
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00782-X
10.1016/j.psj.2024.104203
104203
MANAGEMENT AND PRODUCTION
Dietary resveratrol supplementation alleviates cold exposure-induced pyroptosis and inflammation in broiler heart by modulating oxidative stress and endoplasmic reticulum stress
Wei Haidong *
Li Haochen *
Miao Deyang *
Wang Haowen †
Liu Yuanyuan *
Xing Lu *
Bao Jun †‡
Li Jianhong jhlineau@163.com
*‡1
⁎ College of Life Science, Northeast Agricultural University, 150030 Harbin, China
† College of Animal Science and Technology, Northeast Agricultural University, 150030 Harbin, China
‡ Key Laboratory of Chicken Genetics and Breeding, Ministry of Agriculture and Rural Affairs, Northeast Agricultural University, 150030 Harbin, China
1 Corresponding author: jhlineau@163.com
10 8 2024
11 2024
10 8 2024
103 11 10420321 5 2024
6 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
To explore the potential protective effect of resveratrol (RES) on cold-exposed broilers, 360 21-day-old broilers were equally divided into 5 groups with 6 replicates. A control (CON) group was reared at the normal feeding temperature and received a basal diet, and 4 cold exposure (8 ± 1°C for 10 h/d from d 29 to 42) groups were fed the basal diet with 0 (CE), 250 (CE + RES250), 500 (CE + RES500), and 750 (CE + RES750) mg/kg RES from d 22 to 42. Broilers were slaughtered on d 42 and heart tissues were collected to measure the relevant indexes. The results showed that heart tissues of all CE-broilers had inflammatory cell infiltrations, and dietary RES supplementation reduced this phenomenon. Compared to CON group, the concentrations of MDA and H2O2 were increased and activities of SOD and CAT were decreased in all CE-broilers (P < 0.05). mRNA expression of genes related to endoplasmic reticulum (ER) stress (GRP78, IRE1, PERK, EIF-2α, ATF4, ATF6, and CHOP), pyroptosis (NLRP3, ASC, Caspase1, GSDME, IL-18, and IL-1β), and proinflammation (TNF-α, IFN-γ, IL-2, and IL-6) was upregulated and that of ant-inflammatory cytokines (IL-4 and IL-10) was downregulated in CE and all CE + RES groups compared to CON group (P < 0.05). Compared to CE group, the activities of SOD and CAT and mRNA expression of anti-inflammatory genes were increased (P < 0.05), and concentrations of MDA and H2O2 and mRNA expression of ER stress, pyroptosis and proinflammatory genes were reduced (P < 0.05) in 3 CE + RES groups. Additionally, protein levels of PERK, ATF4, CHOP, NLRP3, Caspase1, GSDMD, IL-18, IL-1β, TNF-α, and IL-10 were similar in their mRNA expression. Overall, cold exposure caused oxidative stress and ER stress, and induced pyroptosis and inflammatory response, resulting in heart injury in broilers, and dietary RES addition reduced heart damage by enhancing antioxidant defense function. This study indicates that RES can be a feed additive to alleviate cold exposure-induced heart injury in broilers, and a 500 mg RES/kg diet is the optimal supplemental level.

Key words

cold exposure
endoplasmic reticulum stress
oxidative stress
pyroptosis
resveratrol
==== Body
pmcINTRODUCTION

Cold is a common weather phenomenon in the northern regions of the globe, which affects the health and welfare of humans, livestock, and poultry living in those regions. The ambient temperature of poultry living below 18°C induces stress response, resulting in reduced growth performance and egg production, disrupted the balance of oxidative and antioxidative systems, impaired the structure and function of organs and tissues, and increased the morbidity and mortality of chickens (Zhang et al., 2016; Bahadoran et al., 2021; Abbas et al., 2022; Wei et al., 2024). Studies have demonstrated that cold exposure-caused stress response and tissue injury are usually related to oxidative stress and inflammation in broilers (Wei et al., 2023, 2024; Bi et al., 2024a). Oxidative stress occurs when redox homeostasis is broken by some stimuli, reflected by the increased concentrations of malondialdehyde (MDA) and hydrogen peroxide (H2O2) and decreased activities of antioxidative enzymes (Pamplona and Costantini, 2011; Abbas et al., 2021). Inflammation is a protective response to tissue injury caused by stressors. Accumulating evidence suggests that cold exposure increases the concentrations of MDA and H2O2, decreases the activities of catalase (CAT) and superoxide dismutase (SOD), and upregulates the expression of tumor necrosis factor-γ (TNF-α), interleukin (IL)-1β, and interferon-γ (IFN-γ) in heart, liver, and intestine tissues in poultry and livestock (Wei et al., 2018; Sun et al., 2022; Bi et al., 2024a), indicating that cold exposure induces oxidative stress and inflammation.

The endoplasmic reticulum (ER) is a key site for protein synthesis, folding, and trafficking. Extensive research suggests that oxidative stress with overaccumulation of reactive oxygen species induces the alternations of protein synthesis and folding in the ER, leading to ER stress (Tripathi et al., 2022). Oxidative stress-modulated ER stress is also associated with pyroptosis by the nod-like receptor protein 3 (NLRP3)-regulated classical pathway. For example, heavy metal cadmium-induced liver injury is controlled by ER stress and oxidative stress in chickens (Li et al., 2023), and cadmium also induces pyroptosis by activating the NLRP3 inflammasome pathway and oxidative stress in triple-negative breast cancer cells (Tang et al., 2021). Thus, oxidative stress and ER stress are involved in the regulation of tissue damage.

Resveratrol (RES, trans-3,5,4-trihydroxystilbene) is a naturally occurring nonflavonoid phytoalexin is produced by Veratrum villosum and widely exists in some spermatophytes, including grapes, berries, peanuts, and other fruits (Berman et al., 2017). It is reported that RES has multiple biological functions with antioxidative, anti-inflammatory, anticancer, antiaging, and others, and is widely used as a drug to treat the diseases and tissue damage in humans and animals in recent decades (Frémont, 2000). Some studies found that RES attenuates a high-fat diet-induced hepatic steatosis and kidney fibrosis in rats by improving lipid metabolism and decreasing proinflammatory cytokines (TNF-α and IL-1β) profile (Andrade et al., 2014; Chowdhury et al., 2022). Dietary RES supplementation improves growth performance and innate immunity and enhances intestinal barrier function in heat-stressed broilers by inhibiting oxidative stress and inflammation (Zhang et al., 2017; He et al., 2019; Ding et al., 2023). Additionally, ERS can alleviate inflammatory response and pyroptosis in Ctenopharyngodon idellus hepatic cells caused by emamectin benzoate via regulating oxidative stress and ER stress (Bi et al., 2023). These findings suggest that RES can be used as an effective drug to alleviate environmental factors-induced tissue damage in animals.

The heart is a vital organ in the circulatory system, and its main function is to power the blood flow to all parts of the body, so that its health is essential for maintaining metabolic balance and thermostasis in homoiotherms. Our previous studies found that cold exposure disrupts redox reaction, causes oxidative stress and inflammation, and induces apoptosis, thereby leading to heart injury in broilers (Wei et al., 2018, 2023). Some studies reported that cold exposure-induced heart injury can be effectively suppressed by RES treatment in mice via inhibiting cardiomyocyte apoptosis (Yin et al., 2015), and dietary RES addition promotes metabolism and antioxidative capacity of tilapia (Oreochromis mossambicus) exposed to cold stress during the winter, which enhances the tolerance of tilapia to cold (Wang et al., 2020), suggesting that RES can reduce cold exposure-caused adverse effects. However, whether dietary RES supplementation could alleviate cold exposure-induced heart damage in broilers and whether oxidative stress and ER stress are involved in this process remains unclear. Therefore, this study aimed to explore the effect of ERS on heart tissues in cold-exposed broilers and its underlining mechanism. We hypothesized that dietary RES supplementation ameliorates inflammation and pyroptosis in broiler heart induced by cold exposure via modulating oxidative stress and ER stress. The results of this study reveal the mechanism of RES in the protection of heart injury, and also provides a new insight into RES reducing the negative effects of cold exposure to broiler heart.

MATERIALS AND METHODS

Ethics Statement

All experiments were approved by and conducted according to the guidelines of the Institutional Animal Care and Use Committee of Northeast Agriculture University (NEAUEC20240107).

Animals and Experimental Design

A total of 360 21-day-old broilers were selected based on their average body weight (829.9 ± 17.8 g) and randomly assigned to 5 treatment groups: (1) control (CON), (2) cold exposure (CE), (3) CE + 250 mg/kg resveratrol (CE + RES250), (4) CE + 500 mg/kg resveratrol (CE + RES500), and (5) CE + 750 mg/kg resveratrol (CE + RES750). Broilers in each group were housed in 6 battery cages (replicates) with 12 broilers per cage (800 cm2/bird), each of cage dimension 120 cm length × 80 cm width × 60 cm height, and these cages in each group were located in a thoroughly cleaned and disinfected experimental chicken house with controlled ambient temperature. Broilers in the CON group were reared at the normal ambient temperature and fed a commercial basal diet (Baisicheng Animal Husbandry Corporation Ltd., Harbin, China) (Supplementary Table S1). The rearing temperature of the CON group was set as follows: 35°C for d 1 to 3, and then continued to lower the rearing temperature of 1°C through every 2 d until it reduced to 20°C on d 32, and keep the temperature at 20°C to d 42. Broilers in CE, CE + RES250, CE + RES500, and CE + RES750 groups were subjected to cold exposure at the temperature of 8 ± 1°C for 10 h/d (10:00–20:00 h) from d 29 to d 42, and the temperature of the rearing time was same as that in the CON group. Meanwhile, broilers in the CE group were fed a basal diet from d 1 to d 42, whereas birds in CE + RES250, CE + RES500, and CE + RES750 groups were fed the special feed with 250 mg, 500 mg, and 750 mg resveratrol per kg basal diet, respectively, from d 22 to d 42. The rearing temperature of each group and experimental design are diagramed in Figure 1. All broilers in each group had free access to feed and water during the entire experimental period from d 1 to d 42.Figure 1 Experimental design and rearing temperature change scheme in each group.

Figure 1

Sample Collection

At the end of the experiment (d 42), 1 broiler was randomly selected from each replicated cage (n = 6 per group) and slaughtered by cervical dislocation. The heart was removed from the body and washed the blood on the surface with ice normal saline, and then cut into 3 parts, one for redox indexes and cytokines determination, the other for histopathological staining analysis, and the remaining part was quickly frozen in liquid nitrogen and then stored into the freezer at −80°C for gene and protein expression measurement.

Determination of Growth Performance and Feed Intake of Broilers

The body weight and feed intake of broilers in each group were recorded during the CE period from d 29 to d 42. Finally, the average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR, ratio of ADFI to ADG) were calculated in the CE period.

Determination of Redox Biomarkers in Heart Tissues

A total of 500 mg of fresh heart tissues for each broiler was weighted and respectively homogenized into 9.5 mL of normal saline. The homogenates were centrifuged at 4000 rpm for 15 min at 4°C and the supernatants were collected to measure the concentrations of oxidative indexes (MDA and H2O2) and the activities of antioxidative enzymes (CAT and SOD) based on the manufacturer's instructions (Jiancheng Biotechnology Research Institute, Nanjing, China). The levels of these indexes in testing samples were calculated by the blank control and standard samples (Wei et al., 2024).

Determination of Inflammatory Cytokines in Heart Tissues

The concentrations of inflammatory cytokines (TNF-α, IFN-γ, IL-4, and IL-6) in heart homogenates were measured according to the manufacturer's instructions (Jinma Laboratory Equipment Corporation Ltd., Shanghai, China). Briefly, 50 μL of supernatants from each testing sample were added into the micropore for the determination of cytokine concentrations in heart tissues. Meanwhile, the corresponding standard curve for each cytokine was obtained using the standard solutions with concentration gradients. The optical density of testing samples and standard samples was measured by a microplate reader at the wavelength of 450 nm, and the final concentrations of TNF-α, IFN-γ, IL-4, and IL-6 in the heart tissues of broilers were calculated by their optical density and standard curve (Bi et al., 2024a).

Hematoxylin and Eosin Staining

The hematoxylin and eosin (H&E) staining was applied to assess the inflammation and structure of the heart tissues in each group. A piece of heart tissue (about 3 mm × 3 mm × 3 mm) was cut from the heart and fixed into 4% of paraformaldehyde solution for 1 wk. The fixed tissues were gradually dewaxed and dehydrated using xylene and ethanol solutions with different graded concentrations. The treated samples were embedded in paraffin and then cut into 5-μm sections in thickness by a microtome. Afterward, the cut sections were stained with hematoxylin and eosin dye, and sealed with neutral gum after dehydration. Finally, the prepared sections were observed by an optical microscope (Eclipse E100, Nikon, Japan) and images were scanned by a scanner (Pannoramic MIDI, Nikon, Japan). The histopathologic analysis of heart H&E staining was performed on under a 50X amplification with a visual field of 20 μm using the CaseViewer 2.4 (3DHISTECH, Hungary) software and relevant pictures were also obtained (Wei et al., 2023).

Immunofluorescence Staining Analysis

Immunofluorescence staining was used to evaluate the extent of heart pyroptosis. In brief, the embedded tissue samples were cut into sections and blocked with 3% of BSA, and then incubated overnight with primary antibody NLRP3 (Servicebio, China) at 4°C. The sections were incubated using a second antibody of goat antirabbit IgG (Servicebio, China) for 50 min in the dark and then DAPI solution was dripped into sections and incubated for 10 min in the dark. Eventually, the sections were observed and images were collected by a fluorescent microscopy. The nucleus of DAPI channel is blue and the positive expression of NLRP3 is red under fluorescent microscopy, and the fluorescence intensities of NLRP3 in heart tissues were analyzed in a visual field of 20 μm using Image-Pro Plus 6.0 software (Media Cybernetic, MD).

Total RNA Extraction, cDNA Synthesis, and Quantitative Real-Time Polymerase Chain Reaction Analysis

A total of 100 mg of frozen heart tissue for each broiler (n = 6 for each group) was weighed and used to extract total RNA with 1 mL of RNAiso Plus Kit (Takara, China). The purity and concentration of extracted total RNA from each sample were detected using a bio-spectrometer (Eppendorf, Germany) at the wavelength of 260/280 nm ratio and 260 nm, respectively. The purity value of total RNA at 1.8-2.1 was accepted. cDNA was synthesized from 1 μg of total RNA for each sample by the reverse transcription kit following the manufacturer's instructions (Takara, China). cDNA was diluted with PCR-grade water to 5 times volume for subsequent quantitative real-time polymerase chain reaction (qRT-PCR) analysis.

The qRT-PCR was performed on the Light Cycler 96 qPCR system (Roche, Switzerland) to measure the mRNA expression levels of genes with ER stress (glucose regulatory protein 78 (GRP78), inositol requiring enzyme 1 (IRE1), protein kinase RNA-like endoplasmic reticulum kinase (PERK), eukaryotic initiation factor 2α (EIF-2α), C/EBP homologous protein (CHOP), activating transcription factor 4 (ATF4), and ATF6), pyroptosis (NLRP3, apoptosis-associated speck-like protein (ASC), Caspase1, gasdermin E (GSDME), IL-1β, and IL-18), and inflammation (TNF-α, IFN-γ, IL-2, IL-4, IL-6, and IL-10) in heart tissues of broilers. The total volume of qRT-PCR reaction system was 10 μL, consisting of 5 μL of SYBR Green Master kit (Taraka, China), 3.2 μL of PCR-grade water, 1 μL of diluted cDNA sample, 0.4 μL of forward primer and 0.4 μL of reverse primer. The special primer sequences of the target genes used in this study are shown in Table 1. The running condition of qRT-PCR as follow: 95°C for 1 min, and then 40 cycles of 95°C for 15s and 60°C for 10s. β-actin, a house-keeping gene, as the internal reference, and the 2−∆∆Ct method was applied to quantify the relative mRNA expression levels of target genes in heart tissues from each group (Wei et al., 2024).Table 1 Special primer sequences of target genes used in the present study for qRT-PCR.

Table 1Gene	Reference sequence	Primer sequence (5′→3′)	
GRP78	NM_205491.2	Forward: GAGAAGTTTGCTGAGGAAGA
Reverse: CCAGCTCCTTCTTCTTTGAT	
IRE1	NM_001285499.2	Forward: AGCATTGCAGGAGATGCTGT
Reverse: TGGAAGCTTGGTTTCCTCAA	
PERK	XM_040700435.2	Forward: TACAGGGGCCAGCTGTATCT
Reverse: ATTCATCCGACCCCACCAAC	
EIF-2α	NM_001006477.2	Forward: GCTGCGAGTCAGTAATGGGTATAA
Reverse: CTGCCAGGAAACTTGCCACA	
ATF4	NM_204880.3	Forward: TGCAACCATGGCGTTTTTCA
Reverse: GACTTTCCTCAGCCACCGAA	
ATF6	XM_052665884.1	Forward: AGCCCGACTCATTTCAGGAA
Reverse: CTGAACAAGTTGAAGGCGCT	
CHOP	XM_040693765.2	Forward: CAGAGGACAAAGCGGAAG
Reverse: CCATCCCATTCTGCTAAGC	
NLRP3	NM_001348947.2	Forward: GTCACCCATCCTTCCTCACTCATC
Reverse: GCAATGTCCATAGCAGCACCTTC	
ASC	NM_001040467.1	Forward: ACGGGTGACTCGGAGTTCTA
Reverse: GTACTGCTCTGGGGTGCAAT	
Caspase1	XM_015295935.4	Forward: CCTCATAGACACCGTACGCC
Reverse: AGCATTGTAGTCCTCTCTTGTGT	
GSDME	NM_001006361.2	Forward: TCGGGTAATGCCCTTTGCTT
Reverse: TCACCTCCGCTGTCTGTTTC	
IL-1β	NM_204524.1	Forward: ACTGGGCATCAAGGGCTACA
Reverse: GCTGTCCAGGCGGTAGAAGA	
IL-18	XM_015297948.4	Forward: GTAGCACAGGAAGCTGGTCA
Reverse: GAGGTGTTGCGTGAAAAGGG	
TNF-α	NM_204267	Forward: GCCCTTCCTGTAACCAGATG
Reverse: ACACGACAGCCAAGTCAACG	
IFN-γ	NM_205149.1	Forward: GCTGACGGTGGACCTATTATTGTAGAG
Reverse: TTCTTCACGCCATCAGGAAGGTTG	
IL-2	NM_204153.1	Forward: CTGTATTTCGGTAGCAATG
Reverse: ACTCCTGGGTCTCAGTTG	
IL-4	NM_001007079.1	Forward: GTGCCCACGCTGTGCTTAC
Reverse: AGGAAACCTCTCCCTGGATGTC	
IL-6	NM_204628.1	Forward: AAATCCCTCCTCGCCAATCT
Reverse: CCCTCACGGTCTTCTCCATAAA	
IL-10	NM_001004414.4	Forward: CGGGAGCTGAGGGTGAA
Reverse: GTGAAGAAGCGGTGACAGC	
β-actin	NM_205518.1	Forward: CCGCTCTATGAAGGCTACGC
Reverse: CTCTCGGCTGTGGTGGTGAA	

Total Proteins Extraction and Western Blot Analysis

In brief, 100 mg of frozen heart tissues were weighed to extract total proteins using 1 mL of western lysis buffer with 10 μL of PMSF. The concentrations of total proteins from each heart sample were detected using an enhanced BCA Protein Assay Kit (Beyotime, China) by a microplate reader, and the final concentration of total proteins in each sample was normalized to 3 μg/μL with phosphate buffer solution. For western blotting, 30 μg of total proteins for each sample were added to separate target proteins by 10% or 12% of sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The target proteins contained in the gels were transferred to nitrocellulose membranes by a trans-blot SD semidry electrophoretic transfer cell (Bio-Rad Laboratories, Hercules, CA) at 13 V for 40 min. The membranes with proteins were blocked using a 5% of skim milk for 2 h, and then incubated with the corresponding primary antibodies against PERK (WL03378, 1:1000, Wanleibio, China), ATF4 (WL02330, 1:1000, Wanleibio, China), CHOP (WL00880, 1:1000, Wanleibio, China), NLRP3 (WL02635, 1:1500, Wanleibio, China), Caspase1 (WL02996, 1:1000, Wanleibio, China), GSDMD (AF4012, 1:1000, Affinity, China), IL-18 (WL01127, 1:1500, Wanleibio, China), IL-1β (WL00891, 1:500, Wanleibio, China), IL-10 (WL03088, 1:1000, Wanleibio, China), TNF-α (WL01581, 1:1500, Wanleibio, China), and β-actin (ab8227, 1:7000, Abcam, UK) for 12 h at 4°C. Subsequently, the membranes were incubated with a secondary antibody of a goat antirabbit IgG labeled with horseradish peroxidase (1:10,000, Bioss Antibodies) for 1 h at room temperature after washing 3 times with TBST. The bands of target proteins were detected and visualized using the enhanced chemiluminescence kit (Beyotime, China) by a grayscale scanner (Gene-Gnome XRQ, Cambridge, UK). The intensities of protein bands were quantified using Image-Pro Plus 6.0 software (Media Cybernetic, MD), and the protein expression level was presented as the ratio of the intensity of each target protein to β-actin.

Statistical Analysis

In the present study, the statistical analysis of data was performed on SPSS 23.0 software. Before analysis, we used the Kolmogorov-Smirnov test to check the normality of data, and all data meet normal distribution. The 1-way ANOVA with Duncan's multiple comparison was applied to compare the differences in each index among treatment groups, and P < 0.05 was considered significant. All results were presented as mean ± SEM, and GraphPad Prism 8.0 software (Boston, MA) was used to draw the resulting pictures.

RESULTS

Resveratrol Improved the Body Weight and Feed Conversion Ratio of Cold-Exposed Broilers

The results of growth performance and feed intake of broilers during the CE period from d 29 to d 42 are shown in Figure 2A. Compared to the CON group, the ADG was reduced and the ADFI and FCR were increased in CE-broilers (P < 0.05). Besides, compared to the CE group, RES increased the ADG and improved the FCR of CE-broilers (P < 0.05), particularly in CE + RES500 group.Figure 2 Growth performance of broilers and histopathological analysis of heart tissues. (A) Average daily gain, average daily feed intake, and feed conversion ratio of broilers in each group. (B) Histopathological analysis of heart tissues in broilers by H&E staining. Red arrows indicate inflammatory cell infiltrations; Blue arrows indicate myocardial fiber fractures. a,b,c,d Bars with different superscripts in the same index are significantly different at P < 0.05, and bars with same or no superscripts represent no significant differences at P > 0.05.

Figure 2

Histopathological Observation

Figure 2B displays the results of H&E staining in heart tissues from each group. The heart tissues of broilers in the CON group exhibited normal, showing no significant damage. Broilers in the CE group appeared an obvious infiltration of inflammatory cells and rupture of cardiac muscle fibers. Overall, dietary RES supplementation reduced heart injuries reflected by less inflammatory cell infiltrations and myocardial fiber fractures, and this mitigation effect was obviously significant in the CE + RES500 group in comparison to CE + RES250 and CE + RES750 groups.

Resveratrol Alleviates Cold Exposure-Induced Oxidative Stress in Broiler Heart

The results of oxidative stress-related indexes in broiler heart are shown in Figure 3. Compared to the CON group, the concentrations of MDA and H2O2 were significantly increased and the activities of SOD and CAT were significantly decreased in CE, CE + RES250, CE + RES500, and CE + RES750 groups (P < 0.05) except SOD was not differential in CE + RES750 group (P > 0.05). Compared to the CE group, the concentrations of MDA and H2O2 were decreased and the activities of SOD and CAT were increased in all CE + RES groups (P < 0.05) except CAT was not differential in CE + RES250 group (P > 0.05).Figure 3 Measurement of oxidative stress-related indexes in heart tissues of broilers in each group. a,b,c,d Bars with different superscripts in the same index are significantly different at P < 0.05, and bars with same or no superscripts represent no significant differences at P > 0.05.

Figure 3

Resveratrol Alleviates ER Stress Caused by Cold Exposure in Broiler Heart

The relative mRNA and protein expression levels of ER stress-related genes are shown in Figure 4. As shown in Figure 4A, compared to the CON group, the mRNA expression of GRP78 in CE and CE + RES250 groups, IRE1 in CE, CE + RES500, and CE + RES750 groups, PERK in CE, CE + RES250, and CE + RES750 groups, ATF6 in CE and CE + RES750 groups, as well as EIF-2α, AFF4, and CHOP in CE and all CE + RES groups were upregulated (P < 0.05). There was no significant difference in the mRNA expression of GEP78, PERK, and ATF6 between CON and CE + RES500 groups (P > 0.05). Besides, compared to the CE group, the mRNA expression of GRP78, IRE1, PERK, EIF-2α, ATF4, ATF6, and CHOP in all CE-broilers was downregulated (P < 0.05) except EIF-2α, ATF4, and ATF6 were upregulated in the CE + RES750 group (P < 0.05).Figure 4 mRNA and protein expression levels of genes related to endoplasmic reticulum stress in broiler heart from each group. (A) Relative mRNA expression of GRP78, IRE1, PERK, EIF-2α, ATF4, ATF6, and CHOP in heart tissues. (B) Protein bands and expression levels of PERK, ATF4, and CHOP in heart tissues. a,b,c,d,e Bars with different superscripts in the same index are significantly different at P < 0.05, and bars with same or no superscripts represent no significant differences at P > 0.05.

Figure 4

As shown in Figure 4B, compared to the CON group, the protein expression of PERK in the CE group was increased (P < 0.05) but that in CE + RES250, CE + RES500, and CE + RES750 groups was decreased (P < 0.05). The protein levels of ATF4 in CE, CE + RES250, and CE + RES750 groups and CHOP in CE, CE + RES500, and CE + RES750 groups were higher than the CON group (P < 0.05). The protein level of ATF4 in the CE + RES500 group was reduced compared to the CON group (P < 0.05). Additionally, compared to the CE group, the protein expression levels of PERK, ATF4, and CHOP in CE + RES250, CE + RES500, and CE + RES750 groups were decreased (P < 0.05).

Resveratrol Alleviates Cold Exposure-Caused Pyroptosis in Broiler Heart

Figure 5 represents the immunofluorescence staining analysis results of NLRP3 in heart tissues of broilers in each group. The relative fluorescence intensity of NLRP3 in CE, CE + RES250, CE + RES500, and CE + RES750 groups was significantly higher than that in the CON group (P < 0.05). Compared to the CE group, the fluorescence intensity of NLRP3 in all RES-broilers was significantly reduced (P < 0.05), and its value in CE + RES250 and CE + RES500 groups was lower than CE + RES750 group (P < 0.05).Figure 5 Immunofluorescence staining results of NLRP3 in heart tissues of broilers in each group. (A) Immunofluorescence staining images of NLRP3 in broiler heart. (B) Relative immunofluorescence density of NLRP3 in heart tissues analyzed by Image-Pro Plus 6.0 software. a,b,c,d,e Bars with different superscripts represents significant difference among groups at P < 0.05.

Figure 5

The results of mRNA and protein expression levels of pyroptosis-related genes are shown in Figure 6. Figure 6A represents the relative mRNA expression results of genes in relation to pyroptosis in the broiler heart. Compared to the CON group, the mRNA expression of NLRP3, ASC, Caspase1, GSDME, IL-1β, and IL-18 in CE, CE + RES250, CE + RES500, and CE + RES750 groups was upregulated (P < 0.05) except ASC and IL-18 in CE + RES500 group and Caspase1 in CE + RES250 group were not differential (P < 0.05). Compared to the CE group, the mRNA expression levels of these pyroptosis-related genes in all CE + RES groups were downregulated (P < 0.05) except NLRP3 was not differential in CE + RES750 group (P > 0.05). The mRNA expression of these pyroptosis-related genes in the CE + RES500 group was lower than that in CE + RES250 and CE + RES750 groups (P < 0.05).Figure 6 mRNA and protein expression levels of genes related to pyroptosis in broiler heart from each group. (A) Relative mRNA expression of NLRP3, ASC, Caspase1, GSDME, IL-1β, and IL-18 in heart tissues. (B) Protein bands and expression levels of NLRP3, Caspase1, GSDMD, IL-1β, and IL-18 in heart tissues. a,b,c,d,e Bars with different superscripts in the same index are significantly different at P < 0.05, and bars with same or no superscripts represent no significant differences at P > 0.05.

Figure 6

As shown in Figure 6B, compared to the CON group, the protein expression levels of NLRP3, Caspase1, GSDMD, IL-18, and IL-1β in CE and all CE + RES groups were increased (P < 0.05) except NLRP3 in CE + RES250 and CE + RES500 groups and Caspase1 in CE + RES500 were reduced (P < 0.05), and IL-1β in CE + RES500 group was not differential (P > 0.05). Meanwhile, the protein expression levels of NLRP3, Caspase1, GSDMD, IL-18, and IL-1β in CE + RES250 and CE + RES500 groups were reduced compared to the CE group (P < 0.05), and their levels in the CE + RES500 group were lower than those in CE + RES250 and CE + RES750 groups (P < 0.05).

Resveratrol Alleviates Inflammation Induced by Cold Exposure in Broiler Heart

The relative mRNA and protein expression levels of inflammatory cytokines are shown in Figure 7. As shown in Figure 7A, compared to the CON group, the mRNA expression of TNF-α in CE and CE + RES750 groups, IFN-γ in CE, CE + RES250, and CE + RES750 groups, and IL-2 and IL-6 in CE, CE + RES250, CE + RES500, and CE + RES750 groups was upregulated (P < 0.05). The mRNA expression of IL-4 in CE, CE + RES250, and CE + RES750 groups and IL-10 in CE group was downregulated (P < 0.05), and IL-10 in CE + RES500 and CE + RES750 groups was upregulated (P < 0.05) compared to the CON group. There was no significant difference in the mRNA expression of TNF-α, IFN-γ, and IL-4 between both CON and CE + RES500 groups (P > 0.05). Compared to the CE group, the mRNA expression of TNF-α, IFN-γ, IL-2, and IL-6 was downregulated and that of IL-4 and IL-10 was upregulated in CE + RES250, CE + RES500, and CE + RES750 groups (P < 0.05) except TNF-α was increased in CE + RES750 group and IL-6 was not differential in CE + RES250 and CE + RES750 groups (P < 0.05).Figure 7 Expression levels of inflammatory cytokines in broiler heart in each group. (A) Relative mRNA expression of TNF-α, IFN-γ, IL-2, IL-4, IL-6, and IL-8 in heart tissues. (B) Protein bands and expression levels of TNF-α and IL-10 in heart tissues. (C) Concentrations of TNF-α, IFN-γ, IL-4, and IL-6 in heart tissues. a,b,c,d Bars with different superscripts in the same index are significantly different at P < 0.05, and bars with same or no superscripts represent no significant differences at P > 0.05.

Figure 7

As shown in Figure 7B, the protein expression level of TNF-α was increased and that of IL-10 was decreased in CE, CE + RES250, and CE + RES750 groups compared to the CON group (P < 0.05). The protein levels of TNF-α and IL-10 were not differential between CON and CE + RES500 groups (P < 0.05). Compared to the CE group, the protein level of TNF-α was reduced and IL-10 was increased in the CE + RES500 group (P < 0.05), and TNF-α was also increased in the CE + RES750 group (P < 0.05).

Additionally, Figure 7C represents the concentrations of inflammatory cytokines in heart tissues of broilers in each group. Compared to the CON group, the concentrations of IL-1β, TNF-α, and IFN-γ were significantly increased and IL-4 was significantly decreased in CE and all CE + RES groups (P < 0.05) except IL-1β in CE + RES500 and CE + RES750 groups and IL-4 in CE + RES500 group were not differential (P > 0.05). Compared to the CE group, the concentrations of IL-1β, TNF-α, and IFN-γ were reduced and IL-4 was increased in CE + RES500 and CE + RES750 groups (P < 0.05). Additionally, the concentration of TNF-α was decreased and that of IL-4 was increased in the CE + RES500 group compared to CE + RES250 and CE + RES750 groups (P < 0.05).

Discussion

Cold weather is one of the key environmental challenges in farm animal husbandry during the winter. Many studies indicated that cold exposure at 12°C and below decreases growth rate, causes oxidative stress, inflammatory response, and immune dysfunction, induces tissue injury, and increases the morbidity and mortality in broilers (Nemati et al., 2017; Bahadoran et al., 2021; Wei et al., 2024). This study found that CE impaired the average daily gain and feed conversion ratio and increased the feed intake of broilers, whereas dietary RES supplementation could relieve the negative effects of CE on the average daily gain and feed conversion ratio, suggesting that RES is an effective feed additive to improve the growth performance of cold-exposed broilers.

The heart plays vital roles in blood circulation and metabolism homeostasis. Our previous studies found that expose broilers to cold environment at 7°C or 10°C for 24 h impairs antioxidative defense function, increases the concentrations of H2O2 and MDA, and decreases the activities of CAT, SOD, and GSH-px, resulting in oxidative damage to the heart (Wei et al., 2018, 2023). MDA is a production of unsaturated fatty acids oxidation under oxidative stress, and CAT and SOD are key antioxidant enzymes that protect cells from damage induced by oxidative stress, wherein SOD can catalyze superoxide anion radicals into oxygen and H2O2, and then CAT decomposes H2O2 into oxygen and water (Lykkesfeldt and Svendsen, 2007). Similarly, in the present study, cold exposure at 8°C with 10 h per day for 14 d increased the concentrations of MDA and H2O2 and decreased the activities of SOD and CAT in broiler heart, implying that cold exposure induces oxidative stress.

RES is a natural plant antitoxin with antioxidative, anti-inflammatory, and antiaging properties. Accumulating studies reported that RES has health benefits for animals exposed to environmental pollutants and stimuli (Andrade et al., 2014; Bi et al., 2024b). For example, dietary RES addition could reduce heat or cold stress-induced oxidative stress damage in broilers and mice by improving antioxidative function, reflected by elevated CAT and SOD activities and decreased MDA concentration (Yin et al., 2015; Ding et al., 2023). This study showed that dietary RES supplementation increased the activities of SOD and CAT and decreased the concentration of MDA and H2O2 in the heart of cold-exposed broilers, which demonstrated that RES protects heart tissues from cold exposure by enhancing antioxidative defense capacity.

Oxidative stress induced by various stimuli is often related to pathological injury. The accumulation of reactive oxygen species occurs when intracellular redox balance is disrupted under oxidative stress conditions, which alters the biosynthesis and folding of protein in the ER and then causes ER stress (Verfaillie et al., 2012). ER stress is mediated by 3 ER-localized senser proteins, namely PERK, IRE1, and ATF6, which combine with the molecular chaperone GRP78 in the ER lumen and keep in an inactive state under normal physiological conditions (Schröder, 2008). Unfolded and misfolded proteins are significantly deposited in the ER lumen under ER stress, which triggers GRP78 to separate from senser proteins PERK, IRE1, and ATF6 on the ER membrane and to bind further with these unfolded proteins, thereby activating the downstream signaling pathways to induce inflammation, apoptosis, and pyroptosis (Eugene et al., 2020; Liu et al., 2024). Besides, PERK, ATF6, and IRE1 promote the ER unfolded protein response by activating downstream molecules, including ATF4, EIF-2α, CHOP and so on to eliminate unfolded and misfolded proteins in the ER lumen under stress conditions, relieving ER stress (Sage et al., 2012). A growing number of studies found that heavy metals, pesticides, and heat stress environment cause tissue damage via ER stress in chickens (Ma et al., 2022; Wang et al., 2023), and antioxidant RES can alleviate ER stress-induced injury by inhibiting oxidative stress in various tissues and cells, reflected by reduced the expression of GRP78, PERK, ATF6, IRE1, ATF4, EIF-2α, and CHOP (Gaballah et al., 2016; Bi et al., 2023). In this study, the expression levels of ER stress-related genes and proteins (GRP78, PERK, ATF6, IRE1, ATF4, EIF-2α, and CHOP) in heart tissues of broilers in the CE group were significantly higher than other groups, and their expression levels were evidently decreased in all CE + RES groups, particularly in the CE + RES500 group, compared to the CE group. These results indicated that cold exposure induces ER stress in broiler heart, and dietary resveratrol supplementation alleviates cold exposure-caused ER stress by inhibiting the PERK/EIF-2α/ATF4, ATF6, IRE1, and CHOP pathways, which could be realized by improving antioxidative capacity.

Pyroptosis is a pattern of programmed cell death than could be induced by proinflammatory mediators. Increasing evidence proves that ER stress caused by oxidative stress can promote pyroptosis by activating the NLRP3 inflammasome (Han et al., 2022; Tak et al., 2024). NLRP3 inflammasome is a multiprotein complex that composes of NLRP3, ASC, and Caspase1. The activation of NLRP3 inflammasome can assemble with ASC and Caspase1, which induces the cleavage and activation of Caspase1. NLRP3-activated inflammatory Caspase1 facilitates inactive pro-IL-1β into its biologically active form and cleaves GSDMD to release its N-terminus (Heneka et al., 2018). The N-terminus of GSDMD functions in the formation of holes in the plasma membrane, leading to the rupture of the plasma membrane and the release of proinflammatory cytokines and cellular contents, such as IL-1β and IL-18 to modulate inflammation and pyroptosis (Gaidt and Hornung, 2016). Studies reported that pathogenic bacteria or environmental pollutants induce pyroptosis by stimulating the expression of NLRP3 inflammasome pathway relevant factors, including NLRP3, ASC, Caspase1, IL-1β, and IL-18 (Bi et al., 2023; Nie et al., 2023). Furthermore, some studies found that NLRP3-regulated pyroptosis can be alleviated by inhibiting oxidative stress and ER stress through the enhancement of antioxidative capacity in liver and lung tissues (Han et al., 2022; Shi et al., 2023). In this study, the mRNA and protein expression levels of genes in relation to pyroptosis (NLRP3, ASC, Caspase1, GSDMD, IL-1β, and IL-18) were evidently increased in the CE group compared to other groups, whereas their expression levels in CE + RES250 and CE + RES500 groups, especially in CE + RES500 group, were significantly lower than those in the CE and CE + RES750 groups, indicating that cold exposure induces pyroptosis in broiler heart, and dietary RES (especially a 500 mg RES/kg diet) addition can effectively ameliorate pyroptosis, which is likely to the inhibition of the NLRP3 inflammasome pathway.

Additionally, pyroptosis is a kind of proinflammatory programmed cell death characterized by Caspase1 dependence, cell membrane destruction, and the release of proinflammatory factors (Wei et al., 2022). ER stress-modulated the activation of NLRP3 inflammasome can promote the secretion of proinflammatory factor IL-1β in a Caspase1-dependent manner, which further regulates inflammation (Li et al., 2020). Inflammation is a local protective response to tissue injury caused by stimuli and infections, while excessive inflammation also induces many diseases, such as inflammatory bowel disease, cancer, hepatitis, and so on (Burgos-Morón et al., 2019). Some studies have suggested that NLRP3 inflammasome-modulated pyroptosis is a key signaling pathway to induce inflammatory response via stimulating the expression of IL-1β, TNF-α, IL-6, and IL-8 in human and animals (Mijošek et al., 2016; Zhou et al., 2023). In the present study, compared to the CON group, the expression of proinflammatory cytokines TNF-α, IFN-γ, IL-2, and IL-6 was increased and that of ant-inflammatory cytokines IL-4 and IL-10 was decreased, and with a large amount of inflammatory cell infiltrations in heart tissues in the CE group, implying that cold exposure induces inflammation to broiler heart. This study also found that dietary RES supplementation, particularly a 500 mg RES/kg diet, can effectively alleviate cold exposure-caused inflammatory response in broiler heart by depressing the expression of TNF-α, IFN-γ, IL-2, and IL-6 and improving the expression of IL-4 and IL-10. Previous studies indicated that RES reduces inflammatory injury by decreasing the expression of IL-1β, IL-2, TNF-α, and IFN-γ in microglia and hepatic cells through the inhibition of NLRP3 inflammasome activation regulated by oxidative stress and ER stress (Tufekci et al., 2021; Bi et al., 2023). Therefore, the findings of this study suggest that RES can attenuate cardiac inflammation injury that might be realized by inhibiting pyroptosis in broilers.

CONCLUSION

The results of this study highlight that dietary resveratrol supplementation improved the body weight and feed conversion ratio of cold-exposed broilers. Besides, cold exposure induced oxidative stress and endoplasmic reticulum stress by destroying antioxidative defense system, which further caused pyroptosis and inflammatory response by activating the NLRP3 inflammasome, thereby leading to heart injury in broilers. Dietary resveratrol supplementation can alleviate cold exposure-induced injury via inhibiting NLRP3 inflammasome activation relevant pyroptosis and inflammation through the regulation of oxidative stress and endoplasmic reticulum stress. These results reveal the underlying mechanism of cold exposure-induced heart injury and protective effects of resveratrol on growth performance and heart health. Overall, this study suggests that resveratrol can be used as a dietary addition to prevent tissue damages induced by cold exposure in broilers living in the cold regions, and a 500 mg resveratrol/kg diet is an optimal feed addition dosage to reduce this damage. Further in vitro experiments should be constructed to further explore the molecular mechanisms of cold exposure and/or resveratrol on broiler heart.

DISCLOSURES

The authors confirm that there are no conflicts of interest.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

This study was supported by the National Natural Science Foundation of China (grant number 32172785 ).

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104203.
==== Refs
REFERENCES

Abbas G. Arshad M. Tanveer A.J. Jabbar M.A. Arshad M. AL-Taey D.K. Mahmood A. Khan M. Konca Y. Sultan Z. Qureshi R.A. Iqbal A. Amad F. Ashraf M. Mahmood R. Iqbal A. Combating heat stress in laying hens a review Pak. J. Sci. 73 2021 633 655
Abbas G. Mahmood S. ul Haq A. Nawaz H. Effect of dietary inclusion of sodium bicarbonate on production performance of caged layers during summer Pak. J. Zool. 54 2022 751
Andrade J.M.O. Paraíso A.F. de Oliveira M.V.M. Martins A.M.E. Neto J.F. Guimarães A.L.S. de Paula A.M. Qureshi M. Santos S.H.S. Resveratrol attenuates hepatic steatosis in high-fat fed mice by decreasing lipogenesis and inflammation Nutrition 30 2014 915 919 24985011
Bahadoran S. Hassanpour H. Arab S. Abbasnia S. Kiani A. Changes in the expression of cardiac genes responsive to thyroid hormones in the chickens with cold-induced pulmonary hypertension Poult. Sci. 100 2021 101263
Berman A.Y. Motechin R.A. Wiesenfeld M.Y. Holz M.K. The therapeutic potential of resveratrol: A review of clinical trials NPJ Precis. Oncol. 1 2017 35 28989978
Bi Y. Wei H. Yu T. Li X. Xu S. New insights into resveratrol attenuates hepatotoxicity in emamectin benzoate-exposed grass carp (Ctenopharyngodon idella) via NO system/NF-κB signaling pathway Pestic. Biochem. Physiol. 202 2024 105941
Bi Y. Wei H. Chai Y. Wang H. Xue Q. Li J. Intermittent mild cold acclimation ameliorates intestinal inflammation and immune dysfunction in acute cold-stressed broilers by regulating the TLR4/MyD88/NF-κB pathway Poult. Sci. 103 2024 103637
Bi Y. Li X. Wei H. Xu S. Resveratrol improves emamectin benzoate-induced pyroptosis and inflammation of Ctenopharyngodon idellus hepatic cells by alleviating oxidative stress/endoplasmic reticulum stress Fish Shellfish Immunol 142 2023 109148
Burgos-Morón E. Abad-Jiménez Z. Martinez de Maranon A. Iannantuoni F. Escribano-López I. López-Domènech S. Salom C. Jover A. Mora V. Roldan I. Solá E. Rocha M. Víctor V.M. Relationship between oxidative stress, ER stress, and inflammation in type 2 diabetes: The battle continues J. Clin. Med. 8 2019 1385 31487953
Chowdhury F.I. Yasmin T. Akter R. Islam M.N. Hossain M.M. Khan F. Aldhahrani A. Soliman M.M. Subhan N. Haque M.A. Alam M.A. Resveratrol treatment modulates several antioxidant and anti-inflammatory genes expression and ameliorated oxidative stress mediated fibrosis in the kidneys of high-fat diet-fed rats Saudi Pharm. J. 30 2022 1454 1463 36387333
Ding K.N. Lu M.H. Guo Y.N. Liang S.S. Mou R.W. He Y.M. Tang L.P. Resveratrol relieves chronic heat stress-induced liver oxidative damage in broilers by activating the Nrf2-Keap1 signaling pathway Ecotoxicol. Environ. Saf. 249 2023 114411
Eugene S.P. Reddy V.S. Trinath J. Endoplasmic reticulum stress and intestinal inflammation: A perilous union Frontiers in Immunology 11 2020 543022
Frémont L. Biological effects of resveratrol Life Sci 66 2000 663 673 10680575
Gaballah H.H. Zakaria S.S. Elbatsh M.M. Tahoon N.M. Modulatory effects of resveratrol on endoplasmic reticulum stress-associated apoptosis and oxido-inflammatory markers in a rat model of rotenone-induced Parkinson's disease Chem. Biol. Interact. 251 2016 10 16 27016191
Gaidt M.M. Hornung V. Pore formation by GSDMD is the effector mechanism of pyroptosis EMBO J 35 2016 2167 2169 27572465
Han D. Kim H. Kim S. Le Q.A. Han S.Y. Bae J. Shin H.W. Kang H.G. Han K.H. Shin J. Park H.W. Sestrin2 protects against cholestatic liver injury by inhibiting endoplasmic reticulum stress and NLRP3 inflammasome-mediated pyroptosis Experiment. Mol. Med. 54 2022 239 251
He S. Yu Q. He Y. Hu R. Xia S. He J. Dietary resveratrol supplementation inhibits heat stress-induced high-activated innate immunity and inflammatory response in spleen of yellow-feather broilers Poult. Sci. 98 2019 6378 6387 31406997
Heneka M.T. McManus R.M. Latz E. Inflammasome signalling in brain function and neurodegenerative disease Nat. Rev. Neurosci. 19 2018 610 621 30206330
Li N. Yi B.J. Saleem M.A.U. Li X.N. Li J.L. Autophagy protects against Cd-induced cell damage in primary chicken hepatocytes via mitigation of oxidative stress and endoplasmic reticulum stress Ecotoxicol. Environ. Saf. 259 2023 115056
Li W. Cao T. Luo C. Cai J. Zhou X. Xiao X. Liu S. Crosstalk between ER stress, NLRP3 inflammasome, and inflammation Appl. Microbiol. Biotechnol. 104 2020 6129 6140 32447438
Liu H. Meng H. Du M. Lv H. Wang Y. Zhang K. Chlorogenic acid ameliorates intestinal inflammation by inhibiting NF-κB and endoplasmic reticulum stress in lipopolysaccharide-challenged broilers Poult. Sci. 103 2024 103586
Lykkesfeldt J. Svendsen O. Oxidants and antioxidants in disease: oxidative stress in farm animals Vet. J. 173 2007 502 511 16914330
Ma B. Xing T. Li J. Zhang L. Jiang Y. Gao F. Chronic heat stress causes liver damage via endoplasmic reticulum stress-induced apoptosis in broilers Poult. Sci. 101 2022 102063
Mijošek V. Lasitschka F. Warth A. Zabeck H. Dalpke A.H. Weitnauer M. Endoplasmic reticulum stress is a danger signal promoting innate inflammatory responses in bronchial epithelial cells J. Innate Immun. 8 2016 464 478 27423489
Nemati M.H. Shahir M.H. Harakinezhad M.T. Lotfalhian H. Cold-induced ascites in broilers: effects of vitamin C and coenzyme Q10 Rev. Bras. Cienc. Avic. 19 2017 537 544
Nie X. Ma B. Liu L. Yuan X. Li M. Liu Y. Hou Y. Yang Y. Xu J. Wang Y. Endoplasmic reticulum stress mediated NLRP3 inflammasome activation and pyroptosis in THP-1 macrophages infected with Bacillus calmette-guérin Int. J. Mol. Sci. 24 2023 11692 37511451
Pamplona R. Costantini D. Molecular and structural antioxidant defenses against oxidative stress in animals Am. J. Physiol. Regul. Integr. Comp. Physiol. 301 2011 R843 R863 21775650
Sage A.T. Holtby-Ottenhof S. Shi Y. Damjanovic S. Sharma A.M. Werstuck G.H. Metabolic syndrome and acute hyperglycemia are associated with endoplasmic reticulum stress in human mononuclear cells Obesity 20 2012 748 755 21633399
Schröder M. Endoplasmic reticulum stress responses Cell. Mol. Life Sci. 65 2008 862 894 18038217
Shi Q. Qian Y. Wang B. Liu L. Chen Y. Chen C. Feng L. Chen J. Dong N. Glycyrrhizin protects against particulate matter-induced lung injury via regulation of endoplasmic reticulum stress and NLRP3 inflammasome-mediated pyroptosis through Nrf2/HO-1/NQO1 signaling pathway Int. Immunopharmacol. 120 2023 110371
Sun G. Song X. Zou Y. Teng T. Jiang L. Shi B. Dietary glucose ameliorates impaired intestinal development and immune homeostasis disorders induced by chronic cold stress in pig model Int. J. Mol. Sci. 23 2022 7730 35887078
Tak J. An Q. Lee S.G. Lee C.H. Kim S.G. Gα12 and endoplasmic reticulum stress-mediated pyroptosis in a single cycle of dextran sulfate-induced mouse colitis Sci. Rep. 14 2024 6335 38491049
Tang J. Bei M. Zhu J. Xu G. Chen D. Jin X. Huang J. Dong J. Shi L. Xu L. Hu B. Acute cadmium exposure induces GSDME-mediated pyroptosis in triple-negative breast cancer cells through ROS generation and NLRP3 inflammasome pathway activation Environ. Toxicol. Pharmacol. 87 2021 103686
Tripathi A. Kalita J. Kant S. Misra U.K. Oxidative stress and ER stress are related to severity of tubercular infection Microb. Pathog. 172 2022 105764
Tufekci K.U. Eltutan B.I. Isci K.B. Genc S. Resveratrol inhibits NLRP3 inflammasome-induced pyroptosis and miR-155 expression in microglia through Sirt1/AMPK pathway Neurotox. Res. 39 2021 1812 1829 34739715
Verfaillie T. Rubio N. Garg A.D. Bultynck G. Rizzuto R. Decuypere J.P. Piette J. Linehan C. Gupta S. Samali A. Agostinis P. PERK is required at the ER-mitochondrial contact sites to convey apoptosis after ROS-based ER stress Cell Death Differ 19 2012 1880 1891 22705852
Wang M.C. Wang Y.C. Peng H.W. Hseu J.R. Wu G.C. Chang C.F. Tseng Y.C. Resveratrol induces expression of metabolic and antioxidant machinery and protects tilapia under cold stress Int. J. Mol. Sci. 21 2020 3338 32397268
Wang M. Wang Y. Wang S. Hou L. Cui Z. Li Q. Huang H. Selenium alleviates cadmium-induced oxidative stress, endoplasmic reticulum stress and programmed necrosis in chicken testes Sci. Total Environ. 863 2023 160601
Wei H. Zhang R. Su Y. Bi Y. Li X. Zhang X. Li X. Li J. Bao J. Effects of acute cold stress after long-term cold stimulation on antioxidant status, heat shock proteins, inflammation and immune cytokines in broiler heart Front. Physiol. 9 2018 1589 30483152
Wei H. Li T. Zhang Y. Liu X. Gong R. Bao J. Li J. Cold stimulation causes oxidative stress, inflammatory response and apoptosis in broiler heart via regulating Nrf2/HO-1 and NF-κB pathway J. Therm. Biol. 116 2023 103658
Wei H. Zhang Y. Li T. Zhang S. Yin J. Liu Y. Xing L. Bao J. Li J. Intermittent mild cold stimulation alleviates cold stress-induced pulmonary fibrosis by inhibiting the TGF-β1/Smad signaling pathway in broilers Poult. Sci. 103 2024 103246
Wei X. Xie F. Zhou X. Wu Y. Yan H. Liu T. Huang J. Wang F. Zhou F. Zhang L. Role of pyroptosis in inflammation and cancer Cell. Mol. Immunol. 19 2022 971 992 35970871
Yin K. Zhao L. Feng D. Ma W. Liu Y. Wang Y. Liang J. Yang F. Bi C. Chen H. Li X. Lu Y. Cai B. Resveratrol attenuated low ambient temperature-induced myocardial hypertrophy via inhibiting cardiomyocyte apoptosis Cell. Physiol. Biochem. 35 2015 2451 2462 25967874
Zhang C. Zhao X.H. Yang L. Chen X.Y. Jiang R.S. Jin S.H. Geng Z.Y. Resveratrol alleviates heat stress-induced impairment of intestinal morphology, microflora, and barrier integrity in broilers Poult. Sci. 96 2017 4325 4332 29053872
Zhang S.S. Su H.G. Zhou Y. Li X.M. Feng J.H. Zhang M.H. Effects of sustained cold and heat stress on energy intake, growth and mitochondrial function of broiler chickens J. Integr. Agric. 15 2016 2336 2342
Zhou Z.Y. Bai S.J. Lu C.W. Yang B. Wang J. Lian S. Jian Z. Wang E. Wang G. Liu T. Nocardia seriolae mediates liver granulomatous chronic inflammation in Micropterus salmoides through pyroptosis J. Fish Dis. 46 2023 321 332 36644875
