
==== Front
Virulence
Virulence
Virulence
2150-5594
2150-5608
Taylor & Francis

39239724
10.1080/21505594.2024.2397492
2397492
Version of Record
Research Article
Research Article
ATP synthase subunit ATP5B interacts with TGEV Nsp2 and acts as a negative regulator of TGEV replication
Y. WANG ET AL.
VIRULENCE
Wang Yanan a b
Sun Aoying a b
Guo Yaru a b
Xin Lingxiang c
Jiang Yanping a b
Cui Wen a b
Li Jiaxuan a b
Li Yijing a b
https://orcid.org/0000-0002-8682-0696
Wang Li a b
a College of Veterinary Medicine, Northeast Agricultural University , Harbin, China
b China Ministry of Agriculture Key Laboratory of Animal Pathogen Biology, Northeastern Science Inspection Station , Harbin, China
c Division of Viral Biologic Testing(I), China Institute of Veterinary Drug Control , Beijing, China
CONTACT Li Wang wanglicau@163.com
Yijing Li yijingli@163.com
6 9 2024
2024
6 9 2024
15 1 2397492Integra06 9 2024
Integra06 9 2024
16 5 2024
08 7 2024
13 8 2024
© 2024 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
2024
The Author(s)
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The terms on which this article has been published allow the posting of the Accepted Manuscript in a repository by the author(s) or with their consent.

ABSTRACT

Coronavirus nonstructural protein 2 (Nsp2) is regarded as a virulence determinant and plays a critical role in virus replication, and innate immunity. Screening and identifying host cell proteins that interact with viral proteins is an effective way to reveal the functions of viral proteins. In this study, the host proteins that interacted with transmissible gastroenteritis virus (TGEV) Nsp2 were identified using immunoprecipitation combined with LC-MS/MS. 77 host cell proteins were identified as putative Nsp2 interaction host cell proteins and a protein-protein interaction (PPI) was constructed. The identified proteins were found to be associated with various subcellular locations and functional categories through Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. It is hypothesized that the host cell proteins interacting with TGEV Nsp2 are mainly involved in the formation of the cytoplasmic translation initiation complex, mRNA binding, ribosomes, and proteasomes. Among these, the ATP5B, a core subunit of the mitochondrial ATP synthase was further studied. The Coimmunoprecipitation (Co-IP) and indirect immunofluorescence (IFA) results confirmed that TGEV Nsp2 interacted with ATP5B. Furthermore, the downregulation of ATP5B expression was found to promote TGEV replication, suggesting that ATP5B might function as a negative regulator of TGEV replication. Collectively, our results offer additional insights into the functions of Nsp2 and provide a novel antiviral target against TGEV.

KEYWORDS

TGEV
ATP synthase
protein-protein interaction
GO and KEGG analyses
immunoprecipitation
National Key Research and Development Program of China 10.13039/501100012166 2022YFD1800800 Natural Science Foundation of Heilongjiang Province 10.13039/501100005046 YQ2021C020 This work was supported by the National Key Research and Development Program of China (2022YFD1800800), and the Natural Science Foundation of Heilongjiang Province (YQ2021C020).
==== Body
pmcIntroduction

Diarrhea is one of the leading causes of death in pigs. Coronaviruses (CoVs) are major pathogens of porcine diarrhea, leading to huge economic losses worldwide. Among four genera CoVs: alpha-, beta-, gamma-, and delta, transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), swine acute diarrhea syndrome-coronavirus (SADS-CoV), porcine deltacoronavirus (PDCoV) have been identified causing porcine diarrhea [1–4]. The transmissible gastroenteritis virus is a member of the Coronaviridae family and is an enveloped, positive-sense, single-stranded RNA virus with a genome size of approximately 28.6 kb [5]. The first two-thirds of the genome comprises ORF1a and ORF1b, encoding two large polyproteins (pp1a and pp1ab), proteolytically processed into 16 non-structural proteins (nsp1 to 16) [6].

TGEV Nsp2, a non-structural protein of approximately 85 kDa, was encoded by the replicase gene, which is composed of several functional domains [7]. Several studies have indicated that CoVs Nsp2 plays a critical role during viral infection and host innate immunity. Nsp2 of Murine Hepatitis Virus (MHV) and Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) is not necessary for viral replication in cell culture, but the deletion of the Nsp2 coding sequence attenuates viral growth and RNA synthesis [8]. MHV Nsp2 could be recruited to the double-membrane vesicles (DMVs)-anchored replication-transcription complexes (RTCs) and involved in DMVs transport in a microtubule-dependent manner [9]. Although Nsp2 is dispensable in virus replication, this protein may be more efficiently involved in other aspects during virus infection. SARS-CoV Nsp2 showed a wide range of interactions with other viral proteins including nsp3, nsp6, nsp8, nsp11, nsp16, and ORF 3a, the colocalization of replicase protein nsp8 with nsp2 with LC3, which is a protein marker for autophagic vacuoles [10–12]. Additionally, Recent papers showed that PEDV Nsp2 could interact with FBXW7 to circumvent the host antiviral response by targeting the ubiquitin-proteasome-mediated degradation of FBXW7 [13]. During the SARS-CoV-2 infection, Nsp2 significantly stimulated the type-I interferon (IFN) induction [14]. Our previous study has proved that TGEV Nsp2 exhibited a high potential for activating the NF-κB signaling pathway and enhancing the expression of pro-inflammatory cytokines [7]. Based on these results, it appears that Nsp2 not only serves as a pivotal regulator of host immunity activation but also plays a role in viral replication. Hence, uncovering host cell proteins interacting with Nsp2 holds paramount scientific significance in elucidating the functional mechanisms of Nsp2.

Here, to gain a more detailed knowledge of the virus-host interaction, through the integration of immunoprecipitation technique with LC-MS/MS, we discerned 77 putative proteins demonstrating interaction with TGEV Nsp2. Furthermore, the functional protein-protein interaction (PPI) analysis, GO enrichment, and KEGG pathway analysis were generated to predict the function of Nsp2. Furthermore, ATP5B is identified as an interacting protein of TGEV Nsp2 and could inhibit TGEV replication. Our study establishes a foundation for further investigation into the specific role of Nsp2 in TGEV replication, and contributing in the design of antiviral drugs for TGEV infection.

Materials and methods

Virus, cells, and plasmids

The TGEV TH-98 strain was isolated from the intestinal tract of TGEV-infected piglets in the Heilongjiang province of China (GenBank accession number: KU729220). Intestinal epithelial cell lines J2 and human embryonic kidney 293T cells were preserved in our laboratory and cultured in Dulbecco’s modified eagle medium (DMEM) (Gibco 12,491,015, USA) comprising a 10% concentration of fetal bovine serum (FBS). (Gibco 10,099,141, USA) at 37°C, with 5% CO2. The eukaryotic expression vectors pCMV-HA and pCMV-Myc were purchased from Clontech (635690 and 635,689, respectively, Japan). The eukaryotic expression plasmids of Nsp2, ATP5B, and Citrin, and the fragments of Nsp2 and ATP5B in this study were constructed in our laboratory. All primers used in this study are listed in Table 1.Table 1. The specific primers for PCR.

Gene name	Primer name	Primer sequence (5’-3’)	
Nsp2	Nsp2-F	TCGGGCCATGGAGGCCGCCATATATGTTGATCAATAC	
 	Nsp2-R	CGCCTCGAGACCACCCATTTTATTATACATTC	
ATP5B	ATP5B -F	AGCAGCAAGATGATCCAACG	
 	ATP5B -R	AAGAGGATGAGTACTTAGTTTGCC	
Citrin-1	Citrin-1-F	GGTGAGAGTGTCCCGTAGT	
 	Citrin-1-R	TCTGCATTCGAGTTTTCAC	
Citrin-2	Citrin-2-F	GCCACTGCTGTGTATCCTATT	
 	Citrin-2-R	AGCCTCTGTGGGACTCTAAT	
Myc-ATP5B	Myc-ATP5B F	GCGTCGACCATGATCCAACGGACGTGCCT	
 	Myc-ATP5B-R	TTGCGGCCGCTCATGAGTGCTCTTCAGCCAGTTTATC	
Myc-Citrin	Myc-Citrin-F	CCGGAATTCGGATGGCGGTCGCTAAGGTGG	
 	Myc-Citrin-R	CTCGAGCTATGGGCCTCCCCTGAG	
The restriction enzyme cutting sites are highlighted by underlines.

Antibodies

Mouse monoclonal antibodies (mAbs) against anti-β-actin and rabbit mAbs against Myc were purchased from Sigma (USA, A1978, M5546). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit, HRP-conjugated goat anti-mouse antibody, Fluorescein isothiocyanate isomer (FITC)-conjugated goat anti-mouse antibody, and Tetramethylrhodamine (TRITC)-conjugated goat anti-rabbit antibody was purchased from ZSGB-BIO (China, BA1054, BA1050, ZF0312, ZF0316). Mouse monoclonal antibodies (mAbs) against TGEV N were preserved in our lab. The ladder used for the western blot was purchased from Thermo Scientific (26617).

Immunoprecipitation (IP) and Co-immunoprecipitation (co-ip)

For immunoprecipitation, as previously described [15], pCMV-HA-Nsp2 transfected IPEC-J2 cells were washed and lysed in IP buffer (Beyotime, P0013G, China) containing a protease inhibitor cocktail (Sigma, P8340, USA). Cells were incubated on a shaker for 30 min at 4°C, followed by centrifugation at 12,000 g for 30 min. A total of the supernatants and 25 µL Pierce Anti-c-HA were incubated with gentle rocking overnight at 4°C. The beads were washed five times with cold PBST and boiled with 5× sodium dodecyl sulfate (SDS) loading buffer for 10 min. The samples were subjected to SDS-PAGE, western blot, and silver staining.

For co-immunoprecipitation, host protein-expressing plasmids and pCMV-HA-Nsp2 were co-transfected into HEK-293T cells. After 24 hours, the cells were lysed in IP buffer and subjected to precipitation with suitable antibodies along with magnetic beads, following the procedure described earlier. Subsequently, the samples were analyzed by western blot.

Western blot analysis

The protein samples were resolved by 8% SDS-PAGE and subsequently transferred to 0.22 μm PVDF membranes. Following blocking with 5% non-fat milk in PBST, the membranes were incubated with specific primary antibodies and treated with either HRP-conjugated goat anti-rabbit IgG or goat anti-mouse IgG. Blotted proteins were detected using the enhanced chemiluminescence (ECL) system.

Silver staining and mass spectrometric identification of proteins

According to the manufacturer’s protocols, the immunoprecipitated proteins were fractionated by electrophoresis on 10% SDS gel and the gel was stained by Pierce TM Silver Stain Kit (Thermo, USA). After determining the distinct bands between the Nsp2-expressing group and the control group, use a sterile blade to cut down the same position on two gels carefully. Put the bands into a sterile 2 mL Ep tube with an appropriate amount of ultrapure H2O. The protein bands were sent to the BGI company for Mass Spectrometry.

Confocal microscopy analysis

As previously described [16], HEK-293T cells were seeded in 12-well cell culture plates. When the cells reached a density of 70%–80%, they were co-transfected with pCMV-HA-Nsp2 and either pCMV-Myc-ATP5B or pCMV-Myc-Citrin for 24 h. Following transfection, the cells were fixed with ice-cold absolute ethanol for 30 min. They were then incubated with either mouse anti-HA (1:1,000) or rabbit anti-Myc (1:1,000) antibodies for 1 h at 37°C. After three washes with PBS, the cells were stained with FITC-conjugated (1:200) or TRITC-conjugated (1:200) secondary antibodies for 30 min at 37°C. Following another three washes with PBS, the cells were stained with 4,’6-diamidino-2-phenylindole (DAPI) (1:50) for 10 min at room temperature. After a final three washes with PBS, 5 µL of an anti-fluorescence quencher was added. The cells were then observed under a confocal microscope.

Construction and analysis of the PPI network

Based on experimentally derived data, the TGEV Nsp2-host proteins interaction network was performed by Search Tool for the Retrieval of Interacting Genes (STRING) (Version 11.5) database (https://string-db.org/). Cytoscape software is used to visualize and analyze networks [17,18]. A PPI network map was constructed for the co-expression, fusion, neighborhood, and co-localization of protein interactions. All proteins in the networks used the NCBI gene names to represent a consensus in protein accession with “Sus scrofa” being selected.

Gene ontology term and KEGG pathway enrichment analysis

Gene ontology (GO) term enrichment and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of all the proteins were performed by the DAVID online tool (DAVID, https://david-d.ncifcrf.gov/) [19,20]. GO biological functions and the KEGG pathway enrichment analysis were s plotted by http://www.bioinformatics.com.cn, a free online platform for data analysis and visualization. A p < 0.05 was regarded as statistically significant for the correlations.

SiRNA transfection

IPEC-J2 cells in 12-well plates were transfected with 10 pmol of negative control or specific SiRNAs against ATP5B with RNAiMAX (Invitrogen). Cells were cultured for at least 24 h prior to virus infections. The transfection was performed in antibiotic-free medium and cells were cultured for at least 24 h prior to virus infections.

Viral titer detection

The virus to be tested was diluted 10−1-10−8 in a sterilized EP tube. The above virus was added to the cells when the IPEC-J2 cells were grown in a 96-well plate monolayer. Four replicate wells were set for each dilution and the cells were placed in a 37°C, 5% CO2 incubator for continued culture. After 48 h, the TGEV N protein antibody was added for immunofluorescence detection, and the viral titer was calculated using the Reed-Muench method [21].

Quantitative real-time PCR

The cells were washed with PBS and total cellular RNA was extracted using RNA Rapid extraction kit, following the manufacturer’s instructions (Fastagen 220,010). Reverse transcription reactions were performed using random hexamers. The abundance of individual mRNA transcripts in each sample was assayed thrice using β-actin as an internal control. The relative transcript levels of ATP5B were calculated according to the 2−ΔΔCt threshold method.

Prediction of the interaction between ATP5B and diarrhea-associated coronavirus Nsp2 protein

The amino acid sequence of the ATP5B and Nsp2 of TGEV, PEDV, and PDCoV was submitted to the HDOCK (http://hdock.phys.hust.edu.cn/) web server for predicting the protein interaction model. The protein domains were colored and labeled using PyMOL(Version 2.5.0a0).

Statistical analysis

All experiments were repeated at least three times. The experimental data were statistically analyzed with Two-way repeated-measures ANOVA using GraphPad Prism software (version 9.0). P-values less than 0.05 were considered statistically significant, and those less than 0.01 were considered highly significant.

Result

Identification of host proteins interacting with TGEV Nsp2

Due to the expression level of the Nsp2 being important for subsequent interactome analysis, pCMV-HA-Nsp2 was transfected into IPEC-J2 cells and the cells were harvested at 12 h to 60 h respectively, subsequently, the samples were analyzed by western blotting. The results revealed that the expression of Nsp2 peaked at 24 hours post-transfection. (Figure 1), thus, we chose 24 h as the optimal time point to collect the samples for further experiments. To gain further insight into the molecular underpinnings of TGEV infection, we employed an LC-MS/MS approach to define the host cell proteins and complexes that physically interact with TGEV Nsp2. IPEC-J2 cells were transfected with plasmids expressing either HA-tagged Nsp2 or HA-tagged empty vector. Immunoprecipitation was carried out using Anti-HA Magnetic Beads 24 hours post-transfection, followed by separation of protein samples via SDS-PAGE and visualization through silver staining. Silver staining showed 5 distinct protein bands immunoprecipitated in Nsp2 overexpressing cells compared with the empty vector group (Figure 2a). Further, LC-MS/MS analysis identified 91 cellular proteins within 5 protein bands distinct from the empty vector control group. Among these, 77 proteins exhibiting high Confidence Indices (p < 0.05) were subjected to bioinformatics analysis (Figure 2b). The differentially expressed proteins were regarded as potential cellular interactors with Nsp2 during TGEV infection (Table 2). Figure 1. Expression of TGEV Nsp2. Western blot analysis of IPEC-J2 cell lysates at different time points after overexpression of Nsp2 was performed using anti-HA antibody and anti-β-actin antibody.

Figure 2. Identification of the cellular proteins that interact with TGEV Nsp2 by immunoprecipitation (IP). (a) pCMV-HA-Nsp2 and empty vector pCMV-ha were transfected into IPEC-J2 cells. 24 h later, the cell protein samples were collected, and the immunoprecipitation (IP) test was carried out with anti-HA magnetic beads. The obtained protein samples were dyed with protein glue silver. (b) Venn diagram of the identified protein candidates interacting with TGEV Nsp2 from mock infected.

Table 2. The list of proteins interacting with the TGEV Nsp2.

Accession	Gene Name	Mass	Score	Matches	Sequences	emPAI	Coverage	
Line1	
A0A0B8RVW3	GIGYF2	149374	3966	256(139)	44(31)	1.76	35%	
A0A287AZA7	RPS27A	18296	32	4(1)	3(1)	0.18	19%	
A0A0B8S089	EIF3A	166356	18	6(0)	4(0)	0.02	2%	
F1RSN8	CPSF1	160564	15	3(0)	3(0)	0.02	1%	
Line2	
Q6W4U4	env	74353	90	7(3)	5(2)	0.09	7%	
A0A286ZLI8	DDX17	72893	58	2(2)	2(2)	0.09	3%	
F1S895	NOP56	63302	55	2(2)	2(2)	0.11	3%	
F1RHH4	RPA1	65741	51	3(1)	2(1)	0.05	3%	
F1SCY2	IFIT3	58447	33	2(1)	2(1)	0.06	4%	
Line3	
F1SA70	HSPA2	69267	811	44 (34)	9(8)	0.66	13%	
A0A0B8RVW3	GIGYF2	149374	548	40(19)	14(8)	0.27	12%	
A0A286ZKD4	SLC25A13	75871	198	30(13)	13(10)	0.53	18%	
A0A286ZLI8	DDX17	72893	111	12(4)	10(3)	0.19	16%	
F8S32	Env	74280	109	7(3)	6(3)	0.14	7%	
K9IVR7	WDR1	66830	103	10(5)	7(4)	0.27	11%	
F1RR89	RARS	76096	101	7(3)	6(3)	0.13	10%	
A0A286ZZA4	RBM39	56028	97	9(2)	4(1)	0.12	9%	
A0A286ZQ07	SLC25A12	75440	95	15(7)	8(4)	0.19	12%	
F1RJE4	LOC100525876	57861	91	29(3)	10(3)	0.18	19%	
A0A287BFC9	RPN1	67142	83	8(2)	6(2)	0.1	12%	
A0A288CFV5	TF	80865	53	4(3)	3(2)	0.08	4%	
A8U4R4	tkt	68479	47	3(1)	3(1)	0.05	4%	
F1SS65	MYH2	223977	45	1(1)	1(1)	0.01	1%	
A0A287BSQ4	LAD1	54586	45	1(1)	1(1)	0.06	2%	
A0A0B8RVP0	NMT1	57140	43	3(1)	2(1)	0.06	4%	
I3LR32	CCT5	60082	43	7(1)	7(1)	0.05	13%	
F1RS49	ABCE1	68254	42	7(2)	5(1)	0.05	9%	
A0A287AL05	EIF3L	74589	40	1(1)	1(1)	0.04	1%	
A0A287AZA7	RPS27A	18296	39	6(1)	4(1)	0.18	25%	
Q0QEM6	ATP5B	47060	38	4(1)	3(1)	0.07	8%	
A0A286ZK05	OAS2	79098	37	9(1)	7(1)	0.04	9%	
A0A287AQG4	SYNCRIP	62845	35	5(1)	4(1)	0.05	8%	
A0A1K0H3U3	GLNB1	16142	35	6(1)	3(1)	0.21	20%	
I3L638	VTN	53191	34	1(1)	1(1)	0.06	2%	
A0A0B8RSI3	NOP58	60878	34	7(1)	6(1)	0.05	14%	
F1RHU1	PNKP	63113	33	4(1)	4(1)	0.05	6%	
A0A287A229	EHD1	60589	32	5(1)	3(1)	0.05	5%	
I3LIM2	UGDH	55719	31	2(1)	2(1)	0.06	4%	
F1SRE0	XRCC6	69852	30	1(1)	1(1)	0.05	2%	
I3LUM8	FARSB	67021	30	2(1)	2(1)	0.05	3%	
F1SKJ5	EIF3D	64548	27	1(1)	1(1)	0.05	2%	
B3VMR0	purH	64993	26	2(0)	2(0)	0.05	4%	
F1SE20	PLAT	65535	24	2(1)	2(1)	0.05	4%	
A0A286ZKW2	PSPC1	58466	16	2(0)	2(0)	0.06	4%	
F1SQF	OGG1	37110	16	1(0)	1(0)	0.09	3%	
Line 4	
Q0QEM6	ATP5B	47060	189	10(8)	4(3)	0.31	11%	
G9F6X8	P4HB	56763	71	6(3)	6(3)	0.18	11%	
F1SA70	HSPA2	69267	56	3(2)	3(2)	0.1	6%	
E1CAJ5	grp-58	57279	55	5(3)	5(3)	0.18	11%	
Q2YGT7	RPL10	3667	38	1(1)	1(1)	1.03	37%	
F2Z5J1	PSMC1	49325	36	9(2)	5(2)	0.14	12%	
A0A287AJY2	TCP1	58499	32	2(1)	1(1)	0.06	1%	
A0A288CFV5	TF	80865	31	1(1)	1(1)	0.04	1%	
A0A287BLN0	CLK3	492770	30	1(1)	1(1)	0.07	1%	
A0A1K0H3U3	GLNB1	16142	28	2(1)	1(1)	0.21	6%	
F1SS65	MYH2	223977	27	2(1)	2(1)	0.01	1%	
A0A287AEM2	RPS5	25546	27	3(1)	2(1)	0.13	4%	
Line 5	
P02554	Beta-Tubulin	50285	711	61(37)	13(9)	1.14	32%	
A0A286ZKZ0	LOC106507258	54783	183	18(10)	8(6)	0.42	14%	
A0A287A9V9	LOC100523670	55292	183	15(9)	8(6)	0.41	13%	
F1RKW8	PSMD11	47634	106	13(4)	9(4)	0.31	20%	
F1SGF1	PSMD6	52629	84	13(3)	8(2)	0.13	18%	
F1S4Y8	EIF2S2	38591	81	2(2)	2(2)	0.18	6%	
B2MUB6	SCAMC-1	53459	80	10(4)	6(3)	0.2	13%	
F1RGC9	PSMD13	43125	74	12(3)	7(3)	0.25	15%	
A0A286ZL11	KRT80	49049	51	1(1)	1(1)	0.07	2%	
G3CKJ2	GAPDH	29621	50	2(1)	2(1)	0.11	8%	
A0A287B7U2	NSUN4	42264	47	4(1)	3(1)	0.08	8%	
A0A287A4Y1	NEFL	65767	45	2(1)	2(1)	0.1	2%	
A0A286ZI27	IFI44L	41223	45	2(1)	1(1)	0.08	3%	
A0A287BPB7	PPP2R2A	53489	43	4(2)	3(2)	0.13	7%	
A0A287A044	GOT2	44052	43	1(1)	1(1)	0.07	3%	
F1S1G0	EIF3E	52587	42	1(1)	1(1)	0.06	2%	
A0A287A558	UQCRC1	58712	39	2(1)	2(1)	0.12	4%	
A0A287B2M3	RPSA	30802	36	1(1)	1(1)	0.11	4%	
F1RPH0	PGK1	44945	36	7(1)	6(1)	0.07	12%	
F1S396	NOB1	46681	32	5(1)	2(1)	0.07	4%	
F1RFI1	TUFM	49762	31	9(1)	8(1)	0.07	25%	
A0A286ZJV6	ANXA2	47318	30	2(1)	2(1)	0.07	5%	
K7GS49	ILF2	43251	30	10(2)	3(2)	0.16	9%	
F1SL15	TRMT10C	48551	28	5(1)	4(1)	0.07	8%	
A0A287APM9	HSPA8	65277	27	4(0)	3(0)	0.05	7%	
F1SAM0	DSC1	101394	24	2(1)	2(1)	0.03	2%	
A0A287B492	TSR3	31088	20	1(0)	1(0)	0.11	6%	
A0A287BIX8	APPBP2	59279	19	4(0)	1(0)	0.06	2%	
A0A287AXR5	YWHAZ	26837	15	1(0)	1(0)	0.12	5%	

Construction and analysis of the protein-protein interactions (PPI) network

The construction and analysis of the protein-protein interactions network are of great significance for understanding protein functions and relationships. The Nsp2-cellular protein interaction network construction from the STRING database demonstrated that these target proteins had complex interactions and the observed number of edges for the network were greater than the expected numbers based on the given number of nodes (Figure 3). This means that the proteins are more likely to interact with each other and compose into protein complexes for executing biological functions in viral replication. The enrichment of this PPI indicated that the proteins are partially clustered as a group of roles in translation initiation factor activity and protein folding and ATP-dependent peptidase activity. Figure 3. Construction and analysis of the protein-protein interactions (PPIs) network using STRING database. Each edge color indicates a different method of PPIs prediction in the legend below the figure. Proteins are labeled with their respective NCBI gene names.

Gene ontology annotation and analysis

To further reveal the functions of proteins that interact with Nsp2 we performed bioinformatics analysis of 77 highly confident proteins. Annotations encompassing biological processes, cellular components, and molecular functions were depicted based on their respective p-values (Figure 4a). The proteins were enriched in regulation of translational, viral translation termination-reinitiation, formation of translation preinitiation complex, and protein stabilization, and the other proteins as reported by analysis of biological process were mostly related to the metabolic process. Furthermore, nucleic acid binding, ATP binding, and translation initiation factor activity were enriched under the category of molecular function. For cellular components, the host proteins were mainly the components of the nuclear lumen, intracellular organelle lumen, and ribonucleoprotein complex. The GO annotation and analysis of all target proteins inferred that Nsp2 might be involved in the regulation of translation initiation, ATP binding, and mRNA binding. Figure 4. Gene ontology analysis and KEGG pathway enrichment analysis of identified Nsp2-host interactome. (a) The annotation of proteins interacting with TGEV Nsp2 using gene ontology. They were displayed for significantly enriched terms in biological process (BP), molecular function (MF), and cellular component (CC) categories with a p-value <0.05. (b) Classification of the top 20 cellular protein-enriching KEGG pathways interacting with TGEV Nsp2. The terms that were significantly enriched (p < 0.05) were shown.

KEGG pathway enrichment analysis

To further understand and predict the pathway enrichment of proteins interacting between Nsp2 and host protein, we analyzed KEGG pathway enrichment and listed the top twenty enrichment pathways (Figure 4b). Based on the results of the KEGG pathway, indicated that the identified proteins may be involved in the biosynthesis of amino acids, carbon metabolism, proteasome, ribosome, RNA transport, and ribosome biogenesis in eukaryotes. The proteasome pathway plays a crucial role in various viral infections, host cell proteins can degrade PEDV N protein through the proteasome pathway to inhibit viral infections [22]. Also, the PRRSV E protein actively degrades the anti-viral gene pCH25H through the ubiquitin-proteasome pathway [23]. The results suggest that these proteins play a potential role in PEDV infection. Based on the high protein scores and recognized functions of TGEV Nsp2 during TGEV infection in the host, we selected ATP5B and Citrin for further verification.

Validation of interactions between Nsp2 and cellular proteins

To confirm the interaction of Nsp2 proteins with the host cell proteins identified in the network above, we selected HSPA2, PSMD11, ATP5B and Citrin for validation [24,25]. The genes encoding ATP5B and Citrin were amplified and inserted into the pCMV-Myc vector. The sequences of porcine ATP5B and Citrin genes have been deposited in GenBank with accession numbers XM_001929410.5 and XP_003130208.3, respectively. Subsequently, HEK-293T cells were co-transfected with either pCMV-HA-Nsp2 or empty vector pCMV-HA, along with one of the eukaryotic expression plasmids for ATP5B and Citrin, respectively. At 24 h post-transfection, cells were collected for performing the Co-IP with anti-HA Magnetic Beads, and then the samples were subjected to western blot by using anti-Myc and anti-HA antibodies. The findings revealed that both ATP5B and Citrin were detectable only in the presence of Nsp2, but not in the presence of the empty vector (Figure 5a–b). Furthermore, confocal microscopy illustrated the colocalization of the Nsp2 and the host proteins in the cytoplasm of the HEK-293T cells (Figure 5c–d). Figure 5. Confirmation of the interaction of TGEV Nsp2 with ATP5B and Citrin. (a)-(b) plasmids expressing host cell protein were co-transfected with PCMV-HA- Nsp2 into HEK-293T cells, while plasmids co-transfected with host cell protein and pCMV-ha cells were used as negative controls. 24 h after transfection, Co-ip assay was performed using anti-c-ha magnetic beads, followed by Western blot assay using HA and Myc monoclonal antibodies. (c)-(d) the plasmid expressing host cell protein and pCMV-HA-Nsp2 were co-transferred into IPEC-J2 cells, and the co-localization was observed by confocal laser microscopy 24 h after transfection.

The expression of ATP5B was down-regulated after TGEV infection

To explore the effect of TGEV infection on ATP5B expression, the protein of IPEC-J2 cells infected with TGEV at different time points was extracted, and the protein expression level of ATP5B was detected by qPCR and Western blot (Figure 6a–b). The results showed that TGEV infection could significantly inhibit the expression of ATP5B, and there was no change in ATP5B expression in the control group. Figure 6. The expression of ATP5B was down-regulated after TGEV infection. The expression level of ATP5B in IPEC-J2 cells at different time points after TGEV infection was detected by QPCR (a) or Western blot (b).

ATP5B can inhibit the replication of TGEV

Given the key role of ATP5B in viral infection and energy synthesis [26,27], we further investigated the effect of ATP5B on TGEV infection, ATP5B was overexpressed in IPEC-J2 cells, and the cells were inoculated with TGEV 24 hours later, and cell samples were collected at different time points to detect virus titers (Figure 7a–b). The results showed that overexpression of ATP5B had no significant effect on TGEV replication 12–48 hours post-infection (hpi), and a significant decrease was observed at 60 hpi (Figure 7c). Furthermore, RNAi technology was used to interfere with the expression of ATP5B in IPEC-J2 cells, and the interference efficiency of SiRNA was detected by Western blot 24 hours later. The results showed that the interference sequence could significantly inhibit the expression of ATP5B, while negative control had no effect on the expression of ATP5B (Figure 7d). In order to determine whether RNA interference with ATP5B can affect cell viability, cell activity was detected by the CCK-8 method. The results showed that there was no significant difference in the activity of cells in RNAi group, RNAi negative control group, and control cells, indicating that interference with ATP5B does not affect cell activity (Figure 7e). To determine the effect of ATP5B on TGEV replication, SiRNA was used to interfere with ATP5B expression in IPEC-J2 cells, TGEV was inoculated 24 h later, and total cell cultures were collected at different time points (12 h-72 h) after viral infection. The results showed that the virus titers interfering with ATP5B cells increased significantly 24 to 48 hours after inoculation, indicating that ATP5B could inhibit viral replication (Figure 7f). Figure 7. ATP5B inhibits TGEV replication. (a) Western blot and IFA (b) were used to detect ATP5B overexpression. pCMV-myc-ATP5B and pCMV-myc were transfected into IPEC-J2 cells for Western blot and IFA assay 24 hours later. (c) ATP5B was overexpressed in IPEC-J2 cells and TGEV was inoculated 24 h later. Total cell cultures were collected at different time points (12 h-72 h) after infection, virus titer was detected, and a one-step growth dynamic curve was drawn. (d) Relative protein expression levels of ATP5B in cells transfected with SiRNAs against ATP5B and control SiRNA analyzed by western blot analysis with anti-ATP5B polyclonal antibodies. (e) Assay of cell viability after transfection with SiRNA. (f) SiATP5B was transfected into IPEC-J2 cells and TGEV was inoculated 24 h later. Total cell cultures were collected at different time points (12 h-72 h) after infection, virus titer was detected, and a one-step growth dynamic curve was drawn.

Discussion

When a virus infects host cells, the host cells can resist pathogen invasion through various pathways, but the virus regulates cellular activities directly or indirectly by interacting with host proteins, thereby facilitating its replication. Nsp2 is one of the large non-structural proteins of coronaviruses. Although some studies suggest that Nsp2 is not essential for virus replication, its absence results in decreased virus replication and RNA synthesis [8,9,12]. Recent research shows that CoV Nsp2 as a novel virulence determinant proposes a crucial role of Nsp2 in diminishing innate antiviral immunity by targeting TBK1 for NBR1-mediated selective autophagy [28]. During the regulation of virus replication, a large number of host cell proteins are involved, but research on Nsp2 related to TGEV is limited. Therefore, to explore the biological function of Nsp2 and the molecular mechanisms underlying its function, this study screened host cell proteins interacting with TGEV Nsp2 and used bioinformatics analysis to elucidate the functions of its interacting proteins, thus revealing the biological function of Nsp2.

Through IP tandem LC-MS/MS technology, we obtained a total of 77 highly credible (p < 0.05) host cell proteins interacting with TGEV Nsp2 and drew a PPI network. The results of the PPI network analysis show that there are complex interactions between host cell proteins, which implies that some host cells may not directly interact with Nsp2, but instead form complexes to participate in various biological processes and virus infection processes. The biological function of the Nsp2-interacting protein was elucidated through bioinformatics analysis. GO analysis showed that these proteins were involved in the formation of cytoplasmic translation initiation complex, positive regulation of mRNA binding, ribosomal and proteasome assembly. The analysis results showed that 20% of the host proteins are involved in protein phosphorylation. These results suggest that Nsp2 may directly participate in regulating the phosphorylation process of proteins, which consist with our previous results that Nsp2 activates the NF-κB signaling pathway by inducing the phosphorylation of p65 [7]. Also, KEGG pathway analysis showed that Nsp2-interacting protein was enriched in the proteasome, spinocerebellar ataxia, biosynthesis of amino acids, and protein processing in the endoplasmic reticulum. Previous studies have shown that the protein processing in endoplasmic reticulum and proteasome system is vital in CoVs replication [29–32]. The GO and KEGG analyses of interacting host proteins revealed that Nsp2 likely modulates the host metabolic response translation system during TGEV infection.

To validate the accuracy of the mass spectrometry results and select host cell proteins closely related to TGEV replication and pathogenesis, we chose several host cell proteins to further verified their interaction with Nsp2. Co-IP and IFA results both indicate that there is an interaction between host cell proteins ATP5B and Citrin with Nsp2, and the expression of Nsp2 did not cause a change in the expression localization of porcine ATP5B and Citrin. Given the high score of ATP5B in the mass spectrometry results and its biological functions, we selected ATP5B for further study. ATP synthase is an enzyme that generates ATP from the ADP by harnessing electrochemical energy across the inner membrane during the oxidative phosphorylation pathway [33]. ATP5B is the β subunit of the ATP synthase F1 domain, which regulates the division and fusion of mammalian cell mitochondria [33–36]. Studies have shown that ATP and ATP synthase play a vital role in providing the energy needed for complete steps of the viral replication cycle, such as DNA packaging and capsid maturation [37]. ATP5B has been identified as an essential factor for HBV entry into the cells [38]. Also, ATP5B can interact with the 3 ‘UTR region of Rotavirus (RV) to promote its maturation in primary intestinal epithelial cells, suggesting that ATP5B is an important host cell protein supporting RV replication [27]. ATP5B could promote the formation of Herpes simplex virus 1 (HSV-1) virus synapses, thereby promoting viral replication and virus transfer between cells. In this study, our results show that the expression of ATP5B decreases after TGEV infection, and knocking down the expression of ATP5B can promote TGEV replication, while when ATP5B is overexpressed in IPEC-J2 cells, there is no obvious effect on TGEV replication. This may be due to the high expression of ATP5B in IPEC-J2 cells. Overall, this may be a strategy used by the virus to promote its replication by inhibiting the expression of ATP5B. Additionally, we predicted potential interactions between ATP5B and the Nsp2 proteins of diarrhea-associated coronavirus. The results indicate that ATP5B has the potential to interact with the Nsp2 proteins of PEDV and PDCoV (Figure 8), suggesting that ATP5B might be involved in regulating the replication of PEDV and PDCoV. However, further experiments are needed to verify the specific mechanisms involved. Figure 8. Prediction of protein-protein interaction between ATP5B and diarrhea-associated coronavirus Nsp2 protein. Blue represents coronavirus Nsp2, green represents ATP5B protein, red represents the interaction site in ATP5B, and yellow represents the interaction site in Nsp2.

In summary, a total of 77 host cell proteins that may interact with TGEV Nsp2 proteins were identified by combining Co-IP and LC/MS-MS. These proteins are enriched in a variety of signaling pathways, including biosynthesis of amino acids, proteasome, ribosome, and RNA transport, and are involved in a variety of biological processes. Among the identified proteins, ATP5B was able to inhibit TGEV replication. Our findings should help elucidate the biological function of Nsp2 in TGEV replication and provide the scientific basis for the development of antiviral drugs.

Authors contributions

Li Wang and Yijing Li designed and provided expertise the study. Yanan Wang, Aoying Sun, Yaru Guo, Lingxiang Xin, Yanping Jiang, Wen Cui and Jiaxuan Li performed the experiments. Yanan Wang prepared and revised the manuscript. All authors read and approved the manuscript.

Data availability statement

The Data generated during the study is available at Mendeley Data at http://doi.org/10.17632/c48bx8fbw4.1.

Disclosure statement

No potential conflict of interest was reported by the author(s).
==== Refs
References

[1] Garwes DJ. Transmissible gastroenteritis. Vet Rec. 1988;122 (19 ):462–13. doi: 10.1136/vr.122.19.462 2839932
[2] Jung K, Saif LJ, Wang Q. Porcine epidemic diarrhea virus (PEDV): an update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020;286 :198045. doi: 10.1016/j.virusres.2020.198045 32502552
[3] Yang Y-L, Yu J-Q, Huang Y-W. Swine enteric alphacoronavirus (swine acute diarrhea syndrome coronavirus): an update three years after its discovery. Virus Res. 2020;285 :198024–. doi: 10.1016/j.virusres.2020.198024 32482591
[4] Jung K, Hu H, Saif LJ. Porcine deltacoronavirus infection: etiology, cell culture for virus isolation and propagation, molecular epidemiology and pathogenesis. Virus Res. 2016;226 :50–59. doi: 10.1016/j.virusres.2016.04.009 27086031
[5] Eleouet JF, Rasschaert D, Lambert P, et al. Complete sequence (20 kilobases) of the polyprotein-encoding gene 1 of transmissible gastroenteritis virus. Virology. 1995;206 (2 ):817–822. doi: 10.1006/viro.1995.1004 7856095
[6] Putics Á, Gorbalenya AE, Ziebuhr J. Identification of protease and adp-ribose 1″-monophosphatase activities associated with transmissible gastroenteritis virus non-structural protein 3. J Gen Virol. 2006;87 (3 ):651–656. doi: 10.1099/vir.0.81596-0 16476987
[7] Wang L, Qiao X, Zhang S, et al. Porcine transmissible gastroenteritis virus nonstructural protein 2 contributes to inflammation via nf-κB activation. Virulence. 2018;9 (1 ):1685–1698. doi: 10.1080/21505594.2018.1536632 30322331
[8] Graham RL, Sims AC, Brockway SM, et al. The nsp2 replicase proteins of murine hepatitis virus and severe acute respiratory syndrome coronavirus are dispensable for viral replication. J Virol. 2005;79 (21 ):13399–13411. doi: 10.1128/JVI.79.21.13399-13411.2005 16227261
[9] Hagemeijer MC, Verheije MH, Ulasli M, et al. Dynamics of coronavirus replication-transcription complexes. J Virol. 2010;84 (4 ):2134–2149. doi: 10.1128/JVI.01716-09 20007278
[10] von Brunn A, Teepe C, Simpson JC, et al. Analysis of intraviral protein-protein interactions of the SARS coronavirus ORFeome. PLOS ONE. 2007;2 (5 ):e459–e. doi: 10.1371/journal.pone.0000459 17520018
[11] Ja P, Peng X, Gao Y, et al. Genome-wide analysis of protein-protein interactions and involvement of viral proteins in SARS-CoV replication. PLOS ONE. 2008;3 (10 ):e3299–e. doi: 10.1371/journal.pone.0003299 18827877
[12] Prentice E, McAuliffe J, Lu X, et al. Identification and characterization of severe acute respiratory syndrome coronavirus replicase proteins. J Virol. 2004;78 (18 ):9977–9986. doi: 10.1128/JVI.78.18.9977-9986.2004 15331731
[13] Li M, Wu Y, Chen J, Gallagher T. Innate immune evasion of porcine epidemic diarrhea virus through degradation of F-box and WD repeat domain-containing 7 protein via ubiquitin-proteasome pathway. J Virol. 2021;96 (5 ):Jvi0088921. doi: 10.1128/jvi.00889-21
[14] Lei X, Dong X, Ma R, et al. Activation and evasion of type I interferon responses by SARS-CoV-2. Nat Commun. 2020;11 (1 ):3810–. doi: 10.1038/s41467-020-17665-9 32733001
[15] Wang L, Zhou L, Zhang H, et al. Interactome profile of the host cellular proteins and the nonstructural protein 2 of porcine reproductive and respiratory syndrome virus. PLOS ONE. 2014;9 (6 ):e99176. doi: 10.1371/journal.pone.0099176 24901321
[16] Wang Y, Sun A, Sun Y, et al. Porcine transmissible gastroenteritis virus inhibits nf-κB activity via nonstructural protein 3 to evade host immune system. Virol J. 2019;16 (1 ):97. doi: 10.1186/s12985-019-1206-9 31382996
[17] Shannon P, Markiel A, Ozier O, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13 (11 ):2498–2504. doi: 10.1101/gr.1239303 14597658
[18] Szklarczyk D, Gable AL, Nastou KC, et al. The STRING database in 2021: customizable protein–protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021;49 (D1 ):D605–D612. doi: 10.1093/nar/gkaa1074 33237311
[19] Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4 (1 ):44–57. doi: 10.1038/nprot.2008.211 19131956
[20] Huang da W, Sherman BT, Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009;37 (1 ):1–13. doi: 10.1093/nar/gkn923 19033363
[21] Wu J, Chi H, Fu Y, et al. The antiviral protein viperin interacts with the viral N protein to inhibit proliferation of porcine epidemic diarrhea virus. Arch Virol. 2020;165 (10 ):2279–2289. doi: 10.1007/s00705-020-04747-8 32719955
[22] Qin W, Kong N, Zhang Y, et al. PTBP1 suppresses porcine epidemic diarrhea virus replication via inducing protein degradation and IFN production. J Biol Chem. 2023;299 (8 ):104987. doi: 10.1016/j.jbc.2023.104987 37392846
[23] Ke W, Fang L, Tao R, et al. Porcine reproductive and respiratory syndrome virus E protein degrades porcine cholesterol 25-hydroxylase via the ubiquitin-proteasome pathway. J Virol. 2019;93 (20 ):93. doi: 10.1128/jvi.00767-19
[24] Sun WY, Jiang Y. Study on interaction between transmissible gastroenteritis virus Nsp2 and host cell protein PSMD11. China Anim Husb Vet Med. 2021;48 :2569–2576. doi: 10.16431/j.cnki.1671-7236.2021.07.033
[25] Wang HL, Sun A. Interaction between host cell protein HSPA2 and TGEV Nsp2 and its effect on virus replication. Heilongjiang Anim Sci Vet Med. 2020:1–6+14+175. doi: 10.13881/j.cnki.hljxmsy.2020.02.0030
[26] Zheng SQ, Li YX, Zhang Y, et al. MiR-101 regulates HSV-1 replication by targeting ATP5B. Antiviral Res. 2011;89 (3 ):219–226. doi: 10.1016/j.antiviral.2011.01.008 21291913
[27] Ren L, Ding S, Song Y, et al. Profiling of rotavirus 3′UTR-binding proteins reveals the ATP synthase subunit ATP5B as a host factor that supports late-stage virus replication. J Biol Chem. 2019;294 (15 ):5993–6006. doi: 10.1074/jbc.RA118.006004 30770472
[28] Jiao Y, Zhao P, Xu LD, et al. Enteric coronavirus nsp2 is a virulence determinant that recruits NBR1 for autophagic targeting of TBK1 to diminish the innate immune response. Autophagy. 2024;20 (8 ):1–18. doi: 10.1080/15548627.2024.2340420 37848407
[29] Xue M, Fu F, Ma Y, et al. The PERK arm of the unfolded protein response negatively regulates transmissible gastroenteritis virus replication by suppressing protein translation and promoting type I interferon production. J Virol. 2018;92 (15 ):92. doi: 10.1128/jvi.00431-18
[30] Shaban MS, Müller C, Mayr-Buro C, et al. Multi-level inhibition of coronavirus replication by chemical ER stress. Nat Commun. 2021;12 (1 ):5536. doi: 10.1038/s41467-021-25551-1 34545074
[31] Bartolini D, Stabile AM, Vacca C, et al. Endoplasmic reticulum stress and nf-kB activation in SARS-CoV-2 infected cells and their response to antiviral therapy. IUBMB Life. 2022;74 (1 ):93–100. doi: 10.1002/iub.2537 34390301
[32] Longhitano L, Tibullo D, Giallongo C, et al. Proteasome inhibitors as a possible therapy for SARS-CoV-2. Int J Mol Sci. 2020;21 (10 ):3622. doi: 10.3390/ijms21103622 32443911
[33] Neupane P, Bhuju S, Thapa N, et al. ATP synthase: structure, function and inhibition. Biomol Concepts. 2019;10 (1 ):1–10. doi: 10.1515/bmc-2019-0001 30888962
[34] Hong S, Pedersen PL. ATP synthase and the actions of inhibitors utilized to study its roles in human health, disease, and other scientific areas. Microbiol Mol Biol Rev. 2008;72 (4 ):590–641, Table of Contents. doi:10.1128/mmbr.00016-08 19052322
[35] Courbon GM, Rubinstein JL. CryoEM reveals the complexity and diversity of ATP synthases. Front Microbiol. 2022;13 :864006. doi: 10.3389/fmicb.2022.864006 35783400
[36] Salabei JK, Hill BG. Mitochondrial fission induced by platelet-derived growth factor regulates vascular smooth muscle cell bioenergetics and cell proliferation. Redox Biol. 2013;1 (1 ):542–551. doi: 10.1016/j.redox.2013.10.011 24273737
[37] Yang Q, Catalano CE. ATP serves as a nucleotide switch coupling the genome maturation and packaging motor complexes of a virus assembly machine. Nucleic Acids Res. 2020;48 (9 ):5006–5015. doi: 10.1093/nar/gkaa205 32255177
[38] Ueda K, Suwanmanee Y. ATP5B is an essential factor for hepatitis B virus entry. Int J Mol Sci. 2022;23 (17 ):9570. doi: 10.3390/ijms23179570 36076968
