
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00767-3
10.1016/j.psj.2024.104188
104188
IMMUNOLOGY, HEALTH AND DISEASE
A σC-protein-based indirect enzyme-linked immunosorbent assay for clinical detection of antiavian reovirus antibodies
Yang Xia yangxia@cau.edu.cn
*†‡
Gao Hui *†‡
Cheng Zhi *†‡
Zhang Su *†‡
Zhao Yimeng *†‡
Zheng Hao *†‡
Gao Li *†‡
Cao Hong *†‡
Li Xiaoqi *†‡
Zheng Shijun J. *†‡
Wang Yongqiang vetwyq@cau.edu.cn
*†‡1
⁎ National Key Laboratory of Veterinary Public Health Security, Beijing 100193, China
† Key Laboratory of Animal Epidemiology of the Ministry of Agriculture, Beijing 100193, China
‡ College of Veterinary Medicine, China Agricultural University, Beijing 100193, China
1 Corresponding author: vetwyq@cau.edu.cn
08 8 2024
11 2024
08 8 2024
103 11 10418815 5 2024
3 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Avian reovirus (ARV) is the causative agent of avian viral arthritis and causes significant economic losses to the global poultry industry. For clinical diagnosis, detecting ARV-specific antibodies is crucial. We successfully expressed the ARV-σC protein in insect cells using the baculovirus expression vector system, achieving an expression level of approximately 200 mg/L. We developed an indirect enzyme-linked immunosorbent assay (iELISA) using the ARV-σC protein as a coating antigen to detect antibodies against it. The inter-batch and intrabatch coefficients of iELISA variation were less than 10%. Its sensitivity (1:12,800 diluted in serum) was 4 times higher than that of the indirect immunofluorescence assay (IFA; 1:3200 diluted in serum), and it showed no cross-reactivity with antibodies against other common avian viruses (such as Infectious bursal disease virus, Newcastle disease virus). The practicality of the iELISA was further evaluated using clinical samples. 300 clinical sera from chickens vaccinated with the ARV attenuated vaccine and 20 SPF sera were tested using both the iELISA and the IFA, demonstrating a 100% conformity rate. In conclusion, these results suggest that the iELISA developed in this study is a rapid, sensitive, and specific method that could serve as an effective diagnostic tool for monitoring and controlling avian viral arthritis.

Key words

Avian reovirus
σC protein
baculovirus
eukaryotic expression
indirect ELISA
==== Body
pmcINTRODUCTION

Avian reovirus (ARV), a member of the genus Orthoreovirus in the family Reoviridae, was first isolated from a wild chicken by Fahey and Crawley in 1954 (Fahey and Crawley, 1954). Since then, ARV has become widespread worldwide, infecting poultry and wildfowl, including chickens, ducks, and turkeys (Mor et al., 2013). ARV infection in poultry is associated with several diseases, such as viral arthritis (Nowak et al., 2022), tenosynovitis (Marks and Marks, 2016), runting–stunting syndrome (Kibenge et al., 1987), and malabsorption syndrome (Dutta and Pomeroy, 1967) has caused significant economic losses to the poultry industry. Research indicates that ARV comprises 7 genotypes(De la Torre et al., 2021), 6 of which have been identified in China. In recent years, the disease has shown regional outbreaks in broiler chicken farms in certain parts of China, with genotype Ⅰ being the predominant circulating strain. In 2023, Dong et al. (Liu et al., 2023) conducted a genetic evolutionary analysis of the σC gene on 2,340 suspected viral arthritis samples from 16 provinces in China between 2019 and 2020. The study revealed that 46 viral strains were distributed across 1–5 branches, with the largest number of strains in branches 1 and 2.

Furthermore, vaccine cross-reactivity tests demonstrated that each genotype strain elicited partial cross-protection, providing a scientific basis for the prevention and control of ARV.

The ARV genome consists of 10 double-stranded RNA segments encapsulated in a double-layered nucleocapsid, which can be divided into 3 segments based on their electrophoretic mobility: L (L1–L3), M (M1–M3), and S (S1–S4). The ARV genomes mainly encode 12 major proteins, consisting of 4 nonstructural proteins (µNS, p10, p17, and σNS) and 8 structural proteins (λA, λB, λC, µA, µB, σA, σB, and σC) (Martínez-Costas et al., 1997; Liu et al., 1997; Benavente and Martínez-Costas, 2007). The σC protein, encoded by the S1 segment, is the immunologically dominant structural protein involved in cell attachment, and is the major virus-neutralizing antigen that induces the production of neutralizing antibodies (Liu et al., 2003; Ayalew et al., 2017).

Detection methods that rely on traditional virus isolation and culture with reverse transcription–polymerase chain reaction (RT–PCR), real-time PCR, or multiplex PCR combined with sequencing in laboratories have been used as the gold standards for the detection of ARV. They benefit from their specificity and sensitivity but cannot meet the urgent need of real-time detection (Fredenck, 2019). The enzyme-linked immunosorbent assay (ELISA), based on a specific antigen-antibody reaction, can easily and sensitively identify antigen or antibody levels in large-scale clinical serum samples. It has been extensively used for serological monitoring to assess virus exposure and vaccine efficacy in poultry for disease outbreak control. To date, indirect ELISA (iELISA) methods used for the detection of ARV serum antibodies have used both whole viruses and recombinant proteins as bait. These methods are associated with substantial cross-reactivity and other issues when using prokaryote-expressed recombinant proteins for the detection of ARV antibodies (Shien et al. 2000; Liu et al. 2002; Zhang et al. 2007; Xie et al. 2010).

Bacterium-to-baculovirus (Bac-to-Bac) is a method that uses baculovirus as the vector from which to express exogenous genes in insect cells. The system is based on the bacterial Site-specific Tn7 transposon, which transposes the target gene into the bacmid in Escherichia coli DH10Bac cells via the pFastBac-donor plasmid. This process facilitates the replication and expression of the target gene. The exogenous genes expressed by Bac-to-Bac exhibit high levels of expression and maintain conformational similarity to their corresponding natural proteins (Felberbaum, 2015).

Here, based on the natural advantages of the Bac-to-Bac expression system, we successfully expressed the σC protein using the eukaryotic expression system and purified it with affinity chromatography. An indirect enzyme-linked immunosorbent assay (iELISA) was developed using the recombinant ARV-σC protein to detect antibodies against ARV. This recombinant σC protein closely mimics its natural conformation, enhancing its ability to bind ARV-seropositive samples and thus, increasing the assay's specificity.

In addition, the iELISA demonstrated higher sensitivity compared to IFA in the identification of clinical samples. It offers a rapid, straightforward, and sensitive method to detect ARV antibodies, serving as a valuable tool for epidemiological investigations and antibody monitoring.

MATERIALS AND METHODS

Cells, Plasmids, and Sera

SIM SF expression medium (Sino Biological) containing 0% serum and 10% triple antibiotic (penicillin, streptomycin, and amphotericin B) was used to culture sf9 cells (maintained in our laboratory) in a 27°C shaker incubator (Chen et al., 2023). The σC plasmid, constructed from the σC gene fragment of ARV strain S1133 (GenBank, Q992I2.1) and maintained in our laboratory, was used as the template for cloning the target genes. Clinical chicken sera (n = 300) were used as the iELISA clinical samples: Hainan Grey chickens (Beijing Yanqing Chicken Farm) At 7 d, were immunized with the ARV-S1133 attenuated vaccine. At 110 d, were administered a quadrivalent vaccine (NDV, IBV, IBDV. ARV). Blood samples were collected at 170 d for serum analysis and subsequent testing. ARV-positive chicken sera, specific-pathogen-free (SPF) chicken sera (n = 50), maintained in our laboratory, were used to optimize the iELISA conditions. An anti-ARV-σC monoclonal antibody (Tang et al., 2022), maintained in our laboratory, was used to assess the expression of recombinant σC protein by Western Blot. It also served as the positive control to evaluate the sensitivity of the iELISA by IFA, and to detect clinical serum samples using both the iELISA and IFA. TMB and stopping solution were provided by Guangdong BiaoYun Biotechnology Company.

Preparation of σC Antigen

PCR was used to amplify the ARV-σC gene, and the Strep-tag II coding sequence was introduced at the C-terminus of the target gene. The recombinant plasmid, designated pFast-Bac–C, was created by cloning the C–Strep II gene into the pFast-Bac vector using homologous recombination. The primer pairs are shown in Table 1 (underlined are the homology arms). E. coli DH10bac cells were then transformed with the pFast-Bac–σC recombinant plasmid and the shuttle plasmid, designated Bacmid–σC, was generated, confirmed with blue–white spot screening and PCR. Sf9 cells were transfected with Bacmid–σC to express the σC protein. The expression of σC protein was confirmed with western blotting probed with the monoclonal antibody of anti-σC protein and the ARV-positive serum.Table 1 Primers for amplification of ARV-σC-StrepⅡ sequence.

Table 1Primer name	Sequence (5´ to 3´)	Size	
σC-StrepⅡ-F	CCTTTGCGGCGGATGGAATTATGGCGGGTCTCAATCCATC	1153 bp	
σC-StrepⅡ-R	TTGGTACCGCATGCCTCGAGTCATTTTTCGAACTGCGGGT	

Establishment and Application of the iELISA

The reaction conditions for the iELISA were determined with a checkerboard titration test. First, samples of ARV antigens (diluted with PH 9.6 0.05M carbonate buffer) ranging from 16 to 0.125 µg/mL and standard ARV-negative and -positive serum samples at dilutions of 1:50 to 1:400 were used to determine the optimal concentration for the iELISA. Next, alternative blocking times (37°C for 2 h, 37°C for 1.5 h, and 37°C for 1 h) and blocking solutions (5% skimmed milk, 1% bovine serum albumin, and 0.8% gluten) were tested to determine the optimal blocking conditions. The iELISA was then performed with various coating times (4°C overnight, 37°C for 2 h, and 37°C for 1 h), and antibody-antigen reaction times (37°C for 30 min, 37°C for 60 min, and 37°C for 90 min) to identify the ideal reaction conditions. Finally, various incubation periods (37°C for 30 min, 37°C for 45 min, and 37°C for 60 min) and dilutions (1:2,000, 1:4,000, 1:8,000, and 1:16,000) for the enzyme-labeled secondary antibody (HRP-Goat anti-Mouse IgG, Beijing Dingguo Changsheng Biotechnology) were tested to determine the optimal reaction conditions. The optical density of the iELISA was measured at 620 nm (OD620) with a spectrophotometer (Sunrise ELISA reader; Tecan, Switzerland).

Cut-Off Value

We used Fifty-four serum samples from SPF chickens to determine the cut-off value for the iELISA. The cut-off value was calculated based on the mean and standard deviation (SD) of the OD620 of the negative samples. It was defined as the mean of the 54 negative serum samples plus 3SD, ensuring 95% or 99% confidence that the negative serum results fell within the specified range.

Cross Reactivity and Repeatability of the iELISA

The specificity of the iELISA was evaluated by analyzing reference sera that were positive for Infectious bursal disease virus (IBDV), Infectious bronchitis virus(IBV), Avian influenza virus (AIV, H5/H7/H9), Chicken anemia virus (CAV), and Newcastle disease virus(NDV)antibodies, while ARV-positive and negative samples were used as control.

To determine the repeatability of the iELISA, we randomly selected 6 reaction strips and applied ARV-positive chicken sera and SPF sera to evaluate both intrabatch (between plates) and interbatch (within plates) variation. We reported the variability as the coefficient of variation (CV), calculated as the SD divided by the mean optical density at 620 nm (OD620) for each group of samples.

Sensitivity of the iELISA

The sensitivity of the iELISA was validated using a parallel assay with the iELISA and IFA for 2-fold gradient dilutions of ARV-positive serum (ranging from 100 to 1:51,200). Three replicates were prepared for each dilution of the same serum sample. Negative sera and an anti-ARV-σC monoclonal antibody were used as negative and positive controls, respectively, at corresponding gradient dilutions.

Detection of Antibodies in Clinical Serum Samples

We analyzed 300 clinical serum samples from chickens with known ARV immunization status, as well as 20 SPF serum samples, using both the developed iELISA and IFA. Each sample was tested in triplicate.

IFA

DF-1 cells were inoculated in 96-well plates and infected with the ARV strain S1133 once their density reached about 80%. After 24 h the cells were washed 3 times with PBS and fixed with 4% paraformaldehyde for 20 min at room temperature. Subsequently, the cells were washed 3 times with precooled PBS and permeabilized with 2% Triton X-100 on ice for 15 min and blocked with 1% BSA at 37°C for 1 h.

Following 2 washes with precooled PBST, the cells were incubated overnight at 4°C with clinical serum (diluted 1:100 in PBST) as the primary antibody. Next, the cells were washed 4 times with PBST and stained with 100 μL of fluorescein isothiocyanate-conjugated rabbit antichicken IgG (diluted 1:200 in PBST) at 37°C for 1 h. Finally, the cells were washed with PBST and visualized under a fluorescence microscope. SPF chicken serum (NC) and an anti-ARV-σC monoclonal antibody were used as the negative and positive controls, respectively.

Statistical Analysis

Each experiment was conducted independently at least 3 times. The results were analyzed with GraphPad Prism version 8.0 (GraphPad Software, San Diego, CA).

RESULTS

Expression, Identification, and Purification of ARV-σC Protein

A 1071bp of σC gene sequence was successfully amplified by PCR from ARV S1133 strain (Figure 1A) and was inserted into the pFast-Bac vector. E. coli DH10Bac cells were transformed with the vector for the transposition of the target gene into the bacmid. Sf9 cells were transfected with the recombinant Bacmid–σC plasmid, and then a clear lesion, characterized by enlargement and rounding, was observed in the transformed Sf9 insect cells (Figure 1B). The target protein was identified with a western bolting analysis, which confirmed that recombinant σC was successfully expressed and had good antigenicity (Figure 1C). The highly purified ARV-σC protein was obtained after affinity chromatography (Figure 1D).Figure 1 Expression, immunogenicity detection, and purification of ARV-σC protein. Amplification of the coding gene of ARV-σC protein with the strep II-tag gene at the C-terminus by PCR, around the target band of 1071bp (A). Recombinant baculovirus causes lesions in sf9 cells. Normal sf9 cells as control, lesions caused by Bacmid and Bacmid-σC (B). Western Blot analysis of the antigenicity of the ARV-σC protein. The upper was incubated with the monoclonal antibody of anti-σC protein and the lower was ARV-positive serum (C). Lane 1: Blank control, Lane 2: Bacmid control, Lane 3: Bacmid-σC. The purification of ARV-σC protein (D). M: Marker, Lane 1-5: 2X gradient dilution of BSA (maximum 0.25 mg/mL), Lane 6-9: Elution buffer samples. Scale: 50 μm.

Figure 1

Development of the iELISA for Detection of ARV Antibodies

We developed an iELISA to detect ARV antibodies using the ARV-σC protein as the coating antigen. All ELISA conditions were sequentially optimized. The results of a checkerboard titration assay indicated the ideal σC protein concentration at 200 ng/well and serum dilution for testing at 1:100 (Figures 2A and 2B). The iELISA was then performed under different coating and blocking conditions. The optimal conditions were coating overnight at 4°C and blocking with 5% skimmed milk for 2 h at 37°C (Figures 2C–2E). Of all the reaction times tested, the optimal reaction time for antigen–antibody binding was 1 h at 37°C (Figure 2F). Finally, the optimal incubation time and optimal dilution for the enzyme-labeled secondary antibody reaction were 30 min and 1:4,000 with 5% skimmed milk, respectively (Figures 2G and 2H).Figure 2 Optimization of the reacting conditions of the established iELISA. Determination of the optimal amount of ARV-σC protein (A). Different dilution of the tested chicken sera was detected for determination of the optimal dilution of the tested serum (B). Determination of the optimal coated conditions for developing the iELISA (C). Determination of the optimal blocking conditions for developing the iELISA (D and E). Determination of the incubation time of the antigen-antibody for iELISA (F). The dilution rate and incubation time of the secondary antibody reaction were optimized (G and H).

Figure 2

Cut-Off Values for the iELISA

To establish the iELISA cut-off, we tested 54 SPF chicken serum samples. The mean OD620 for negative samples was 0.1208 with a SD of 0.0375. Using this data, we set the iELISA cut-off at 0.218 (mean + 3SD) (Figure 3A). Collectively, a serum sample with an OD620 at or above 0.218 was considered ARV-seropositive, while samples below this threshold were deemed ARV-seronegative.Figure 3 Specificity of the ELISA for detecting anti-ARV antibodies. 54 ARV-seronegative serum samples were tested using the IELISA to calculate the cut-off value (A). As an assessment of the iELISA detecting the antibodies against other chicken disease viruses, including IBDV, IBV, AIV (H5/H7/H9), CAV, and NDV(n=3) (B).

Figure 3

Reproducibility and Specificity of the iELISA

Sera from chickens infected with other chicken disease viruses, including IBDV, IBV, AIV (H5/H7/H9), CAV, and NDV, were tested to evaluate the specificity of the iELISA. Only ARV-seropositive samples reacted with the coating protein ARV-σC, whereas sera positive for antibodies directed against the other viruses did not (Figure 3B). For the repeatability experiment, ARV-positive chicken sera and SPF chicken sera were randomly selected and tested with the iELISA to determine the intra- and inter-assay CVs, which were 5.17% and 5.46%, respectively, for positive sera and 8.58% and 7.84%, respectively, for negative sera; thus, all were below10% (Table 2). These results demonstrate that the novel iELISA has both good specificity and good reproducibility in detecting ARV antibodies.Table 2 The results of the repeatability test using the developed iELISA.

Table 2Item	Positive	Negative	
Coefficient of variation in intraplates	5.17%	8.58%	
Coefficient of variation between inter-plates	5.46%	7.84%	

Sensitivity of the iELISA

To assess the sensitivity of the iELISA, both iELISA, and IFA were used to detect ARV-positive sera at 2-fold dilutions ranging from 1:100 to 1:51,200. The results indicated that the minimum detection dilution for iELISA was 1:12800 (Figure 4A) and for IFA was 1:3,200 (Figure 4B). These findings suggest that the sensitivity of iELISA is 4 times higher than that of IFA.Figure 4 Sensitivities of iELISA. 2-fold gradient dilution of ARV-positive sera for iELISA and IFA parallel testing Sensitivity results of iELISA (A). Three replicate assessments were performed for each dilution of ARV-positive serum and SPF serum and a 620 value greater than or equal to 0.218 was considered positive. Sensitivity results of IFA (B). ARV-positive serum (diluted from 1:100 to 1:51,200) on DF-1 cells infected with ARV strain S1133 (characterized by syncytia lesion). SPF chicken serum and an anti-ARV-σC monoclonal antibody were used as negative and positive controls. Scale: 50 μm.

Figure 4

Detection of Antibodies in Clinical Serum Samples

To evaluate the efficacy of the developed ELISA in testing clinical samples, 300 serum samples from a farm in China and 20 serum samples from SPF chickens were collected and simultaneously tested using iELISA and IFA. The results showed that all 300 clinical serum samples were positive and 20 SPF chicken serum samples were negative by iELISA and IFA (Table 3 and Supplementary Figure S1). The concordance rate between the 2 detection methods was 100% (320/320).Table 3 The results of the ARV-iELISA and IFA tests on clinical and SPF serum samples.

Table 3Sample	Self-established iELISA	
IFA	Positive no.	Negative no.	Total no.	
Positive no.	300	0	300	
Negative no.	0	20	20	
Total no.	300	20	320	
Coincidence rate	100%	

DISCUSSION

In recent decades, the commercial poultry industry has suffered significant economic losses due to the global spread of ARV infections, which have become increasingly complex. Currently, there is no effective clinical treatment for this disease, and immunization is primarily used for its prevention. The existing vaccines include live attenuated and inactivated vaccines (Vasserman et al. 2004; Ayalew et al., 2017; Liu et al. 2022). However, live attenuated vaccines carry the risk of reversion to their virulent form and the potential to spread this virulence. The limitations of inactivated vaccines include a suboptimal immune response, a short period of immune protection, and the induction of only a humoral immune response (Goldenberg, 2022). Furthermore, the extensive mutations of ARV strains hamper the effectiveness of immunization as a preventive measure against this disease (Markis, 2022). To address these challenges, it is essential to develop rapid and sensitive detection methods for identifying the disease and evaluating the effectiveness of immunization strategies.

In the context of these requirements, ELISA is the preferred option for the large-scale surveillance of disease outbreaks because it can quantify the titers of antibodies in chicken sera to assess the presence of infection or the effectiveness of vaccine immunization. Different ELISA formats have been established for monitoring ARV antibodies.

Among these, ELISAs based on the recombination σC protein of ARV, induce lower nonspecific responses and have shown higher correlations in viral neutralization assays than ELISAs based on whole viral particles (Shien et al. 2000). However, ELISAs based on prokaryotically expressed recombinant viral proteins as coating antigen suffers from the drawbacks of extensive cross-reactivity and frequent false positive results. The E. coli prokaryotic expression system, which is commonly used to express large amounts of exogenous proteins, is flawed insofar as the expressed proteins do not form the correctly folded structure and retain a methionine at the amino-terminus of the proteins, which affects the function and stability of the expressed protein (Chaudhuri et al., 1999; Daly and Hearn, 2006).

Eukaryotic expression systems are superior to prokaryotic expression in that the posttranslational protein processing is very similar to the natural form in vivo, and the expressed proteins retain their biological activities (Dulwich et al., 2018). The insect Bac-to-Bac Baculovirus Expression System uses baculovirus as the vector for the expression of exogenous genes in insect cells or in vivo. It exploits the advantages of insect cells, which can recognize and process signal peptides, support oligomerization, and undertake the appropriate posttranslational modifications (e.g., glycosylation, acylation, phosphorylation, and disulfide bond formation), to facilitate the correct conformations of the expressed proteins in space. This expression system also has the advantage of not causing human infections or environmental pollution and has been widely used in developing vaccines, antibodies, gene therapies, and biopesticides (Ma et al., 2021).

The oC protein, as a structural component of Avian Reovirus (ARV), plays a pivotal role in viral adsorption to host cells, induction of cell fusion, and the apoptosis process (Shapouri et al., 1995). Furthermore, the surface of the oC protein harbors multiple neutralizing antigenic epitopes (Sellers, 2022), positioning it as an optimal target for the development of vaccines and diagnostic reagents. Hence, the σC protein expressed efficiently in the Bac-to-Bac system shows superior stability and functional activity. A western blotting analysis confirmed that the σC protein expressed was recognized by labeled antibodies, anti-σC protein monoclonal antibodies, and ARV-positive serum, suggesting that the protein was successfully expressed in the baculovirus expression system, with good reactogenicity. The iELISA, using the exogenously expressed σC protein, exhibited high specificity, sensitivity, and excellent reproducibility. It showed no cross-reactivity with sera positive for IBDV, IBV, AIV (H5/H7/H9), CAV, and NDV antibodies. The sensitivity of iELISA (1:12,800 diluted in serum) was 4 times higher than that of the indirect immunofluorescence assay (IFA; 1:3,200 diluted in serum). Additionally, its intra and inter-batch CVs were below 10%. Furthermore, the concordance between the results of the iELISA and those of the IFA was 100%, indicating that the iELISA has high specificity, sensitivity, and promising commercial applicability.

CONCLUSIONS

The iELISA developed here, based on baculovirus-expressed ARV-σC, is a novel and efficient immunoassay for monitoring antibodies directed against ARV. This method is not only cost-effective but also highly specific and sensitive. It enables the evaluation of antibody levels postvaccination and shows no cross-reactivity with other common chicken pathogens.

DISCLOSURES

All authors disclosed no relevant relationships.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

We thank the contributors to the ARV study and regret any relevant studies not cited due to space constraints.

Author Contributions: Conceptualization: Y.W.; funding acquisition, S.J.Z., and Y.W.; Project administration: Y. W; Supervision: S.J.Z., Y.W, L.G., H.C., and X.L; Writing original draft: X.Y; Writing review and editing: H G, Z C., S.Z., Y.Z., H.Z., and Y.W. All authors have read and agreed to the published version of the manuscript.

This work was supported by grants from the National Natural Science Foundation of China (#32072850 ) and Earmarked Fund for Modern Agro-Industry Technology Research System (#CARS-40 ), China.

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104188.
==== Refs
REFERENCES

Ayalew L.E. Gupta A. Fricke J. Ahmed K.A. Popowich S. Lockerbie B. Tikoo S.K. Ojkic D. Gomis S. Phenotypic, genotypic, and antigenic characterization of emerging avian reoviruses isolated from clinical cases of arthritis in broilers in Saskatchewan Canada. Sci. Rep. 7 2017 3565 28620186
Benavente J. Martínez-Costas J. Avian reovirus: Structure and biology Virus. Res. 123 2007 105 119 17018239
Chaudhuri T.K. Horii K. Yoda T. Arai M. Nagata S. Terada T.P. Uchiyama H. Ikura T. Tsumoto K. Kataoka H. Matsushima M. Kuwajima K. Kumagai I. Effect of the extra n-terminal methionine residue on the stability and folding of recombinant alpha-lactalbumin expressed in Escherichia coli J. Mol. Biol. 285 1999 1179 1194 9887272
Chen J. Yuan X. Ma Z. Wang G. Wang Y. Cao H. Li X. Zheng S.J. Gao L. Chicken infectious anemia virus (CIAV) VP1 antagonizes type I interferon (IFN-I) production by inhibiting TBK1 phosphorylation Virus. Res. 327 2023 199077
Daly R. Hearn M.T.W. Expression of the human activin type I and II receptor extracellular domains in Pichia pastoris Protein. Expr. Purif. 46 2006 456 467 16309921
De la Torre D. Astolfi-Ferreira C.S. Chacón R.D. Puga B. Piantino Ferreira A.J. Emerging new avian reovirus variants from cases of enteric disorders and arthritis/tenosynovitis in Brazilian poultry flocks Br. Poult. Sci. 62 2021 361 372 33448227
Dulwich K.L. Asfor A.S. Gray A.G. Nair V. Broadbent A.J. An ex vivo chicken primary bursal-cell culture model to study infectious bursal disease virus pathogenesis J. Vis. Exp. 140 2018 58489
Dutta S.K. Pomeroy B.S. Isolation and characterization of an enterovirus from baby chicks having an enteric infection II. Physical and chemical characteristics and ultrastructure Avian. Dis. 11 1967 9 14 4291487
Fahey J.E. Crawley J.F. Studies on chronic respiratory disease of chickens II. Isolation of A virus Can. J. Comp. Med. Vet. Sci. 18 1954 13 21 17648682
Felberbaum R.S. The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors Biotechnol. J. 10 2015 702 714 25800821
Fredenck S.B.K. Infectious bursal disease virus Avian virology: Current research and future trends 2019 Caister Academic Press  179  210
Goldenberg D. Avian reovirus in Israel, variants and vaccines-a review Avian. Dis. 66 2022 447 451 36715478
Kibenge F.S. Jones R.C. Savage C.E. Effects of experimental immunosuppression on reovirus-induced tenosynovitis in light-hybrid chickens Avian. Pathol. 16 1987 73 92 18766593
Liu H.J. Giambrone J.J. Nielsen B.L. Molecular characterization of avian reoviruses using nested PCR and nucleotide sequence analysis J. Virol. Meth. 65 1997 159 167
Liu H.J. Kuo L.C. Hu Y.C. Liao M.H. Lien Y.Y. Development of an ELISA for detection of antibodies to avian reovirus in chickens J. Virol. Meth. 102 2002 129 138
Liu H.J. Lee L.H. Hsu H.W. Kuo L.C. Liao M.H. Molecular evolution of avian reovirus: Evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages Virology 314 2003 336 349 14517086
Liu H. Wei Z. Yang J. Wang Y. Hu J. Tang Y. Diao Y. Development of an indirect enzyme-linked immunosorbent assay for the detection of novel chicken orthoreovirus Pol. J. Vet. Sci. 25 2022 109 118 35575862
Liu D. Zou Z. Song S. Liu H. Gong X. Li B. Liu P. Wang Q. Liu F. Luan D. Zhang X. Du Y. Jin M. Epidemiological Analysis of Avian Reovirus in China and Research on the Immune Protection of Different Genotype Strains from 2019 to 2020 Vaccines (Basel) 11 2023 485 36851362
Ma M. Zheng M. Li X. Gao L. Cao H. Wang Y. Zheng S. [Gene cloning, protein expression and examination of biological activity of chicken CD40L] Sheng Wu Gong Cheng Xue Bao 37 2021 2786 2793 34472296
Markis M. Evaluation of pathogenicity and antigenicity of avian reoviruses and disease control through vaccination Avian. Dis. 66 2022 435 442 36715476
Marks M. Marks J.L. Viral arthritis Clin. Med. (Lond.) 16 2016 129 134 27037381
Martínez-Costas J. Grande A. Varela R. García-Martínez C. Benavente J. Protein architecture of avian reovirus S1133 and identification of the cell attachment protein J. Virol. 71 1997 59 64 8985323
Mor S.K. Sharafeldin T.A. Porter R.E. Ziegler A. Patnayak D.P. Goyal S.M. Isolation and characterization of a turkey arthritis reovirus Avian. Dis. 57 2013 97 103 23678736
Nowak T. Kwiecinski A. Kwiecinski P. Tomczyk G. Wodz K. Detection and identification of avian reovirus in young geese (Anser anser domestica) in Poland Animals 12 2022 3346 36496863
Sellers H.S. Avian reoviruses from clinical cases of tenosynovitis: An overview of diagnostic approaches and 10-year review of isolations and genetic characterization Avian. Dis. 66 2022 420 426 36715473
Shapouri M.R. Kane M. Letarte M. Bergeron J. Arella M. Silim A. Cloning, sequencing and expression of the S1 gene of avian reovirus J. Gen. Virol. 76 1995 1515 1520 7782781
Shien J.H. Yin H.S. Lee L.H. An enzyme-linked immunosorbent assay for the detection of antibody to avian reovirus by using protein sigma B as the coating antigen Res. Vet. Sci. 69 2000 107 112 11020359
Tang J. Fu M. Chen X. Zhao Y. Gao L. Cao H. Li X. Zheng S.J. Wang Y. Arrest of cell cycle by avian reovirus p17 through its interaction with Bub3 Viruses 14 2022 2385 36366482
Vasserman Y. Eliahoo D. Hemsani E. Kass N. Ayali G. Pokamunski S. Pitcovskiad J. The influence of reovirus sigma C protein diversity on vaccination efficiency Avian Dis 48 2004 271 278 15283414
Xie Z. Qin C. Xie L. Liu J. Pang Y. Deng X. Xie Z. Khan M.I. Recombinant protein-based ELISA for detection and differentiation of antibodies against avian reovirus in vaccinated and non-vaccinated chickens J. Virol. Meth. 165 2010 108 111
Zhang Y. Guo D. Liu M. Geng H. Hu Q. Liu Y. Liu N. Characterization of the sigma B-encoding genes of Muscovy duck reovirus: Sigma C-sigma B-ELISA for antibodies against duck reovirus in ducks Vet. Microbiol. 121 2007 231 241 17218069
