
==== Front
Cell Rep Med
Cell Rep Med
Cell Reports Medicine
2666-3791
Elsevier

S2666-3791(24)00407-5
10.1016/j.xcrm.2024.101686
101686
Article
Soluble Tim-3 serves as a tumor prognostic marker and therapeutic target for CD8+ T cell exhaustion and anti-PD-1 resistance
Chen Chaojia 128
Zhao Fangcheng 18
Peng Jiali 138
Zhao Di 48
Xu Liyun 5
Li Huayu 1
Ma Shuaiya 1
Peng Xueqi 1
Sheng Xue 1
Sun Yang 1
Wang Tixiao 1
Dong Haoqing 1
Ding Yuming 1
Wu Zhuanchang 1
Liang Xiaohong 1
Gao Lifen 1
Wang Hongyan 6
Ma Chunhong machunhong@sdu.edu.cn
1∗
Li Chunyang lichunyang@sdu.edu.cn
79∗∗
1 Key Laboratory for Experimental Teratology of Ministry of Education and Department of Immunology, School of Basic Medical Sciences, Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250012, P.R. China
2 The Jackson Laboratory, Bar Harbor, ME, USA
3 Shandong Key Laboratory of Gynecologic Oncology, Qilu Hospital of Shandong University, Jinan, Shandong 250012, P.R. China
4 Department of Clinical Laboratory, Qilu Hospital of Shandong University, Jinan, Shandong 250012, P.R. China
5 Cell and Molecular Biology Laboratory, Zhoushan Hospital, Zhoushan, Zhejiang 316004, China
6 State Key Laboratory of Cell Biology, Shanghai Institute of Biochemistry and Cell Biology, Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences, University of Chinese Academy of Sciences, Shanghai 200031, P.R. China
7 Key Laboratory for Experimental Teratology of Ministry of Education and Department of Histology and Embryology, School of Basic Medical Sciences, Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250012, P.R. China
∗ Corresponding author machunhong@sdu.edu.cn
∗∗ Corresponding author lichunyang@sdu.edu.cn
8 These authors contributed equally

9 Lead contact

20 8 2024
20 8 2024
20 8 2024
5 8 10168628 10 2022
14 6 2024
23 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Summary

Resistance to PD-1 blockade in onco-immunotherapy greatly limits its clinical application. T cell immunoglobulin and mucin domain containing-3 (Tim-3), a promising immune checkpoint target, is cleaved by ADAM10/17 to produce its soluble form (sTim-3) in humans, potentially becoming involved in anti-PD-1 resistance. Herein, serum sTim-3 upregulation was observed in non-small cell lung cancer (NSCLC) and various digestive tumors. Notably, serum sTim-3 is further upregulated in non-responding patients undergoing anti-PD-1 therapy for NSCLC and anti-PD-1-resistant cholangiocarcinoma patients. Furthermore, sTim-3 overexpression facilitates tumor progression and confers anti-PD-1 resistance in multiple tumor mouse models. Mechanistically, sTim-3 induces terminal T cell exhaustion and attenuates CD8+ T cell response to PD-1 blockade through carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM-1). Moreover, the ADAM10 inhibitor GI254023X, which blocks sTim-3 production, reduces tumor progression in Tim-3 humanized mice and reverses anti-PD-1 resistance in human tumor-infiltrating lymphocytes (TILs). Overall, human sTim-3 holds great predictive and therapeutic potential in onco-immunotherapy.

Graphical abstract

Highlights

• Patients with tumors resistant to anti-PD-1 therapy exhibit high serum sTim-3 levels

• sTim-3 promotes tumor progression and confers anti-PD-1 resistance in tumor models

• sTim-3 promotes CD8+ T cell exhaustion and resistance to PD-1 blockade through CEACAM-1

• The ADAM10 inhibitor suppresses tumor progression and reverses anti-PD-1 resistance

Tim-3 is a promising immune checkpoint in tumor immunotherapy. Chen et al. demonstrate that soluble Tim-3 (sTim-3) is a potential marker of tumor prognosis and resistance to anti-PD-1 therapy. sTim-3 exacerbates CD8+ T cell exhaustion and inhibits response to anti-PD-1 treatment, suggesting sTim-3 as a target to enhance tumor immunotherapy.

Keywords

sTim-3
T cell exhaustion
resistance to PD-1 blockade
CEACAM-1
anti-PD-1 therapy
ADAM10
hepatocellular carcinoma
HCC
intrahepatic cholangiocarcinoma
ICC
lung cancer
Published: August 20, 2024
==== Body
pmcIntroduction

Malignant tumors, a leading cause of global mortality and morbidity, pose a substantial risk to human health. Immune cell exhaustion, especially of T cells, is a significant mechanism contributing to tumor progression that commonly occurs within the tumor microenvironment (TME). Exhausted T cells are characterized by high expression of multiple inhibitory receptors (such as programmed cell death protein 1 [PD-1] and cytotoxic T lymphocyte-associated antigen 4 [CTLA-4]), progressive loss of effector functions, and diminished cytotoxicity to tumor cells.1 Notably, onco-immunotherapy using immune-checkpoint blockade (ICB), primarily via anti-PD-L1/PD-1 antibodies, rejuvenates exhausted T cells, enhancing tumor eradication. Furthermore, antibodies targeting PD-1/PD-L1 have demonstrated remarkable clinical outcomes in treating diverse malignancies, such as non-small cell lung cancer (NSCLC), melanoma, and hepatocellular carcinoma (HCC), heralding a new onco-immunotherapy era. However, anti-PD-1 therapies only benefit a few cancer patients,2 with the majority developing resistance during treatment.3 In other words, the emergence of resistance to anti-PD-1 immunotherapy greatly hinders its clinical utility. Therefore, it is imperative to identify predictive biomarkers and thoroughly elucidate the mechanisms underlying anti-PD-1 resistance in cancer patients.

Accumulated evidence suggests that soluble forms of checkpoint molecules in sera could serve as predictive biomarkers. For instance, elevated soluble CTLA-4 levels were observed in breast cancer and mesothelioma patients, a phenomenon that was correlated with cancer progression.4,5 Additionally, high serum sPD-1 and sPD-L1 concentrations were reported in patients with Hodgkin’s lymphoma, melanoma, and HCC, among other malignancies.6 Soluble forms of checkpoint molecules also perform various immunomodulatory functions. For example, enforced sPD-1 expression repressed tumor progression and prolonged the survival of HCC mice.7 Conversely, splicing variants of secreted PD-L1 were reported to mediate resistance to anti-PD-1/PD-L1 therapy.8,9 Furthermore, the combination of sPD-L1 and sCTLA-4 was recently reported to discriminate responsiveness to PD-1/PD-L1 blockade therapy in NSCLC patients efficiently.10 In this regard, further exploration of additional soluble immune factors could yield novel insights, enhancing the development of predictive strategies for ICB therapy.

It has been established that T cell immunoglobulin and mucin domain containing-3 (Tim-3), a type I transmembrane glycoprotein first discovered in 2002,11 is highly expressed on exhausted T cells during chronic viral infection and tumor progression.12 Additionally, we previously discovered that Tim-3 regulates immune and tumor cells, potentially aggravating tumor progression.13,14,15 Tim-3 upregulation has also been identified as a potential biomarker for adaptive resistance to PD-1 blockade, with anti-Tim-3 antibodies preventing anti-PD-1 resistance.16 Moreover, the simultaneous targeting of Tim-3 and PD-1 synergistically enhanced T cell antitumor activity and suppressed tumor growth.16,17,18 These findings collectively suggest that Tim-3 is a highly promising ICB immunotherapy target.

A soluble form of Tim-3 (sTim-3), generated through alternative splicing at the mRNA level in mice19,20 or shedding of the surface molecule via matrix metalloproteinases (MMPs) ADAM10 and ADAM17 at the protein level, has been confirmed to exist in humans.21,22 Furthermore, clinical investigations correlated sTim-3 with the progression of multiple diseases, including sepsis,23 systemic lupus erythematosus (SLE),24 graft-versus-host disease (GVHD),25 and HIV infection.22 Nevertheless, there is limited biofunctional research on sTim-3, and the existing few studies have yielded conflicting results. Specifically, the extracellular segment of murine Tim-3, which is structurally identical to cleaved sTim-3, has been shown to enhance T cell proliferation and cytokine secretion.19,26 Conversely, the spliced variant form of mouse sTim-3 has been reported to hinder T cell-mediated antitumor response.20 In this regard, the precise role of human sTim-3 in tumor progression, as well as the mechanism of its interaction with anti-PD-1 therapy, remains unclear.

In this study, we discover significant sTim-3 upregulation in both non-responder patients undergoing anti-PD-1 treatment for NSCLC and anti-PD-1-resistant cholangiocarcinoma patients. Moreover, sTim-3 promotes tumor progression and confers resistance to anti-PD-1 therapy in mouse models of spontaneous primary liver cancer. Additionally, sTim-3 enhances T cell exhaustion and suppresses CD8+ T cell response to PD-1 blockade in a carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM-1)-dependent manner. Furthermore, the administration of the ADAM10 inhibitor, which efficiently blocks sTim-3 production, retards liver cancer progression and reverses the anti-PD-1 resistance in tumor-infiltrating lymphocytes (TILs) isolated from HCC patients. Based on these findings, it is plausible that sTim-3 could serve as a biomarker for tumor progression and resistance to PD-1 blockade treatment. Overall, targeting sTim-3 holds great potential in cancer treatment.

Results

Serum sTim-3 is a potential biomarker of tumor progression and anti-PD-1 resistance

Serum sTim-3 concentrations were measured in NSCLC patients to assess the association between sTim-3 expression and tumor progression and immunotherapy. NSCLC patients exhibited significantly higher serum sTim-3 levels than healthy individuals (Figure 1A). Subsequent analyses revealed a notable elevation of serum sTim-3 concentrations in both the lung squamous cell carcinoma (LUSC) and lung adenocarcinoma (LUAD) subtypes of NSCLC (Figure 1B). Furthermore, invasive adenocarcinoma (IAC) patients exhibited markedly higher serum sTim-3 levels than adenocarcinoma in situ (AIS) and minimally invasive adenocarcinoma (MIA) patients (Figure 1C). These findings suggested a potential association between sTim-3 expression and lung cancer malignant behavior or tumor burden. Subsequent analysis based on the tumor/node/metastasis (TNM) classification system showed that serum sTim-3 levels were significantly higher at advanced stages compared to early-stage LUAD (Figure 1D). Furthermore, sTim-3 levels correlated positively with tumor size in LUAD (Figure 1E). Patients with high sTim-3 levels showed poorer overall survival (OS) outcomes than those with low sTim-3 (Figure 1F). In light of the previously reported association between membrane Tim-3 and resistance to PD-1 blockade immunotherapy,27 we also explored the serum sTim-3 concentrations in NSCLC patients undergoing anti-PD-1 therapy. The results showed that patients undergoing PD-1 blockade therapy exhibited higher serum sTim-3 levels than those not receiving anti-PD-1 treatment (Figure 1G). Additionally, patients who failed to respond to anti-PD-1 therapy exhibited higher serum sTim-3 levels than responders (Figure 1H), highlighting sTim-3 as a potential biomarker for PD-1 blockade therapy.Figure 1 Serum sTim-3 is a potential biomarker of tumor progression and anti-PD-1 resistance

(A) The serum sTim-3 concentrations in NSCLC patients (N = 65) and healthy people (N = 23) were determined by ELISA.

(B) The serum sTim-3 concentrations in lung squamous cell carcinoma (LUSC) patients (N = 12), lung adenocarcinoma (LUAD) patients (N = 53), and healthy individuals (N = 23) were determined using ELISA.

(C) The serum sTim-3 concentrations in different subtypes of lung adenocarcinoma, including adenocarcinoma in situ (AIS) (N = 10), minimally invasive adenocarcinoma (MIA) (N = 11), and invasive adenocarcinoma (IAC) (N = 32), as well as healthy individuals (N = 23) were determined using ELISA.

(D) The serum concentrations of sTim-3 in LUAD patients at early (N = 10) and advanced stages (N = 43) according to the tumor/node/metastasis (TNM) classification system.

(E) Correlation of serum sTim-3 concentrations with in situ tumor size in patients with LUAD.

(F) Kaplan-Meier survival curve of NSCLC patients with high (N = 32) versus low (N = 32) sTim-3 expression.

(G) sTim-3 concentrations in the serum of anti-PD-1-treated (N = 67) or non-treated (N = 54) NSCLC patients were evaluated using ELISA.

(H) sTim-3 concentrations in the serum of NSCLC patients post anti-PD-1 therapy, including 16 responders and 26 non-responders, were evaluated using ELISA.

(I) The serum sTim-3 concentrations in healthy individuals (N = 28), HCC patients (N = 20), gastric cancer patients (N = 16), colorectal cancer patients (N = 15), and cholangiocarcinoma (N = 9) patients. Data are presented as means ± SEM and were analyzed by the two-tailed unpaired Student’s t test (A, B, C, D, G, H, and I), linear regression (E) and log rank test (F). ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001.

We also observed elevated serum sTim-3 in diverse digestive tumors, including gastric cancer, colorectal cancer, HCC, and cholangiocarcinoma patients (Figure 1I). Furthermore, consistent with the NSCLC results, cholangiocarcinoma patients, who were previously reported to respond poorly to anti-PD-1 therapy,28,29 exhibited the highest serum sTim-3 levels among the examined digestive tumor patients (Figure 1I). Additionally, sTim-3 expression increased significantly with hepatitis B virus (HBV)-related HCC progression. On the other hand, chronic hepatitis B (CHB) patients exhibited substantially higher serum sTim-3 concentrations than healthy individuals, with even higher concentrations observed in HBV-related HCC patients (Figure S1A). Serum sTim-3 levels in CHB patients also correlated positively with alanine aminotransferase (ALT) and aspartate aminotransferase (AST), which are established markers of hepatocyte injury (Figures S1B–S1E). Overall, sTim-3 could serve as a biomarker for tumor progression and clinical response to anti-PD-1 therapy.

ADAM10/17 contributes to sTim-3 production

Stimulating monocytes with liposaccharides (LPS) and T cells with anti-CD3/CD28 antibodies has been reported to induce sTim-3 production by human peripheral blood mononuclear cells (PBMCs).22 However, our findings indicated sTim-3 production only under T cell stimuli, implying that activated human T cells are, at least, partially responsible for sTim-3 generation (Figure S2A). Consistent with previous reports that human sTim-3 is generated via proteolytic cleavage by sheddase ADAM10/17 rather than alternative splicing,19,20,21,22 we did not detect short-spliced Tim-3 mRNA in PBMCs from healthy individuals, as well as in CHB and HCC patients (Figures S2B and S2C). Furthermore, the ADAM10 (GI254023X, GI) and ADAM17 (TAPI-1) inhibitors completely blocked sTim-3 production in PBMCs stimulated with anti-CD3/CD28 antibodies and reversed the increase of sTim-3 production in PBMCs from HCC patients (Figure S2D). Moreover, tumor tissues exhibited higher ADAM10/17 expression than para-tumor tissues in HCC patients (Figure S2E). Conversely, only ADAM10 expression was significantly higher in PBMCs from HCC patients than healthy donors (p = 0.0231) (Figure S2F). Similarly, the analysis of The Cancer Genome Atlas (TCGA) database showed a higher ADAM10/17 expression in tumor tissues than in para-tumor tissues from NSCLC patients (Figures S2G and S2H), with patients exhibiting high ADAM10 expression having poorer OS outcomes than those with low ADAM10 expression (Figure S2I). These findings suggest that human sTim-3 production is ADAM10/17 dependent, with ADAM10 playing a more critical role than AMAM17.

sTim-3 facilitates tumor progression in multiple mouse models in a membrane Tim-3-independent manner

Since human sTim-3 is shed by ADAM10/17 at a membrane-proximal site21,22 and correlated with tumor burden in the clinic (Figure 1E), we ectopically overexpressed Tim-3’s ectodomain to assess the role of sTim-3 in tumor progression. First, a spontaneous orthotopic v-akt murine thymoma viral oncogene homolog (AKT)/c-Myc-driven HCC mouse model was constructed with firefly luciferase expression as a tumor burden indicator.18 Specifically, the human sTim-3 expression plasmid (pT3-sTim-3)/control vector (pT3-Vector) was delivered into hepatocytes via hydrodynamic injection (HDI) (Figure 2A). The ELISA results confirmed the successful overexpression of sTim-3 (Figure 2B). Additionally, intrahepatic tumors were detected four weeks post-injection via in vivo bioluminescence imaging (Figure 2C). The overexpression of sTim-3 led to significantly higher luciferase activity in the liver than the vector control (Figure 2D), indicating faster tumor growth. Furthermore, sTim-3-treated mice exhibited higher liver weight (Figure 2E) and more tumor nodes in the liver than control mice (Figure 2F). Moreover, histological analysis with hematoxylin and eosin (H&E) staining revealed larger tumor areas, and immunohistochemical staining demonstrated higher Ki-67 expression in livers of sTim-3-overexpressing mice (Figure 2G), further indicating accelerated tumor growth. On the other hand, survival analysis showed that sTim-3 overexpression reduced the survival time of HCC mice (Figure 2H).Figure 2 sTim-3 promotes tumor progression in multiple mouse models

(A–H) Overexpression of sTim-3 in the AKT/c-Myc-induced intrahepatic HCC models. (A) Schematic diagram of human sTim-3-overexpressing or control HCC model. (B) Concentrations of serum sTim-3 in HCC model (n = 5). (C) Representative images and (D) quantification of bioluminescence in the liver at four weeks post tumor induction (n = 6). (E) Liver-to-body weight ratio (n = 5). (F) Gross appearances of the liver. (G) H&E staining and Ki67 immunohistochemistry staining of the intact liver tumors. (H) Survival curve (n = 6).

(I–P) Overexpression of sTim-3 in the intrahepatic AKT-NICD1-induced ICC models. (I) Schematic diagram of sTim-3-overexpressing or control ICC model. (J) Concentrations of serum sTim-3 in ICC model (n = 5). (K) Representative images and (L) quantification of bioluminescence in the liver at four weeks post tumor induction (n = 7). (M) Liver-to-body weight ratio (n = 9). (N) Gross appearances of the liver. (O) H&E staining and Ki67 immunohistochemistry staining of the intact liver tumors. (P) Survival curve (Vector, n = 6; sTim-3, n = 7).

(Q–T) Control (LV-Vector) or sTim-3-overexpressing (LV-sTim-3) B16-MO5 melanoma cells were subcutaneously injected into wild-type and Tim-3 knockout mice , separately. (Q) Schematic diagram of the B16-MO5 tumor model. (R) Concentrations of serum sTim-3. (S) Tumor growth curve (wild-type: LV-Vector, n = 5; LV-sTim-3, n = 4;Tim-3 knockout: LV-Vector, n = 4; LV-sTim-3, n = 4). (T) Survival curve (wild-type: LV-Vector, n = 7; LV-sTim-3, n = 8;Tim-3 knockout: LV-Vector, n = 4; LV-sTim-3, n = 4). All results are representative of at least three independent experiments. Data are presented as mean ± SEM and were analyzed by the unpaired Student’s t test (B, D, E, J, L, and M), two-way analysis of variance (ANOVA) (S), and log rank test (H, P, and T). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

The sTim-3-mediated tumor progression acceleration was further verified in an AKT/NICD1-induced intrahepatic cholangiocarcinoma (ICC) mouse model (Figure 2I).30 The results showed that sTim-3 overexpression markedly accelerated ICC progression, as evidenced by heightened luciferase activity, increased liver weight and tumor area at the microscopic level, hepatic Ki-67 expression upregulation, and reduced survival time (Figures 2J–2P). These findings collectively suggest that sTim-3 could significantly promote primary liver cancer progression, including both HCC and ICC in vivo.

Subsequently, we used lentivirus vectors to construct the control (LV-Vector) and sTim-3-overexpressing melanoma B16-MO5 cells (LV-sTim-3). We then inoculated the tumor cells in both wild-type (WT) and Tim-3 knockout (KO) mice separately (Figure 2Q). The ELISA results confirmed the successful sTim-3 overexpression in the serum of LV-sTim-3-inoculated mice (Figure 2R). Furthermore, compared to the injection of control LV-Vector B16-MO5 cells, the subcutaneous injection of LV-sTim-3 B16-MO5 cells markedly accelerated tumor growth (Figure 2S) and shortened survival (Figure 2T) in WT recipient mice. Additionally, consistent with Tim-3’s functional role in tumor growth regulation, both LV-Vector and LV-sTim-3 B16-MO5 cells grew faster in WT mice than in Tim-3 KO mice (Figures 2S and 2T). Moreover, as in WT recipient C57BL/6 mice, sTim-3 overexpression in Tim-3 KO mice significantly promoted B16-MO5 melanoma cell growth and greatly reduced the survival time (Figures 2S and 2T). These findings indicate that sTim-3’s tumor-promoting effect is not entirely membrane-type Tim-3 dependent.

sTim-3 overexpression aggravates T cell exhaustion in TMEs

Several tumor cell lines (including human liver cancer HepG2 and Huh7 cells, murine hepatoma Hepa1-6 cells, and melanoma B16F10 cells) were exposed to recombinant sTim-3 to explore the direct impact of sTim-3 on tumor cell growth. According to the results, sTim-3 exerted no influence on the proliferation of any of the examined tumor cells in vitro (Figures S3A–3C). Melanoma B16-MO5 cells exhibited similar results following sTim-3 overexpression via adeno-associated viruses (AAV) or lentivirus treatment (Figures S3D and S3E). These findings suggest that sTim-3 could promote tumor progression via immune cell modulation.

Subsequently, we evaluated the immune profiles of tumor-infiltrating cells in mice with AKT/c-Myc-driven HCC at day 30 post-HDI (Figure 3A). According to the flow cytometric results, sTim-3 overexpression dramatically reduced the number of tumor-infiltrating CD8+ and CD4+ T cells (Figures 3B and S4A). Furthermore, compared to control HCC mice, sTim-3-expressing HCC mice exhibited lower interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) production in tumor-infiltrating CD8+ and CD4+ T cells (Figures 3C and S4B) and a higher PD-1 and Tim-3 expression (Figures 3D and S4C), indicating enhanced T cell exhaustion. Terminally exhausted T cells (TEX) are often characterized by high PD-1, Tim-3, and Tox expression; low TCF1 expression; and a gradual loss of polyfunctionality in cytokine production.31 Herein, further analysis revealed that sTim-3 upregulated the frequency of terminally exhausted CD8+ T cells (PD-1+Tim-3+TCF1−) (Figure 3D) and reduced T cell polyfunctionality (IFN-γ+TNF-α+) (Figure 3C), demonstrating that sTim-3 aggravated CD8+ T cell exhaustion in HCC. Moreover, sTim-3-overexpressing HCC mice exhibited a significant increase in the frequency of Gr1+CD11b+ myeloid-derived suppressor cells (MDSCs) and CD4+ Foxp3+ regulatory T cells (Tregs) (Figures S4D and S4E).Figure 3 sTim-3 overexpression aggravates T cell exhaustion in tumor microenvironments

(A–D) Tumor-infiltrating lymphocytes were isolated from control (n = 5) and sTim-3-overexpression (n = 5) HCC mice on day 30 post-HDI. (A) Schematic diagram of the immune phenotype analysis. (B) The number of CD8+ T cells in tumors. (C) Percentages of IFN-γ+, TNF-α+, and IFN-γ+TNF-α+ CD8+ TILs. (D) Percentage of PD-1+, Tim-3+, and PD-1+Tim-3+TCF1− (TEX) CD8+ T cells in tumor.

(E–H) Tumor-infiltrating lymphocytes were isolated from control (n = 5) and sTim-3-overexpression (n = 5) ICC mice on day 30 post-HDI. (E) Schematic diagram of the immune phenotype analysis. (F) The number of CD8+ T cells in tumors. (G) Percentages of IFN-γ+, TNF-α+, and IFN-γ+TNF-α+ CD8+ TILs. (H) Percentage of PD-1+, Tim-3+, Tox+, and PD-1+Tim-3+Tox+TCF1− (TEX) tumor-infiltrating CD8+ T cells.

(I–L) Tumor-infiltrating lymphocytes were isolated from control and sTim-3-overexpression B16-MO5 tumor control on day 26 post-tumor inoculation. (I) Schematic diagram of the immune phenotype analysis. (J) The number of CD8+ T cells per gram of tumor tissue from control (n = 5) and sTim-3-overexpressing (n = 8) B16-MO5 tumor-bearing mice. (K) Percentages of IFN-γ+, TNF-α+, and IFN-γ+TNF-α+ CD8+ TILs from control (n = 5) and sTim-3-overexpressing (n = 5) B16-MO5 tumors were measured. (L) Percentage of PD-1+, Tim-3+, LAG-3+, Tox+, and PD-1+Tim-3+Tox+TCF1− (TEX) tumor-infiltrating CD8+ T cells from control (n = 5) and sTim-3-overexpressing (n = 5) B16-MO5 tumor mice. All results are representative of at least three independent experiments. Data are presented as mean ± SEM and were analyzed by the unpaired Student’s t test. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

Next, we confirmed the immunosuppressive role of sTim-3 in the AKT/NICD1-driven ICC model (Figure 3E). Consistently, sTim-3 decreased the number of CD8+ and CD4+ T cells in tumors (Figures 3F and S4F) and reduced their cytokine-producing ability (Figures 3G and S4G). On the other hand, sTim-3 upregulated the exhaustion molecules PD-1, Tim-3, and Tox in tumor-infiltrating T cells (Figures 3H and S4H). Notably, sTim-3 overexpression increased the frequency of PD-1+Tim-3+Tox+TCF1− terminally exhausted CD8+ T cells (Figure 3H) and decreased the frequency of IFN-γ+TNF-α+ polyfunctional CD8+ T cells in the TME (Figure 3G). Furthermore, the sTim-3-overexpressing TME showed a higher MDSC and Treg accumulation than the control (Figures S4I and S4J).

The subcutaneous B16-MO5 melanoma model also demonstrated that sTim-3 enhanced T cell exhaustion (Figure 3I). Specifically, sTim-3 overexpression decreased the accumulation of tumor-infiltrating CD8+ T cells (Figure 3J), reduced the frequency of IFN-γ+TNF-α+ CD8+ T cells (Figure 3K), and increased the frequency of PD-1+Tim-3+Tox+TCF1− and PD-1+LAG3+ exhausted CD8+ T cells (Figures 3L and S4K) within the TME. These findings collectively suggest that sTim-3 promotes a suppressive TME and facilitates tumor T cell exhaustion.

Overexpression of sTim-3 abrogates the therapeutic effects of anti-PD-1 treatment

Based on a previous research finding that terminally exhausted CD8+ TILs did not respond to anti-PD-1 therapy,32 we hypothesized that sTim-3 could confer resistance to anti-PD-1 therapy. To verify this speculation, we treated the AKT/c-Myc-induced HCC and AKT/NICD1-induced ICC mouse models with PD-1-blocking antibodies (Figure 4A). In the vector control group, the anti-PD-1 antibodies significantly reduced hepatic tumor burden at four weeks post-HDI and prolonged survival of both HCC (Figures 4B–4D) and ICC (Figures 4E–4G) mice. Notably, the anti-PD-1 treatment-mediated antitumor effects on tumor growth and mouse survival were almost entirely abolished in sTim-3-overexpressing HCC mice, with PD-1-blocking antibodies exerting no therapeutic impacts on tumor burden (Figures 4B and 4C) or survival time, ultimately leading to mortality in all mice before the eighth-week post-HDI (Figure 4D). Furthermore, sTim-3 overexpression repealed the effect of PD-1 blockade in the ICC model (Figures 4E–4G). These findings collectively suggest that sTim-3 impacts anti-PD-1 therapy efficacy, highlighting its potential significance in promoting PD-1 blockade resistance.Figure 4 sTim-3 abrogates the therapeutic effects of anti-PD-1 treatment

(A) Schematic diagram of HCC mice or ICC mice treated with isotype control antibodies (IgG) or anti-PD-1 (α-PD-1).

(B–D) (B) Representative images and (C) quantification of bioluminescence in the liver of HCC mice at 4 weeks post-HDI (n = 6). (D) Survival curve of HCC mice (Vector + IgG n = 7; Vector + anti-PD-1 n = 7; sTim-3 + IgG n = 9; sTim-3 + anti-PD-1 n = 8).

(E–G) (E) Representative images and (F) quantification of bioluminescence in the liver of ICC mice at 3 weeks post-HDI (Vector + IgG n = 13; Vector + anti-PD-1 n = 10; sTim-3 + IgG n = 9; sTim-3 + anti-PD-1 n = 9). (G) Survival curve of ICC mice (Vector + IgG n = 8; Vector + anti-PD-1 n = 7; sTim-3 + IgG n = 10; sTim-3 + anti-PD-1 n = 9). All results are representative of at least two independent experiments. Data are presented as mean ± SEM and were analyzed by the Mann-Whitney U test (C and F) and log rank test (D and G). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001; ns, no significance.

Treatment with sTim-3 induces T cell dysfunction and reduces T cell anti-PD-1 response

Given that therapeutic anti-PD-1 antibodies function mainly through reinvigorating T cell responses and that sTim-3 impaired T cell immune response in the aforementioned tumor models, we further explored the direct impact of sTim-3 on T cells. Specifically, we stimulated C57BL/6-Tg(TcraTcrb)1100Mjb/J (OT-Ⅰ) T cell receptor (TCR) transgenic CD8+ cytotoxic T lymphocytes (CTLs) with anti-CD3/CD28 antibodies in the presence or absence of a recombinant sTim-3 protein. The results revealed that sTim-3 treatment significantly reduced IFN-γ, TNF-α, and interleukin (IL)-2 production at both the protein and mRNA levels in OT-Ⅰ CTLs (Figures 5A and S5A). Furthermore, consistent with the in vivo results, which revealed that Tim-3 is dispensable for the promoting role of sTim-3 in tumor growth (Figures 2S and 2T), sTim-3 dramatically suppressed IFN-γ and TNF-α production in Tim-3-deficient OT-Ⅰ CTLs (Figures 5B and S5B). The sTim-3-mediated inhibition of CTL effector function was further verified via retroviral sTim-3 overexpression in OT-Ⅰ CTLs. Compared to the control, the retrovirus-mediated sTim-3 overexpression (RV-sTim-3) inhibited IFN-γ secretion by OT-Ⅰ CTLs stimulated with 200 pM and 2 nM ovalbumin (OVA)257-264 peptide (Figure S5C) and significantly reduced cytotoxicity of OT-Ⅰ CTLs against OVA257-264-pulsed B16F10 melanoma cells at various effector-to-target ratios (Figure 5C). Subsequently, CD8+ T cell exhaustion was induced in vitro through chronic TCR stimulation33 in the presence or absence of sTim-3. Consistent with the in vivo results, treatment with sTim-3 in vitro directly increased the proportion of PD-1+Tim-3+Tox+TCF1− terminally exhausted T cells (Figure 5D). Moreover, sTim-3 treatment diminished PD-1 blockade response in OT-Ⅰ CTLs. Specifically, PD-1 blockade greatly increased the percentage of IFN-γ+TNF-α+ CD8+ T cells in the absence of sTim-3, whereas sTim-3 treatment abrogated the PD-1 blockade-induced augmented cytokine secretion (Figure 5E), confirming that sTim-3 caused the resistance to PD-1 blockade in CD8+ CTLs.Figure 5 sTim-3 induces T cell dysfunction and reduces T cell anti-PD-1 response

(A and B) WT (A, n = 7) or Tim-3 KO (B, n = 3) OT-Ⅰ CTLs were pretreated with sTim-3 protein (5 μg/mL) and stimulated with anti-CD3/CD28 antibodies for 6 h. IFN-γ, TNF-α, and IL-2 production was assessed using flow cytometry.

(C) Cytotoxicity of control (RV-Vector) and sTim-3-overexpressing (RV-sTim-3) OT-Ⅰ CTLs against firefly luciferase-expressing B16F10 targets (n = 3).

(D) Exhausted OT-Ⅰ CTLs were induced by chronic stimulation in the presence or absence of sTim-3. Percentages of PD-1+Tim-3+TOX+TCF1− CD8+ TEX cells were assessed using flow cytometry (n = 5).

(E) OT-Ⅰ CTLs were pretreated with IgG or anti-PD-1 antibodies (5 μg/mL) in the presence of sTim-3 protein (5 μg/mL) or not and stimulated with anti-CD3/CD28 antibodies for 6 h. IFN-γ and TNF-α production were assessed using flow cytometry (n = 6).

(F) TILs from HCC patients were pretreated with sTim-3 protein (5 μg/mL) and stimulated with anti-human CD3/CD28 beads. TNF-α and IFN-γ in supernatants were detected using ELISA 24 h later (n = 6).

(G) TILs from HCC patients were pretreated with sTim-3 protein (5 μg/mL) and anti-PD-1 antibodies (5 μg/mL) and stimulated with anti-human CD3/CD28 beads. IFN-γ in supernatants was detected using ELISA 24 h later (n = 3).

(H and I) Gene set enrichment analysis (GSEA) was performed to determine the specific enrichment in T cell activation signature gene set (H) and anti-PD-1 unresponsive gene set (I) in human sTim-3 protein-treated CTLs versus Mock CTLs. FDR, false discovery rate; NES, normalized enrichment score.

(J) Representative immunoblots of sTim-3 protein-treated OT-Ⅰ CTLs or Mock OT-Ⅰ CTLs after stimulation with anti-CD3/CD28 antibodies for indicated time points.

(K) Flow cytometry analysis of phospho-LCK, phospho-Zap-70 (Syk), and phospo-PLCγ-1 in mouse HCC tumor-infiltrating CD8+ T cells. All results are representative of at least three independent experiments. Data are presented as mean ± SEM and were analyzed by the unpaired Student’s t test (A, B, D, E, F, G, and K) and two-way ANOVA (C). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001; ns, no significance.

Human TILs and PBMCs from HCC patients were stimulated with anti-CD3/CD28 beads in the presence or absence of human sTim-3 protein to verify the aforementioned findings in human T cells. According to the flow cytometric and quantitative reverse-transcription PCR (RT-qPCR) results, sTim-3 inhibited IFN-γ and TNF-α secretion upon anti-CD3/CD28 stimulation in TILs from HCC patients (Figures 5F and S5D). Conversely, sTim-3 treatment did not inhibit the production of IFN-γ and TNF-α in TCR-stimulated human PBMCs (Figure S5E), implying that the immune-suppressive role of sTim-3 might be TME dependent in humans. However, as in mice OT-Ⅰ CTLs, sTim-3 treatment abolished the anti-PD-1-induced increase of IFN-γ production in TILs from HCC patients (Figure 5G).

A global RNA sequencing (RNA-seq) analysis was performed to further elucidate the negative regulatory role of sTim-3 in T cells. According to the gene set enrichment analysis (GSEA) results, control cells exhibited a notably higher enrichment of T cell activation-related signature genes than sTim-3-treated cells (Figure 5H). Moreover, consistent with our clinical data and the functional study results, sTim-3 treatment significantly enriched the reported anti-PD-1 unresponsive signature gene set34 in OT-Ⅰ CTLs (Figure 5I).

Based on previous research findings, which posited that erroneous TCR signaling induces T cell unresponsiveness to the PD-1 blockade,35 we further sought to establish whether sTim-3 disrupts TCR signaling. Western blotting assay results showed that sTim-3 treatment decreased the phosphorylation levels of ERK1/2, LCK, ZAP70, and PLCγ1 upon anti-CD3/CD28 stimulation (Figure 5J). Moreover, flow cytometric analysis demonstrated that the tumor-infiltrating CD8+ T cells from sTim-3-overexpressing HCC mice displayed lower TCR activation than those from control mice (Figure 5K). These findings suggest that sTim-3 directly promotes T cell exhaustion and disrupts TCR signaling, inducing T cell unresponsiveness to the PD-1 blockade.

sTim-3 augments T cell dysfunction and anti-PD-1 resistance via CEACAM-1

Given that human sTim-3, as a cleaved form of membrane Tim-3, inhibited T cell function independent of membrane Tim-3, we hypothesized that sTim-3 could serve as a ligand rather than a membrane Tim-3 blocker. The aforementioned results revealed that sTim-3 suppressed cytokine production in mouse T cells and human TILs but not in human T cells from PBMCs. This implies that human peripheral T cells might lack the corresponding sTim-3 receptor. Consequently, we compared the expression levels of known Tim-3 binding partners, including phosphatidylserine (PS), Galectin-9, CEACAM-1, and HMGB1 in PBMCs. Only CEACAM-1 was not expressed in PBMC-derived T cells (Figure S6A). Furthermore, both human tumor-infiltrating CD4+ and CD8+ T cells showed higher CEACAM-1 expression than para-tumor tissue cells (Figure S6B).

Notably, mouse OT-Ⅰ CD8+ T cells showed high CEACAM-1 expression upon antigen stimulation (Figures S6C and S6D). In this regard, we knocked down CEACAM-1 in OT-Ⅰ CD8+ CTLs using retroviral short hairpin RNA (shRNA) to evaluate its role in sTim-3-mediated T cell inhibition (Figure S6E). Under CEACAM-1 silencing condition, sTim-3 overexpression failed to inhibit IFN-γ and TNF-α secretion by OT-Ⅰ CTLs (Figure 6A) but also abolished their ability to enhance T cell exhaustion (Figure 6B) and induce ant-PD-1 resistance (Figure 6C). Furthermore, knocking out CEACAM-1 in OT-Ⅰ CTLs using the retroviral CRISPR-Cas9 system yielded similar results (Figures 6D, 6E, 6F, and S6F). These findings indicate that sTim-3 aggravates T cell exhaustion and anti-PD-1 resistance through CEACAM-1.Figure 6 sTim-3 augments T cell dysfunction and anti-PD-1 resistance via CEACAM-1

(A–C) RV-shCEACAM-1 was used to knock down CEACAM-1 in OT-I CTLs cells. (A) shCEACAM-1 OT-Ⅰ CTLs were pretreated with sTim-3 protein (5 μg/mL), followed by stimulation with anti-CD3/CD28 antibodies for 6 h. IFN-γ and TNF-α production was assessed using flow cytometry (n = 3). (B) Exhausted shCEACAM-1 OT-Ⅰ CTLs were induced in the presence or absence of sTim-3. Percentages of PD-1+Tim-3+TOX+TCF1− CD8+ TEX cells were assessed using flow cytometry (n = 5). (C) shCEACAM-1 OT-Ⅰ CTLs were pretreated with IgG or anti-PD-1 antibodies (5 μg/mL) in the presence of sTim-3 protein (5 μg/mL) or not, followed by stimulation with anti-CD3/CD28 antibodies for 6 h. IFN-γ and TNF-α production was assessed using flow cytometry (n = 3).

(D–F) RV-sgCEACAM-1 was used to knock out CEACAM-1 in OT-Ⅰ-Cas9tdTomato CTLs cells. (D) IFN-γ and TNF-α production by control or sTim-3-treated sgCEACAM-1 OT-Ⅰ CTLs were assessed using flow cytometry (n = 3). (E) Exhausted sgCEACAM-1 OT-Ⅰ CTLs were induced in the presence or absence of sTim-3. Percentages of PD-1+Tim-3+TCF1− CD8+ TEX cells were assessed using flow cytometry (n = 5). (F) sgCEACAM-1 OT-Ⅰ CTLs were pretreated with IgG or anti-PD-1 antibodies (5 μg/mL) in the presence of sTim-3 protein (5 μg/mL) or not, followed by stimulation with anti-CD3/CD28 antibodies. IFN-γ and TNF-α production was assessed using flow cytometry (n = 3).

(G and H) Jurkat cells (G) or CEACAM-1-overexpressing Jurkat cells (Jurkat-CEACAM-1) (H) were pretreated with sTim-3 protein (5 μg/mL) and then stimulated with anti-CD3/CD28 antibodies for 12 h. IL-2 expression at mRNA and protein level was assessed using qPCR and flow cytometry (n = 3).

(I and J) Representative immunoblots of control (Mock) and sTim-3-treated Jurkat cells (I) or Jurkat-CEACAM-1 cells (J), which were stimulated with anti-CD3/CD28 antibodies for indicated time points.

(K and L) PD-1-overexpressing Jurkat or Jurkat-CEACAM-1 cells were pretreated with anti-PD-1 antibody for 1 h and then stimulated with plate-coated anti-CD3/CD28 antibodies and PD-L1 protein for 6 h. RT-qPCR detected the IL-2 mRNA level of Jurkat-PD-1 cells (K) and Jurkat-CEACAM-1-PD-1 cells (L). All results are representative of at least three independent experiments. Data are presented as mean ± SEM and were analyzed by the unpaired Student’s t test (A, B, C, D, E, F, G, H, K, and L). ∗p < 0.05 and ∗∗p < 0.01; ns, no significance.

To further confirm the involvement of CEACAM-1 in human T cells, we used the Jurkat human T cell line, which did not express CEACAM-1 even after phytohaemagglutinin (PHA) stimulation (Figure S6F). As expected, sTim-3 treatment did not inhibit the anti-CD3/CD28-induced IL-2 and TCR activation in Jurkat cells (Figures 6G and 6I). However, following CEACAM-1 overexpression, sTim-3 inhibited IL-2 production and TCR activation in Jurkat cells (Figures 6H and 6J). Furthermore, with CEACAM-1 null expression, sTim-3 did not affect the anti-PD-1-mediated IL-2 mRNA upregulation in a system in which PD-1-overexpressing Jurkat cells interact with plate-bound PD-L1 (Figure 6K). Conversely, consistent with the in vivo outcomes of sTim-3-induced anti-PD-1 resistance, sTim-3 diminished the efficacy of PD-1 blockade in Jurkat cells under CEACAM-1 overexpression conditions (Figure 6L).

These findings collectively suggest that sTim-3 can suppress T cell function, as well as promote T cell exhaustion and unresponsiveness to PD-1 blockade, through CEACAM-1.

Blocking sTim-3 or ADAM10 suppresses tumor progression and reverses anti-PD-1 resistance

Since sTim-3 is the cleaved form of membrane Tim-3, we sought to establish whether the Tim-3 blocking antibody could inhibit the tumor-promoting functions of sTim-3. To rule out the influence of membrane Tim-3, sTim-3 was overexpressed in Tim-3-deficient mice bearing AKT/c-Myc-driven HCC (Figure 7A). The results showed that treatment with the Tim-3 antibody significantly impeded HCC progression and extended survival in mice (Figure 7B).Figure 7 Blocking sTim-3 or ADAM10 suppresses tumor progression and reverses anti-PD-1 resistance

(A and B) Tim-3 knockout mice were hydrodynamically injected with mTim-3/AKT/c-Myc plasmids to construct the sTim-3-overexpressing HCC model and then received anti-Tim-3 antibody (α-Tim-3) at the indicated times. (A) Schematic diagram of the sTim-3-overexpressing HCC in Tim-3 KO mice treated with anti-Tim-3 antibody. (B) Survival curve of Tim-3 KO mice bearing sTim-3-overexpressing HCC treated with IgG or anti-Tim-3 antibody (n = 7).

(C–E) Tim-3 humanized mice were hydrodynamically injected with AKT/c-Myc plasmids to construct an HCC model, and mice were then treated with intraperitoneal DMSO or ADAM10 inhibitor GI254023X (GI, 20 mg/kg/d) at the indicated times. (C) Schematic diagram of the experiment. (D) Tumor growth was assessed using bioluminescence imaging (n = 7 per group), and (E) survival curves were monitored (DMSO: n = 7; GI: n = 8).

(F and G) Human TILs from HCC patients were isolated and pretreated with ADAM10 inhibitor GI (5 μM) or DMSO together with anti-PD-1 antibodies (5 μg/mL) or IgG (5 μg/mL) for 3 days and then stimulated with anti-human CD3/CD28 beads for 24 h (n = 4). (F) Schematic diagram of the experiment. (G) The secretion of IFN-γ in the supernatants was detected using ELISA. All results are representative of at least two independent experiments. Data are presented as mean ± SEM and were analyzed by the unpaired Student’s t test (D and G) and log rank test (B and E). ∗p < 0.05 and ∗∗p < 0.01; ns, no significance.

Since we had already demonstrated the critical involvement of ADAM10 in human sTim-3 generation, we further interrogated whether ADAM10 inhibitors could suppress tumor progression and reverse anti-PD-1 resistance. Specifically, Tim-3 humanized mice, in which the extracellular region of Tim-3 is replaced with its human counterpart, were used to construct AKT/c-Myc-driven HCC models, followed by intraperitoneal treatment with GI (Figure 7C). The ELISA results confirmed human sTim-3 production by cultured T cells from Tim-3 humanized mice, as well as the GI treatment-mediated successful inhibition of serum sTim-3 (Figures S7A and S7B). Notably, compared to the vehicle control treatment, GI treatment significantly delayed HCC progression (Figure 7D) and prolonged survival (Figure 7E).

To further explore the reinvigorating effect of the ADAM10 inhibitor GI on human T cell responses, we obtained TILs that exhibited poor response to PD-1 blockade from HCC patients (Figure 7F). According to the ELISA results, anti-PD-1 treatment did not increase IFN-γ secretion (Figure 7G). Notably, treatment with GI alone significantly enhanced IFN-γ secretion by the anti-PD-1-resistant TILs, and the combination of anti-PD-1 and GI also synergistically enhanced IFN-γ production (Figure 7G), highlighting the role of ADAM10 inhibition in improving T cell function and overcoming anti-PD-1 resistance in human TILs. These findings collectively suggest that targeting the ADAM10-sTim-3 axis, either by blocking sTim-3 production or by neutralizing sTim-3 using a blockade antibody, holds great potential in tumor therapy, even in PD-1-resistant tumors.

Discussion

In this study, we explored the inhibitory role of sTim-3 in antitumor response and anti-PD-1 therapy with various types of mouse tumor models and human TILs. In addition to illuminating tumor immune evasion and anti-PD-1 resistance, this study highlighted sTim-3 as a potential biomarker and promising therapeutic target for onco-immunotherapy.

We observed that sTim-3 was upregulated in NSCLC and several digestive tumors. Furthermore, high serum sTim-3 levels correlated with shorter survival, more advanced tumor stages, and larger tumor burden in NSCLC patients, highlighting sTim-3 as a potential biomarker for tumor progression. Additionally, sTim-3 displayed a gradually increasing trend in HBV-related HCC progression and correlated positively with ALT and AST concentrations. These findings were consistent with those of a recent study, which reported higher sTim-3 expression in HBV cirrhosis patients compared to HBV carriers,36 further underscoring the potential roles of sTim-3 as a chronic inflammation marker. Notably, NSCLC patients who were unresponsive to anti-PD-1 therapy also showed higher sTim-3 levels than responders. Similarly, patients with cholangiocarcinoma, which has been reported to be poorly responsive to anti-PD-1 therapy, showed higher serum sTim-3 levels than HCC. These findings strongly support the clinical usefulness of sTim-3 as an easily detectable biomarker for tumor prognosis and response to anti-PD-1 therapy. Moreover, combining sTim-3 with other potential biomarkers, such as sPD-L1, might show higher accuracy for predicting the response to anti-PD-1 blockade in tumor patients, which warrants further study.

After excluding the direct effect of sTim-3 on tumor cell proliferation in vitro, we found that sTim-3 promoted tumor growth in both subcutaneous xenograft tumor models and spontaneous liver cancer models via TME regulation. Notably, sTim-3 is more than just a biomarker of anti-PD-1 resistance, as it could directly inhibit response to PD-1 blockade in orthotopic HCC and ICC tumor models. Functional investigations involving mice CD8+ CTLs and human TILs revealed that sTim-3 impairs T cell effector function while promoting T cell exhaustion and resistance to PD-1 blockade. However, several studies have shown that the ectodomain of murine Tim-3 fused with human IgG, with a similar structure as the cleaved form, promotes T cell proliferation and cytokine production in vitro and suppresses tolerance induction to accelerate diabetes in vivo.19,26 We attributed the discrepancies to the fact that the Fc tag in the recombinant protein might alter the sTim-3 function or that sTim-3 might play different roles in various diseases. Consequently, additional research is required to further elucidate the role of sTim-3 in different diseases.

Since the tumor-promoting role of sTim-3 is not membrane Tim-3 dependent, we speculated that sTim-3 could function as a ligand of certain receptors on T cells rather than as a Tim-3 competitor. Hitherto, several binding partners of Tim-3 have been identified, including Galectin-9, HMGB1, PS, and CEACAM-1.37 Our investigations revealed that sTim-3 could not inhibit cytokine production by human peripheral T cells. Furthermore, CEACAM-1 expression was detected in tumor-infiltrating T cells but not peripheral T cells in humans, which explains their different responses to sTim-3. This finding demonstrated that sTim-3 inhibits T cell function and response to PD-1 blockade through CEACAM-1.

According to research, ADAM10/17 shed the ectodomain, generating human sTim-3.21,22 Our findings revealed that tumor tissues exhibited a higher ADAM10/17 expression than para-tumor tissues. Given that Tim-3 is highly expressed on tumor-infiltrating T cells, it is plausible that the high ADAM10/17 expression in the TME mediates Tim-3 shedding from T cells. Moreover, the ADAM10 inhibitor that greatly blocks sTim-3 generation could suppress HCC progression in vivo and reverse the anti-PD-1 resistance in TILs from HCC patients. This phenomenon supports the combined usage of ADAM10 inhibitors and PD-1 antibodies in onco-immunotherapy. Furthermore, some ADAM10/17 inhibitors were proven to collaborate with several existing tumor therapies to inhibit tumor growth.38,39 For instance, a dual ADAM10/17 inhibitor (INCB7839) was clinically administered along with trastuzumab to treat HER2-positive metastatic breast cancer patients.40,41 This combination therapy demonstrated safety and was well tolerated. In this regard, we propose a novel application of ADAM10/17 inhibitors along with existing onco-immunotherapy strategies in cancer treatment, a therapeutic approach that could benefit tumor patients with anti-PD-1 resistance.

Using Tim-3 KO mice, which lack both membrane-bound and soluble Tim-3 from the host, we verified the preliminary efficacy of Tim-3 antibodies in neutralizing sTim-3 in the HCC model. Nevertheless, we observed elevated sTim-3 levels following anti-PD-1 treatment in NSCLC patients, which raised serious concerns regarding the dosing of Tim-3 antibodies and their therapeutic efficacy for potential clinical application. In this regard, we deduced that the fact that anti-PD-1 treatment has been shown to stimulate T cells42,43 and that Tim-3 is upregulated during T cell activation44,45 could explain the anti-PD-1-mediated sTim-3 induction. Recent advancements in multi-omics technology have greatly enhanced our understanding of T cell heterogeneity. Studies have demonstrated that following anti-PD-1 treatment, various T cell subsets exhibit unique alterations in their proliferative capacities, effector functions, homing activities, and expression of exhaustion markers.32,43,46,47,48 We hypothesized that sTim-3 production induced by anti-PD-1 treatment could be attributed to certain T cell subset(s), which mediate anti-PD-1 treatment resistance. Moreover, Tim-3 is also expressed by other immune cells and tumor cells, which are also potential sources of sTim-3. Utilizing multi-omics technologies to pinpoint the sTim-3-associated T cell or other cell subsets represents a promising avenue for future research. Furthermore, ADAM10/17, highly expressed in the TME, might continuously shed the membrane Tim-3. Therefore, before employing the Tim-3 antibody as a therapeutic intervention, it is imperative to conduct thorough pharmacokinetic assessments in both preclinical models and clinical trials. Additionally, it is essential to closely monitor plasma sTim-3 levels in patients undergoing therapy to identify the optimal treatment window.

In summary, our findings highlight the significance of sTim-3 in mediating tumor immune escape and resistance to PD-1 blockade. As a result, we propose human sTim-3 as a candidate biomarker for the progression of various tumors and response to anti-PD-1 therapy with tremendous therapeutic implications. Moreover, our findings strongly support the clinical application of Tim-3 antibodies to inhibit both the membrane and soluble Tim-3-mediated immune suppression in onco-immunotherapy. Overall, targeting the ADAM10-sTim-3-CEACAM-1 axis could benefit anti-PD-1-resistant tumor patients.

Limitations of the study

The major limitation of this study is that we only assessed the association of sTim-3 with anti-PD-1 resistance in NSCLC, in which anti-PD-1 therapy is commonly used as the primary therapeutic approach. In this regard, the clinical diagnostic value of serum sTim-3 in immunotherapy, particularly in anti-PD-1 therapy, requires additional exploration in various tumor types. Although we have proved that sTim-3 aggravates T cell exhaustion in mouse models, more direct clinical evidence is still needed. Future elaborating T cell phenotypes in patients with high and low sTim-3 levels could further support sTim-3’s role in T cell exhaustion. Our findings also revealed a strong correlation between sTim-3 downregulation and the efficacy of ADAM10 inhibitor GI, implying a potential mechanism of ADAM10 in generating sTim-3 in our HCC mouse model. However, ADAM10/17 has been reported to cleave other receptors besides Tim-3; hence, we cannot conclude that the observed effects on tumor growth were entirely attributable to sTim-3 downregulation. So far, there are currently no available inhibitors that specifically block sTim-3 generation, further limiting our study. Therefore, it is crucial to identify the cutting site of ADAM10/17 on Tim-3 to design a specific peptide that might block sTim-3 production in the future.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Antibodies	
	
anti-mouse CD8-APC	BioLegend	cat#100712; RRID:AB_312751	
anti-mouse PD-1-BV421	BioLegend	cat#135218; RRID:AB_2561447	
anti-mouse CD4-APC	BioLegend	cat#100411; RRID:AB_312696	
anti-mouse Ly6G/Ly6C (Gr1)-PE	BioLegend	cat#108408; RRID:AB_313373	
anti-mouse CTLA4-PEcy7	BioLegend	cat#106313; RRID:AB_2564237	
anti-mouse CD45-percpcy5.5	BioLegend	cat#103132; RRID:AB_893340	
anti-mouse IL-2-FITC	BioLegend	cat#503806; RRID:AB_315300	
anti-human CEACAM-1-BV421	BioLegend	cat#342314; RRID:AB_2716133	
anti-mouse CD8-percpcy5.5	eBioscience	cat#45-0081-82; RRID:AB_1107004	
anti-mouse CD4-percpcy5.5	eBioscience	cat#45-0042-82; RRID:AB_1107001	
anti-mouse Lag3-PE	eBioscience	cat#12-2231-81; RRID:AB_494216	
anti-mouse Foxp3-eFlour660	eBioscience	cat#50-5773-82; RRID:AB_11218868	
anti-mouse CD25-PE	eBioscience	cat#12-0251-81; RRID:AB_465606	
anti-mouse IFN-γ-APC	eBioscience	cat#17-7311-82; RRID:AB_469504	
anti-mouse IFN-γ-BV421	BioLegend	cat#505829; RRID:AB_10897937	
anti-mouse TNF-α-PE	eBioscience	cat#12-7321-81; RRID:AB_466198	
anti-mouse CD11b-PEcy7	eBioscience	cat#25-0112-82; RRID:AB_469588	
anti-mouse CD66a (CEACAM-1)-PE	eBioscience	cat#12-0661-80; RRID:AB_1311201	
anti-human CD4-FITC	eBioscience	cat#11-0048-42; RRID:AB_1633390	
anti-human CD8-PEcy7	eBioscience	cat#25-0088-42; RRID:AB_1659702	
anti-mouse IL-2-eflour450	Invitrogen	cat#48-7021-82; RRID:AB_1944462	
anti-rabbit IgG (H + L), F(ab')2 Fragment	Cell Signaling Technology (CST)	cat#4412; RRID:AB_1904025	
anti-GAPDH (1E6D9)	Proteintech	cat#60004-1-Ig; RRID:AB_2107436	
anti-phosphor-Zap-70 (Tyr319)/Syk (Tyr352)	Cell Signaling Technology (CST)	cat#2701; RRID:AB_331600	
anti-phospho-PLCγ1 (Tyr783) (D6M9S)	Cell Signaling Technology (CST)	cat#14008; RRID:AB_2728690	
anti-phosphor-Lck (Tyr505)	Cell Signaling Technology (CST)	cat#2751; RRID:AB_330446	
anti-phosphor-p44/42 MAPK (Erk1/2)	Cell Signaling Technology (CST)	cat#9101; RRID:AB_331646	
and anti-CEACAM-1 (D1P4T)	Cell Signaling Technology (CST)	cat#14771; RRID:AB_2798605	
anti-p44/42 MAPK (Erk1/2)	Cell Signaling Technology (CST)	cat#9102; RRID:AB_330744	
anti-SHP-1	ABclonal	cat#a19111; RRID:AB_2862604	
anti-SHP-2	ABclonal	cat#a12486; RRID:AB-2861667	
anti-human CD3 (OKT3)	Bio X cell	cat# BE0001-2; RRID:AB_1107632	
anti-human CD28 (CD28.2)	Bio X cell	cat#BE0291; RRID:AB_2687814	
anti-mouse CD3 (2C11)	Bio X cell	cat#BE0001-1; RRID:AB_1107634	
anti-mouse CD28 (PV1)	Bio X cell	cat#BE0015-5; RRID:AB_1107628	
anti-PD-1 mAb (29F.1A12)	Bio X cell	cat#BE0273; RRID:AB_2687796	
anti-Tim-3 mAb (CD366)	Bio X cell	cat#BE0115; RRID:AB_10949464	
anti-Ki67	Abcam	cat#ab16667; RRID:AB_302459	
	
Biological samples	
	
Human tissues samples	This paper	N/A	
Human blood samples	This paper	N/A	
	
Chemicals, peptides, and recombinant proteins	
	
GI 254023X	Shanghai Topbiochem Technology Co., LTD	cat#260264-93-5	
DMSO	Beijing Solarbio Science & Technology Co.,Ltd	cat#D8371	
OVA257-264 (SIINFEKL) peptide	AnaSpec	cat#AS-64384	
sTim-3 protein	Sanyoubio	cat#PHA261	
Phorbol myristate acetate (PMA)	Selleck	cat# S7791	
Ionomycin	Sigma	cat#I3909	
	
Critical commercial assays	
	
human IFN-γ ELISA Kit	Dakewe	cat#1110002	
human TNF-α ELISA Kit	Dakewe	cat#1117202	
T cell TransAct™	Miltenyi Biotec	cat#130-111-160	
ALT Assay Kits	Nanjing Jiancheng Bioengineering Institute	cat#C009-2	
AST Assay Kits	Nanjing Jiancheng Bioengineering Institute	cat#C010-2	
RevertAid First Strand cDNA Synthesis Kit	Thermo Fisher Scientific	cat#K1621	
SuperReal MaterMix	Vazyme	cat#Q711-03	
NucleoBond Xtra Midi EF endotoxin-free plasmid kits	MACHEREY-NAGEL	cat#740420.50	
BeyoClick™ EdU Cell Proliferation Kit	Beyotime Biotechnology	cat#C0081S	
CCK8 kit	KeyGEN BioTECH	cat#KGA9305-500	
	
Deposited data	
	
T cell activation gene set	GO:0042110	https://www.informatics.jax.org/vocab/gene_ontology/GO:0042110	
Anti-PD-1 unresponsive gene set	Kim et al.35	https://doi.org/10.1038/s41423-020-0427-6	
RNA sequencing dataset	This paper	SRA:PRJNA1135313	
	
Experimental models: Cell lines	
	
Lenti-X 293T cells	Takara Bio Inc.	cat#632180	
Platinum-E cells	China Infrastructure of Cell Line Resource	N/A	
Jurkat cells	Chinese Academy of Sciences	N/A	
EL4 cells	Chinese Academy of Sciences	N/A	
HepG2 cells	Chinese Academy of Sciences	N/A	
Huh7 cells	Chinese Academy of Sciences	N/A	
	
Experimental models: Organisms/strains	
	
OT-Ⅰ TCR transgenic mice	Gift from Prof. CE Rudd (University of Cambridge, UK)	N/A	
Tim-3 TALEN (Tim-3 KO) mice	Sidansai Biotechnology Company14,49	N/A	
Havcr2tm1(hHAVCR2)/Gpt	Gempharmatech Co. Ltd	N/A	
Gpt-Rosa26tm1(CAG-LSL-Cas9-tdTomato)/Gpt	Gempharmatech Co. Ltd	N/A	
	
Oligonucleotides	
	
human Tim3 primer 1 Forward primer (5′-3′):
GAGAGTTAAAACTGTGCCTAACAG	Beijing Tsingke Biotech Co., Ltd.	N/A	
human Tim3 primer 1 Reverse primer (5′-3′): CTCCAAAACCAGTCAGGTGACACA	Beijing Tsingke Biotech Co., Ltd.	N/A	
human Tim3 primer 2 Forward primer (5′-3′):
TGTGACTCTAGCAGACAGTGGGAT	Beijing Tsingke Biotech Co., Ltd.	N/A	
human Tim3 primer 2 Reverse primer (5′-3′): CTGCTACTGCATTTGCCAATCCTG	Beijing Tsingke Biotech Co., Ltd.	N/A	
h-ADAM10 Forward primer (5′-3′):
TGGTGGCACATTTTATGTTGAGC	Beijing Tsingke Biotech Co., Ltd.	N/A	
h-ADAM10 Reverse primer (5′-3′): AAGTTCTGGACCATTAGCAGC	Beijing Tsingke Biotech Co., Ltd.	N/A	
h-ADAM 17 Forward primer (5′-3′):
GACTCTAGGGTTCTAGCCCAC	Beijing Tsingke Biotech Co., Ltd.	N/A	
h-ADAM 17 Reverse primer (5′-3′):
GGAGACTGCAAACGTGAAACAT	Beijing Tsingke Biotech Co., Ltd.	N/A	
mIFN-γ Forward primer (5′-3′):
TGAGTATTGCCAAGTTTGAGGTCA	Beijing Tsingke Biotech Co., Ltd.	N/A	
mIFN-γ Reverse primer (5′-3′):
CGGCAACAGCTGGTGGAC	Beijing Tsingke Biotech Co., Ltd.	N/A	
mTNF-α Forward primer (5′-3′):
AGTGACAAGCCTGTAGCCC	Beijing Tsingke Biotech Co., Ltd.	N/A	
mTNF-α Reverse primer (5′-3′):
GAGGTTGACTTTCTCCTGGTAT	Beijing Tsingke Biotech Co., Ltd.	N/A	
mIL-2 Forward primer (5′-3′):
GGAGCAGCTGTTGATGGACCTAC	Beijing Tsingke Biotech Co., Ltd.	N/A	
mIL-2 Reverse primer (5′-3′):
AATCCAGAACATGCCGCAGAG	Beijing Tsingke Biotech Co., Ltd.	N/A	
m18S Forward primer (5′-3′):
AGTTCCAGCACATTTTGCGAG	Beijing Tsingke Biotech Co., Ltd.	N/A	
m18S Reverse primer (5′-3′):
TCATCCTCCGTGAGTTCTCCA	Beijing Tsingke Biotech Co., Ltd.	N/A	
h-βActin Forward primer (5′-3′):
AGTTGCGTTACACCCTTTC	Beijing Tsingke Biotech Co., Ltd.	N/A	
h-βActin Reverse primer (5′-3′):
CCTTCACCGTTCCAGTTT	Beijing Tsingke Biotech Co., Ltd.	N/A	
shCEACAM-1 sense:
TGGGAGTCTACACACTAGATA	Beijing Tsingke Biotech Co., Ltd.	N/A	
shCEACAM-1 anti-sense:
TATCTAGTGTGTAGACTCCCA	Beijing Tsingke Biotech Co., Ltd.	N/A	
sgCEACAM-1: TTCACGGGGCAAGCATACAG	Beijing Tsingke Biotech Co., Ltd.	N/A	
	
Recombinant DNA	
	
pT3/NICD1	Addgene (Gift from Xin Chen)	#86500	
pCMV(CAT)T7-SB100	Addgene (Gift from Zsuzsanna Izsvak)	#34879	
pT3-c-Myc	Addgene (Gift from Xin Chen)	#92046	
pMXs-IRES-GFP	Gift from Hongyan Wang	N/A	
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP	Addgene	cat#86457	
psPAX2	Addgene	cat#12260	
pMD2G	Addgene	cat#12259	
pHelper	MiaoLingBio	cat#P0243	
pAAV-DJ	MiaoLingBio	cat#P2924	
pCL-Eco	Addgene	cat#12371	
pT3-AKT-Fluc	This paper	N/A	
pT3-AKT-Fluc-OVAp	This paper	N/A	
pT3-sTim-3	This paper	N/A	
	
Software and algorithms	
	
GraphPad Prism 9	GraphPad software	N/A	
IVIS Spectrum system	PerkinElmer	N/A	
FlowJo 10.8.1.	FlowJo, LLC	N/A	
CytoFLEX S Flow Cytometer	Beckman Coulter Inc.	N/A	
GSEA software	Broad Institute, MIT	N/A	
	
Other	
	
Percoll	Cytiva	cat#17089101	
Ficoll-Hypaque	TBD-science	cat#LTS1077	
RIPA lysis buffer	Beyotime	cat#P0013D	
Protease inhibitor cocktail	Sigma-Aldrich	cat#P8340	
Phosphatase inhibitors	Sigma-Aldrich	cat#P0044	
TRIzol	TIANGEN Biotech	cat#GDP424	
IC fixation buffer	eBioscience	cat#00-8222-49	
Permeabilization buffer	eBioscience	cat#00-8333-56	
Fixation/permeabilization concentrate and diluent buffer	eBioscience	cat#00-5521	

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Chunyang Li (lichunyang@sdu.edu.cn).

Materials availability

All unique/stable reagents generated in this study are available from the lead contact upon request and upon completion of Materials Transfer Agreement.

Data and code availability

• The RNA-seq data generated in this study have been deposited in the National Center for Biotechnology Information (NCBI) database under BioProject accession number SRA: PRJNA1135313.

• This paper does not report the original code.

• Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Experimental model and study participant details

Cell lines

Lenti-X 293T cells, Platinum-E cells, HepG2 and Huh7 human HCC cells, Hepa1-6 mouse hepatoma cells, B16F10 and its ovalbumin (OVA)-expressing derivate (i.e., B16-MO5) mouse melanoma cells were cultured in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% (v/v) Fetal Bovine Serum (FBS) and 50 U/mL penicillin-streptomycin. The Jurkat human T lymphoma cells and the EL4 mouse T lymphoma cells were cultured in the Roswell Park Memorial Institute Medium 1640 (RPMI 1640) supplemented with 10% (v/v) FBS and 50 U/mL penicillin-streptomycin. All cell lines were routinely examined for mycoplasma infection.

Animal studies

OT-Ⅰ TCR transgenic mice expressing an OVA257-264-specific TCR on a C57BL/6J background were kindly provided by Prof. CE Rudd (University of Cambridge, UK). Tim-3 TALEN (Tim-3 KO) mice were generated by Sidansai Biotechnology Company, which has been described previously.13,50 Tim-3 humanized mice on C57BL/6 background (Havcr2tm1(hHAVCR2)/Gpt), in which coding sequence of the extracellular region of Tim-3 was replaced with its human counterpart, were purchased from Gempharmatech Co. Ltd (Nanjing, Jiangsu, China). Cas9tdTomato mice on C57BL/6J background (Gpt-Rosa26tm1(CAG−LSL-Cas9−tdTomato)/Gpt) (Gempharmatech Co. Ltd), in which the CAG promoter-driven Cas9 expression element was inserted into the Rosa26 site, and an STOP element with loxP on both sides was placed between CAG and Cas9, were purchased from Gempharmatech Co. Ltd. Then Cas9tdTomato mice were crossed with CD4-Cre mice and OT-Ⅰ mice sequentially to generate OT-Ⅰ-CD4-Cre-Cas9tdTomato mice with T cell-specific expression of Cas9 protein. Sex and age-matched (6–12 weeks old) mice were randomized into the indicated groups. Mice were bred under specific pathogen-free conditions at the Model Animal Research Center of Shandong University under a regular 12 h light/12 h dark schedule at a constant room temperature (22 ± 2°C). All animal procedures were performed strictly with the ethical guidelines and were approved by the Animal Care and Use Committee of Shandong University. Special attention was taken to determining the humane endpoints and deciding whether the mice should be euthanized to avoid further suffering. According to the 3Rs principle, experiments were carefully designed to minimize mice use and obtain the maximum data. Animal experiments are reported in accordance with the ARRIVE guidelines.51

Clinical specimens

Blood samples were collected from non-small-cell lung cancer (NSCLC) patients prior to anti-cancer treatment (also as no ant-PD-1 group), including those with squamous cell carcinoma and adenocarcinoma, at the Qilu Hospital Health Examination Center, Shandong University.

Blood samples were also collected from NSCLC patients who had undergone multiple rounds of anti-PD-1 therapy (anti-PD-1 group). Based on radiographic staging according to the Response Evaluation Criteria in Solid Tumors (RECIST),49 NSCLC patients undergoing anti-PD-1 therapy were classified into two groups: Responders (R) or Non-responders (NR) to anti-PD-1 therapy. The NR group comprised both patients with a progressive disease and those with a stable disease (SD). On the other hand, the R group comprised patients with complete or partial responses (CR/PR).

Blood samples were also collected from 28 healthy donors, 43 CHB patients, 20 HCC patients (2 non-HBV-associated HCC and 18 HBV-associated HCC), 16 gastric cancer (GC) patients, 15 colorectal cancer patients, and 9 cholangiocarcinoma patients, as well as six paired tumor tissues and para-tumor tissues from HCC patients, at Qilu Hospital, Shandong University. None of the patients had other infectious diseases or underwent chemotherapy, radiation, or any other antitumor treatment before tumor resection. All the included HCC patients underwent hepatoectomy at Qilu Hospital, Shandong University, between 2017 and 2020. Sample collection procedures in this study were approved by the Ethics Committee of Shandong University School of Basic Medical Sciences, and all patients provided written informed consent.

Method details

Measurement of sTim-3 by ELISA.

Serum sTim-3 concentrations in patients and tumor-bearing mice were measured using the human enzyme-linked immunosorbent assay (ELISA) kit (cat#DTIM30, R&D Systems, Inc., Minneapolis, MN, USA).

The spontaneous orthotopic HCC mouse model

The SB100 transposase-expressing vector pCMV(CAT)T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879). An oncogene c-Myc-expressing vector pT3-c-Myc was a gift from Xin Chen (Addgene plasmid #92046). First, the firefly luciferase gene was subcloned to the 3′ end of the AKT gene, which was coupled by the P2A sequence to obtain a pT3-AKT-Fluc plasmid for live imaging of tumor progression. Subsequently, either control pT3-Vector or human sTim-3 expression pT3-sTim-3 plasmid (10 μg) along with pT3-AKT-Fluc (12 μg), pT3-c-Myc (12 μg), and pCMV(CAT)T7-SB100 (1.36 μg) were suspended in a saline solution at a final volume equal to 10% of the mouse body weight and hydrodynamically injected into the lateral tail vein in <10 s per injection. HCC progression was monitored by bioluminescence imaging with the IVIS Spectrum system (PerkinElmer). The survival rate was recorded every day.

The spontaneous orthotopic ICC mouse model

An intracellular domain of Notch1-expressing vector pT3/NICD1 was a gift from Xin Chen (Addgene plasmid # 86500). First, a mini-gene encoded polypeptide derived from OVA was subcloned to the 3′ end of the firefly luciferase gene of pT3-AKT-Fluc to get a pT3-AKT-Fluc-OVAp plasmid, introducing surrogate tumor antigens to enhance the immunogenicity of the intrahepatic cholangiocarcinoma (ICC). Subsequently, either control pT3-Vector or human sTim-3 expression pT3-sTim-3 plasmid (10 μg), along with pT3-AKT-Fluc-OVAp (4 μg), pT3/NICD1 (10 μg), and pCMV(CAT)T7-SB100 (1 μg) were suspended in a saline solution at a final volume equal to 10% of the mouse body weight, and hydrodynamically injected into the lateral tail vein in <10 s per injection. ICC progression was monitored by bioluminescence imaging with the IVIS Spectrum system (PerkinElmer). The survival rate was recorded every day.

Anti-PD-1 antibody and ADAM10 inhibitor therapy

For anti-PD-1 antibody therapy, the mice were intraperitoneally injected with 150 μg anti-PD-1 mAb on days 10, 13, 16, 19, and 22 post-HDI. Tumor development was monitored by bioluminescence imaging with IVIS Spectrum system (PerkinElmer) at three- and four-weeks post-HDI.

For the ADAM10 inhibitor therapy, the mice were intraperitoneally injected with GI 254023X (GI, 20 mg/kg/d) from day 10 to day 24 post-HDI, along with a vehicle control (DMSO). Plasma was collected by bleeding from the submandibular vein after GI treatment. Concentrations of sTim-3 in plasma samples were determined by ELISA.

The subcutaneous melanoma mouse model

Mice were subcutaneously inoculated with B16F10 or B16-MO5 cells (2.0×105 cells). Tumor sizes were measured every three days using a digital caliper in two dimensions (width and length) and presented as tumor volume (mm3, defined as w2×l/2). Mice with a tumor size >20 mm along the longest axis were euthanized by CO2 inhalation in accordance with ethical guidelines.

Immunohistochemistry (IHC) and hematoxylin and eosin (H&E) staining

Liver tissues from control or sTim-3-overexpressing mice were dissected, fixed in a 4% paraformaldehyde solution, embedded in paraffin, and sectioned. The tissues were then stained with the H&E solution or anti-Ki67 (cat#ab16667, Abcam, Cambridge, USA) antibody for H&E staining or IHC analysis, respectively.

Separation of tumor-infiltrating mononuclear cells

The human tumor-infiltrating mononuclear cells were isolated by first cutting the liver tissues from HCC patients into pieces and then digesting them with collagenase type Ⅱ, hyaluronidase, and DNA polymerase (all from Sigma, St.Louis, USA) for 1 h at 37°C. Subsequently, the cell suspension was layered over Ficoll-Hypaque (TBD-science, Tianjin, China) and centrifuged to obtain the mononuclear cells. The B16 tumor infiltrated mononuclear cells were isolated by harvesting the tumor tissues and then digesting and mashing them through a 70 μM nylon mesh. The resultant was centrifuged in 40% Percoll (GE Healthcare, Uppsala, Sweden) to obtain the mononuclear cells. PBMCs were isolated by first harvesting peripheral blood samples from HCC patients into anticoagulant tubes and then diluting them with 1 × phosphate-buffered saline (PBS). Subsequently, the resulting cell suspension was layered over Ficoll-Hypaque (TBD-science, Tianjin, China) and centrifuged to obtain the PBMCs.

Cytokines secretion analysis of TILs

First, TILs from HCC patients were stimulated with T cell TransAct (130-111-160, Miltenyi Biotec, USA) for 24 h in vitro. Subsequently, ELISA kits, including a human IFN-γ ELISA Kit (cat#1110002, Dakewe, Shenzhen, China) and a human TNF-α ELISA Kit (cat#1117202, Dakewe, Shenzhen, China), were used to measure cytokine secretion by cultured PBMCs and TILs from HCC patients following the manufacturer’s instructions. TILs from tumor mice were first stimulated with 50 ng/mL phorbol myristate acetate (PMA) and 1 μg/mL ionomycin (Sigma, St. Louis, USA) in vitro for 5 h.

Surface and intracellular staining and flow cytometry

Surface staining was performed using monoclonal antibodies (mAbs) for 30 min in the dark at 4°C. For intracellular staining, the cells were fixed with an IC fixation buffer (cat#00-8222-49, eBioscience, USA), permeabilized with a permeabilization buffer (cat#00-8333-56, eBioscience), and then labeled with indicated antibodies. For nuclear protein staining, the cells were fixed and permeabilized with a fixation/permeabilization concentrate and a diluent buffer (cat#00–5521, eBioscience). All flow cytometric data were obtained on CytoFLEX S Flow Cytometer (Beckman Coulter Inc., Brea, CA, USA) and analyzed with the CytExpert program (Beckman Coulter Inc.).

Generation and transduction of CD8+ CTLs

OVA257-264 (SIINFEKL) peptide-specific CD8+ CTLs were generated as described previously.52 Briefly, OT-Ⅰ mice splenocytes were isolated and cultured in an RPMI 1640 medium supplemented with 10% FBS, 50 U/mL penicillin-streptomycin, 50 μM 2-Mercaptoethanol, 20 U/mL human recombinant IL-2, and 10 nM OVA257-264 peptide for three days. Cells were then washed and cultured with RPMI growth medium for three days to obtain mature CTLs.

For the retrovirus transfection of CTLs, retrovirus was generated by collecting the supernatants from Platinum-E cells co-transfected with retroviral vector plasmid and a pCL-Eco packaging plasmid as described previously.53 Subsequently, activated OT-I CD8+ T cells were transduced with the retrovirus by centrifugation at 2000g for 90 min at 30°C twice over a 12-h period with 8 μg/mL polybrene.

Cytotoxicity assay and cytokine secretion assay for CD8+ CTLs in vitro

The cytotoxicity was performed using activated OT-Ⅰ CTLs harvested on day 6. For the in vitro cytotoxicity assay, luciferase-expressing B16F10 cells were pulsed with 10 nM OVA257-264 peptide for 1 h and then co-cultured with OT-Ⅰ CTLs at different cell ratios in a culture medium at 37°C for 5 h. Maximal death RLU (Relative luciferase activity) was measured using target cells incubated without effector cells. The specific lysis percentage was calculated as follows: %specific lysis = [1- (maximal death RLU-test RLU)/maximal death RLU)] × 100%.

For the in vitro cytokine secretion assay, OT-Ⅰ CTLs were stimulated with either 2 μg/mL anti-CD3 and 2 μg/mL CD28 antibodies (anti-CD3/CD28) or OVA257-264 peptide-pulsed EL4 at 1:2 ratio in a culture medium for 6 h, then IFN-γ, TNF-α, and IL-2 production were assessed using flow cytometry.

Western Blot

OT-Ⅰ CTLs were stimulated with 2 μg/mL plate-bound anti-CD3 and anti-CD28 antibodies for the indicated time. Cells were washed once with 1 × PBS and lysed in RIPA lysis buffer (Beyotime, Shanghai, China) in the presence of 1% protease inhibitor cocktail and 1% phosphatase inhibitors (Sigma-Aldrich).

AST and ALT assays

Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were determined using ALT and AST Assay Kits (cat#C009-2 and cat#C010-2, Nanjing Jiancheng Bioengineering Institute). All experiments were carried out according to the manufacturer’s guidelines.

Real-time RT-qPCR

Total RNA was extracted from cells using TRIzol (TIANGEN Biotech, Beijing, China) reagent and was reverse transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). RT-qPCR was performed on Bio-Rad Laboratories C1000 Thermal Cycler CFX96 Real-Time System with SuperReal MaterMix (cat#Q711-03, Vazyme). The housekeeping gene mouse 18S rRNA and human ACTIN were used for normalization. Primer sequences are listed in the key resources table.

Plasmid construction

The retroviral pMXs-GFP-2A-BSD vector (RV-vector) was constructed by cloning the GFP and blasticidin resistance genes into the pMXs-IRES-GFP plasmid (from Prof. Hongyan Wang). Human sTim-3 fragment was cloned into pUltra-GFP-2A-BSD plasmid, pscAAV-GFP plasmid, and pMXs-GFP-2A-BSD plasmid to generate sTim-3 overexpression construct. For the knockdown of CEACAM-1, miR-30-based shRNA constructs targeting CEACMA-1 were cloned into the pMXs-GFP-2A-BSD vector. The shRNA sequence is listed in the key resources table. The retroviral MSCV-Guide-P2B vector was obtained by replacing the SalⅠ digestion site upstream of the U6 promoter of the MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP (Addgene plasmid # 86457) with the XhoⅠ digestion site. For the knockout of CEACAM-1, sgRNA constructs targeting CEACMA-1 were cloned into the MSCV-Guide-P2B vector. The sgRNA sequence is listed in the key resources table. The human CEACAM-1 full-length fragment was cloned into pMXs-GFP-2A-Puro plasmid used for CEACAM-1 overexpression in Jurkat cells. All constructs were confirmed by DNA sequencing. All plasmids used in this study were amplified in DH5α and purified using NucleoBond Xtra Midi EF endotoxin-free plasmid kits (cat#740420.50, MACHEREY-NAGEL, Germany).

CCK8 and EdU cell proliferation assays

Tumor cell lines were incubated in a 96-well plate (3000 cells per well). OD values at 450 and 630 nm were measured at the indicated time using a CCK8 kit to analyze relative cell proliferation (Genechem, Shanghai, China).

EdU (5-Ethynyl-2′-deoxyuridine) cell proliferation assay was performed using the BeyoClick EdU Cell Proliferation Kit with Alexa Fluor 647 (cat#C0081S, Beyotime Biotechnology, China). Briefly, the cells were seeded in 96-well plates at a 3000 cells/well density for 24 h. Then, the cells were incubated with 10 μM EdU for 2 h at 3°C and harvested for click reaction according to the manufacturer’s instructions. The percentage of EdU-positive cells was defined as the proliferation rate.

Virus packaging and transduction

Lenti-X 293T cells or Platinum-E cells were transfected with vector and helper plasmids using PEI reagent to produce the virus. Specifically, the lentivirus constructs were packaged in Lenti-X 293T cells with the helper plasmids psPAX2 (Addgene plasmid # 12260) and pMD2G (Addgene plasmid # 12259). The adeno-associated constructs were packaged in Lenti-X 293T cells with the helper plasmids pHelper and pAAV-DJ. The retrovirus constructs were packaged in Platinum-E cells with the helper plasmids pCL-Eco (Addgene plasmid # 12371). The virus supernatant was harvested 48 h after transfection.

For lentivirus and adeno-associated virus transduction, cell lines were infected with 5 mL of virus supernatant containing 10 μg/mL of polybrene. After 24 h, the virus was replaced for a second infection.

The induction of CD8+ CTLs exhaustion (TEX) in vitro

To induce T cell exhaustion. OT-Ⅰ CTLs were seeded onto a 12-well plate coated with anti-mouse CD3 antibodies in the presence or absence of sTim-3 protein. Then, OT-Ⅰ CTLs were passaged and refreshed with anti-mouse CD3 antibodies every two days. After three rounds of repeated anti-CD3 stimulation, the expression of exhaustion markers was determined by flow cytometry analysis.

RNA-seq analysis

First, OT-Ⅰ CTLs were stimulated with 2 μg/mL plate-bound anti-CD3 and anti-CD28 antibodies at a density of 1 × 106 cells/mL in 24-well plates. After 6 h, the cells were harvested and washed with 1×PBS twice and then snap-frozen immediately in TRIzol, awaiting RNA-seq analysis. Following the manufacturer’s protocol, NEBNext Ultra RNA Library Prep Kit for Illumina (cat#E7530L, NEB, USA) was used to generate the sequencing libraries before adding the index codes to attribute sequences to each sample. The adjusted p value <0.05 and | log2(fold change) | > 0.5 thresholds were used to identify differentially transcribed genes between sTim-3-treated and Mock CTLs. Gene Set Enrichment Analysis (GSEA) was performed using the GSEA software (Broad Institute, MIT).

The anti-PD-1 unresponsive gene set was created by identifying upregulated genes in CD28−PD-1+ TILs from a published dataset,34 whereas the T cell activation gene set was obtained from Gene Ontology (GO) terms (GO:0042110).

Quantification and statistical analysis

Statistical analysis was conducted with GraphPad Prism software. Statistical significance was assessed with the Mann–Whitney U test when a nonparametric distribution was assumed. Statistical significance between groups was determined by two-tailed unpaired Student’s t test and two-way ANOVA. For survival analysis, the Log rank test was used to evaluate statistical differences in the Kaplan-Meier analysis. Further details regarding the specific tests used and sample sizes (n) can be found in the figure legends. All in vitro experiments were independently repeated at least three times, unless otherwise specified in the figure legends. Statistical significance was marked as ‘∗’ when p < 0.05, ‘∗∗’ when p < 0.01, ‘∗∗∗’ when p < 0.001 or ‘∗∗∗∗’ when p < 0.0001. p values < 0.05 were considered statistically significant.

Supplemental information

Document S1. Figures S1‒S7

Document S2. Article plus supplemental information

Acknowledgments

This work was supported by the National Key Research and Development Program of China (grant 2022YFC2303600 to C.M.), the 10.13039/501100001809 National Natural Science Foundation of China (grant 82230056 and 82321002 to C.M.; grant 31600714 to C.L.; grant 82271769 to Z.W.), "Open Competition to Select the Best Candidates" Key Technology Program for Nucleic Acid Drugs of NCTIB (Grant No. NCTIB2023XB02006), the Taishan Scholarship (grant no. tspd20181201 to C.M.), the Major Basic Research Project of 10.13039/501100007129 Shandong Natural Science Foundation (grant ZR2020ZD12 to C.M.), the Young Elite Scientist Sponsorship Program by CAST (grant YESS20160077 to C.L.), 10.13039/501100012152 National Postdoctoral Program for Innovative Talents (grant BX201700147 to C.L.), and Cutting Edge Development Fund of Advanced 10.13039/100012335 Medical Research Institute (to X.L.). The authors sincerely thank Prof. Guangwen Ren (The Jackson Laboratory) for comments and consultation on the manuscript. We also thank the Translational Medicine Core Facility of Shandong University and the School of Basic Medical Sciences Core Facility for the consultation and instrument availability that supported this work.

Author contributions

Conceptualization and supervision, C.L. and C.M.; methodology, C.L., C.C., F.Z., and J.P.; investigation, C.C., F.Z., J.P., D.Z., L.X., H.L., S.M., X.P., X.S., Y.S., T.W., H.D., Y.D., and C.L.; formal analysis, C.L., C.C., F.Z., and J.P.; visualization, C.L., C.C., F.Z., and J.P.; resources, C.L., C.M., H.W., and D.Z.; writing – original draft, C.L. and C.C.; writing – review and editing, C.L., C.M., X.L., L.G., and H.W.; funding acquisition, C.M., C.L., X.L., and Z.W.

Declaration of interests

C.L., C.M., C.C., J.P., S.M., and X.L. are inventors on the China patent (ZL202111222514.8) “Application of soluble form of Tim-3 in resistance to immune checkpoint blockade therapy” that has claims directed to sTim-3 application in immunotherapy.

Supplemental information can be found online at https://doi.org/10.1016/j.xcrm.2024.101686.
==== Refs
References

1 Wherry E.J. T cell exhaustion Nat. Immunol. 12 2011 492 499 21739672
2 Ren D. Hua Y. Yu B. Ye X. He Z. Li C. Wang J. Mo Y. Wei X. Chen Y. Predictive biomarkers and mechanisms underlying resistance to PD1/PD-L1 blockade cancer immunotherapy Mol. Cancer 19 2020 19 10.1186/s12943-020-1144-6 32000802
3 Sharma P. Hu-Lieskovan S. Wargo J.A. Ribas A. Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy Cell 168 2017 707 723 10.1016/j.cell.2017.01.017 28187290
4 Roncella S. Laurent S. Fontana V. Ferro P. Franceschini M.C. Salvi S. Varesano S. Boccardo S. Vigani A. Morabito A. CTLA-4 in mesothelioma patients: tissue expression, body fluid levels and possible relevance as a prognostic factor Cancer Immunol. Immunother. 65 2016 909 917 10.1007/s00262-016-1844-3 27207606
5 Erfani N. Razmkhah M. Ghaderi A. Circulating soluble CTLA4 (sCTLA4) is elevated in patients with breast cancer Cancer Invest. 28 2010 828 832 10.3109/07357901003630934 20482250
6 Chakrabarti R. Kapse B. Mukherjee G. Soluble immune checkpoint molecules: Serum markers for cancer diagnosis and prognosis Cancer Rep. 2 2019 e1160 10.1002/cnr2.1160
7 He L. Zhang G. He Y. Zhu H. Zhang H. Feng Z. Blockade of B7-H1 with sPD-1 improves immunity against murine hepatocarcinoma Anticancer Res. 25 2005 3309 3313 16101143
8 Chen G. Huang A.C. Zhang W. Zhang G. Wu M. Xu W. Yu Z. Yang J. Wang B. Sun H. Exosomal PD-L1 contributes to immunosuppression and is associated with anti-PD-1 response Nature 560 2018 382 386 10.1038/s41586-018-0392-8 30089911
9 Gong B. Kiyotani K. Sakata S. Nagano S. Kumehara S. Baba S. Besse B. Yanagitani N. Friboulet L. Nishio M. Secreted PD-L1 variants mediate resistance to PD-L1 blockade therapy in non-small cell lung cancer J. Exp. Med. 216 2019 982 1000 10.1084/jem.20180870 30872362
10 Hayashi H. Chamoto K. Hatae R. Kurosaki T. Togashi Y. Fukuoka K. Goto M. Chiba Y. Tomida S. Ota T. Soluble immune checkpoint factors reflect exhaustion of antitumor immunity and response to PD-1 blockade J. Clin. Invest. 134 2024 e168318 10.1172/JCI168318 38557498
11 Monney L. Sabatos C.A. Gaglia J.L. Ryu A. Waldner H. Chernova T. Manning S. Greenfield E.A. Coyle A.J. Sobel R.A. Th1-specific cell surface protein Tim-3 regulates macrophage activation and severity of an autoimmune disease Nature 415 2002 536 541 10.1038/415536a 11823861
12 Wolf Y. Anderson A.C. Kuchroo V.K. TIM3 comes of age as an inhibitory receptor Nat. Rev. Immunol. 20 2020 173 185 10.1038/s41577-019-0224-6 31676858
13 Zhang H. Song Y. Yang H. Liu Z. Gao L. Liang X. Ma C. Tumor cell-intrinsic Tim-3 promotes liver cancer via NF-kappaB/IL-6/STAT3 axis Oncogene 37 2018 2456 2468 10.1038/s41388-018-0140-4 29449693
14 Yan W. Liu X. Ma H. Zhang H. Song X. Gao L. Liang X. Ma C. Tim-3 fosters HCC development by enhancing TGF-beta-mediated alternative activation of macrophages Gut 64 2015 1593 1604 10.1136/gutjnl-2014-307671 25608525
15 Tan S. Xu Y. Wang Z. Wang T. Du X. Song X. Guo X. Peng J. Zhang J. Liang Y. Tim-3 Hampers Tumor Surveillance of Liver-Resident and Conventional NK Cells by Disrupting PI3K Signaling Cancer Res. 80 2020 1130 1142 10.1158/0008-5472.Can-19-2332 31848194
16 Koyama S. Akbay E.A. Li Y.Y. Herter-Sprie G.S. Buczkowski K.A. Richards W.G. Gandhi L. Redig A.J. Rodig S.J. Asahina H. Adaptive resistance to therapeutic PD-1 blockade is associated with upregulation of alternative immune checkpoints Nat. Commun. 7 2016 10501 10.1038/ncomms10501 26883990
17 Sakuishi K. Apetoh L. Sullivan J.M. Blazar B.R. Kuchroo V.K. Anderson A.C. Targeting Tim-3 and PD-1 pathways to reverse T cell exhaustion and restore anti-tumor immunity J. Exp. Med. 207 2010 2187 2194 10.1084/jem.20100643 20819927
18 Ma S. Tian Y. Peng J. Chen C. Peng X. Zhao F. Li Z. Li M. Zhao F. Sheng X. Identification of a small-molecule Tim-3 inhibitor to potentiate T cell–mediated antitumor immunotherapy in preclinical mouse models Sci. Transl. Med. 15 2023 eadg6752 10.1126/scitranslmed.adg6752 37967204
19 Sabatos C.A. Chakravarti S. Cha E. Schubart A. Sánchez-Fueyo A. Zheng X.X. Coyle A.J. Strom T.B. Freeman G.J. Kuchroo V.K. Interaction of Tim-3 and Tim-3 ligand regulates T helper type 1 responses and induction of peripheral tolerance Nat. Immunol. 4 2003 1102 1110 10.1038/ni988 14556006
20 Geng H. Zhang G.M. Li D. Zhang H. Yuan Y. Zhu H.G. Xiao H. Han L.F. Feng Z.H. Soluble form of T cell Ig mucin 3 is an inhibitory molecule in T cell-mediated immune response J. Immunol. 176 2006 1411 1420 16424168
21 Moller-Hackbarth K. Dewitz C. Schweigert O. Trad A. Garbers C. Rose-John S. Scheller J. A disintegrin and metalloprotease (ADAM) 10 and ADAM17 are major sheddases of T cell immunoglobulin and mucin domain 3 (Tim-3) J. Biol. Chem. 288 2013 34529 34544 10.1074/jbc.M113.488478 24121505
22 Clayton K.L. Douglas-Vail M.B. Nur-ur Rahman A.K.M. Medcalf K.E. Xie I.Y. Chew G.M. Tandon R. Lanteri M.C. Norris P.J. Deeks S.G. Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8(+) T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression J. Virol. 89 2015 3723 3736 10.1128/JVI.00006-15 25609823
23 Ren F. Li J. Jiang X. Xiao K. Zhang D. Zhao Z. Ai J. Hou C. Jia Y. Han G. Xie L. Plasma soluble Tim-3 emerges as an inhibitor in sepsis: sepsis contrary to membrane Tim-3 on monocytes Tissue Antigens 86 2015 325 332 10.1111/tan.12653 26373631
24 Zhao D. Li C. Yang X. Yan W. Zhang Y. Elevated soluble Tim-3 correlates with disease activity of systemic lupus erythematosus Autoimmunity 54 2021 97 103 10.1080/08916934.2021.1891535 33641540
25 Hansen J.A. Hanash S.M. Tabellini L. Baik C. Lawler R.L. Grogan B.M. Storer B. Chin A. Johnson M. Wong C.-H. A novel soluble form of Tim-3 associated with severe graft-versus-host disease Biol. Blood Marrow Transplant. 19 2013 1323 1330 10.1016/j.bbmt.2013.06.011 23791624
26 Sanchez-Fueyo A. Tian J. Picarella D. Domenig C. Zheng X.X. Sabatos C.A. Manlongat N. Bender O. Kamradt T. Kuchroo V.K. Tim-3 inhibits T helper type 1-mediated auto- and alloimmune responses and promotes immunological tolerance Nat. Immunol. 4 2003 1093 1101 10.1038/ni987 14556005
27 Koyama S. Akbay E.A. Li Y.Y. Herter-Sprie G.S. Buczkowski K.A. Richards W.G. Gandhi L. Redig A.J. Rodig S.J. Asahina H. Adaptive resistance to therapeutic PD-1 blockade is associated with upregulation of alternative immune checkpoints Nat. Commun. 7 2016 10501 10.1038/ncomms10501 26883990
28 Piha-Paul S.A. Oh D.-Y. Ueno M. Malka D. Chung H.C. Nagrial A. Kelley R.K. Ros W. Italiano A. Nakagawa K. Efficacy and safety of pembrolizumab for the treatment of advanced biliary cancer: Results from the KEYNOTE-158 and KEYNOTE-028 studies Int. J. Cancer 147 2020 2190 2198 10.1002/ijc.33013 32359091
29 Bang Y.-J. Ueno M. Malka D. Chung H.C. Nagrial A. Kelley R.K. Piha-Paul S.A. Ros W. Italiano A. Nakagawa K. Pembrolizumab (pembro) for advanced biliary adenocarcinoma: Results from the KEYNOTE-028 (KN028) and KEYNOTE-158 (KN158) basket studies J. Clin. Oncol. 37 2019 4079 10.1200/JCO.2019.37.15_suppl.4079
30 Fan B. Malato Y. Calvisi D.F. Naqvi S. Razumilava N. Ribback S. Gores G.J. Dombrowski F. Evert M. Chen X. Willenbring H. Cholangiocarcinomas can originate from hepatocytes in mice J. Clin. Invest. 122 2012 2911 2915 10.1172/jci63212 22797301
31 Scharping N.E. Rivadeneira D.B. Menk A.V. Vignali P.D.A. Ford B.R. Rittenhouse N.L. Peralta R. Wang Y. Wang Y. DePeaux K. Mitochondrial stress induced by continuous stimulation under hypoxia rapidly drives T cell exhaustion Nat. Immunol. 22 2021 205 215 10.1038/s41590-020-00834-9 33398183
32 Miller B.C. Sen D.R. Al Abosy R. Bi K. Virkud Y.V. LaFleur M.W. Yates K.B. Lako A. Felt K. Naik G.S. Subsets of exhausted CD8+ T cells differentially mediate tumor control and respond to checkpoint blockade Nat. Immunol. 20 2019 326 336 10.1038/s41590-019-0312-6 30778252
33 Turner J.A. Fredrickson M.A. D’Antonio M. Katsnelson E. MacBeth M. Van Gulick R. Chimed T.-S. McCarter M. D’Alessandro A. Robinson W.A. Lysophosphatidic acid modulates CD8 T cell immunosurveillance and metabolism to impair anti-tumor immunity Nat. Commun. 14 2023 3214 10.1038/s41467-023-38933-4 37270644
34 Kim K.H. Kim H.K. Kim H.D. Kim C.G. Lee H. Han J.W. Choi S.J. Jeong S. Jeon M. Kim H. PD-1 blockade-unresponsive human tumor-infiltrating CD8(+) T cells are marked by loss of CD28 expression and rescued by IL-15 Cell. Mol. Immunol. 18 2021 385 397 10.1038/s41423-020-0427-6 32332901
35 Verma V. Shrimali R.K. Ahmad S. Dai W. Wang H. Lu S. Nandre R. Gaur P. Lopez J. Sade-Feldman M. PD-1 blockade in subprimed CD8 cells induces dysfunctional PD-1(+)CD38(hi) cells and anti-PD-1 resistance Nat. Immunol. 20 2019 1231 1243 10.1038/s41590-019-0441-y 31358999
36 Chen L. Yu X. Lv C. Dai Y. Wang T. Zheng S. Qin Y. Zhou X. Wang Y. Pei H. Increase in Serum Soluble Tim-3 Level Is Related to the Progression of Diseases After Hepatitis Virus Infection Front. Med. 9 2022 880909 10.3389/fmed.2022.880909
37 Du W. Yang M. Turner A. Xu C. Ferris R.L. Huang J. Kane L.P. Lu B. TIM-3 as a Target for Cancer Immunotherapy and Mechanisms of Action Int. J. Mol. Sci. 18 2017 645 10.3390/ijms18030645 28300768
38 Miller M.A. Sullivan R.J. Lauffenburger D.A. Molecular Pathways: Receptor Ectodomain Shedding in Treatment, Resistance, and Monitoring of Cancer Clin. Cancer Res. 23 2017 623 629 10.1158/1078-0432.CCR-16-0869 27895032
39 Duffy M.J. Mullooly M. O'Donovan N. Sukor S. Crown J. Pierce A. McGowan P.M. The ADAMs family of proteases: new biomarkers and therapeutic targets for cancer? Clin Proteomics 8 2011 9 10.1186/1559-0275-8-9
40 Witters L. Scherle P. Friedman S. Fridman J. Caulder E. Newton R. Lipton A. Synergistic inhibition with a dual epidermal growth factor receptor/HER-2/neu tyrosine kinase inhibitor and a disintegrin and metalloprotease inhibitor Cancer Res. 68 2008 7083 7089 10.1158/0008-5472.Can-08-0739 18757423
41 Friedman S. Levy R. Garrett W. Doval D. Bondarde S. Sahoo T. Lokanatha D. Julka P. Shenoy K. Nagarkar R. Clinical Benefit of INCB7839, a Potent and Selective Inhibitor of ADAM10 and ADAM17, in Combination with Trastuzumab in Metastatic HER2 Positive Breast Cancer Patients Cancer Res. 69 2009 5056 10.1158/0008-5472.Sabcs-09-5056
42 Sharpe A.H. Wherry E.J. Ahmed R. Freeman G.J. The function of programmed cell death 1 and its ligands in regulating autoimmunity and infection Nat. Immunol. 8 2007 239 245 10.1038/ni1443 17304234
43 Siddiqui I. Schaeuble K. Chennupati V. Fuertes Marraco S.A. Calderon-Copete S. Pais Ferreira D. Carmona S.J. Scarpellino L. Gfeller D. Pradervand S. Intratumoral Tcf1+PD-1+CD8+ T Cells with Stem-like Properties Promote Tumor Control in Response to Vaccination and Checkpoint Blockade Immunotherapy Immunity 50 2019 195 211.e10 10.1016/j.immuni.2018.12.021 30635237
44 Avery L. Filderman J. Szymczak-Workman A.L. Kane L.P. Tim-3 co-stimulation promotes short-lived effector T cells, restricts memory precursors, and is dispensable for T cell exhaustion Proc. Natl. Acad. Sci. USA 115 2018 2455 2460 10.1073/pnas.1712107115 29463725
45 Anderson A.C. Lord G.M. Dardalhon V. Lee D.H. Sabatos-Peyton C.A. Glimcher L.H. Kuchroo V.K. T-bet, a Th1 transcription factor regulates the expression of Tim-3 Eur. J. Immunol. 40 2010 859 866 10.1002/eji.200939842 20049876
46 Liu B. Hu X. Feng K. Gao R. Xue Z. Zhang S. Zhang Y. Corse E. Hu Y. Han W. Zhang Z. Temporal single-cell tracing reveals clonal revival and expansion of precursor exhausted T cells during anti-PD-1 therapy in lung cancer Nat. Cancer 3 2022 108 121 10.1038/s43018-021-00292-8 35121991
47 Bassez A. Vos H. Van Dyck L. Floris G. Arijs I. Desmedt C. Boeckx B. Vanden Bempt M. Nevelsteen I. Lambein K. A single-cell map of intratumoral changes during anti-PD1 treatment of patients with breast cancer Nat. Med. 27 2021 820 832 10.1038/s41591-021-01323-8 33958794
48 Kurtulus S. Madi A. Escobar G. Klapholz M. Nyman J. Christian E. Pawlak M. Dionne D. Xia J. Rozenblatt-Rosen O. Checkpoint Blockade Immunotherapy Induces Dynamic Changes in PD-1(-)CD8(+) Tumor-Infiltrating T Cells Immunity 50 2019 181 194.e6 10.1016/j.immuni.2018.11.014 30635236
49 Therasse P. Arbuck S.G. Eisenhauer E.A. Wanders J. Kaplan R.S. Rubinstein L. Verweij J. Van Glabbeke M. van Oosterom A.T. Christian M.C. Gwyther S.G. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada J. Natl. Cancer Inst. 92 2000 205 216 10655437
50 Du X. Wu Z. Xu Y. Liu Y. Liu W. Wang T. Li C. Zhang C. Yi F. Gao L. Increased Tim-3 expression alleviates liver injury by regulating macrophage activation in MCD-induced NASH mice Cell. Mol. Immunol. 16 2019 878 886 10.1038/s41423-018-0032-0 29735977
51 Kilkenny C. Browne W.J. Cuthill I.C. Emerson M. Altman D.G. Improving Bioscience Research Reporting: The ARRIVE Guidelines for Reporting Animal Research PLoS Biol. 8 2010 e1000412 10.1371/journal.pbio.1000412 20613859
52 Li C. Li W. Xiao J. Jiao S. Teng F. Xue S. Zhang C. Sheng C. Leng Q. Rudd C.E. ADAP and SKAP55 deficiency suppresses PD-1 expression in CD8+ cytotoxic T lymphocytes for enhanced anti-tumor immunotherapy EMBO Mol. Med. 7 2015 754 769 10.15252/emmm.201404578 25851535
53 Ding Y. Chen C. Ma S. Sheng X. Zhao F. Peng J. Dong H. Ma C. Li C. Intrinsic PD-L1 promotes antitumor activity of CD8(+) cytotoxic T lymphocytes via in cis interaction with CD80 Cancer Commun. 42 2022 784 788 10.1002/cac2.12337
