staining of DDR2 and PD-L1 in HCC tissues. (E) The associations between the H-scores of DDR and PD-L1 are shown for the 80 tissues. (F) Kaplan-Meier overall survival curves of patients with high DDR2 and low DDR2 expression.

Discussion

In recent decades, the treatment of HCC has attracted widespread attention. Oxaliplatin is a commonly used drug for patients with advanced HCC. It functions by forming intrastrand and interstrand DNA platinum adjuncts that inhibit gene transcription or trigger G2/M phase arrest.22 The prognosis of advanced HCC patients has considerably improved due to systemic treatments, including chemotherapy, molecular targeted therapy, and immunotherapy. However, systematic treatment of HCC remains a critical challenge. Chemotherapy is a crucial component in the management of advanced HCC, with over 60% of patients requiring transarterial chemoembolization or systemic chemotherapy.23,24 Due to the insurmountable drug resistance phenotype of HCC, further improving the efficacy of chemotherapy is difficult. New immunotherapy has emerged as a breakthrough in the clinical management of advanced HCC. Immune checkpoint inhibitors, as exemplified by certain drugs, stimulate immune function to target and eliminate tumors by modulating the immune tolerance of the tumor.25,26 However, the mechanism of immune escape is complex, and the use of a single immune checkpoint may not yield satisfactory response rates. Thus, it is crucial to investigate the molecular mechanisms underlying chemotherapy resistance and immune escape, as well as to develop effective intervention strategies in the field of systematic HCC treatment. In this study, we revealed that the DDR2/STAT3 axis is key for regulating oxaliplatin resistance and immunosuppression in HCC. In order to achieve long-term survival, oxaliplatin-resistant cells overexpressed immunosuppression checkpoints such as PD-L1 and CD155 through a DDR2/STAT3 positive feedback loop, preventing CD8+ T cell–mediated immune killing. What’s more, oxaliplatin-resistant cells secrete the chemokine CCL20, which recruits MDSCs into the tumor microenvironment, thereby establishing an immune-tolerant environment.

Current investigations have revealed the involvement of DDR2 in driving tumorigenesis and metastasis.27,28 In HCC, DDR2 enhances cell motility and epithelial–mesenchymal transition via activation of the ERK2/Snail1 pathway.15 In this study, we observed that DDR2 silencing markedly attenuated cell viability. A significant decrease in the IC50 value of oxaliplatin in both the parental nonresistant cells and oxaliplatin-resistant cells following DDR2 knockdown. In terms of the underlying mechanism, for the first time, we verified the relationship between DDR2 and STAT3.

STAT3 is a cytoplasmic transcription factor that belongs to a family of proteins activated by tyrosine kinases. It plays a critical role in cell proliferation, differentiation, angiogenesis, and apoptosis.29,30 Diverse human malignancies exhibit activated STAT3 signaling, which is linked to tumor progression and lymph node metastasis.31 In HCC, STAT3 functions as an oncogene, is predominantly expressed, and is responsible for propagating proliferative signaling. Janus kinases, SRC kinases, receptors with intrinsic tyrosine kinase activity, and extracellular cytokines are common activators of STAT3. As a tyrosine kinase, DDR2 promotes the phosphorylation of STAT3 signaling pathway components. Once activated by phosphorylation of STAT3, pSTAT3 dimerizes and is transferred to the nucleus, where it regulates gene transcription.32 Here, we also demonstrated that DDR2 is a downstream target gene of STAT3. STAT3 directly binds to the promoter of DDR2 and enhances DDR2 transcription. Further experiments verified that the suppression of DDR2 impeded the proliferation and oxaliplatin resistance of HCC via STAT3, while STAT3 promoted HCC by increasing DDR2 expression. Therefore, a DDR2/STAT3 positive feedback loop exists in HCC and is responsible for oxaliplatin resistance and tumor progression.

The tumor microenvironment generates molecules that establish a reciprocal STAT3 activation loop between tumor and stromal cells, which has suppressive impacts on various immune cells in the context of immune suppression in HCC.33, 34, 35, 36 In the tumor cells themselves, overactivation of STAT3 leads to the secretion of some chemokines such as CCL2, thus exerting multiple immune effects.37 MDSCs, a population of immature myeloid cells, undergo significant expansion and accumulation within the tumor microenvironment. They are widely acknowledged as the principal immune response regulators in cancer and other pathological conditions.38, 39, 40 In many cases, tumor progression is caused by immunosuppression due to MDSCs accumulation. In this study, we screened a variety of chemokines by ELISA and detected their differential expression in the control and STAT3-silenced cells. As a result, noticeable variations were observed in the expression levels of several factors including CCL20.

CCL20 has been found to be associated with malignancies in various cancers. It plays a role in antimicrobial activity and is implicated in diseases such as arthritis and psoriasis. CCL20 induced by hepatitis C virus was identified as a direct proangiogenic factor that acts on endothelial CCR6.41 The hepatitis C virus–induced CCL20 has been found to act as a direct proangiogenic factor targeting endothelial CCR6, indicating that the CCL20/CCR6 axis plays a crucial role in hepatic angiogenesis and contributes to the hypervascular state characteristic of HCC. CCL20 expression was observed to be positively correlated with CCR6 levels in HCC tissues. Inhibiting CCL20 activity could significantly reduce tumor incidence and suppressed both tumor outgrowth and distant metastasis.42 Importantly, CCL20 is involved in recruiting regulatory T, T helper 17, and T helper 22 cells, which contribute to sustaining an immunosuppressive microenvironment that indirectly supports the progression of cancer.43 In melanomas, the stromal level of CCL20 has been proposed to be valuable for evaluating patient risk and guiding treatment choices.44 In this study, we showed that CCL20 could regulate PMN-MDSCs migration both in vitro and in vivo. Neutralizing CCL20 significantly reduced the recruitment of MDSCs. Moreover, the cytotoxic function of T cells was partially restored, accompanied by an elevation in the proportion of GranB+CD8+ T cells and Perforin+CD8+ T cells. These results provide further evidence supporting the potential of CCL20 as a novel target for HCC treatment.

PD-L1 can lead to T cell exhaustion and immune tolerance and is considered to be a key factor in promoting tumor immune evasion.45,46 Within the tumor microenvironment, the effect of immune cytotoxic cells is downregulated by modulating PD-L1 expression. Clinical data revealed a positive correlation between DDR2 and PD-L1 expression. Here, we demonstrated that DDR2/STAT3 was responsible for PD-L1 upregulation in oxaliplatin-resistant HCC cells. Subsequent experiments confirmed that inhibiting DDR2/STAT3 could alter the immunosuppressive microenvironment and boost the killing function of CD8+ T cells. Moreover, the combination of the CCL20 antibody and PD-L1 antibody had a more pronounced beneficial effect than the PD-L1 monoclonal antibody alone. Thus, the CCL20 antibody might enhance the immune effect of the PD-L1 antibody.

In summary, the DDR2/STAT3 positive feedback loop mediated the oxaliplatin resistance in HCC via CCL20 and PD-L1 signaling. Blocking CCL20 inhibited tumor progression and enhanced sensitivity to oxaliplatin in HCC. Combining CCL20 blockade with anti-PD-L1 treatment showed promising therapeutic effects. Hence, therapeutic interventions aimed at the DDR2/STAT3 axis could represent an effective strategy for HCC.

Materials and Methods

Cell Lines

The HCC cell lines Hep3B, MHCC97H, and Hepa1-6 were acquired from the Liver Cancer Institute of Zhongshan Hospital. After 3 months of exposure to oxaliplatin, the oxaliplatin-resistant strains were established. The cells were cultured in appropriate medium (Minimum Eagle Medium or Dulbecco’s Modified Eagle Medium) supplemented with 10% fetal bovine serum (Gibco) under humidified conditions with 5% CO2 at 37.0 °C.

Cell Viability Assay

First, the cells were placed in 96-well plates (3 × 103 cells/well). After a 12-hour incubation period, oxaliplatin was applied at different concentrations for 48 hours. Then, 10 μL of CCK-8 reagent (Yeasen) was added and incubated at 37 °C for 2 hours. The optical density was read at 450 nm on a microplate reader (Bio-Rad).

Lentiviral Vector Preparation and Transfection

Stable gene knockdown or overexpression cell lines were generated using lentiviral plasmid vectors. shRNA targeted DDR2 (human: GCAACAACATGTTTGCTAAAG; mouse: GCATGTCAGGAGGCCACATTC) and STAT3 (human: CATCTGCCTAGATCGGCTA; mouse: GGTATAACATGCTGACCAATA), and were designed. Hep3B-OXA-control, MHCC97H-OXA-control, and Hepa1-6-OXA-control cells were generated by transfection with a scrambled sequence (TTCTCCGAACGTGTCACGT). All cells were treated with culture medium containing 6 μg/mL puromycin or blasticidin for 48 hours.

Real-Time qPCR

RNA was isolated using TRIzol reagent (Invitrogen) and transcribed to complementary DNA following the manufacturer’s instructions (Thermo Fisher Scientific). Real-time qPCR was carried out using SYBR Green Master Mix (eBioscience) and the PCR amplifier (Bio-Rad). The sequences of primer used are provided in Table 1.Table 1 The Primer Sequences for the Study

Gene	Primer sequence (5’ → 3’)	
β-actin (human)	Forward	GACTACCTCATGAAGATCCTCACC	
Reverse	TCTCCTTAATGTCACGCACGATT	
DDR2 (human)	Forward	GCTATATGCCGCTATCCTCTGG	
Reverse	ACTCTGACCACTGACTGGAAG	
STAT3 (human)	Forward	CAGCAGCTTGACACACGGTA	
Reverse	AAACACCAAAGTGGCATGTGA	
PD-L1 (human)	Forward	GCTGCACTAATTGTCTATTGGGA	
Reverse	AATTCGCTTGTAGTCGGCACC	
PVR (human)	Forward	GATGTTCGGGTTGCGCGTA	
Reverse	GGCTCGTATTGGGCATCCC	
CCL20 (human)	Forward	TGCTGTACCAAGAGTTTGCTC	
Reverse	CGCACACAGACAACTTTTTCTTT	
β-actin (mouse)	Forward	ATCTGGCACCACACCTTCTACAATG	
Reverse	CACGCTCGGTCAGGATCTTCATG	
DDR2 (mouse)	Forward	ATGATCCCGATTCCCAGAATGC	
Reverse	CATATTTGGCAGCCGTGGATT	
STAT3 (mouse)	Forward	AGGAGTCTAACAACGGCAGCCT	
Reverse	GTGGTACACCTCAGTCTCGAAG	
PD-L1 (mouse)	Forward	GCTCCAAAGGACTTGTACGTG	
Reverse	TGATCTGAAGGGCAGCATTTC	
PVR (mouse)	Forward	GGGTGGGGATATACGTGTGC	
Reverse	GAGATGCGTTCCTCAGATCCT	
CCL20 (mouse)	Forward	ACTGTTGCCTCTCGTACATACA	
Reverse	GAGGAGGTTCACAGCCCTTTT	
PVR, poliovirus receptor.

RNA Sequencing

Total RNA was isolated from MHCC97H and MHCC97H-OXA cells. The RNA was utilized for the preparation of the cDNA library with the NEBNext Ultra RNA Library Prep Kit for Illumina (ENB). The index-coded samples were clustered using the HiSeq Rapid PE Cluster Kit V2 (Illumina). After cluster generation, the libraries were subjected to sequencing (2 × 150 bp) on the HiSeq 3000 platform.

Western Blot

The cells were lysed in ice-cold lysis buffer for 30 minutes and then centrifuged at 12,000 g for 30 minutes. The protein samples were separated using sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride membranes (Millipore). The sections were incubated with primary antibodies overnight at 4 °C. Subsequently, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit or mouse IgG; Beyotime) for 1 hour at room temperature. The antibodies utilized were anti-DDR2, anti-β-actin, anti-STAT3, anti-p-STAT3, anti-Bcl2, anti-Bax, anti-CD155, and anti-PD-L1, which were all purchased from Abcam and Cell Signaling Technology.

Enzyme-Linked Immunosorbent Assay

The cell culture supernatants were gathered, centrifuged for 10 minutes at 250 g and kept at −20 °C. The concentrations of different cytokines were determined with their commercial ELISA kits (R&D Systems) according to the manufacturers’ protocols.

Immunohistochemistry

Immunohistochemical staining was carried out utilizing the avidin-biotin-peroxidase complex method. Antibodies targeting Ki67 and DAB (Abcam) were employed.

Flow Cytometry

The tumor tissue was sliced into fragments and digested with collagenase IV for 1 hour at 37 °C. The suspended cells were first blocked with Fc antibody first and subsequently stained with specific antibodies. All the antibodies listed in Table 2 were purchased from BioLegend.Table 2 Antibodies Used for Flow Cytometry

Antibody	Clone	Company	
anti-CD45	30-F11	BioLegend	
anti-CD11b	M1/70	BD	
anti-Gr-1	RB6-8C5	BioLegend	
anti-CD8	53-6.7	eBioscience	
anti-Ly6C	HK1.4	BioLegend	
anti-Ly6G	1A8	BioLegend	
anti-CD3	145-2C11	eBioscience	
anti-CD4	RM4-5	eBioscience	
anti-Granzyme B	QA16A02	BioLegend	
anti-CTLA4	UC10-4B9	BioLegend	
anti-Perforin	S16009A	BioLegend	
anti-TIGIT	1G9	BioLegend	

MDSC Isolation by Magnetic Bead Cell Sorting

CD11b+Ly6G+ PMN-MDSCs were isolated with an MDSC isolation kit (Miltenyi Biotec). Following FcR blocking, the cells were stained with anti-Ly6G-biotin antibody and then labeled with antibiotin microbeads. The cell suspension was passed through an LS separation column, where the purified murine MDSCs were collected.

Transwell Migration Assay of MDSCs

Murine MDSCs migration ability was assessed using transwell polycarbonate-permeable supports (8.0 μm, Costar; Corning). PMN-MDSCs (1.5 × 106) were seeded in the upper chambers of the inserts, while conditioned media from Hepa1-6 cells were added to the lower chamber. The mouse CCL20 antibody (10 μg/mL; R&D Systems) was placed in the lower chamber. Following a 48-hour incubation period, the number of MDSCs present in the lower compartment was quantified.

T Cell–Mediated Tumor-Killing Assay

Human peripheral blood mononuclear cells were cultured in ImmunoCult-XF T cell Medium (Stemcell Technologies) with ImmunoCultTM CD3/CD28/CD2 T cell Activator (Stemcell Technologies) and recombinant human IL-2 protein (1000 U/mL; R&D Systems) for 1 week. After allowing HCC cells to adhere to the plates overnight, they were cocultured with activated T cells at a ratio of 1:3 for 2 days. Subsequently, the suspension cells were eliminated, and the viability of the cancer cells was assessed using a CCK-8 assay.

Clinical Tissue Samples

In this study, 80 HCC tissues were used. Prior to their inclusion, written informed consent was received from patients. The use of these tissues was conducted in compliance with the approved protocols by the Institutional Review Board of Zhongshan Hospital, Fudan University (B2022-164).

Animal Experiments

C57BL/6J mice (5–7 weeks old) were obtained from Shanghai JieSiJie Laboratory Animal Co., Ltd. A total of 5 × 106 Hepa1-6 cells were injected subcutaneously into the right flank of the mice. Seven days postimplantation, the tumor-bearing mice received intraperitoneal injections of 5 mg/kg oxaliplatin (Sigma-Aldrich) twice a week. Additionally, the mice were treated with an anti-PD-L1 antibody (200 μg, intraperitoneal, q3d; Bio X Cell) and an anti-CCL20 antibody (50 μg/mouse, intratumorally, q3d; R&D Systems), or an isotype control antibody (Bio X Cell).

Statistical Analysis

Statistical analyses were conducted utilizing SPSS version 22.0 software and GraphPad Prism 7 (GraphPad Software). The level of significance was set as ∗P < .05, ∗∗P < .01, ∗∗∗P < .001, ∗∗∗∗P < .0001, or not significant.

CRediT Authorship Contributions

Wenfeng Liu (Conceptualization: Lead; Data curation: Lead; Investigation: Lead; Methodology: Lead; Software: Lead; Writing – original draft: Lead)

Feng Zhang (Methodology: Equal; Software: Equal; Writing – review & editing: Equal)

Bing Quan (Data curation: Equal; Methodology: Equal; Project administration: Equal; Writing – review & editing: Equal)

Fan Yao (Project administration: Supporting; Validation: Equal)

Rongxin Chen (Formal analysis: Lead; Investigation: Equal)

Zhenggang Ren (Methodology: Supporting; Software: Supporting; Supervision: Equal; Validation: Equal)

Ling Dong (Funding acquisition: Equal; Supervision: Equal; Validation: Equal; Visualization: Equal)

Xin Yin (Funding acquisition: Lead; Supervision: Lead; Validation: Lead; Visualization: Lead)

Conflicts of Interest The authors disclose no conflicts.

Funding This study was supported by the 10.13039/501100001809 National Natural Science Foundation of China (grant no. 81972889 , 81972234 , and 82273027 ) and Exploratory Clinical Research Projects of National Clinical Research Center for Interventional Medicine (grant no. 2021-001 ).
==== Refs
References

1 Xia C. Dong X. Li H. Cancer statistics in China and United States, 2022: profiles, trends, and determinants Chin Med J (Engl) 135 2022 584 590 35143424
2 Du D. Liu C. Qin M. Metabolic dysregulation and emerging therapeutical targets for hepatocellular carcinoma Acta Pharm Sin B 12 2022 558 580 35256934
3 He R. Wang Z. Shi W. Exosomes in hepatocellular carcinoma microenvironment and their potential clinical application value Biomed. Pharmacother 138 2021 111529
4 Mehta N. Bhangui P. Yao F.Y. Liver Transplantation for Hepatocellular Carcinoma. Working Group Report from the ILTS Transplant Oncology Consensus Conference Transplantation 104 2020 1136 1142 32217938
5 Couri T. Pillai A. Goals and targets for personalized therapy for HCC Hepatol Int 13 2019 125 137 30600478
6 Llovet J.M. Montal R. Sia D. Molecular therapies and precision medicine for hepatocellular carcinoma Nat Rev Clin Oncol 15 2018 599 616 30061739
7 Faivre S. Rimassa L. Finn R.S. Molecular therapies for HCC: Looking outside the box J Hepatol 72 2020 342 352 31954496
8 Elkamhawy A. Lu Q. Nada H. The journey of DDR1 and DDR2 kinase inhibitors as rising stars in the fight against cancer Int J Mol Sci 22 2021 6535 34207360
9 Tu M.M. Lee F.Y.F. Jones R.T. Targeting DDR2 enhances tumor response to anti-PD-1 immunotherapy Sci Adv 5 2019 2437
10 Terai H. Tan L. Beauchamp E.M. Characterization of DDR2 inhibitors for the treatment of DDR2 mutated nonsmall cell lung cancer ACS Chem Biol 10 2015 2687 2696 26390252
11 Gonzalez M.E. Martin E.E. Anwar T. Mesenchymal stem cell-induced DDR2 mediates stromal-breast cancer interactions and metastasis growth Cell Rep 18 2017 1215 1228 28147276
12 Ren Zhang J. Zhang J. Increased expression of discoidin domain receptor 2 (DDR2): a novel independent prognostic marker of worse outcome in breast cancer patients Med Oncol 30 2013 397 23307244
13 Kim D. You E. Jeong J. DDR2 controls the epithelial-mesenchymal-transition-related gene expression via c-Myb acetylation upon matrix stiffening Sci Rep 7 2017 6847 28754957
14 Walsh L.A. Nawshad A. Medici D. Discoidin domain receptor 2 is a critical regulator of epithelial-mesenchymal transition Matrix Biol 30 2011 243 247 21477649
15 Xie B. Lin W. Ye J. DDR2 facilitates hepatocellular carcinoma invasion and metastasis via activating ERK signaling and stabilizing SNAIL1 J Exp Clin Cancer Res 34 2015 101 26362312
16 Zhang K. Corsa C.A. Ponik S.M. The collagen receptor discoidin domain receptor 2 stabilizes SNAIL1 to facilitate breast cancer metastasis Nat Cell Biol 15 2013 677 687 23644467
17 Jinushi M. Immune regulation of therapy-resistant niches: emerging targets for improving anticancer drug responses Cancer Metastasis Rev 33 2014 737 745 24756203
18 Zhang F. Hu K. Liu W. Oxaliplatin-resistant hepatocellular carcinoma drives immune evasion through PD-L1 up-regulation and PMN-singular recruitment Cell Mol Gastroenterol Hepatol 15 3 2023 573 591 36513250
19 Yu H. Lee H. Herrmann A. Revisiting STAT3 signalling in cancer: new and unexpected biological functions Nat Rev Cancer 14 2014 736 746 25342631
20 Parri E. Kuusanmäki H. van Adrichem A.J. Identification of novel regulators of STAT3 activity PLoS One 15 3 2020 e0230819
21 Song T.L. Nairismägi M.L. Laurensia Y. Oncogenic activation of the STAT3 pathway drives PD-L1 expression in natural killer/T-cell lymphoma Blood 132 11 2018 1146 1158 30054295
22 Tentori L. Muzi A. Dorio A.S. MSH3 expression does not influence the sensitivity of colon cancer HCT116 cell line to oxaliplatin and pol y(ADP-ribose) polymerase (PARP) inhibitor as monotherapy or in combination Cancer Chemother Pharmacol 72 2013 117 125 23636450
23 Raoul J.L. Forner A. Bolondi L. Updated use of TACE for hepatocellular carcinoma treatment: How and when to use it based on clinical evidence Cancer Treat Rev 72 2019 28 36 30447470
24 Sonbol M.B. Riaz I.B. Naqvi S.A.A. Systemic therapy and sequencing options in advanced hepatocellular carcinoma: A systematic review and network meta-analysis JAMA Oncol 6 2020 e204930
25 Cheng A.L. Hsu C. Chan S.L. Challenges of combination therapy with immune checkpoint inhibitors for hepatocellular carcinoma J Hepatol 72 2020 307 319 31954494
26 Harkus U. Wankell M. Palamuthusingam P. Immune checkpoint inhibitors in HCC: Cellular, molecular and systemic data Semin Cancer Biol 86 2022 799 815 35065242
27 Park J.W. Lee Y.S. Kim J.S. Downregulation of discoidin domain receptor 2 decreases tumor growth of hepatocellular carcinoma J. Cancer Res Clin Oncol 141 2015 1973 1983 25842034
28 Lee N.O. Park J.W. Lee J.A. Dual action of a selective cyclooxygenase-2 inhibitor on vascular endothelial growth factor expression in human hepatocellular carcinoma cells: novel involvement of discoidin domain receptor 2 J Cancer Res Clin Oncol 138 2012 73 84 22009181
29 Verhoeven Y. Tilborghs S. Jacobs J. The potential and controversy of targeting STAT family members in cancer Semin Cancer Biol 60 2020 41 56 31605750
30 Mohassab A.M. Hassan H.A. Abdelhamid D. STAT3 transcription factor as target for anti-cancer therapy Pharmacol Rep 72 2020 1101 1124 32880101
31 Yang L. Lin S. Xu L. Novel activators and small-molecule inhibitors of STAT3 in cancer Cytokine Growth Factor Rev 49 2019 10 22 31677966
32 Hu C. Wu Z. Huang Z. Nox2 impairs VEGF-A-induced angiogenesis in placenta via mitochondrial ROS-STAT3 pathway Redox Biol 45 2021 102051
33 Cheng J.T. Deng Y.N. Yi H.M. Hepatic carcinoma-associated fibroblasts induce IDO-producing regulatory dendritic cells through IL-6-mediated STAT3 activation Oncogenesis 5 2016 e198
34 Yin Z. Ma T. Lin Y. IL-6/STAT3 pathway intermediates M1/M2 macrophage polarization during the development of hepatocellular carcinoma J Cell Biochem 119 2018 9419 9432 30015355
35 Deng Y. Cheng J. Fu B. Hepatic carcinoma-associated fibroblasts enhance immune suppression by facilitating the generation of myeloid-derived suppressor cells Oncogene 36 2017 1090 1101 27593937
36 Sun X. Sui Q. Zhang C. Targeting blockage of STAT3 in hepatocellular carcinoma cells augments NK cell functions via reverse hepatocellular carcinoma-induced immune suppression Mol Cancer Ther 12 2013 2885 2896 24107450
37 Yang X. Lin Y. Shi Y. FAP promotes immunosuppression by cancer-associated fibroblasts in the tumor microenvironment via STAT3-CCL2 Signaling Cancer Res 76 2016 4124 4135 27216177
38 Hegde S. Leader A.M. Merad M. MDSC: Markers, development, states, and unaddressed complexity Immunity 54 2021 875 884 33979585
39 Grover A. Sanseviero E. Timosenko E. Myeloid-derived suppressor cells: A propitious road to clinic Cancer Discov 11 2021 2693 2706 34635571
40 Wan S. Kuo N. Kryczek I. Myeloid cells in hepatocellular carcinoma Hepatology 62 2015 1304 1312 25914264
41 Benkheil M. Van Haele M. Roskams T. CCL20, a direct-acting pro-angiogenic chemokine induced by hepatitis C virus (HCV): Potential role in HCV-related liver cancer Exp Cell Res 372 2018 168 177 (2018) 30287142
42 Du D. Liu Y. Qian H. The effects of the CCR6/CCL20 biological axis on the invasion and metastasis of hepatocellular carcinoma Int J Mol Sci 15 2014 6441 6452 24743888
43 Suthen S. Lim C.J. Nguyen P.H.D. Hypoxia-driven immunosuppression by Treg and type-2 conventional dendritic cells in HCC Hepatology 76 2022 1329 1344 35184329
44 Samaniego R. Gutiérrez-González A. Gutiérrez-Seijo A. CCL20 expression by tumor-associated macrophages predicts progression of human primary cutaneous melanoma Cancer Immunol Res 6 2018 267 275 29362221
45 Kim J.M. Chen D.S. Immune escape to PD-L1/PD-1 blockade: seven steps to success (or failure) Ann Oncol 27 2016 1492 1504 27207108
46 Chen D.S. Mellman I. Elements of cancer immunity and the cancer-immune set point Nature 541 2017 321 330 28102259
