
==== Front
Skin Res Technol
Skin Res Technol
10.1111/(ISSN)1600-0846
SRT
Skin Research and Technology
0909-752X
1600-0846
John Wiley and Sons Inc. Hoboken

39252568
10.1111/srt.13921
SRT13921
Original Article
Original Article
Proanthocyanidins alleviate Henoch‐Schönlein purpura by mitigating inflammation and oxidative stress through regulation of the TLR4/MyD88/NF‐κB pathway
LI et al.
Li Xiaolong 1 2
Wang Meng 1
Pan Shihong 1
Xian Li 3
Zhang Shuyi 4
Xian Dehai 5 xdh969@163.com

Zhong Jianqiao 1 zjq7632@hotmail.com

1 Department of Dermatology The Affiliated Hospital of Southwest Medical University Luzhou China
2 Department of Dermatology Longchang People's Hospital Neijiang China
3 Department of Emergency The Affiliated Hospital of Southwest Medical University Luzhou China
4 Southwest Medical University Luzhou China
5 Department of Anatomy, School of Basic Medical Sciences Southwest Medical University Luzhou China
* Correspondence
Dehai Xian, Department of Anatomy, School of Basic Medical Sciences, Southwest Medical University, Luzhou, 646000, China.
Email: xdh969@163.com
Jianqiao Zhong, Department of Dermatology, The Affiliated Hospital of Southwest Medical University, Luzhou, 646000, China.
Email: zjq7632@hotmail.com

10 9 2024
9 2024
30 9 10.1111/srt.v30.9 e1392106 3 2024
17 6 2024
© 2024 The Author(s). Skin Research and Technology published by John Wiley & Sons Ltd.
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc-nd/4.0/ License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.

Abstract

Objective

Investigate Proanthocyanidins (PCs) efficacy and mechanisms in treating Henoch‐Schönlein purpura (HSP)‐like rat models, focusing on inflammatory and oxidative stress (OS) responses.

Methods

An HSP‐like rat model was established using ovalbumin (OVA) injection, leading to symptoms mimicking HSP. The study measured inflammatory markers (IL‐4, IL‐17, TNF‐α), OS markers (MDA, SOD, CAT), and assessed the TLR4/MyD88/NF‐κB signaling pathway's involvement via histopathological and immunofluorescence analyses.

Results

PCs treatment significantly improved HSP‐like symptoms, reduced inflammatory cell infiltration, and decreased IgA deposition in renal mesangial areas. Serum analyses revealed that PCs effectively lowered IL‐4, IL‐17, TNF‐α, and MDA levels while increasing SOD and CAT levels (p < 0.05). Crucially, PCs also downregulated TLR4, MyD88, and NF‐κB expressions, highlighting the blockage of the TLR4‐mediated signaling pathway as a key mechanism.

Conclusion

PCs show promising therapeutic effects in HSP‐like rats by mitigating inflammatory responses and oxidative damage, primarily through inhibiting the TLR4/MyD88/NF‐κB pathway. These findings suggest PCs as a potential treatment avenue for HSP, warranting further investigation.

Henoch‐Schönlein purpura
inflammatory response
oxidative stress
proanthocyanidins
TLR4‐mediated signaling pathway
Sichuan Provincial Cadres Health research project2020‐1501 School‐level Research of Southwest Medical University2023XGZX001 source-schema-version-number2.0
cover-dateSeptember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:10.09.2024
Li X , Wang M , Pan S , Xian L , Zhang S , Xian D , et al. Proanthocyanidins alleviate Henoch‐Schönlein purpura by mitigating inflammation and oxidative stress through regulation of the TLR4/MyD88/NF‐κB pathway. Skin Res Technol. 2024;30 :e13921. doi:10.1111/srt.13921 39252568

Xiaolong Li, Meng Wang, Shihong Pan, and Li Xian have contributed equally to this work and share first authorship.
==== Body
pmcAbbreviations

ANOVA analysis of variance

CAT catalase

ELISA enzyme‐linked immunosorbent assay

GSH‐Px glutathione peroxidase

HE hematoxylin‐eosin

HR hypersensitive reaction

HSP Henoch‐Schönlein purpura

IL interleukins

LTB4 leukotriene B4

MDA malondialdehyde

MyD88 myeloid differentiation factor 88

NF‐κB nuclear factor‐kappaB

NO nitric oxide

OCT optimum cutting temperature compound

OS oxidative stress

OVA ovalbumin

PCs proanthocyanidins

ROS reactive oxygen species

SD Sprague Dawley

SD standard deviation

SDS‐PAGE sodium dodecyl sulfate‐polyacrylamide gel electrophoresis

SOD superoxide dismutase

SPF specific pathogen‐free

TLRs toll‐like receptors

TNF‐α tumor necrosis factor‐alpha

WB Western blotting

1 INTRODUCTION

Henoch‐Schönlein purpura (HSP) is a type III hypersensitivity vasculitis mediated by IgA antibodies, characterized by cutaneous/mucosal purpura, frequently accompanied by arthritis, abdominal pain, and renal damage. It predominantly occurs in children, with an annual incidence of 1–2/10 000, varying by geographic region. 1 , 2 , 3 The disease is prone to recurrence and can lead to serious complications such as HSP nephritis, intussusception, and bowel infarction, significantly affecting the physical and mental health of patients. 4 , 5 , 6 , 7 Although systemic corticosteroids have become a treatment option for HSP, they can cause adverse effects such as osteoporosis, weight gain, and gastrointestinal discomfort. 8 Therefore, current treatment methods still require optimization. Although the pathogenesis of HSP remains unclear, it is essentially an inflammatory response occurring in small blood vessels and capillaries. In genetically susceptible individuals, triggers such as infections and allergens can induce vascular and surrounding tissue inflammation through various pathways, leading to the onset of HSP. Numerous studies have demonstrated that inflammatory responses and oxidative stress (OS) play significant roles in the pathogenesis of HSP, closely associated with the abnormal activation of Toll‐like receptors (TLRs), particularly TLR4. 9 , 10 TLRs are crucial proteins in innate immunity, recognizing a variety of endogenous and exogenous ligands, thereby initiating inflammatory responses and stimulating adaptive immune responses. Specifically, TLR4 and TLR2 are involved in immune‐inflammatory diseases by activating genes related to adaptive immunity. 11 Under pathogenic factors such as infections and allergens, TLRs can bind with the key adaptor molecule myeloid differentiation factor 88 (MyD88) and activate downstream signaling molecules like nuclear factor‐kappaB (NF‐κB). This activation of the TLR4/MyD88/NF‐κB inflammatory signaling pathway results in the production and release of various inflammatory cytokines, including tumor necrosis factor‐alpha (TNF‐α), interleukins (IL)−4, IL‐6, IL‐8, which attract neutrophils and other inflammatory cells, leading to local inflammation and the generation of large amounts of reactive oxygen species (ROS), thus activating OS. 12 Additionally, the activation of the TLR4/MyD88/NF‐κB signaling pathway can activate the complement system, causing abnormal activation/proliferation of Th2 cells and Th1/Th2 imbalance through various immune mechanisms. 13 , 14 Abnormally activated Th2 cells can secrete various inflammatory cytokines, such as IL‐4, IL‐6, IL‐17, IL‐21, TNF‐α, which further promote B cell proliferation and differentiation, resulting in the synthesis and secretion of antibodies like IgA, IgG, and IgM, leading to humoral immune imbalance. 15 , 16 Circulating immune complexes of IgA can bind to receptors on vascular endothelial cells, triggering the production of complement C3, chemokine IL‐8, and leukotriene B4 (LTB4), attracting neutrophils, inducing inflammatory responses, and damaging vascular endothelial cells. 17 Moreover, they can activate OS, leading to an abnormal increase in reactive oxygen/nitrogen species such as malondialdehyde (MDA) and nitric oxide (NO), and a decrease in antioxidant enzymes such as catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GSH‐Px), thereby promoting vascular endothelial cell damage. 15 , 18 Subsequently, a large number of neutrophils gather around the blood vessels, undergo respiratory burst, and produce large amounts of ROS, further activating OS, damaging endothelial cells, and exacerbating the inflammatory response. 18 The damage to endothelial cells further aggravates the deposition of neutrophils, IgA, and complement C3 in the vascular wall, forming a positive feedback loop. 19 The combined effect of these factors exacerbates endothelial cell damage and increases vascular permeability, ultimately leading to the histopathological changes and clinical symptoms/lesions associated with HSP. In summary, the inflammation and OS mediated by the TLR4/MyD88/NF‐κB pathway are key factors in the pathogenesis of HSP. Therefore, targeting this signaling pathway to counteract inflammation and OS offers new hope for the treatment of HSP.

Proanthocyanidins (PCs), derived from natural plants, exhibit diverse bioactivities, including anti‐inflammation, anti‐oxidation, immunomodulation. Currently, they have shown significant efficacy in treating various disorders such as inflammatory diseases, OS‐related diseases, tumors, and other conditions by inhibiting the TLR4‐mediated signaling pathway and mitigating inflammatory response/OS damage. 20 , 21 , 22 , 23 , 24 However, to date, there are few reports on the use of PCs in treating HSP.

Considering the HSP pathogenesis and the bioactive properties of PCs, we speculate that PCs could inhibit HSP through stopping inflammatory response and OS aggression by the block of TLR4‐mediated signaling pathway (e.g., TLR4/MyD88/NF‐κB pathway). The present study, therefore, was carried out to test this hypothesis by using an animal model of HSP.

2 MATERIALS AND METHODS

2.1 Animals and drugs

Four‐week‐old male Sprague Dawley (SD) rats (75–95 g) were obtained from the Center of Experimental Animals, Southwest Medical University, China.

PCs (powder, purity more than 95%) were purchased from Beijing Solarbio Science & Technology Co., Ltd, China.

2.2 Animal experiments

2.2.1 Establishment of HSP‐like rat model

Five male SD rats initially received an intraperitoneal injection of ovalbumin (OVA, Solarbio, CHN) emulsified solution (consisting of a 2% OVA solution [OVA diluted in normal saline] and Freund's complete adjuvant [Sigma‐Aldrich, USA] mixed in a 1:1 ratio) at a dose of 10 mg/kg once a week for 3 weeks. Subsequently, 0.25 mL of a 1% OVA solution was intravenously administered to their tail vein along with a 1 mL of 0.3% OVA solution intradermal injection into the back (5 injection points) to elicit hyper‐sensitive reaction (HR). As a control, quantity‐and sex‐matched rats were given an equal amount of normal saline according to above‐mentioned method. Visual changes in the rats' skin were observed and photographed. All rats were sacrificed within 24 h after the final injection. Skin and blood samples were collected for the determination of histopathological and inflammation/OS‐related parameters through hematoxylin‐eosin (HE) staining and enzyme‐linked immunosorbent assay (ELISA).

All rats were housed in the specific pathogen‐free (SPF) animal laboratory at 22–24°C with 60% humidity with a 12/12 h light/dark cycle. They were fed with standard rat chow and water ad libitum. To minimize their pain and discomfort, animals were operated on or sacrificed under anesthesia with an intraperitoneal injection of pentobarbital.

2.2.2 Administration of PCs on HSP‐like rat models

Drug preparation

PCs at low, medium, and high doses were calculated as the dose of 12.5, 25, and 37.5 mg/kg/d for each rat, respectively; the corresponding weight of PCs powder was measured and dissolved in 6 mL normal saline to prepare for the next experiment.

Grouping

Thirty male SD rats were randomly divided into six groups (n = 5): normal, model, negative control, low‐dose PCs, medium‐dose PCs, and high‐dose PCs groups.

PCs intervening HSP‐like rats

All rats, except those in the normal group, were injected with OVA to establish HSP‐like rat models by using the method described above. The day following HR induction, rats in the different‐dose PC groups were each given a corresponding dose of PC solution via intragastric administration, 3 mL each time, twice a day for 7 consecutive days; while those in negative control group intragastrically received equal amounts of normal saline, but none was assigned to the normal and model groups. On the 3rd and 6th day of PCs medication, an extra tail‐vein injection of 0.25 mL of 1% OVA solution was respectively given to rats except those in the normal group to maintain the HR state. Skin lesion changes were observed and documented daily through photography. Following 1‐week of intragastric administration of PCs, all rats were euthanized under anesthesia. Concurrently, blood, skin, and kidney samples were collected for subsequent analysis.

2.3 A serial of biomarkers detection

2.3.1 ELISA assay

ELISA kits for inflammatory cytokines in serum including interleukin (IL)−4, IL‐17, and tumor necrosis TNF‐α were provided by Beijing Andygene Biotechnology Co., Ltd (Beijing, China), while those kits for OS‐related indexes containing MDA, SOD, and CAT, were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). All parameters were determined using these kits according to the manufacturer's guidelines.

2.3.2 Histology analysis

Specimens from the skin and kidneys were fixed in 4% paraformaldehyde, embedded in paraffin, and cut into 5‐µm slices. Histological features of these sections were detected by HE staining and observed under a light microscope.

2.3.3 Immunofluorescence analysis

Renal samples were fixed with 4% paraformaldehyde, embedded in an optimum cutting temperature compound (OCT), frozen, and sliced into 40 µm serial sections. These slices were incubated with an anti‐IgA antibody (Abcam, UK), followed by the addition of a secondary antibody (goat anti‐rabbit IgG, Beyotime, CHN), and then observed under a fluorescence microscope.

2.3.4 Quantitative real‐time polymerase chain reaction (qRT‐PCR) analysis

Total RNA was extracted from skin specimens using TRI pure total RNA extraction reagent (ELK Biotechnology, CHN) following the manufacturer's instructions. The expression levels of target genes including TLR4, MyD88, and NF‐κB were determined relative to Gapdh (internal control). The primers are shown in Table 1.

TABLE 1 The primers of relevant genes.

Genes	Forward	Reverse	
GAPDH	5′‐GCCAAGGTCATCCATGACAAC‐3′	5′‐GTGGATGCAGGGATGATGTTC‐3′	
TLR4	5′‐CCCAATTGACTCCATTCAAGC‐3′	5′‐CCTGAACTCATCAATGCTCACAT‐3′	
MyD88	5′‐GGACTGCCAGAAATACATACGC‐3′	5′‐GTCTGTCTGTTCTAGTTGCCGG‐3′	
NF‐κB	5′‐TCTGCCGAGTAAACCGGAAC‐3′	5′‐CAGGCTAGGGTCAGCGTATG‐3′	
Note: Forward and reverse primer sequences for the relevant genes.

John Wiley & Sons, Ltd.

2.4 Western blotting (WB) analysis

Ground skin tissue was treated with lysis and protein loading buffers to extract total protein. The protein concentrations were then detected with BCA protein assay kit (Beyotime, CHN). Protein samples were subsequently transferred to polyvinylidene fluoride membranes (Millipore, USA) via sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE). The protein membranes were incubated overnight at 4°C with primary antibodies (i.e., anti‐TLR4, anti‐MyD88, and anti‐NF‐κB polyclonal antibodies, 1: 1000, Affinity Biosciences, USA), followed by the incubation with a secondary antibody (horseradish peroxidase‐conjugated goat anti‐rabbit IgG, 1: 5000, Beyotime, CHN). Ultimately, protein signals were detected and analyzed by an enhanced chemiluminescence system and image software (Bio‐Rad Laboratories, Inc, CA, USA). Anti‐GAPDH antibody was used as an internal reference protein.

2.5 Statistical analysis

Statistical analysis was performed using the SPSS 22.0 software (IBM Co., Armonk, NY, USA). Data were expressed as mean ± standard deviation (SD); differences between groups were assessed by t‐test and analysis of variance (ANOVA). p < 0.05 was considered statistically significant. GraphPad Prism 8.0 software was applied to analyze the data and plots.

3 RESULTS

3.1 Manifestations of typical HSP‐like rat models

After the OVA injection, typical purpura‐like lesions, for example petechiae and ecchymoses occurred on the tail skin of rats, accompanied by characteristic pathological alterations primarily comprising edema and vasodilation in the dermis, subcutaneous hemorrhage, and infiltration of inflammatory cells; however, above alterations rarely emerged in the control rats (Figure 1). Moreover, the levels of IL‐4, IL‐17, TNF‐α, and MDA in the serum increased significantly, while those of SOD and CAT decreased remarkably after OVA administration (p < 0.05) (Table 2).

FIGURE 1 Morphological and histopathological manifestations of HSP‐like rat. (A): Visual appearance of the tail skin. (B): Histopathological alterations of the tail skin, H&E (×200). A: rats treated with normal saline; B: rats treated with OVA.

TABLE 2 Serum levels of inflammatory/OS‐related parameters in HSP‐like rats.

	IL‐4 (ng/mL)	IL‐17 (ng/L)	TNF‐α (ng/L)	MDA (nmol/mL)	CAT (U/mL)	SOD (U/mL)	
A	9.35 ± 0.44	25.97 ± 0.52	21.14 ± 0.47	2.63 ± 0.96	2.71 ± 0.29	33.60 ± 1.47	
B	13.63 ± 0.56 *	30.71 ± 0.38 *	32.54 ± 1.35 *	8.51 ± 0.89 *	1.43 ± 0.25 *	22.08 ± 1.42 *	
Notes: Protein expression levels of inflammatory/OS‐related factors detected by ELISA.

A: rats treated with normal saline; B: rats treated with OVA.

Abbreviations: CAT, catalase; HSP, Henoch‐Schönlein purpura; MDA, malondialdehyde; OS, oxidative stress; SOD, superoxide dismutase.

* p < 0.05 compared with A.

John Wiley & Sons, Ltd.

3.2 PCs ameliorated cutaneous appearance and histopathology of HSP‐like rats

In the presence of PCs, purpura‐like lesions that is, petechiae and ecchymoses on rats in different‐dose PCs groups gradually vanished and completely disappeared by the end of intragastric administration. Conversely, these lesions existed in the model and negative control groups as before in PCs absence (Figure 2A). Histopathologically, rats in the different‐dose PCs groups displayed significant relief of dermal edema, subcutaneous hemorrhage, and infiltration of inflammatory cells; but few improvements appeared in both model and negative control groups (Figure 2B).

FIGURE 2 Visual and histopathological manifestations of skin in HSP‐like rats after PCs treatment. (A): Cutaneous appearance of HSP‐like rats in different groups. (B): Histopathological alterations of HSP‐like rats skin in different groups, H&E (×200). A: normal group; B: model group; C: negative control group; D: low‐dose PCs group; E: medium‐dose PCs group; F: high‐dose PCs group.

3.3 PCs mitigated renal impairments and IgA deposition of HSP‐like rats

Normal rats rarely appeared renal injury and immune complex deposition. However, after OVA induction, the kidneys of rats histopathologically exhibited mesangial cell/matrix hyperplasia, protein exudation, and scattered bleeding as seen in the model group(Figure 3A,B). PCs, however, reversed this phenomenon; that was, above alterations scarcely emerged from kidney after different‐dose PCs treatment, high‐dose PCs in particular (Figure 3A). Apart from that, granular complexes of IgA were positively deposited (+++) in the mesangial area in the model and negative control groups under immunofluorescence. In contrast, PCs, especially high‐dose PCs, effectively reduced IgA immune deposition to 0–+ (Figure 3B).

FIGURE 3 Histopathological and immunofluorescent alterations of kidney in HSP‐like rats after PCs treatment. (A): Renal Histopathology of HSP‐like rats in different groups, H&E (×200). (B): IgA immune deposition in HSP‐like rats kidney in different groups. A: normal group; B: model group; C: negative control group; D: low‐dose PCs group; E: medium‐dose PCs group; F: high‐dose PCs group.

3.4 PCs lowered the serum levels of inflammatory/OS‐related indicators in HSP‐like rats

To investigate the anti‐inflammatory and antioxidant bioactivities of PCs, serum parameters of inflammation and OS from rats in different groups were analyzed by ELISA assay. After OVA stimulation, a notable increase in IL‐4, IL‐17, TNF‐α, and MDA emerged from HSP‐like rat serum, along with an obvious decrease in SOD and CAT (p < 0.05). Different‐dose PCs treatment, however, remarkably down‐regulated the expression of IL‐4, IL‐17, TNF‐α, and MDA, and dramatically up‐regulated SOD and CAT activity (p < 0.05). Interestingly, the improvements of the above parameters seemed to be greater with PCs dose increasing, but the difference failed to reach statistical significance (p > 0.05). On the contrary, scarce amelioration appeared in rats with normal saline, that was, no significant difference existed between the negative control group and the model group (p > 0.05) (Table 3).

TABLE 3 Serum levels of inflammatory/OS‐related parameters in different groups.

	IL‐4 (ng/mL)	IL‐17 (ng/L)	TNF‐α (ng/L)	MDA (nmol/mL)	CAT (U/mL)	SOD (U/mL)	
Normal group	9.61 ± 0.35	22.84 ± 0.86	21.7 ± 0.68	3.09 ± 1.25	2.89 ± 0.23	32.93 ± 0.95	
Model group	14.22 ± 0.32 *	30.05 ± 0.82 *	34.22 ± 2.11 *	8.57 ± 3.44 *	1.57 ± 0.17 *	20.02 ± 0.81 *	
Negative control group	14.18 ± 0.22	29.95 ± 0.72	33.99 ± 1.70	8.46 ± 0.96	1.58 ± 0.14	20.21 ± 0.95	
Low‐dose PCs group	11.1 ± 0.16 ** , ***	26.19 ± 0.66 ** , ***	28.33 ± 0.59 ** , ***	4.4 ± 0.33 ** , ***	2.02 ± 0.13 ** , ***	28.18 ± 0.67 ** , ***	
Medium‐dose PCs group	11.23 ± 0.30 ** , ***	24.99 ± 0.32 ** , ***	24.69 ± 0.83 ** , ***	3.89 ± 0.56 ** , ***	2.22 ± 0.13 ** , ***	26.59 ± 0.67 ** , ***	
High‐dose PCs group	10.85 ± 0.49 ** , ***	25.07 ± 0.42 ** , ***	25.01 ± 0.52 ** , ***	3.31 ± 0.82 ** , ***	2.28 ± 0.07 ** , ***	26.02 ± 0.58 ** , ***	
Note: Protein expression levels of inflammatory/OS‐related factors in the serum of rats from different groups detected by ELISA.

Abbreviations: CAT, catalase; IL, interleukin; MDA, malondialdehyde; OS, oxidative stress; PCs, proanthocyanidins; SOD, superoxide dismutase; TNF‐α, tumor necrosis factor.

* p < 0.05, compared with the normal group.

** p < 0.05, compared with model groups.

*** p < 0.05, compared with the negative control group.

John Wiley & Sons, Ltd.

3.5 PCs down‐regulated the expressions of TLR4, MyD88, and NF‐κB in HSP‐like rats skin

To confirm the mechanism of PCs in managing HSP, the expressions of TLR4, MyD88, and NF‐κB in skin were investigated by qRT‐PCR and WB analysis. In normal rat skin, TLR4, MyD88, and NF‐κB expressions, regardless of genes or proteins, were extremely low. OVA stimulation, nevertheless, apparently heightened the mRNA and protein levels of these receptor/factors in skin tissues of the model group (p < 0.05). After the treatment of PCs, a great decline of TLR4, MyD88, and NF‐κB levels both gene and protein emerged from PCs groups in a dose‐dependent tendency (p < 0.05), the high‐dose PCs group in particular (p < 0.01). Conversely, the expression of above genes/proteins barely reduced in the negative control group compared with the model group (p > 0.05). (Figures 4 and 5).

FIGURE 4 Effect of PCs on the mRNA expressions of Tlr4, Myd88, and NF‐κB genes in the skin of HSP‐like rats. Notes: Compared with the normal group, # p < 0.05; compared with the model group, *p < 0.05; compared with the negative control group, & p < 0.05.

FIGURE 5 Effect of PCs on TLR4/MyD88/NF‐κB proteins in the skin of HSP‐like rats. Notes: Compared with the normal group, # p < 0.05; compared with the model group, *p < 0.05; compared with the negative control group, & p < 0.05.

4 DISCUSSION

In the current study, we reveal a promising strategy for HSP by which PCs do work well in HSP‐like rats. First, an HSP‐like rat model was successfully established. Then, we showed that PCs could ameliorate the cutaneous appearance and histopathology of HSP‐like rats, and mitigate renal impairments and IgA deposition. Moreover, the levels of inflammatory cytokines and OS‐related products were significantly reduced in the presence of PCs. Additionally, using qRT‐PCR and WB analysis, we verified that PCs significantly down‐regulated both gene and protein expressions of TLR4, MyD88, and NF‐κB in a dose‐dependent tendency. These findings demonstrate the capacity of PCs to treat HSP‐like symptoms by alleviating inflammatory response and OS damage via the block of TLR4/MyD88/NF‐κB signaling pathway.

Animal models always carry the research of disease mechanism and pharmaceutical development. Currently, there are some approaches to constructing animal models of HSP, but they are relatively few with a low success rate. Li et al. 25 once proposed a modeling method based on type III hypersensitivity, by which they successfully established an HSP‐like rat/rabbit model undergoing a total 6‐week modeling time with OVA after elimination of individual sensitivity differences with traditional Chinese medicine (containing ginger, long pepper, and pepper decoction). 26 , 27 However, the application of traditional Chinese medicine in the modeling process probably had a potential impact on the hepatic and renal function of animals, and it tended to take more time. Avoiding this interference, thus, the traditional Chinese medicine was not introduced in our study. Surprisingly, we found that typical purpura‐like lesions (i.e., petechiae and ecchymoses) appeared on the tail skin of rats after only about 3 weeks of OVA stimulation, conforming to the cutaneous lesions of HSP patients 7 , 28 ; histopathological alterations positively emerged from the skin and kidney, including dermal edema and vasodilation, subcutaneous hemorrhage and inflammatory cells infiltration, as well as hyperplasia of mesangial cells, protein exudation and scattered bleeding, which were similar to those of human HSP. 1 , 7 Moreover, the immunofluorescence showed a granular complex of IgA deposition in the mesangial region of the kidney, confirming the success of the model. In addition, rats with OVA alone had higher levels of inflammatory and OS parameters (e.g., IL‐4, IL‐17, TNF‐α, and MDA) than those with normal saline; these molecular changes were also consistent with those of HSP individuals. 29 Taken together, an improved HSP‐like rat model was successfully constructed with OVA alone. It not only simplified the modeling steps to save time and cost, but also had less injury on rats to protect animals in the maximum extent, therefore offering a base for the further experiment about HSP.

Following the successful establishment of HSP‐like rat model, it was critical to determine the safe therapeutic dose of PCs. Based on previous literature and our pilot experimental outcomes, the proper dose of PCs was safely set at 12.5, 25, and 37.5 mg/kg per day in the current study. 30 , 31 , 32 , 33 This range of dosages was considered to minimize the possibility of toxic side effects. Notably, HSP is a self‐limiting disease that sometimes gets better without treatment. To determine whether PCs work, therefore, all rats except the normal group were injected with OVA solution via tail‐vein on the third and sixth days of PCs treatment in order to maintain HR state. As expected, PCs, particularly high‐dose PCs, greatly mitigated the cutaneous appearance, skin/kidney histopathology and renal IgA deposition of HSP‐like rats. In contrast, rats in the model and negative control groups showed few improvements regardless of visual manifestation, histopathological alterations or IgA fluorescent intensity. These results coincided with those of He et al., who found that PCs ameliorated vascular inflammation, strengthened vascular endothelial function and reduced renal immune complex deposition. 34 The findings from the present study, thus, confirmed that PCs could remarkably alleviate the skin symptoms and kidney damage in HSP‐like rats, indicating the fine efficacy of PCs on the HSP‐like model rat and promising a cure for HSP. Nevertheless, how do PCs work? Next, the possible mechanisms of PCs on HSP will be investigated.

Numerous studies have shown that PCs are widely applied in various diseases owing to their powerful abilities of anti‐inflammation and antioxidation. 35 , 36 , 37 , 38 As vital contributors to HSP pathogenesis, inflammatory response and OS may be involved in the mechanism of PCs fighting HSP. In our experiment, it was found that OVA created increased expression of inflammatory and oxidative mediators (e.g., IL‐4, IL‐17, TNF‐α, and MDA), along with decreased antioxidants CAT and SOD. These outcomes implied that OVA application could evoke an HSP‐like inflammatory response and OS condition, which were consistent with Thakur et al. who discovered OVA induction of vasculitis through promoting inflammatory/OS factors release in rat. 39 However, PCs treatment reversed this condition. The levels of IL‐4, IL‐17, TNF‐α, and MDA significantly went down, while those of CAT and SOD greatly increased in the presence of PCs. A lot of this had to do with the anti‐inflammatory and antioxidant capacities of PCs, which was in agreement with the relevant reports. Li et al. 25 observed that PCs availably lowered the expression of IL‐17, TNF‐α, and MDA, and enhanced that of SOD and CAT to reduce the renal injury in diabetic nephropathy model rat. 40 , 41 As a result, our study suggests that PCs are potentially effective in controlling HSP‐like symptoms via inhibiting the inflammatory response and combating OS damage. The specific mechanism, however, need to be clarified further.

Increasing evidence indicates that TLR4‐mediated signaling pathway is central to the inflammation‐ and OS‐involved pathogenesis of HSP. 42 , 43 , 44 Chang et al. 45 discovered an obvious activation of TLRs pathway emerging from HSP patients, especially TLR4 [11]. Via MyD88‐dependent signaling pathways, TLRs could activate downstream signaling molecules, NF‐κB in particular, to arouse inflammatory response and OS state and induce IgA secretion and immune complexes deposition in the vascular wall, thereby triggering HSP occurrence. 46 Hence, the activation of TLR4/MyD88/NF‐κB pathway is possibly key to the pathogenesis of HSP. To elucidate the specific mechanism of PCs on HSP, we investigated the gene and protein expressions of TLR4, MyD88, and NF‐κB in HSP‐like rat skin. The present study showed the gene and protein ex‐pressions of TLR4, MyD88, and NF‐κB in model group were higher than those in nor‐mal group, which reconfirmed the importance of TLR4/MyD88/NF‐κB in HSP pathogenesis; whereas PCs greatly reduced the levels of above genes and proteins compared with model group. So, it indicated that TLR4/MyD88/NF‐κB signaling pathway would be the crucial target for PCs controlling OVA‐induced HSP. Similarly, it was found that grape‐derived PCs could protect vascular endothelial cells against inflammatory damage by suppressing NF‐κB signal transduction. 47 Kim et al. likewise verified that proanthocyanidin extract from grape seed remarkably attenuated the clinical severity and histological damage of collagen‐induced arthritis through inhibiting the TLR4/MyD88/NF‐κB signaling pathway. 23 Therefore, we reach a conclusion that the therapeutic effect of PCs on HSP‐like rats may be through blocking the TLR4/MyD88/NF‐κB signaling pathway, further reducing the release of inflammatory factors and regulating redox balance, ultimately mitigating inflammatory response and OS damage.

5 CONCLUSION

In summary, the current study demonstrates that PCs have a fine curative effect on HSP‐like symptoms involving skin and kidney, likely by attenuating inflammatory response and OS damage through the blockade of the TLR4/MyD88/NF‐κB signaling pathway. They potentially become a promising HSP treatment. Further studies, however, are needed to clarify the mechanisms of PCs on HSP, such as employing TLR4 and NF‐κB inhibitors in vitro experiments. Our findings illuminate a prospective therapy for HSP and offer a basis for mechanism research into the anti‐purpuric effects of PCs.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

ETHICS STATEMENT

The animal study protocol was approved by the Ethics Committee of the Animal Experiment Ethics Management Committee of Southwest Medical University (Approval No: 2020436) and was strictly performed following the Guide for the Care and Use of Laboratory Animals.

ACKNOWLEDGMENTS

This research was funded by Sichuan Provincial Cadres Health research project(grant number 2020‐1501),School‐level Research Program of Southwest Medical University. We would like to express our gratitude to Jixiang Xu for his help in this experiment. We also sincerely appreciate the Experimental Animal Center of Southwest Medical University and the Clinical Medical Research Center of Affiliated Hospital of Southwest Medical University for their support to our work.

DATA AVAILABILITY STATEMENT

Datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
==== Refs
REFERENCES

1 Pillebout E , Sunderkötter C . IgA vasculitis. Semin Immunopathol. 2021;43 (5 ):729‐738.34170395
2 Gómez S , Pérez M , Pellegrini M , et al. Henoch‐schonlein purpura in pediatrics: ten years of experience at a moderate risk office of a general hospital. Arch Argent Pediatr. 2020;118 (1 ):31‐37.31984693
3 Leung AKC , Barankin B , Leong KF . Henoch‐Schönlein purpura in children: an updated review. Curr Pediatr Rev. 2020;16 (4 ):265‐276.32384035
4 Kurt‐Şükür ED , Sekar T , Tullus K . Biopsy‐proven Henoch‐Schönlein purpura nephritis: a single center experience. Pediatr Nephrol. 2021;36 :1207‐1215.33089378
5 Hu R , Quan S , Wang Y , et al. Spectrum of biopsy proven renal diseases in central China: a 10‐year retrospective study based on 34,630 cases. Sci Rep. 2020;10 (1 ):10994.32620914
6 Fang X , Wu H , Lu M , et al. Urinary proteomics of Henoch‐Schönlein purpura nephritis in children using liquid chromatography‐tandem mass spectrometry. Clin Proteomics. 2020;17 (1 ):10.32190014
7 Hetland LE , Susrud KS , Lindahl KH , Bygum A . Henoch‐Schönlein purpura: a literature review. Acta Derm Venereol. 2017;97 (10 ):1160‐1166.28654132
8 Zhong X , Ding J . Diagnosis and treatment of IgA nephropathy and IgA vasculitis nephritis in Chinese children. Pediatr Nephrol. 2023;38 (6 ):1707‐1715.36348077
9 Xu H , Jiang G , Shen H , Li W , Mao J , Pan Y . Association of TLR4 gene polymorphisms with childhood Henoch‐Schönlein purpura in a Chinese population. Rheumatol Int. 2017;37 (11 ):1909‐1915.28905155
10 Niknam N , Ha L , Gautam‐Goyal P . Adult onset immunoglobulin A vasculitis (Henoch‐Schonlein purpura) with alveolar hemorrhage. IDCases. 2018;12 :47‐48.29942747
11 Saito A , Komatsuda A , Kaga H , et al. Different expression patterns of toll‐like receptor mRNAs in blood mononuclear cells of IgA nephropathy and IgA vasculitis with nephritis. Tohoku J Exp Med. 2016;240 (3 ):199‐208.27818460
12 Donadio ME , Loiacono E , Peruzzi L , et al. Toll‐like receptors, immunoproteasome and regulatory T cells in children with Henoch‐Schönlein purpura and primary IgA nephropathy. Pediatr Nephrol. 2014;29 (9 ):1545‐1551.24687448
13 Chang H , Zhang QY , Lin Y , Cheng N , Zhang SQ . Correlation of TLR2 and TLR4 expressions in peripheral blood mononuclear cells to Th1‐ and Th2‐type immune responses in children with Henoch‐Schönlein purpura. Int J Clin Exp Med. 2015;8 (8 ):13532‐13539.26550291
14 Chang H , Cao Y , Lin YI , et al. Association between toll‐like receptor 6 expression and auxiliary T cells in the peripheral blood of pediatric patients with allergic purpura. Exp Ther Med. 2015;10 (4 ):1536‐1540.26622521
15 Heineke MH , Ballering AV , Jamin A , Ben Mkaddem S , Monteiro RC , Van Egmond M . New insights in the pathogenesis of immunoglobulin A vasculitis (Henoch‐Schönlein purpura). Autoimmun Rev. 2017;16 (12 ):1246‐1253.29037908
16 Wu L , Yuan LP , Fei WJ , et al. [Impact of sera from children with active Henoch‐Schönlein purpura on human umbilical venous endothelial cells (HUVECs) and protective effects of methylprednisolone against HUVECs injury]. Zhongguo Dang Dai Er Ke Za Zhi. 2012;14 (1 ):59‐63.22289755
17 Yang YH , Tsai IJ , Chang CJ , Chuang YH , Hsu HY , Chiang BL . The interaction between circulating complement proteins and cutaneous microvascular endothelial cells in the development of childhood Henoch‐Schönlein Purpura. PLoS One. 2015;10 (3 ):e0120411.25760949
18 Omma A , Colak S , Can Sandikci S , et al. Serum neopterin and ischemia modified albumin levels are associated with the disease activity of adult immunoglobulin A vasculitis (Henoch‐Schönlein purpura). Int J Rheum Dis. 2019;22 (10 ):1920‐1925.31411385
19 Keskin N , Civilibal M , Elevli M , Koldas M , Duru NS , Ozturk H . Elevated plasma advanced oxidation protein products in children with Henoch‐Schonlein purpura. Pediatr Nephrol. 2011;26 (11 ):1989‐1993.21553322
20 Rauf A , Imran M , Abu‐Izneid T , et al. Proanthocyanidins: a comprehensive review. Biomed Pharmacother. 2019;116 :108999.31146109
21 Zeng Y‐X , Wang S , Wei L , Cui Y‐Y , Chen Y‐H . Proanthocyanidins: components, pharmacokinetics and biomedical properties. Am J Chin Med. 2020;48 (04 ):813‐869.32536248
22 Li S , Xu M , Niu Q , et al. Efficacy of procyanidins against in vivo cellular oxidative damage: a systematic review and meta‐analysis. PLoS One. 2015;10 (10 ):e0139455.26426531
23 Kim S‐H , Bang J , Son C‐N , Baek W‐K , Kim J‐M . Grape seed proanthocyanidin extract ameliorates murine autoimmune arthritis through regulation of TLR4/MyD88/NF‐κB signaling pathway. Korean J Intern Med. 2018;33 (3 ):612.27271273
24 Shang P , Tang Q , Hu Z , et al. Procyanidin B3 alleviates intervertebral disc degeneration via interaction with the TLR4/MD‐2 complex. J Cell Mol Med. 2020;24 (6 ):3701‐3711.32068951
25 Li MM , Liu N , Zhang M , et al. Clinical Significance of Serum Midkine in Children with Henoch‐Schonlein Purpura. Journal of Experimental Hematology. 2017;25 (1 ):181‐185.28245398
26 Li Y , Feng X , Huang L , et al. Hematologic and immunological characteristics of Henoch‐Schönlein purpura in rat and rabbit models induced with ovalbumin based on type III hypersensitivity. Sci Rep. 2015;5 (1 ):8862.25749457
27 Li Y , Sui X , Zhu H , et al. Histopathological and immunological changes during the acute and recovery phase in Henoch–Schönlein purpura rabbit model. Arch Dermatol Res. 2017;309 :21‐30.27770201
28 Du L , Wang P , Liu C , Li S , Yue S , Yang Y . Multisystemic manifestations of IgA vasculitis. Clin Rheumatol. 2021;40 :43‐52.32557258
29 Zhu Y , Dong Y , Wu L , Deng F . Changes of inflammatory mediators and oxidative stress indicators in children with Henoch‐Schönlein purpura and clinical effects of hemoperfusion in the treatment of severe Henoch‐Schönlein purpura with gastrointestinal involvement in children. BMC Pediatr. 2019;19 (1 ):1‐10.30606158
30 Gil‐Cardoso K , Ginés I , Pinent M , et al. Chronic supplementation with dietary proanthocyanidins protects from diet‐induced intestinal alterations in obese rats. Mol Nutr Food Res. 2017;61 (8 ):1601039.
31 Deng ZJ , Zhao JF , Huang F , et al. Protective effect of procyanidin B2 on acute liver injury induced by aflatoxin B1 in rats. Biomed Environ Sci. 2020;33 (4 ):238‐247.32438961
32 Liu D . Effects of procyanidin on cardiomyocyte apoptosis after myocardial ischemia reperfusion in rats. BMC Cardio Dis. 2018;18 :1‐7.
33 Arie H , Nozu T , Miyagishi S , Ida M , Izumo T , Shibata H . Grape seed extract eliminates visceral allodynia and colonic hyperpermeability induced by repeated water avoidance stress in rats. Nutrients. 2019;11 (11 ):2646.31689935
34 He J , Sun M , Tian S . Procyanidin B2 prevents lupus nephritis development in mice by inhibiting NLRP3 inflammasome activation. Innate Immun. 2018;24 (5 ):307‐315.29874961
35 Shi X , Shang F , Zhang Y , Wang R , Jia Y , Li K . Persimmon oligomeric proanthocyanidins alleviate ultraviolet B‐induced skin damage by regulating oxidative stress and inflammatory responses. Free Radical Res. 2020;54 (10 ):765‐776.33108915
36 Li H , Li R , Wang L , Liao D , Zhang W , Wang J . Proanthocyanidins attenuate the high glucose‐induced damage of retinal pigment epithelial cells by attenuating oxidative stress and inhibiting activation of the NLRP3 inflammasome. J Biochem Mol Toxicol. 2021;35 (9 ):e22845.34338401
37 Lokman MS , Zaafar D , Althagafi HA , et al. Antiulcer activity of proanthocyanidins is mediated via suppression of oxidative, inflammatory, and apoptotic machineries. J Food Biochem. 2022;46 (2 ):e14070.35034361
38 Huang T , Zhang Y , Zhang W , et al. Attenuation of perfluorooctane sulfonate‐induced steatohepatitis by grape seed proanthocyanidin extract in mice. Biomed Res Int. 2020;2020 :1.
39 Thakur VR , Mehta AA . Ovalbumin/lipopolysaccharide induced vasculitis in rats: a new predictive model. J Basic Clin Physiol Pharmacol. 2021;33 (4 ):445‐455.33892525
40 Li X , Gao Z , Gao H , et al. Nephrin loss is reduced by grape seed proanthocyanidins in the experimental diabetic nephropathy rat model. Mol Med Rep. 2017;16 (6 ):9393‐9400.29152654
41 Gao Z , Liu G , Hu Z , et al. Grape seed proanthocyanidins protect against streptozotocin‑induced diabetic nephropathy by attenuating endoplasmic reticulum stress‑induced apoptosis. Mol Med Rep. 2018;18 (2 ):1447‐1454.29901130
42 Donadio ME , Loiacono E , Peruzzi L , et al. Toll‐like receptors, immunoproteasome and regulatory T cells in children with Henoch–Schönlein purpura and primary IgA nephropathy. Pediatr Nephrol. 2014;29 :1545‐1551.24687448
43 Chang H , Zhang Q‐Y , Lin Y , Cheng N , Zhang S‐Q . Correlation of TLR2 and TLR4 expressions in peripheral blood mononuclear cells to Th1‐and Th2‐type immune responses in children with Henoch‐Schönlein purpura. Int J Clin Exp Med. 2015;8 (8 ):13532.26550291
44 Xu H , Jiang G , Shen H , Li W , Mao J , Pan Y . Association of TLR4 gene polymorphisms with childhood Henoch–Schönlein purpura in a Chinese population. Rheumatol Int. 2017;37 :1909‐1915.28905155
45 Chang H , Yu DS , Liu XQ , et al. Clinical significance of TLR3 and TLR4 in peripheral blood mononuclear cells from children with Henoch‐Schönlein purpura nephritis. Exp Ther Med. 2014;7 (6 ):1703‐1707.24926370
46 Xie Y , Deng Q , Guo M , Li X , Xian D , Zhong J . Proanthocyanidins: a novel approach to Henoch‑Schonlein purpura through balancing immunity and arresting oxidative stress via TLR4/MyD88/NF‑κB signaling pathway. Exp Ther Med. 2023;25 (6 ):1‐12.36561629
47 Ardid‐Ruiz A , Harazin A , Barna L , et al. The effects of Vitis vinifera L. phenolic compounds on a blood‐brain barrier culture model: expression of leptin receptors and protection against cytokine‐induced damage. J Ethnopharmacol. 2020;247 :112253.31562952
