
==== Front
Epigenetics
Epigenetics
Epigenetics
1559-2294
1559-2308
Taylor & Francis

39246182
10.1080/15592294.2024.2392401
2392401
Version of Record
Research Article
Research Article
Biogenesis of circRBM33 mediated by N6-methyladenosine and its function in abdominal aortic aneurysm
Y. XU ET AL.
EPIGENETICS
Xu Yingqi *
Weng Xiang *
Qiu Jiacong
Wang Shizhi
Department of Vascular Surgery, The Second Affiliated Hospital of Nanchang University, Jiangxi Medical College, Nanchang University , Nanchang, Jiangxi, China
CONTACT Shizhi Wang ndefy11086@ncu.edu.cn Department of Vascular Surgery, The Second Affiliated Hospital of Nanchang University, Jiangxi Medical College, Nanchang University, No.1 Minde Road, Nanchang, Jiangxi 330006, China
* Yingqi Xu and Xiang Weng are co-first authors

9 9 2024
2024
9 9 2024
19 1 2392401Integra04 9 2024
Integra04 9 2024
03 3 2024
26 6 2024
09 8 2024
© 2024 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
2024
The Author(s)
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The terms on which this article has been published allow the posting of the Accepted Manuscript in a repository by the author(s) or with their consent.

ABSTRACT

This study aimed to explore whether m6A modification affects the biogenesis of circRBM33, which is involved in the progression of abdominal aortic aneurysm (AAA). For in vitro experiments, vascular smooth muscle cells (VSMCs) were treated with Ang II. MeRIP‒PCR was used to assess m6A modification of circRBM33. Gene expression was measured using RT‒qPCR and Western blotting. For in vivo experiments, a mouse model of AAA was established via Ang II infusion. HE, Sirius Red and TUNEL staining was performed to evaluate pathological changes and cell apoptosis in aortic vessels. The results showed that the m6A level of circRBM33 was abnormally increased in Ang II-induced VSMCs. In addition, METTL3 positively regulated circRBM33 expression. YTHDC1 deficiency decreased circRBM33 expression but had no effect on RBM33 mRNA expression. Notably, neither METTL3 nor YTHDC1 influenced the stability of circRBM33 or RBM33 mRNA. The interaction between circRBM33 and METTL3/YTHDC1 was verified by RIP analysis. Moreover, the Ang II-induced increase in circRBM33 expression was reversed by cycloleucine (an inhibitor of m6A methylation). Importantly, the m6A modification and expression of circRBM33 in the circRBM33-m6A-mut2-expressing VSMCs were not altered by METTL3 silencing. Mechanistically, METTL3/YTHDC1 modulates the biogenesis of circRBM33 in an m6A-dependent manner. In addition, circRBM33 knockdown alleviated AAA by reducing ECM degradation in the Ang II-infused mice. In conclusion, this study demonstrated that METTL3/YTHDC1-mediated m6A modification modulates the biogenesis of circRBM33 from exons of the RBM33 gene. Moreover, knockdown of circRBM33 alleviated AAA by reducing ECM degradation, which may provide a novel therapeutic strategy for treating AAA.

KEYWORDS

METTL3
YTHDC1
circRBM33
abdominal aortic aneurysm
Natural science Foundation in Jiangxi Province 20224BAB206015 The study was supported by Natural science Foundation in Jiangxi Province [20224BAB206015].
==== Body
pmcIntroduction

Abdominal aortic aneurysm (AAA) refers to a tumour-like dilation of the abdominal aorta and is usually defined as an aneurysm with a diameter increase of more than 50% (>3.0 cm) [1]. People with AAAs are usually asymptomatic but are at risk of death if the artery ruptures. The main risk factors are male sex, smoking, familial inheritance, etc. At present, the main treatment methods for AAA are surgery and drug therapy. Despite the availability of advanced minimally invasive surgery, such as endovascular aneurysm repair (EVAR), surgical treatment is still risky [2]. Moreover, the therapeutic efficacy of clinical drugs is limited [3]. Therefore, it is highly important to explore the pathogenesis of AAA to identify new drugs that can effectively reduce the growth rate of aneurysms.

Circular RNAs (circRNAs) are covalently closed circular noncoding RNAs formed from precursor mRNAs (pre-mRNAs) by backsplicing of exons [4]. To date, many abnormally expressed circRNAs have been found in AAA. Zhou et al. used high-throughput sequencing and identified 411 abnormally expressed circRNAs in AAA [5]. Using circRNA expression profiling, Wang et al. reported the aberrant expression of 413 circRNAs in mice with AAA [6]. CircCCDC66 [7], circCBFB [8], circRNA CDR1as [9], and circFNDC3B [10] reportedly modulate the expression of target genes by sponging miRNAs, and circChordc1 [11] and circRasGEF1B [12] affect protein degradation by binding target proteins, further mediating the phenotype and growth of vascular smooth muscle cells (VSMCs) and participating in the development of AAA. CircRBM33 (hsa_circ_0001772) is a recently discovered circRNA that is produced from the exons of pre-mRNA RBM33 by backsplicing. In our previous study [13], a total of 65 DEcircRNAs were identified in AAA tissues by transcriptome sequencing: 30 upregulated and 35 downregulated circRNAs. Moreover, circRBM33 was found to be significantly upregulated and to regulate extracellular matrix (ECM) degradation by targeting the miR-4268/EPHB2 axis, thus participating in the progression of AAA. However, the biogenesis of circRBM33 in AAA needs to be further explored.

In recent years, extensive evidence has supported the correlation between N6-methyladenosine (m6A) and RNA splicing [14]. Kong et al. [15] revealed that m6A modification affects pre-mRNA splicing to promote the biogenesis of circDDIT4, which suppresses the progression of prostate cancer via the ELAVL1/ANO7 axis. m6A is a post-transcriptional modification of mRNAs and noncoding RNAs that is associated with three modulators (‘writers,’ including METTL3, METTL14, and WTAP; ‘erasers,’ including ALKBH5 and FTO; and ‘readers,’ including YTHDF1–3, YTHDC1–3 and IGF2BPs) [16]. Existing research has indicated that the m6A level is increased in human AAA tissues [17]. Zhong et al. [18] showed that METTL3 expression was increased in AAA tissues and promoted the maturation of miR-34a through m6A methylation, thus advancing the development of AAA. Emerging literature has indicated that nuclear YTHDC1 binds to m6A-modified mRNA [19] and recruits mRNA splicing factors to direct mRNA splicing [20], thereby promoting the formation of mature circular molecules from precursor transcripts [21]. Through a database search and bioinformatics analysis, it was predicted that there are multiple m6A modification sites in the mRNA sequence of RMB33 and that the pre-mRNA of RMB33 can bind to multiple m6A-related proteins, including METTL3 and YTHDC1. Herein, we propose that m6A modification may affect the biogenesis of circRBM33, which is subsequently involved in the progression of AAA.

Materials and methods

Cell culture and treatment

Human aortic vascular smooth muscle cells (HA-VSMCs) were purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China), and cultured in complete medium for HA-SMCs (Procell) containing fetal bovine serum and penicillin/streptomycin. HA-VSMCs were incubated in an incubator at 37°C and 5% CO2. VSMCs were treated with angiotensin II (Ang II, 100 nM) for 48 h to induce AAA in vitro. The cells treated with PBS served as a negative control.

For the RNA stability assay, actinomycin D (2 mg/mL) was added to VSMCs with METTL3/YTHDC1 knockdown for 6 h, followed by RT‒qPCR.

Lentivirus infection

The lentiviral vectors used for METTL3 overexpression (LV-METTL3) and shRNAs targeting METTL3 (LV-shMETTL3) and YTHDC1 (LV-shYTHDC1) were synthesized by OBIO (Shanghai, China). VSMCs were infected with lentivirus and polybrene. After 24–48 h of infection, the supernatants were harvested for subsequent experiments.

Quantification of m6A RNA methylation

An EpiQuik™ m6A RNA Methylation Quantification Kit (Epigentek) was used to measure the m6A level in total RNA. The experiments were performed in accordance with the manufacturer’s instructions.

Methylated RNA immunoprecipitation (MeRIP)‑qPCR

MeRIP-qPCR was performed using a GenSeq® m6A MeRIP Kit (Cloudseq, Shanghai, China) according to the manufacturer’s instructions. In brief, the fragmented RNA was incubated in a shaker at 4°C for 1 h with IP buffer and beads containing m6A antibodies (Proteintech). After elution of the beads and purification of the RNA, qPCR was used to assess the m6A modification of circRBM33.

RT-qPCR

Total RNA was extracted from VSMCs using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Then, the RNA was reverse transcribed using a First Strand cDNA Synthesis Kit (Aidlab, Beijing, China) to synthesize cDNA. Next, RT‒qPCR was performed using 2×SYBR Green qPCR Mix (Aidlab) on an ABI-7500 system. The PCR amplification conditions were as follows: 40 cycles of 94°C for 10 min, 94°C for 20 s, 55°C for 20 s, and 72°C for 20 s. Finally, the relative mRNA expression levels were quantified using the 2−ΔΔCt method. The following primer sequences were used (5’−3’):

circRBM33 (human)- F: GAATTGTATACTCAAGAGTACC;

circRBM33 (human)-R: CTGGTCAAAGTCATCATTGTA;

β-actin (human)-F: ACAGAGCCTCGCCTTTGCC;

β-actin (human)-R: TGGCCATCTCTTGCTCGAAG;

RBM33 (human)- F: AAGAAAGGGAGCGACAGCAT;

RBM33 (human) -R: CTCTCTCTCCTCTGGTCCCC;

METTL3 (human)-F: AGATGGGGTAGAAAGCCTCCT;

METTL3 (human) -R: TGGTCAGCATAGGTTACAAGAGT;

YTHDC1 (human)-F: GGAGGGCCAAATCTCCTACG;

YTHDC1 (human) -R: CTTTTCGGACAGCACGAACG.

Western blotting

RIPA buffer supplemented with PMSF (Servicebio, Wuhan, China) was added to the VSMCs to extract total protein, and the concentration of total protein was measured with a BCA protein quantification kit (Vazyme, Nanjing, China). After SDS‒PAGE, the protein sample was transferred to a PVDF membrane. Then, 5% skim milk was added for 2 h at room temperature to prevent nonspecific binding of the primary antibodies. After that, the membrane was incubated with primary antibodies at 4°C overnight and HRP-labeled secondary antibodies at room temperature for 1–2 h. Finally, the protein bands were visualized with enhanced chemiluminescence (ECL) solution (Biosharp, Hefei, China). We used a chemiluminescence imaging system (Bio-Rad ChemiDoc XRS+) to capture images. Primary antibodies against the following proteins were purchased from Proteintech Group, Inc. (Wuhan, China): METTL3 polyclonal antibody (at a dilution ratio of 1:1000), YTHDC1 polyclonal antibody (at a dilution ratio of 1:10000), MMP2 polyclonal antibody (at a dilution ratio of 1:1000), and TIMP1 polyclonal antibody (at a dilution ratio of 1:1000).

RNA immunoprecipitation (RIP)

Briefly, VSMCs (1 × 107) were lysed using RIPA buffer supplemented with PMSF on ice for 2 h. Then, METTL3, YTHDC1 and IgG antibodies were incubated with magnetic beads at 4°C for 4 h. After washing with RIP wash buffer, the cell lysates were incubated with bead-antibody complexes at 4°C overnight. IgG served as a negative control. After elution with proteinase K buffer, the interaction RNA was assessed using RT‒qPCR.

Mouse model of AAA

A total of 24 male ApoE-/- mice were purchased from Charles River (Beijing, China). All experimental procedures in this study were approved by the Animal Committee of Jiangxi Medical College, Nanchang University. All mice had free access to food and water and were housed in a standard laboratory room at 22–24°C with a 12 h light/dark cycle and 45–55% humidity. Mice were randomly divided into 4 groups (n = 6/group): sham, Ang II, Ang II+LV-shNC, and Ang II+ LV-sh circRBM33.

As previously reported [22], a mouse AAA model was established via the infusion of Ang II. In the Ang II+LV-shNC and Ang II+ LV-sh circRBM33 groups, the mice were injected with LV-shNC/LV-sh circRBM33 through the tail vein. After 30 days, the anaesthetised mice were infused with Ang II (1.44 mg/kg/day, A9525, Sigma, USA) using a micro-osmotic pump (Alzet, USA). The mice in the sham group were infused with normal saline. After 28 days of Ang II perfusion, the mice were euthanized, and the aorta was collected for detection of the maximal aortic diameter.

HE staining and sirius red staining

HE staining was performed with an HE staining kit (Solarbio, Beijing, China). Mouse aortic tissues were fixed with 4% formaldehyde, dehydrated with gradient alcohol, embedded in paraffin, and finally sliced into 3–8 μm sections. After the sections were deparaffinized with gradient alcohol, they were stained with haematoxylin for 20 min and eosin for 2 min, followed by sealing with neutral gum. Histopathological changes were observed under a microscope (Olympus DP70, Tokyo, Japan).

Modified Sirius Red staining solution (Solarbio) was used for collagen fiber staining. The aortic tissues were fixed with 10% formalin. After dehydration and embedment, the slices were cut into 3–8 μm sections. Then, the slices were deparaffined with gradient alcohol followed by staining with Sirius Red solution for 15–30 min. After dehydration to transparency, the slices were sealed with neutral gum. The images were captured under a microscope.

TUNEL staining

A One Step TUNEL Apoptosis Assay Kit (Beyotime, Shanghai, China) was used to assess cell apoptosis in aortic tissues in accordance with the manufacturer’s instructions. After dewaxing, the tissue slices were incubated with proteinase K solution without DNase (20 μg/mL) for 15 min at 37°C. The fluorescently labeled TUNEL test solution containing the TdT enzyme was added and incubated for 60 min at 37°C to initiate the labeling reaction. Then, the slices were washed with PBS and sealed with antifluorescence quenching solution. Finally, images were taken under a fluorescence microscope. Positively stained cells are shown in green. ImageJ software (National Institutes of Health, Bethesda, MD, USA) was used to count the numbers of positive cells and total cells in the view fields, from which the percentage of apoptotic cells was calculated.

Statistical analysis

Three replicates were set up for each experiment. All the data are presented as the mean ± standard deviation (SD). GraphPad Prism 8.0 software was used for the statistical analysis. Student’s t test and one-way ANOVA were used for comparisons between two groups or among multiple groups, respectively. Differences were considered significant at p < 0.05.

Results

The m6A level of circRBM33 was abnormally increased in ang ii-induced VSMCs

First, Ang II was used to establish an AAA cell model in vitro. As shown in Figure 1a, the m6A level in VSMCs was significantly increased after treatment with Ang II. The MeRIP-PCR results indicated that Ang II induced a significant increase in the m6A modification of circRBM33 (Figure 1b,c). In addition, the RT‒qPCR data showed that circRBM33 expression clearly increased, whereas RBM33 mRNA expression substantially decreased in the Ang II-induced VSMCs (Figure 1d,e). Moreover, the mRNA and protein levels of m6A-related regulators (METTL3 and YTHDC1) significantly increased in the Ang II-induced VSMCs (Figure 1f–h). Thus, these results suggest an increase in the m6A modification of circRBM33 in the Ang II-induced VSMCs, which may depend on METTL3 and YTHDC1. Figure 1. The m6A level of circRBM33 was abnormally increased in ang ii-induced VSMCs.

VSMCs were induced with Ang II to generate an AAA cell model in vitro. (a) Quantification of m6A RNA methylation. (b–c) MeRIP-PCR was performed to assess the m6A modification of circRBM33. (d–g) RT‒qPCR was performed to analyze circRBM33, RBM33, METTL3, and YTHDC1 mRNA expression. (h) METTL3 and YTHDC1 protein expression was analyzed using Western blotting. ***p < 0.001 vs. PBS.

The influence of METTL3 on circRBM33

To explore the influence of METTL3 on circRBM33, we constructed LV-METTL3 and three LV-shMETTL3 vectors and transfected them into VSMCs. The overexpression or silencing efficacy of LV-METTL/LV-shMETTL3 is shown in Figure 2a–c. As shown in Figure 2d–e, METTL3 overexpression increased circRBM33 expression but decreased RBM33 mRNA expression. The opposite results were obtained when METTL3 was silenced. Notably, METTL3 knockdown had no significant effect on the RNA stability of circRBM33 or RBM33 mRNA (Figure 2f,g). Thus, these findings suggest that METTL3 positively regulates circRBM33 expression. Figure 2. The influence of METTL3 on circRBM33.

The overexpression or silencing efficacy of LV-METTL3/LV-shMETTL3 was evaluated using (a–b) RT‒qPCR and (c) Western blotting. After transfection with LV-METTL3/LV-shMETTL3, (d) circRBM33 and (e) RBM33 mRNA expression was evaluated using RT‒qPCR. The RNA stability of (f) circRBM33 and (g) RBM33 mRNA in the VSMCs transfected with LV-shMETTL3 was measured using RT‒qPCR after treatment with actinomycin D. **p < 0.01, ***p < 0.001 vs. LV-NC or LV-shRNA.

YTHDC1 mediates the formation of circRBM33

Next, three shRNAs targeting YTHDC1 (LV-shYTHDC1) were constructed to investigate the effect of YTHDC1 on circRBM33. The transfection efficacies of LV-shYTHDC1 are shown in Figure 3a,b. LV-shYTHDC1-3, which has the highest efficacy, was used for the follow-up experiments. Subsequently, LV-shYTHDC1 decreased circRBM33 expression but had no effect on RBM33 mRNA expression (Figure 3c). Notably, there were no significant changes in circRBM33 or RBM33 mRNA stability after silencing YTHDC1 (Figure 3d,e). Therefore, the above results indicate that YTHDC1 mediates the formation of circRBM33. Figure 3. YTHDC1 mediates the formation of circRBM33.

The silencing efficacy of LV-shYTHDC1 was evaluated using (a) RT‒qPCR and (b) Western blotting. After (c) transfection with LV-shYTHDC1 or (d–e) treatment with actinomycin d, circRBM33 and RBM33 mRNA expression was evaluated using RT‒qPCR. ***p < 0.001 vs. LV-shRNA.

METTL3/YTHDC1 modulates the biogenesis of circRBM33 in an m6A-dependent manner

To confirm the mechanism by which METTL3/YTHDC1 modulates the biogenesis of circRBM33, we cotransfected LV-METTL3 and LV-shYTHDC1 into VSMCs. RT‒qPCR showed that YTHDC1 knockdown reversed the upregulation of circRBM33 caused by METTL3 overexpression but had no effect on the downregulation of RBM33 mRNA caused by METTL3 overexpression (Figure 4a,b). Then, RIP experiments were performed to verify the interaction between circRBM33 and METTL3/YTHDC1 and revealed a significant increase in circRBM33 expression in the anti-METTL3 and anti-YTHDC1 groups (Figure 4c,d). Figure 4. METTL3/YTHDC1 modulates the biogenesis of circRBM33 in an m6A-dependent manner.

LV-METTL3 and LV-shYTHDC1 were cotransfected into VSMCs. (a,b) CircRBM33 and RBM33 mRNA expression was determined using RT‒qPCR. (c,d) The interaction between circRBM33 and METTL3/YTHDC1 was verified using RIP analysis. (e) Cycloleucine was added to block m6A methylation in the Ang II-induced VSMCs. CircRBM33 expression was determined using RT‒qPCR. nsP > 0.05 vs. LV-METTL3; **p < 0.01 vs. LV-NC or PBS; ***p < 0.001 vs. LV-METTL3 or IgG or Ang II+DMSO.

To further validate the regulatory effect of METTL3/YTHDC1-mediated m6A modification on the biogenesis of circRBM33, we added cycloleucine, an inhibitor of m6A methylation, to Ang II-induced VSMCs, and the results indicated that the increase in circRBM33 expression induced by Ang II was reversed by cycloleucine treatment (Figure 4e). In contrast, SRAMP (http://www.cuilab.cn/sramp/) was used to screen candidate m6A sites in circRBM33. We found three m6A sites (184/235/256, Supplementary Figure S1A) in circRBM33. We further constructed circRBM33 with a mutation (184-mut1) or two mutations (235/256-mut2) in the m6A site (termed circRBM33-m6A-mut1 or circRBM33-m6A-mut2), and MeRIP-qPCR confirmed that circRBM33-m6A-mut2 exhibited lower m6A levels than did WT circRBM33 (Supplementary Figure S1B-1C). In addition, the m6A modification and expression of circRBM33 in the circRBM33-m6A-mut2-expressing VSMCs were not altered by METTL3 silencing (Supplementary Figure S1D-1E).

Given the above data, we propose that METTL3/YTHDC1 modulates the biogenesis of circRBM33 in an m6A-dependent manner.

CircRBM33 knockdown alleviates AAA by reducing ECM degradation in the ang ii-infused mice

Finally, the effects of circRBM33 on VSMC growth and the ECM were verified in a mouse model of AAA. Compared to those in the sham group, Ang II substantially increased the maximal aortic diameter, thickened the blood vessel wall, increased collagen fibers and increased cell apoptosis in arterial tissue. However, the absence of circRBM33 abolished these effects (Figure 5a–d). In addition, the protein expression levels of MMP-2 and TIMP-1 were determined to assess ECM degradation. The results showed that Ang II induced the upregulation of the MMP-2 protein and the downregulation of the TIMP-1 protein, and these effects were partially reversed by circRBM33 knockdown (Figure 5e–g). Moreover, LV-sh-circRBM33 partially abolished the increase in circRBM33 expression caused by Ang II (Figure 5h). Overall, circRBM33 knockdown alleviates AAA by reducing ECM degradation in the Ang II-infused mice. Figure 5. CircRBM33 knockdown alleviates AAA by reducing ECM degradation in ang ii-infused mice.

A mouse model of AAA was established by Ang II infusion. (a,b) The maximal aortic diameter was measured. (c) HE and Sirius Red staining of pathological changes in aortic vessels. (d) TUNEL staining was performed to evaluate cell apoptosis in arterial tissue. Scale bar = 20 μm. (e–g) Western blotting was used to determine the protein expression of MMP-2 and TIMP-1. (h) RT‒qPCR was used to determine circRBM33 expression. **p < 0.01, ***p < 0.001 vs. sham; *p < 0.05, **p < 0.01 vs. Ang II+LV-shNC.

Discussion

According to their origin, there are three kinds of circRNAs: exon‒intron circRNAs (EIcircRNAs), exonic circRNAs, and intronic circRNAs [23]. Despite their different sources, circRNAs are mainly produced by backsplicing of the head to the tail of pre-mRNAs. Currently, the formation of circRNAs has been shown to be regulated by various factors, such as backsplicing coupled with polymerase II (Pol II) transcription, the core spliceosome, cis-elements, trans-factors, complementary RNA pairing, and RNA-binding proteins [4,24]. This study attempted to determine the regulatory effect of m6A modification on the formation of circRBM33 in vitro. In our preliminary experiments, increased levels of global m6A modification and METTL3 and YTHDC1 expression were observed in the Ang II-induced VSMCs, which was consistent with the findings of existing studies [17,18,25]. More importantly, m6A modification was enriched in circRBM33. Moreover, Ang II induced the upregulation of circRBM33 and the downregulation of RBM33 mRNA expression. Hence, we speculated that m6A modification may promote the production of circRBM33 from RBM33 mRNA, and this process may depend on METTL3 and YTHDC1.

To further explore the influences of METTL3 and YTHDC1 on the production of circRBM33, we generated VSMCs with METTL3 overexpression/knockdown and YTHDC1 deficiency. METTL3 positively regulated circRBM33 expression but negatively regulated RBM33 mRNA expression, suggesting that METTL3 controls the conversion of RBM33 pre-mRNA to circRBM33. Notably, YTHDC1 deficiency decreased circRBM33 expression but had no effect on RBM33 mRNA expression, suggesting that the regulation of circRBM33 production by YTHDC1 is independent of variations in the transcriptional levels of RBM33. Moreover, neither METTL3 nor YTHDC1 influenced the stability of circRBM33 or RBM33 mRNA. The above results were supported by similar findings in a previous study [26]. Given the above evidence, we concluded that m6A modification mediated by METTL3/YTHDC1 facilitates the biogenesis of circRBM33 via backsplicing.

The literature has clarified the association between m6A and RNA splicing [14]. METTL3 is well known as the major methyltransferase that catalyzes the methylation of the m6A sites of mRNAs. A study using m6A-seq in HepG2 cells revealed that m6A sites are enriched on exons and around stop codons of HSP transcripts and that METTL3 deficiency alters methylation patterns [27]. Xiao et al. proposed that YTHDC1, an m6A reader, binds to m6A sites and directs pre-mRNA splicing by recruiting pre-mRNA splicing factors, including SRSF3 [20]. Another study indicated that increased splicing at m6A sites promoted the production of circRNAs [28]. Bioinformatics prediction analysis of the database revealed multiple m6A modification sites on the mRNA sequence of RMB33 and revealed a binding relationship between the pre-mRNA of RMB33 and multiple m6A-related proteins, including METTL3 and YTHDC1. Our RIP results confirmed the binding of circRBM33 to METTL3/YTHDC1. Further experiments revealed that the promoting effect of METTL3 overexpression on the generation of circRBM33 could be abolished by YTHDC1 knockdown, whereas YTHDC1 deficiency could not reverse the decrease in RBM33 mRNA caused by METTL3 overexpression, suggesting that METTL3 cooperates with YTHDC1 to promote the biogenesis of circRBM33. In contrast, Ang II-induced upregulation of circRBM33 in VSMCs was eliminated by cycloleucine (an inhibitor of m6A methylation). Based on the evidence collected above, we concluded that METTL3/YTHDC1-mediated m6A modification modulates the biogenesis of circRBM33 via backsplicing in Ang II-induced VSMCs.

Our previous in vitro study confirmed that an increase in circRBM33 induced ECM degradation via the miR-4268/EPHB2 axis [13]. Here, this conclusion was verified in an AAA mouse model in which circRBM33 was knocked down. The results of the in vivo experiments revealed that knockdown of circRBM33 decreased the maximal aortic diameter, collagen deposition and cell apoptosis in arterial tissue in the mice with Ang II-induced AAA. In particular, knockdown of circRBM33 reversed the upregulation of the MMP-2 protein and downregulation of the TIMP-1 protein. ECM degradation has been recognized as an important part of the pathogenesis of AAA [29]. MMP-2 is a member of the MMP family that degrades almost every component of the ECM, while TIMPs, including TIMP-1, inhibit the proteolytic activity of MMPs [30]. Overall, knockdown of circRBM33 alleviates AAA by reducing ECM degradation in Ang II-infused mice.

In summary, this study demonstrated that METTL3/YTHDC1-mediated m6A modification modulated the biogenesis of circRBM33 from exons of the RBM33 gene via backsplicing. Moreover, knockdown of circRBM33 alleviated AAA by reducing ECM degradation, which may provide a novel therapeutic strategy for treating AAA.

Supplementary Material

Supplemental Material

Supplementary Figure 1.tif

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data of this study are available from the corresponding author upon reasonable request.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15592294.2024.2392401.
==== Refs
References

[1] Boese AC, Chang L, Yin KJ, et al. Sex differences in abdominal aortic aneurysms. Am J Physiol Heart Circ Physiol. 2018 Jun 1;314 (6 ):H1137–H1152. doi: 10.1152/ajpheart.00519.2017 29350999
[2] Golledge J, Thanigaimani S, Powell JT, et al. Pathogenesis and management of abdominal aortic aneurysm. Eur Heart J. 2023 Aug 1;44 (29 ):2682–12. doi: 10.1093/eurheartj/ehad386 37387260
[3] Schanzer A, Oderich GS, Solomon CG. Management of abdominal aortic aneurysms. N Engl J Med. 2021 Oct 28;385 (18 ):1690–1698. doi: 10.1056/NEJMcp2108504 34706173
[4] Li X, Yang L, Chen LL. The biogenesis, functions, and challenges of circular RNAs. Mol Cell. 2018 Aug 2;71 (3 ):428–442. doi: 10.1016/j.molcel.2018.06.034 30057200
[5] Zhou M, Shi Z, Cai L, et al. Circular RNA expression profile and its potential regulative role in human abdominal aortic aneurysm. BMC Cardiovasc Disord. 2020 Feb 10;20 (1 ):70. doi: 10.1186/s12872-020-01374-8 32039711
[6] Wang J, Sun H, Zhou Y, et al. Circular RNA microarray expression profile in 3,4-benzopyrene/angiotensin ii-induced abdominal aortic aneurysm in mice. J Cell Biochem. 2019 Jun;120 (6 ):10484–10494. doi: 10.1002/jcb.28333 30614051
[7] Yang R, Wang Z, Meng G, et al. Circular RNA CCDC66 facilitates abdominal aortic aneurysm through the overexpression of CCDC66. Cell Biochem Funct. 2020 Oct;38 (7 ):830–838. doi: 10.1002/cbf.3494 31997404
[8] Yue J, Zhu T, Yang J, et al. CircCBFB-mediated miR-28-5p facilitates abdominal aortic aneurysm via LYPD3 and GRIA4. Life Sci. 2020 Jul 15;253 :117533. doi: 10.1016/j.lfs.2020.117533 32151690
[9] Zhao F, Chen T, Jiang N. CDR1as/miR-7/CKAP4 axis contributes to the pathogenesis of abdominal aortic aneurysm by regulating the proliferation and apoptosis of primary vascular smooth muscle cells. Exp Ther Med. 2020 Jun;19 (6 ):3760–3766. doi: 10.3892/etm.2020.8622 32346440
[10] Liu Y, Zhong Z, Xiao L, et al. Identification of circ-FNDC3B, an Overexpressed circRNA in abdominal aortic aneurysm, as a regulator of vascular smooth muscle cells. Int Heart J. 2021 Nov 30;62 (6 ):1387–1398. doi: 10.1536/ihj.21-186 34789642
[11] He X, Li X, Han Y, et al. CircRNA Chordc1 protects mice from abdominal aortic aneurysm by contributing to the phenotype and growth of vascular smooth muscle cells. Mol Ther Nucleic Acids. 2022 Mar 8;27 :81–98. doi: 10.1016/j.omtn.2021.11.005 34938608
[12] Lv P, Yin YJ, Kong P, et al. SM22 α loss contributes to apoptosis of vascular smooth muscle cells via macrophage-derived circRasgef1b. Oxid Med Cell Longev. 2021;2021 (1 ):5564884. doi: 10.1155/2021/5564884 33859778
[13] Wang S, Yuan Q, Zhao W, et al. Circular RNA RBM33 contributes to extracellular matrix degradation via miR-4268/EPHB2 axis in abdominal aortic aneurysm. PeerJ. 2021;9 :e12232. doi: 10.7717/peerj.12232 34820156
[14] Zhou KI, Shi H, Lyu R, et al. Regulation of Co-transcriptional pre-mRNA splicing by m(6)A through the low-complexity protein hnRNPG. Mol Cell. 2019 Oct 3;76 (1 ):70–81 e9. doi: 10.1016/j.molcel.2019.07.005 31445886
[15] Kong Z, Lu Y, Yang Y, et al. m6A-Mediated biogenesis of circDDIT4 inhibits prostate cancer progression by sequestrating ELAVL1/HuR. Mol Cancer Res. 2023 Dec 1;21 (12 ):1342–1355. doi: 10.1158/1541-7786.MCR-22-0271 37647111
[16] Zhang X, Peng Q, Wang L. N(6)-methyladenosine modification-a key player in viral infection. Cell Mol Biol Lett. 2023 Oct 12;28 (1 ):78. doi: 10.1186/s11658-023-00490-5 37828480
[17] He Y, Xing J, Wang S, et al. Increased m6A methylation level is associated with the progression of human abdominal aortic aneurysm. Ann Transl Med. 2019 Dec;7 (24 ):797. doi: 10.21037/atm.2019.12.65 32042813
[18] Zhong L, He X, Song H, et al. METTL3 induces AAA development and progression by modulating N6-methyladenosine-dependent primary miR34a processing. Mol Ther Nucleic Acids. 2020 Sep 4;21 :394–411. doi: 10.1016/j.omtn.2020.06.005 32650237
[19] Liu T, Wei Q, Jin J, et al. The m6A reader YTHDF1 promotes ovarian cancer progression via augmenting EIF3C translation. Nucleic Acids Res. 2020 Apr 17;48 (7 ):3816–3831. doi: 10.1093/nar/gkaa048 31996915
[20] Xiao W, Adhikari S, Dahal U, et al. Nuclear m(6)A Reader YTHDC1 regulates mRNA splicing. Mol Cell. 2016 Feb 18;61 (4 ):507–519. doi: 10.1016/j.molcel.2016.01.012 26876937
[21] Dattilo D, Di Timoteo G, Setti A, et al. The m(6)A reader YTHDC1 and the RNA helicase DDX5 control the production of rhabdomyosarcoma-enriched circRNAs. Nat Commun. 2023 Apr 5;14 (1 ):1898. doi: 10.1038/s41467-023-37578-7 37019933
[22] Zhang Y, Huang X, Sun T, et al. MicroRNA-19b-3p dysfunction of mesenchymal stem cell-derived exosomes from patients with abdominal aortic aneurysm impairs therapeutic efficacy. J Nanobiotechnology. 2023 Apr 26;21 (1 ):135. doi: 10.1186/s12951-023-01894-3 37101174
[23] Ma S, Kong S, Wang F, et al. CircRNAs: biogenesis, functions, and role in drug-resistant tumours. Mol Cancer. 2020 Aug 5;19 (1 ):119. doi: 10.1186/s12943-020-01231-4 32758239
[24] Chen LL, Yang L. Regulation of circRNA biogenesis. RNA Biol. 2015;12 (4 ):381–388. doi: 10.1080/15476286.2015.1020271 25746834
[25] Li T, Wang T, Jing J, et al. Expression pattern and clinical value of key m6A RNA modification regulators in abdominal aortic aneurysm. J Inflamm Res. 2021;14 :4245–4258. doi: 10.2147/JIR.S327152 34511965
[26] Di Timoteo G, Dattilo D, Centron-Broco A, et al. Modulation of circRNA metabolism by m(6)A modification. Cell Rep. 2020 May 12;31 (6 ):107641. doi: 10.1016/j.celrep.2020.107641 32402287
[27] Yu J, Li Y, Wang T, et al. Modification of N6-methyladenosine RNA methylation on heat shock protein expression. PLOS ONE. 2018;13 (6 ):e0198604. doi: 10.1371/journal.pone.0198604 29902206
[28] Tang C, Xie Y, Yu T, et al. m(6)A-dependent biogenesis of circular RNAs in male germ cells. Cell Res. 2020 Mar;30 (3 ):211–228. doi: 10.1038/s41422-020-0279-8 32047269
[29] Lowis C, Ramara Winaya A, Kumari P, et al. Mechanosignals in abdominal aortic aneurysms. Front Cardiovasc Med. 2022;9 :1021934. doi: 10.3389/fcvm.2022.1021934 36698932
[30] Cabral-Pacheco GA, Garza-Veloz I, Castruita-De la Rosa C, et al. The roles of matrix metalloproteinases and their inhibitors in human diseases. Int J Mol Sci. 2020 Dec 20;21 (24 ):9739. doi: 10.3390/ijms21249739 33419373
